MOLECULAR AND CELLULAR BIOLOGY, Nov. 1984, p. 2321-23310270-7306/84/112321-11$02.00/0Copyright © 1984, American Society for Microbiology

Expression of Tissue-Specific Ren-] and Ren-2 Genes of Mice:Comparative Analysis of 5'-Proximal Flanking Regions

LOREN J. FIELD, WILLIAM M. PHILBRICK, PHILIP N. HOWLES, DOUGLAS P. DICKINSON, ROSS A.McGOWAN, AND KENNETH W. GROSS*

Department of Molecular Biology, Roswell Park Memorial Institute, Buffalo, New York 14263

Received 16 May 1984/Accepted 16 August 1984

All inbred strains of mice carry the Ren-1 structural gene, which encodes the renin-1 isozyme, the classicalrenin activity found in kidneys. In addition, some strains carry a second renin structural gene, Ren-2, whichencodes the predominantly expressed submaxillary gland renin isozyme, renin-2. Ren-l and Ren-2 exhibitmarkedly different patterns of tissue-specific expression. In an effort to understand the molecular basis for thisdifferential expression, detailed analysis of the genomic sequences corresponding to the Ren-) and Ren-2 genes,and the transcripts originating from these loci, was undertaken. Sequence analysis of regions proximal to thestructural genes indicated the presence of eucaryotic consensus sequences for transcription. These sequencemotifs were strongly conserved between Ren-1 and Ren-2. Approximately 150 bases upstream from the majortranscription initiation site, significant differences between these genes were apparent, including the presenceof a repetitive DNA element in the Ren-2 copy as well as other breaks in homology and sequence curiosities.Strong homology between Ren-1 and Ren-2 resumed at a point ca. 200 bases further upstream on Ren-1. Slanalysis of submaxillary gland and kidney RNA populations indicated that the majority of transcripts initiate athomologous positions on Ren-1 and Ren-2. On a per cell basis, the accumulation of Ren-) transcripts in thekidney and Ren-2 transcripts in the submaxillary gland are probably equivalent. These results suggest that it istissue-specific utilization of the homologous start sites that is critical to their differential patterns of expression.Models which can account for this observation are presented. Interestingly, we found a minor fraction oftranscripts initiating 5' to the major transcription start site. These transcripts encoded an open reading framewhich may add an additional 23 amino acids to the N-terminus of the renin precursor.

Renin is a 45,000-dalton protein that participates in theprocessing of angiotensinogen to the potent vasopressorangiotensin II. It is therefore a key component of theregulatory controls acting upon blood pressure. The classicalcirculatory renin is a glycoprotein synthesized in the juxta-glomerular cells of the kidney. In mice, renin activity canalso be detected in the granular convoluted tubules of thesubmaxillary gland (SMG) (37, 42). The levels of SMG reninactivity differ widely among strains and have been shown tobe under genetic as well as hormonal control (44). Workfrom a number of laboratories has resulted in the identifica-tion of a renin gene duplication event that correlates with thepattern of genetic control of SMG renin expression (24, 29,31).

All inbred strains of mice carry the Ren-J structural genethat is closely linked to the Pep-3 locus on chromosome 1(45). This gene encodes the thermostable renin-1 isozymethat is expressed at relatively low levels in the SMG. Somestrains also carry a tightly linked second copy of the struc-tural gene, designated Ren-2, that encodes the thermolabile,nonglycosylated renin-2 isozyme (16, 46). These strains haveSMG renin levels that are up to 100-fold higher than those ofone-gene strains. SMG renin activity in these strains isthermolabile and is almost completely blocked by alloanti-body specific for the renin-2 isozyme (46). In addition,sequence analysis of a number of SMG renin cDNA recom-binants independently cloned from two-gene strains indi-cates that the transcripts arose from the Ren-2 gene (29;D. P. Dickinson, L. J. Field, and K. W. Gross, unpublisheddata). Taken together, these data strongly suggest that intwo-gene strains of mice, Ren-2 is the predominant SMG

* Corresponding author.

2321

renin isozyme. Therefore, the high levels of SMG renin inthese strains is a reflection of the relatively high level ofaccumulation of Ren-2 transcripts as compared with Ren-ltranscripts.

In contrast, a number of lines of evidence indicate that thethermostable, glycosylated renin derived from the Ren-lgene is the predominantly expressed isozyme in the kidneysof two-gene strains. Renin-2 isozyme has not been detectedin the kidneys of such strains (16, 46). In addition, sequenceanalysis of a limited number of renin cDNA clones hasprovided direct evidence for the expression of Ren-I in thekidneys of two-gene strains (8, 30). The Ren-l and Ren-2copies of the gene therefore exhibit markedly differenttissue-specific patterns of expression. However, when con-sidered on a per nucleus basis, output from Ren-J in thekidney and Ren-2 in the SMG are probably approximatelyequivalent (see below).Although the Ren-J and Ren-2 genes show considerable

differences in tissue-specific expression, they otherwise ap-pear to be highly homologous. The coding regions of Ren-Jand Ren-2 show a more than 95% sequence homology (15).Gross similarity is also apparent at the level of genomicsequence organization. Restriction and heteroduplex map-ping indicate that the nine exons and eight interveningsequences are similarly positioned and that homology ex-tends both 5' and 3' from the structural gene sequences (24;K. W. Gross, unpublished data). Such close homologywould be anticipated from the relatively recent origin of theRen-2 gene as a result of a gene duplication event thatoccurred an estimated 2.75 to 7.2 million years ago (15, 29;D. P. Dickinson, K. W. Gross, N. Piccini, and C. M. Wilson,Genetics, in press).The extensive homology between the mouse renin genes,

Vol. 4. No. 11

2322 FIELD ET AL.

combined with their very different patterns of tissue-specificexpression, provides an interesting model system with whichto examine those details of structure and genomic organiza-tion that provide the basis for their regulation. Structuraldifferences that are discernible between Ren-J and Ren-2would represent prime candidates for the investigation ofsequences involved in the tissue-specific regulation of thegenes. As a first step in establishing this correlation betweenstructure and function, we have undertaken a detailed com-parative analysis of the 5' flanking regions of the Ren-J andRen-2 loci and the transcripts which arise from these loci inSMGs and kidneys.

MATERIALS AND METHODSScreening bacteriophage lambda libraries. Bacteriophage

lambda libraries were screened for the presence of reningenomic clones essentially as described by Benton andDavis (1). The DBA/2J library was constructed by HansLehrach, European Molecular Biology Institute, Heidel-berg, Federal Republic of Germany. DBA/2J genomic DNAwas partially restricted with Sau3AI and ligated to BamHI-restricted lambda EMBL-3. The BALB/cJ library was con-structed by S. Weaver, University of Illinois-Chicago.BALB/cJ genomic DNA was partially restricted withSau3AI and ligated to BamHI-restricted lambda L47.1 (20).Filter hybridizations were as described previously (1). Theprobe used to screen the libraries was purified insert frompDD-1D2, a full-length submaxillary renin cDNA clone (8).The probe was labeled to a specific activity of 1 x 108 to 2 x108 dpm/,ug by the nick-translation method of Rigby et al.(32). Positive clones were carried through three rounds ofplaque purification. Phage DNA was isolated as describedpreviously (21).Cosmid library construction and screening. High-molecu-

lar-weight DNA prepared from DBA/2J mouse liver wassubjected to partial digestion with MboI and gradient frac-tionation as described previously (11). Vector arms wereprepared from cosmid pSAE (a generous gift of R. A.Flavell, F. G. Grosveld, S. Bodery, and P. Wellauer),followed by ligation of donor DNA into the BamHI cloningsite (11). Preparation of packaging extracts, in vitro packag-ing of ligated DNA, and transduction of Escherichia coli hostED8767 (K. Murray, University of Edinburgh, Edinburgh,Scotland) were performed essentially as described previous-ly (10). The cells were plated onto 150-mm, detergent-freenitrocellulose filters (HATF; Millipore Corp.) on L-agarplates (100 ,ug of ampicillin per ml) at a density of 10,000 to20,000 colonies per filter (13). Screening of the library wasperformed as described previously (10). Cosmid DNA wasisolated by the method of Ish-Horowicz and Burke (17).

Subcloning of renin sequences. Subcloning was carried outessentially as described by Maniatis et al. (21). mp9-1D2, a5'-specific renin probe, was constructed by ligation of the219-base-pair (bp) PstI-Sau3AI fragment of pDD-1D2 (resi-dues 14 through 233 of the submaxillary renin mRNA) intoM13 mp9 (Gross, unpublished data). Putative promoter-containing restriction fragments of the genomic renin cloneswere identified by Southern blot analysis (36) with mp9-1D2as a probe. Our hybridization conditions have been de-scribed previously (31). p5'-1(BALB), a 5' subclone of theRen-J(BALB) gene, was constructed by ligation of a gel-purified 1.275-kilobase (kb) SacI-BamHI restriction frag-ment into pUC-13 (39). p5'-2(DBA), a 5' subclone of theRen-2(DBA) gene, was constructed by a shotgun ligation ofSacI-HindIII-restricted DNA from a lambda DBA reningenomic clone containing the Ren-2(DBA) gene into pUC-

13. p3'-1(BALB), p3'-1(DBA), and p3'-2(DBA) are sub-clones of the 3' portions of the Ren-J(BALB), Ren-J(DBA),and Ren-2(DBA) genes, respectively. These subclones wereconstructed by shotgun ligation of PstI-restricted lambdagenomic clones into pUC-13. Positive 3' subclones wereidentified by Southern blot hybridizations with the 3'-specif-ic SMG cDNA clone pSM479 (31).End labeling and DNA sequence analysis. Plasmid DNA

was isolated by the alkali method of Birnboim and Doly (3)and purified by cesium chloride-ethidium bromide centrifu-gation as described previously (4). Selected DNA restrictionfragments were 5'-end labeled by T4 polynucleotide kinase(Bethesda Research Laboratories) and 3'-end labeled byeither the Klenow fragment of DNA polymerase I (Interna-tional Biotechnologies Inc.) or terminal deoxyrobonucleoti-dyl transferase (gift of R. Ratliff, Los Alamos Laboratories,Los Alamos, N.M.). Reaction conditions have been de-scribed previously (21). 32P-isotope with the highest avail-able specific activity was used (ICN Radiochemicals Inc.;Amersham Corp.). The incorporation of each labeling reac-tion was estimated to be 50 to 90% of the theoretical yield.Labeled ends of a given restriction fragment were separatedby secondary restriction or strand-separating gels and thensubjected to the base-specific chemical modification andcleavage procedures of Maxam and Gilbert (23).

Preparation of total RNA. Total RNA was extracted by theguanidine-hydrochloride method of Cox (6) as modified byField et al. (8). RNA was isolated from male BALB/cJ andDBA/2J mice obtained from West Seneca Labs, West Sene-ca, N.Y.

S1 nuclease mapping. Mapping of the 5' and 3' ends ofrenin transcripts was performed by the S1 nuclease tech-nique of Berk and Sharp (2) as modified by Maquat et al.(22). Total RNA (80 ,ug) from BALB/cJ kidney, BALB/cJSMG, or DBA/2J kidney and 8 or 0.8 p.g of total RNA fromDBA/2J SMG was hybridized to 30,000 cpm of various end-labeled probes and digested with S1 nuclease as described.S1 nuclease was a gift of J. Ross, University of Wisconsin,Madison. Samples were analyzed on 8% polyacrylamide-7M urea sequencing gels (23). Molecular weight markers aredescribed in the figure legends.The probes used were generated from our genomic sub-

clones. The 5' Ren-J(BALB) probe was a 239-base 5'-end-labeled Hinfl fragment complementary to the mRNA (resi-dues -159 to +80, see Fig. 3A). The 5' Ren-2(DBA) probewas a 450-base 5'-end-labeled Hinfl fragment complemen-tary to the mRNA (residues -370 to +80, see Fig. 3B). 3'probes from Ren-J(BALB), Ren-l(DBA), and Ren-2(DBA)were generated by TdT 3'-end labeling BglI-restricted 3'subclones, followed by PstI digestion and agarose gel purifi-cation of the 1.075-kb BglI-PstI 3' fragment. The BglIrestriction site is at residues 1278 to 1288 of the submaxillaryrenin cDNA as determined by Panthier et al. (28) and cuts124 bases 5' to the polyadenylation recognition sequenceAATAAA (residues 1407 to 1412).Primer extension analysis. Primer extension analysis of the

renin transcripts was modified from the procedure of Hagen-buchle et al. (12). The primer used was the 68-base 5'-end-labeled DdeI-Hinfl fragment from p5'-1(BALB) complemen-tary to the mRNA (residues +13 to +80; see Ren-J(BALB)in Fig. 3A). Total RNA (80 ,ug) from BALB/cJ kidney,BALB/cJ SMG, or DBA/2J kidney and 8 or 0.8 ,ug of totalRNA from DBA/2J SMG was hybridized to 40,000 dpm ofthe primer in 40 ,ll of 80% deionized formamide-0.012 MTris-hydrochloride (pH 7)-0.56 M NaCl. The samples weredenatured at 68°C for 10 min and then incubated at 42°C

MOL. CELL. BIOL.

MURINE RENIN GENES: STRUCTURE AND EXPRESSION 2323

overnight. The hybrids thus formed were ethanol precipitat-ed and dissolved in 50 [L1 of 0.05 M Tris-hydrochloride (pH8.1)-0.002 M dithiothreitol-0.005 M MgCl-0.04 M KCl.Reverse transcriptase (18 U; Life Sciences, Inc., St. Peters-burg, Fla.) was added, and the samples were incubated at42°C for 2 h. RNA was hydrolyzed by the addition of 50 ,ul of0.4 M NaOH and incubation at 42°C for 2 h. Samples wereprecipitated by the addition of 1 ml of 95% ethanol-0.0125 MTris-hydrochloride (pH 7)-3 ,ug of calf thymus DNA per ml,washed twice with 70% ethanol, and analyzed on 8% poly-acrylamide-7 M urea sequencing gels (23). Molecular weightmarkers are described in the figure legends.

RESULTS

Isolation and characterization of 5' renin subclones. TheRen-J genes from BALB/cJ (a one-gene strain) and DBAI2J(a two-gene strain) have been shown to be allelic andvirtually identical by a number of criteria. These includeprotein activity, thermostability, and immuno-cross-reactiv-ity (46), as well as overall genomic structure (24, 31; K. W.Gross, D. P. Dickinson, and K. Abel, unpublished data; L.Beecroft and W. Brammar, personal communication). Thus,we have chosen to compare the nonallelic Ren-l(BALB) andRen-2(DBA) genes. To this end, we have isolated the entireRen-J gene from a BALB/cJ lambda genomic library and theentire Ren-2 gene from a genomic cosmid library of DBA/2J.Also isolated were lambda genomic clones of exons V-IX ofRen-J(DBA) and exons I-VII of Ren-2(DBA). Each clonealso carried several kb of flanking sequences. Since aphylogenetically based study of the renin gene duplicationevent (Dickinson et al., in press) suggested that the sequencedifferences near the 3' ends of the renin genes were notessential for the differential expression of Ren-J and Ren-2,we have decided to focus on the analysis of 5' proximalsequence polymorphisms.

Figure 1A shows a Southern blot of PvuII-restrictedgenomic DNA isolated from the two-gene strain DBA/2J(lane 1) and from the one-gene strain BALB/cJ (lane 2). Theblot was probed with a nick-translated insert from a full-length SMG renin cDNA clone, pDD-1D2 (8). When a 5'-specific probe derived from pDD-1D2 is used, only the 0.84-and 0.63-kb fragments are detected (data not shown). The0.63-kb fragment is held in common between the two strains,whereas the 0.84-kb fragment is unique to DBA/2J. Further-more, Southern blot analysis of PvuII-restricted DNA fromour cosmid clone, which contains the entire Ren-2 gene,exhibits the 0.84-kb band but not the 0.63-kb band (Fig. 1B,lane 1). This 5' restriction fragment length polymorphism hasbeen observed by using other enzymes (data not shown).Therefore, restriction fragments from both genes thatspanned these polymorphic regions were subcloned intopUC-13. Figure 1B shows PvuII restrictions of our Ren-2and Ren-J subclones (lanes 2 and 4, respectively) hybridizedto nick-translated pDD-1D2. The Ren-J derived 5' subclonehas been designated p5'-l(BALB), and the Ren-2 derived 5'subclone has been designated p5'-2(DBA).Sequence analysis was used to identify regions of the

subclones corresponding to the 5' end of pDD-1D2. Thesequencing strategy used and the results obtained for bothsubclones from the Sacl site through the PvuII site areshown (Fig. 2 and 3). The potential amino acid sequencesencoded by each gene are also indicated.The derived Ren-J(BALB) amino acid sequence agrees

completely with that determined from an independent set ofBALB/cJ genomic clones (15), and the derived Ren-2(DBA)

A. B.1 2 1 2 3 4

8.5

.842

.634

FIG. 1. Southern blot analysis of PvuII-restricted DNAs. (A)Southern blot of PvuII-restricted genomic DNA from the two-genestrain DBA/2J (lane 1) and the one-gene strain BALB/cJ (lane 2).Restricted DNA was electrophoresed on a 0.8% agarose gel, trans-ferred to nitrocellulose, and hybridized with a nick-translated insertfrom our full-length SMG renin cDNA clone, pDD-1D2 (8). Thebands at 11.5, 8.5, 8.0, and 2.6 kb arise from restriction fragmentpolymorphisms at the 3' end of the renin genes and have beendescribed previously (31; Gross et al., unpublished data). The bandsat 5.5 kb are only detected by probes containing polyadenylic acidtracts and are not homologous to renin-encoding sequences (Grosset al., unpublished data). (B) Southern blot of PvuII-restricted DNAfrom the Ren-2(DBA) cosmid (lane 1), the 5' Ren-2 subclone p5'-2(DBA) (lane 2), a 5' lambda Ren-2(DBA) genomic clone (lane 3),and the 5' Ren-J(BALB) subclone p5'-(BALB) (lane 4).

amino acid sequence agrees with that determined from anSWR SMG renin cDNA clone (28). Both genes are nearlyidentical for 180 bases 5' to the proposed initiation codonidentified by Panthier et al. (28), and within this region, bothgenes contain identical consensus TATA sequences (Fig. 3Aand B). Immediately upstream of this TATA homology lieseveral bases of alternating purines and pyrimidines whichmay have the potential to form Z-DNA (26). Interestingly,we find that the reading frame is open in both genes for anadditional 23 amino acids 5' to the proposed initiation codon(italicized amino acid sequences in Fig. 3A and B). Howev-er, transcripts encoding these residues would have to initiate5' to the observed TATA box. Other sequences exhibitinglimited homology to the consensus TATA sequences are alsopresent in this region.

5' S1 nuclease analysis of renin transcripts. To furtherdefine the sites of transcription initiation, we performed S1nuclease mapping experiments. RNAs from the one-genestrain BALB/cJ were analyzed with a Ren-J derived 5' S1probe. The probe consisted of a 5'-end-labeled 239-baseHinfl fragment complementary to the mRNA (residues -159to +80, Fig. 3A). Total RNA was hybridized to excessprobe, digested with S1 nuclease, and analyzed on 8%denaturing polyacrylamide gels as described above. Si nu-clease analysis of BALB/cJ kidney RNA generates a set of

VOL. 4, 1984

2324 FIELD ET AL.

__ _ 3 4-

1--p s .0 a~~~~~

Ron -1

Rn-2

a 2

FIG. 2. Restriction maps of the 5' regions of the Ren-J(BALB) and Ren-2(DBA) subclones. Abbreviations of restriction enzymes: S, Sacl;P, PvuII; X, XbaI; H, Hinfl; B, BamHl. The distance between unlabeled hatch marks corresponds to 100 bp. Connecting lines setapproximate homology boundaries. The sequencing strategy for each segment is also indicated. The Symbols: *, 5'-end label; *, 3'-end label.

protected fragments 79 to 82 bases in length (Fig. 4A, laneA). Thus, we have assigned the 5' terminus of kidney renintranscripts to a position 32 bases 5' to the initiation codonand designated this adenine residue +1 (Fig. 3A and B). Inall subsequent 5' Si nuclease and primer extension experi-ments, transcription initiation sites will be numbered relativeto this position. Since the presence of a 5' cap structure mayinhibit S1 nuclease digestion by ca. 4 bases (25, 41) and sincemost eucaryotic mRNAs initiate at an adenine residue (5), itis possible that kidney renin transcripts may actually initiateat +1, +3, or +5 (32, 30 and 28 bases 5' to the initiationcodon, respectively) or at a combination of these. Thesetranscripts initiate 29 to 33 bases downstream from theTATA box identified by sequence analysis, suggesting thatthis TATA box functions in vivo.The Ren-l 5' S1 probe was also used to examine SMG

transcripts in strain BALB/cJ. SMG RNA protects two setsoffragments (Fig. 4A, lane C). The first set offragments is 79to 82 bases in length, is identical to those observed forkidney renin transcripts (originating at +1), and representsthe majority of BALB/cJ SMG transcripts. The second set offragments is 195 to 205 bases in length, corresponding totranscripts which initiate at residues -115 to -125. Inaddition, less intense bands corresponding to fragments ofintermediate size are detectable. High-resolution Northerngels (8) and 3' S1 nuclease analysis (below) suggest that this5'-size heterogeneity is present in steady-state SMG reninmRNA.Renin transcripts from the two-gene strain DBA/2J were

examined with a Ren-2 derived 5' S1 probe. The probeconsisted of a 5'-end-labeled 450-base Hinfl fragment com-plementary to the mRNA (residues -370 to +80, Fig. 3B).Total RNA was hybridized in probe excess, digested with S1nuclease, and analyzed on denaturing polyacrylamide gels asdescribed above. Figure 4B shows an autoradiograph of atypical gel. DBA/2J kidney RNA generates a set of protectedfragments 79 to 82 bases in length, originating at + 1 (Fig. 4B,lane D) and identical to those obtained with BALB/cJ kidneyRNA and the Ren-J derived probe. S1 nuclease analysis ofDBA/2J SMG RNA generates a spectrum of fragmentssimilar to those obtained with BALB/cJ SMG RNA, al-though the relative intensities differ (Fig. 4B, lanes E and F).The majority of the protected fragments are 79 to 82 bases inlength and initiate at + 1. Since the predominantly expressedrenin gene in the SMG of two-gene strains is Ren-2, theseresults demonstrate that the majority of the transcripts

observed initiate at homologous sites on Ren-J and Ren-2.Thus, it is likely that elevated levels of SMG renin mRNA intwo-gene strains are due to relatively higher utilization of themajor initiation site on Ren-2 as compared to Ren-J, ratherthan to the utilization of a different initiation site.

In addition, sets offragments 116 to 118, 142 to 145, 159 to162, and 195 to 205 bases in length are readily detected, aswell as numerous other minor bands. These fragmentscorrespond to transcripts originating at residues -36 to -38,-62 to -65, -79 to -82, and -115 to -125. These bandspersist with increased S1 nuclease digestion and are absentin control experiments (L. J. Field and K. W. Gross,unpublished data). BALB/cJ kidney and SMG transcriptswere also analyzed with the Ren-2 5' S1 probe (Fig. 4B,lanes B and C, respectively). The results obtained with theRen-2 probe corroborate those obtained with the Ren-Jprobe and suggest that the bands do not arise from basemismatch. This result was expected due to the homologybetween Ren-J and Ren-2 in this region (Fig. 3A and B).Primer extension analysis of renin transcripts. Primer ex-

tension analysis was used to confirm the results obtained byS1 nuclease mapping. The probe used consisted of a 68-base5-end-labeled DdeI-Hinfl fragment complementary to themRNA (residues +13 to +80, Fig. 3A). The probe washybridized to total SMG or kidney RNA from one- or two-gene strains, extended by reverse transcriptase in the pres-ence of dNTPs, and analyzed on denaturing polyacrylamidegels. Lanes J through N show the primer-extended products,whereas lanes C through G show the various S1 nuclease-protected fragments with the 239-base Hinfl Ren-J 5' S1probe (Fig. 5). As can be seen, primer extension producesthe same array of fragments as does S1 nuclease digestion,strongly suggesting that these fragments arise from genuinetranscripts and do not represent discontinuities in homologyintroduced by splicing or artifacts of the S1 nuclease system.

3' Si nuclease analysis of renin transcripts. S1 nucleasemapping was also used to identify the 3' termini of renintranscripts in different tissues and to examine them forpossible heterogeneity. 3'-end-labeled 1.075-kb BgI-PstIfragments complementary to the mRNA were isolated fromour 3' genomic subclones (see above). The probe used forkidney and SMG RNA from the one-gene strain BALB/cJwas obtained from a Ren-J(BALB) subclone, the probe forkidney RNA from the two-gene strain DBA/2J was obtainedfrom a Ren-J(DBA) subclone, and the probe for DBA/2JSMG RNA was obtained from a Ren-2(DBA) subclone. The

MOL. CELL. BIOL.

MURINE RENIN GENES: STRUCTURE AND EXPRESSION 2325

PvuIIA -475 -450 -425 -400GACAGCA6GGGAAGGCACTGGGTGGTCTGGC-AGCTGGAAATGCTGGGAGGCCTTCTTGGGGGAGATTAGATTAAAGCTCTTCAGGGGAAGGCCTATTCCA

-375 XbaI -350 -325 -300TGACTCCAGCATGGTGAGTCTAGATGAAAGGAGGTAGTCTATGGTTTTAGAGCTTTATTGTAGAAGAGAGAGAGAGAAGGTAGAGAAGTAGAAGCCAGTC

-273 -250 -225 -200ATTGCCATGAAGAAGGAAGGGGGAGAAGGAGAGCGAAAGGTAAGAGTAAGAAAACAAGAGCTTTAGGAGAGAGACAAGAGAGAGAGGAGGAGGCAAGCAG

-175 HinfI -150 -125 -100CCAAGTGGdCTCTGGGGGTGGAGTCTGGACAGCCTACATGACTGATGGCCACAGAATTATGGAGCTGGGTCCTTGGCC.RAGAAACAGGCTGCCTTTCATGG

i -75 -0 -25 -5 +1 DdeI +15TCCCACAGGCCCTGGGGTAATAAATCAAAGCAGAGCCTGTGATACATGGTGTAAA AGGCTCAGGGGGTCTGGGCTICACAGCTCTTAGAAAGC

MetValCysIleLysZluGlySerGlyGZyLeuGZyTyrThrAlaLeuArgLysP

+25 +50 +75 HinfICTTGGCTGAACCAG ATG GAC AGA AGG AGG ATG CCT CTC TGG GCA CTC TTG TTG CTC TGG AGT CCT TGC ACC TTC AGT CroTrpLeuAsnGZn MET ASP ARG ARG ARG MET PRO LEU TRP ALA LEU LEU LEU LEU TRP SER PRO CYS THR PHE SER L

+100 +125 +150 +175TC CCA ACA CGC ACC GCT ACC TTT GAA CG GTAACTTGGGCAGAGAAGGGGTGGCAGGGTACAGGAACTGGCATCTTACTAACGCCCITEU PRO THR ARG THR ALA THR PHE GLU ARG

PvuII +200 +225AGCTGTCTATACGTTGGATCATCCAGTCCTTTTGGCCAGCCAGTCAGGGATGTATG

BSacI -700 -675 PvuII -650 -625

GAGCTCAGAGACTGGGCAGGCAGACAGCAGGAGAAGACACTGGGTGGTCTGGCAGCTGGAAACGCTGGGAGGCCTTCTTGCGGGAGATTAGATGAGGCTA

-6Q0 -575LXbaI -550 -525TTCAGGGGAAGGCCTATTCCATTTCTCCAGCATGGTGAGTCTAGATGAAAAGAGGTAGTGAAATAGAGGCCAGCCATTGCCACAAAGAAGGTAAGAGTAA

-500 -475 -450 -425GAGAACAAGAGCTTAAGAAAGAGCCAAGATGGGCTGGAGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCGAAGTTCAAATCCCA

-400 -375HinfI -350 -325GCAACCACATGGTGGCTCACAACCATCTCATAATGAGATCTGACTCCCTCTTCTTGGAGTGTCTGAAGACAGCTACAGTATATTTACATATAATAAAAAT

-300 -275 -250 -225AAATTTAAAAAATAAAAAAATAAAAATAAATTTAAGAGAGAGAGAGAGGAGGAGCCAAGCAGCCCCATTTATAGTGGGCTGGGCTACCTTGCTGTTGTAG

-200 -175 -150 -1254 BGGTAACTGTGGGGAGGAGCAAACCTGGCTATTGCCAGGTAACTCTGGGGGGTGGAGTTACCTTGACTACTTGACTGATGGCCACAGAATGATGGAGGTGG

amHI -100 1 -75 1 + -50 -25ATCTTGGCCAGAAAGCAGGCTGCGTTTCATGGTCCCACAGGCCCTGGGGTAATAAATCAGAGCAGAGCCTGTGATACATGGTGTGorATAAAA,AAGGCT

MetVaZCysIZeLysGluGZyS-5 +. ; DdeI +25 +50

C,AGGGGGTCTGGGCTACACAGCTCTTAGAAAGCCTTGGCTGAACCAG ATG GAC AGG AGG AGG ATG CCT CTC TGG GCA CTC TTG TGGerGZyGlyLeuGZyTyrThrAZaLeuArgLysProTrpLeuAsnGZn MET ASP ARG ARG ARG MET PRO LEU TRP ALA LEU LEU LEU

+75 HinfI +100 +125CTC TGG AGT CCT TGC ACC TTC AGT CTC CCA ACG GGC ACC ACC TTT GAA CG GTAACTTGGGCAGAGAAGGGGTGGCAGGLEU TRP SER PRO CYS THR PHE SER LEU PRO THR GLY THR THR PHE GLU ARG

+150 +175 PvuII +200GTACAGGMCTGGCATCTTACTAACGCCCTCAGCTGTCTATGCGTTGGGTCATCCAGTCC

FIG. 3. Nucleotide sequences of (A) the Ren-J(BALB) and (B) the Ren-2(DBA) subclones from their common Sacl sites through exon Iand including a portion of the first intron. The major transcription initiation site is numbered + 1, with negative numbers indicating distances 5'to this point. The amino acid sequence of exon I is given in capital letters, and the predicted sequence of the open reading frame is indicated initalics. The consensus TATA sequence is boxed. Potential Z-DNA adjacent to the TATA box is underlined. Vertical arrows denote alternativesites of initiation (see the text). Relevant restriction sites are indicated.

VOL. 4, 1984

2326 FIELD ET AL.

A M A B C MU

1461

616

352279K274249

- 222= 91l189

-179

1-24 !

9l

FIG. 4. Si nuclease protection mapping of the 5' termini of renin transcripts. (A) Si nuclease analysis of total RNA from the one-genestrain BALB/cJ with a Ren-J derived probe. Total RNA (80 ,ug) from BALB/cJ kidney (lane A) or SMG (lane C) was hybridized to a 5'-end-la-beled 239-base Hinfl Ren-J probe, digested with Si nuclease, and analyzed on an 8% polyacrylamide-7 M urea sequencing gel. Size markerswere generated by end labeling Sau96I-restricted pBR322. (B) Si nuclease analysis of total RNA from the two-gene strain DBA/2J with a Ren-2 derived probe. RNA (80 jig) from DBA/2J kideny (lane D) and 8 or 0.2 jLg of RNA from DBA/2J SMG (lanes E and F. respectively) was hy-bridized to a 5'-end-labeled 450-base Hinfl Ren-2 probe, digested with Si nuclease, and analyzed on an 8% polyacrylamide-7 M urea

sequencing gel. Size markers were generated by A + G-specific partial chemical cleavage of the Ren-2 probe (22) and are numbered relative tothe major BALB/cJ kidney transcription start site. Total RNA (80 jig) from BALB/cJ kidney and SMG (lanes B and C, respectively) were alsoanalyzed with the Ren-2 Si nuclease probe. The apparent decrease in fragment size was generated by a smile effect during electrophoresis. Aminus-Si nuclease control is shown in lane A.

Si nuclease analysis was performed as described above (Fig.6). As can be seen, all of the renin transcripts analyzedprotect a fragment ca. 147 bases in length. This fragmentcorresponds to termination at a point 12 bases 3' to thepolyadenylation recognition sequence AATAAA (residues1407 to 1412 on the SMG RNA message; see reference 28).This agrees with the position of the polyadenylic acid tailsseen on our full-length SMG renin cDNA clone (Dickinson etal., unpublished data).

Analysis of 5' flanking sequences. Since transcripts fromboth Ren-1 and Ren-2 initiate at homologous sites, we have

compared the flanking regions further upstream of the twogenes for sequence differences which might be involved intheir differential utilization of the homologous initiation site.Figure 7 shows the sequences of the Ren-1 and Ren-2subcloned fragments from their 5' ends through to the exon,aligned for maximum homology. The two genes are essen-

tially colinear for 150 bases upstream from the exon and atthe 5' ends of the fragments for 150 bases from the commonSacl site. Between these two regions of homology lies a

region of sequence divergence spanning 163 bases in Ren-1and 376 bases in Ren-2. The difference in the sizes of these

4

.....I.Wmw.

MOL. CELL. BIOL.

MURINE RENIN GENES: STRUCTURE AND EXPRESSION 2327

FIG. 5. 5' primer extension analysis of renin transcripts. Total RNA from the kidney and SMG of the one-gene strain BALB/cJ and thetwo-gene strain DBA/2J were hybridized to a 5'-end-labeled 68-base DdeI-Hinfl Ren-I derived probe, extended by reverse transcriptase, andanalyzed on an 8% polyacrylamide-7 M urea sequencing gel. Lane H shows the minus-enzyme control, and lane I shows the minus-RNAcontrol. The unextended primer migrates at + 13 bases. Primer-extended products produced from 80 ,ug of total RNA from BALB/cJ kidney(lane J), BALB/cJ SMG (lane K), and DBA/2J kidney (lane L) and from 0.8 and 8 ,ug of total RNA from DBA/2J SMG (lanes M and N, respec-tively) are shown. Markers were generated by A + G-specific partial chemical cleavage of the 5'-end-labeled 239-base Hinfl Ren-l derived Sinuclease probe (23) and are numbered relative to the major BALB/cJ kidney transcription start site. Lanes A to G show Si nuclease analysisof the same RNAs with a 5'-end-labeled Ren-J derived 239-base Hinfl probe. Lane A is the minus-Si nuclease control, and lane B is theminus-RNA control. Si nuclease-produced fragments from 80 ,ug of total RNA from BALB/cJ kidney (lane C), BALB/cJ SMG (lane D), andDBA/2J kidney (lane E) and from 0.8 and 8 ,ug of total RNA from DBA/2J SMG (lanes F and G, respectively) are shown.

regions therefore accounts for the restriction fragment lengthpolymorphism described above (Fig. 1).

In the Ren-J gene, this region exhibits a remarkable strandasymmetry due to the presence of three polypurine tractsthat are predominantly (GA)n at positions -321 to -303,-274 to -250, and -207 to -190. Overall, this region of thestrand shown is 76% purine. In the Ren-2 gene, the strandasymmetry is considerably altered due to the absence of thetwo 5'-most polypurine tracts. Although the third polypurinetract is present, its environment differs significantly due toadditional sequences on either side. A sequence of 71 basesadjacent to the 3' end of this tract has the effect of increasingits distance from the TATA consensus sequence. This 71-base sequence shows no homology to any of the variousrepetitive and nonrepetitive sequences tested for compari-son (Genbank).When the additional 214 bases located on the 5' side of the

Ren-2 polypurine tract were compared with published se-quences, they were found to contain a mouse type 2 Alu-equivalent mobile element (18) (Fig. 7). Included in thiselement are the RNA polymerase III recognition sequences(35) and a polyadenylic acid-polythymidylic acid tail. Thistail has been found to vary in length and composition among

different copies of the Alu element (14). A number of short,direct, or inverted repeats lie near the boundaries of theregions of difference between the two genes (arrows, Fig. 7).Creation of direct repeats is characteristic of Alu insertionevents (14).

DISCUSSIONThe mouse renin genes offer a system in which two tightly

linked, highly homologous structural genes, Ren-J and Ren-2, exhibit strikingly different patterns of tissue-specificexpression. Gross similarity is preserved in the flankingregions as well, with the exception of a large insertion, ca. 3kb in length, within 1 kb of the 3' end of Ren-2 (24). Webelieve it is unlikely, however, that this sequence is ofimportance in the differential expression of the two genes, asa related species, Mus hortulanus, exhibiting evidence ofgene duplication and similar tissue-specific expression, lackssuch an insertion (Dickinson, et al., in press). The 5' flankingregions immediately upstream of transcriptional start siteshave been shown to harbor control elements for a variety ofgenes (27, 40). Although we had no a priori reason to believethat elements within these regions of the renin genes areresponsible for the tissue-specific expression, the discovery

VOL. 4, 1984

2328 FIELD ET AL.

M 123 4 5 M

-622- 523- 404

- 309

,. 242-238-247_201-190-480

-460-447

-i22

1140

=90

-76

-67

FIG. 6. Si nuclease analysis of the 3' termini of renin transcripts.3' S1 nuclease probes were generated by isolation of the 1.075-kbBglI-PstI fragment (3-end-labeled at the BgIl site) from appropriategenomic subclones (see the text). Total SMG and kidney RNA fromthe one-gene strain BALB/cJ or the two-gene strain DBA/2J washybridized to the appropriate probe, digested with S1 nuclease, andanalyzed on an 8% polyacrylamide-7 M urea gel. Lanes 1 and 2show Si nuclease analysis of 80 jig of total RNA from BALB/cJkidney and SMG, respectively, with a Ren-I(BALB) derived 3'probe. Lane 3 shows Si nuclease analysis of 80 pLg of total RNAfrom DBA/2J kidney with a Ren-I(DBA) derived 3' probe. Lanes 4and 5 show Si nuclease analysis of 0.8 and 8 ,ug of total DBA/2JSMG RNA, respectively, with a Ren-2(DBA) derived 3' probe.Markers were generated by end labeling HpaII-restricted pBR322.

of a restriction fragment length polymorphism encompassingthe 5' ends of the two genes, which appeared equivalent to a210-bp insertion in Ren-2, led us to carry out a detailedanalysis of these regions.Comparative sequence analysis of the 5' ends of Ren-J and

Ren-2 reveals that the two genes are nearly identical for thelength of exon I and for ca. 150 bases extending in the 5'direction. Within this region, both genes contain an identicalTATA homology and 20 bp of potential Z-DNA, an arrange-ment which may have some regulatory significance (25).Examination of the transcription initiation sites of Ren-J andRen-2 by S1 nuclease mapping demonstrates that the posi-tions of the primary starts in the SMG and kidney of two-gene strains are identical and that the homologous site isutilized in the SMG and kidney of one-gene strains. Further,this analysis suggests that the tissue-specific difference inrenin message levels is probably due to relative utilization ofthis transcription initiation site and is not due to utilization of

different promoters, as is the case in the amylase system(33).

High-resolution Northern analysis of RNA from the SMGof one-gene strains reveals the presence of two species ofrenin message (8). The predominant species is identical inmobility to that detected in the SMG of two-gene strains andwould correspond to transcripts initiating at the primarystart site, whereas the second species appears somewhatlarger. Si nuclease analysis with 3'-specific probes rules outthe possibility that this larger message species originatesfrom alternative transcription termination further down-stream. Si nuclease analysis with 5'-specific probes, howev-er, detects a population of upstream starts in the SMG ofboth one-gene and two-gene strains which is not visible inthe kidney of either strain. On longer exposure of gels of Sinuclease analyses, the number and relative positions of theseminor starts appear to be the same in the SMG of one-genestrains as in the SMG of two-gene strains. Corroboration byprimer extension suggests that these bands do not representS1 nuclease artifacts or differential splicing at the 5' ends ofthe messages. A functional role for the weak, upstreamTATA homologies in the generation of these transcripts ismade unlikely by the lack of any appropriate alignment.Multiple upstream origins of transcription have been seen fora variety of eucaryotic genes (9, 19). These additional starts,then, could well account for the additional band seen inNorthern analysis of SMG RNA from one-gene strains.Northern analysis would not be expected to detect additionalbands in SMG RNA from two-gene strains due to the drasticincrease in transcripts initiating at the major start site. It isnot clear, however, that the RNA being analyzed representsentirely mature message, and the possibility of differentialintron-exon splicing has not been tested.

If, indeed, these putative upstream transcripts do repre-sent a stable message population, the existence of the in-phase, open reading frame extending from the conventionalprotein start becomes more intriguing. Although it is notknown whether this translation start is utilized, it is conceiv-able that a new leader sequence could carry implications foralternative pathways of processing renin protein.

Since the tissue-specific regulation of the renin genes didnot appear to be due to the use of different major start sites,we next turned our attention to the sequences 5' proximal tothe transcription initiation sites in Ren-l and Ren-2. It is nowapparent that the primary cause of the size polymorphismobserved in the 5' flanking regions of the two genes is theinsertion of a mouse type 2 Alu-equivalent element into thatregion in Ren-2. Perturbations in the homology beyond theAlu boundaries may also be a consequence of the insertion,as this kind of sequence scrambling appears to have oc-curred in another instance (18). Comparisons of Ren-l andRen-2 in this region, where one might reasonably anticipatethe location of regulatory elements, reveal some dramaticsequence differences.Two of a series of three A-G-rich motifs, present in Ren-l

and extending from positions -190 to -321, are to a largeextent missing from Ren-2. The remaining purine-rich tractis located 71 bases further 5' of the TATA consensus thanthe homologous tract in Ren-I. Polypurine tracts have beenseen in the promoter regions of a number of viral andeucaryotic genes, and although they may have some confor-mational consequences, their functional significance is un-known (7, 34, 43).An A-T stretch of more than 50 bases in length, which is

not present in Ren-J, resides ca. 280 bases from the majorcap site in Ren-2. It is likely that this arrangement was

3 3

II* 0

* 0

* *

S

a a

..l

I

r

MOL. CELL. BIOL.

MURINE RENIN GENES: STRUCTURE AND EXPRESSION 2329

SacI -700 -675 PvuII -650 -625Ren-2 GAGCTCAGAGACTGGGCAGGCAGACAGCAGGAGAAGACACTGGGTGGTCTGGCAGCTGGAAACGCTGGGAGGCCTTCTTGCGGGAGATTAGAT GAGGCT

* * * * * *Ren-1 n. d. ) GACAGCAGGGGAAGGCACTGGGTGGTCTGGCAGCTGGAAATGCTGGGAGGCCTTCTTGGGGGAGATTAGATTAAAGCT

-475 -450 -425

Ren-2

Ren-1

Ren-2

Ren-1

-600 -5!7 XbaIATTCAGGGGAAGGCCTATTCCATTTCTCCAGCATGGTGAGTCTAGATGAAAAGAGGTAGT* ** *CTTCAGGGGAAGGCCTATTCCATGACTCCAGCATGGTGAGTCTAGATGAAAGGAGGTAGTC TATGGTTTTAGAGCTTTATTGTAGAAGAGAGAGAGAGAA

-400 -375 -350 -325

-550 -525 -500GAAATAGAGGCCAGCCATTGCCACAAAGAAGG TAAGAGTAAGAGAACAAGAGCT TAAGAAAGAGCCAAr,

* * * ** * * * *GGTAGAGAAGTAGAAGCCAGTCATTGCCATGAAGAAGGAAGGGGGAGAAGGAGAGCGAAAGGTAAGAGTAAGAAAACAAGAGCTTTAGGAGAGAGACAG

=Too -275 -250 -225

-475 -450 -425 -400Ren-2 ATtOTtGAGAGATGGCTCAGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCGAAGTTCAAATCCCAGCAACCACATGGTGGCTCAC AACCATC

* * * * **Alu-2 GGGCTGGTGAGATGGTTCAGTGGGTTAGAGCACCCGACTGCTCT CCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACCAACCATC

-375 -350 -325 -300Ren-2 TCATAATGAGATCTGAC TCCCTCTTC TTGGAGTGTCTGAAGACAGCTACAGTATATTTACATATAATAAAAATAAATTTAAAAAATMAAAAMATAAAAAT

* ** * * * * * **** *

Alu-2 CGTAACAAGATCTGACTCCCTCTTCT GGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTAAAAAAAAA

-275 -250 -225 -200Ren-2 AAATTTAGAGAGAGAGAGAGGAGGAGCCAAGCAGCCCCATTTATAGTGGGCTGGGCTACCTTGCTGTTGTAGGGTMCTGTGGGGAGGAGCAAARen-1 AGAGAGAGGAGGAGGCAAGCAGCC

-200

-175 -150 -125 BamHI -100Ren-2 tTATTtCCAGGTAACTGTGGGGGGTGGAGTTACT TGACTACTTGACTGATGGCCACA ATGATGGAGGTGGATCCTTGGCCAGAAACAGGCTGCCT

* ** ***** ** * * * *Ren-1 AAGTGGCTCTGGG GGTGGA.GTCTGGACAGCCTACATGACTGATGGCCACA AATTATGGAGCTGGGTCCTTGGCCAGAAAACAGGCTGCCT

HinfI

-75 -50 -25 -1 +5Ren-2 TTCATGGTCCCACAGGCCCTGGGGTAATAAATCAGAGCAGAGCCTGTGATACATGGTGT AAGGCTCAGGGGGTCTGGGCTACACAGCT...

III Exon IRen-1 TTCATGGTCCCACAGGCCCTGGGGTAATAAATCAAAGCAGAGCCTGTGATACATGGTGT TATAAAA AAGGCTCAGGGGGTCTGGGCTACACAGCT...

FIG. 7. Alignment of the Ren-J and Ren-2 5'-flanking sequences for maximum homology. Gaps indicate sequences absent from one genebut present in the other. Asterisks indicate bp mismatches. Arrows above and below the lines indicate short, direct, and inverted repeatspresent near the boundaries of the gaps. Alu-2 is the sequence of a mouse type 2 Alli equivalent element reported by Kominami et al. (18)aligned with a similar element present in Ren-2 but not in Ren-1. Underlining indicates the polypurine tracts present in Ren-I but largelyabsent from Ren-2. A region which has the potential for forming stem-loop secondary structures is indicated by brackets. Potential Z-DNA isoverlined. The concensus TATA sequences is boxed. The numbering is as in Fig. 3. (n.d.); Sequence not determined. Relevant restrictionsites are indicated.

introduced as a result of the Alu insertion, since heterogene-ity in the length of the A-rich tails of these elements has beennoted (14). Similar sequences have been reported to intro-duce bends in the DNA helix (38, 47). However, the effectsof conformational changes on gene regulation have not beenestablished.A number of direct and inverted repeats exist, some of

which are present in one of the genes and absent in the other(Fig. 7). In addition, computer analysis reveals that thereexists the potential for the formation of one or two promi-nent stem-loop structures at either the DNA or RNA levelwithin the homologous region 5' to exon I (position -129 to-26, Fig. 7). If these structures exist, their relative stabilitieswill be altered by the four single-base changes between thetwo genes that lie within this region.Thus far, we have considered the expression of the Ren-J

and Ren-2 genes in terms of mRNA accumulation in thekidney and SMG. However, a more accurate measure of

expression must account for the fact that only a fraction ofthe cells in each tissue produce renin. When allowance ismade for this, the per cell accumulation of Ren-J transcriptsin the kidney and Ren-2 transcripts in the SMG are probablyroughly equivalent. That is, the Ren-2 gene does not appearto carry a more efficient promoter than does the Ren-l gene,but rather, the tissue-specific pattern of expression is al-tered. On a per cell basis, the Ren-J gene is expressed in theSMG at substantially lower levels than in the kidney. Todate, Ren-2 expression has not been detected in the kidneyof two-gene strains. However, methods that are able todistinguish Ren-J and Ren-2 transcripts are currently beingused to further investigate this issue.The data presented in this paper are consistent with two

different models for transcriptional regulation of the reningenes. One model would propose that Ren-J and Ren-2 liewithin different structural domains of chromatin and that thetissue-specific expression of the genes is a reflection of their

VOL. 4, 1984

2330 FIELD ET AL.

availability to the general transcriptional machinery of thecell. Although experiments with congenic strains of micehave localized the structures regulating expression of thesegenes to a limited region of chromosome 1 encompassing theRen loci, the disparity between genetic distance and molecu-lar distance allows ample room for the operation of a varietyof control mechanisms. We are currently constructing trans-genic mice (27) as a means of further investigating positionaleffects.The second model proposes that the interaction of tissue-

specific cellular factors with sequences lying within or nearthe genes is responsible for the differential expression of thegenes. In this paper we have described several structuraldifferences in the sequences of the Ren-J and Ren-2 genes.One must be circumspect, however, in favoring any of thesewith regard to playing a role in the differential expression ofthe two genes. The possibility cannot be excluded, forinstance, that regions further upstream from the commonSacl site or in an intervening sequence may exert someinfluence. We are currently using a combination of ap-proaches to the investigation of the structural aspects ofrenin gene regulation. Through the analysis of structural andexpression variants in wild-derived mice (Dickinson, et al.,in press) we hope to delineate features that correlate withpatterns of gene expression in vivo. In addition, we are usingtransient expression assays in cell culture (40) as well as intransgenic mice to define sequences responsible for thetissue specificity of the genes.

ACKNOWLEDGMENTSWe are indebted to S. Weaver (University of Illinois, Chicago)

and H. Lehrach (European Molecular Biology Institute, Heidelberg,Federal Republic of Germany) for lambda genomic libraries used inthis study. We also thank S. Bodery and the laboratories of P.Wellauer, 0. Hagenbuchle, and U. Schibler (Swiss Institute forCancer Research, Lausanne, Switzerland) for their assistance inconstructing cosmid libraries used in this studies. We thank L.Beecroft and W. Brammar (University of Leicester, Leicester,England) for their communication of unpublished results on Ren-JDsequence organization and renin transcript studies. We also wish tothank A. Kinniburgh (Roswell Park Memorial Institute) for assist-ance with the Si nuclease assay and pUC-13 DNA; J. Ross(Wisconsin) for S1 nuclease; E. Morgan (State University of NewYork, Buffalo) for M13 mp9 DNA; K. Manly (Roswell Park Memori-al Institute) for assisting us with computer searches; R. Ratliff forcalf thymus TdT; and W. Held, A. Kinniburgh, and L. Maquat(Roswell Park Memorial Institute) for discussion. We acknowledgethe excellent technical assistance of K. Abel and C. Kane-Haas andthe secretarial aid of C. Bell.

This work was supported by Public Health Service grants GM30248 and GM 33159 from the National Institutes of Health, by agrant-in-aid from the American Heart Association, and by fundscontributed in part by the American Heart Association, New YorkState Affiliate, Syracuse, N.Y. L.J.F. is a postdoctoral trainee(National Institute of General Medical Sciences grant GM 07093).K.W.G. was the recipient of a UICC/ICRET travel award.

LITERATURE CITED

1. Benton, W. D., and R. W. Davis. 1977. Screening Agt recombi-nant clones by hybridization to single plaques in situ. Science196:180-182.

2. Berk, A. J., and P. A. Sharp. 1978. Spliced early mRNAs ofsimian virus 40. Proc. Natl. Acad. Sci. U.S.A. 75:1274-1278.

3. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extractionprocedure for screening recombinant plasmid DNA. NucleicAcids Res. 7:1513-1523.

4. Clewell, P. B., and D. R. Helinski. 1969. Supercoiled circularDNA-protein complexes in E. coli: purification and inducedconversion to an open circular DNA form. Proc. Natl. Acad.

Sci. U.S.A. 62:1159-1166.5. Cordon, J., B. Wasylyk, A. Buchwalder, P. Sassone-Corsi, C.

Kadinger, and P. Chambon. 1980. Promoter sequences of eu-karyotic protein-coding genes. Science 209:1406-1414.

6. Cox, R. A. 1968. The use of guanidinium chloride in the isolationof nucleic acids. Methods Enzymol. 12:120-129.

7. Everett, R. D. 1983. DNA sequence elements required forregulated expression of the HSV-1 glycoprotein D lie within83bp of the RNA capsites. Nucleic Acids Res. 11:6647-6666.

8. Field, L. J., R. A. McGowan, D. P. Dickinson, and K. W. Gross.1984. Tissue and gene specificity of mouse renin expression.Hypertension. 6:597-603.

9. Grindley, G. J., W. G. Lanyon, M. Allan, and J. Paul. 1984.Alternative sites of transcription initiation upstream of thecanonical cap site in human -y-globin and 1-globin genes.Nucleic Acids Res. 12:1811-1820.

10. Grosveld, F. G., H.-H. M. Dahl, E. de Boer, and R. A. Flavell.1981. Isolation of 3-globin related genes from a human cosmidlibrary. Gene 13:227-237.

11. Grosveld, F. G., T. Lund, E. J. Murray, A. L. Mellor, H.-H. M.Dahl, and R. A. Falvell. 1982. The construction of cosmidlibraries which can be used to transform eukaryotic cells.Nucleic Acids Res. 10:6715-6732.

12. Hagenbuchle, O., R. Bovey, and R. A. Young. 1980. Tissuespecific expression of mouse a-amylase genes: nucleotide se-quence of isoenzyme mRNAs from pancreas and salivary gland.Cell 21:179-187.

13. Hanahan, D., and M. Meselson. 1980. Plasmid screening at highcolony density. Gene 10:63-67.

14. Haynes, S. R., T. P. Toomey, L. Leinwand, and W. R. Jelinek.1981. The Chinese hamster Alu-equivalent sequence: a con-served, highly repetitions, interspersed deoxyribonucleic acidsequence in mammals has a structure suggestive of a transpos-able element. Mol. Cell. Biol. 1:573-583.

15. Holm, I., R. Ollo, J.-J. Panthier, and F. Rougeon. 1984. Evolu-tion of aspartyl proteases by gene duplication: the mouse reningene is organized in two homologous clusters of four exons.EMBO J. 3:557-562.

16. Inagami, T. 1981. Renin. p. 39-71. In R. L. Stoffer, (ed.), InBiochemical regulation of blood pressure. John Wiley and Sons,Inc., New York.

17. Ish-Horowicz, D., and J. F. Burke. 1981. Rapid and efficientcosmid cloning. Nucleic Acids Res. 9:2989-2998.

18. Kominami, R., M. Muramatsu, and K. Moriwaki. 1983. Amouse type 2 Alu sequence (M2) is mobile in the genome.Nature (London) 301:87-92.

19. Lai, E. C., D. R. Roop, M.-J. Tsai, S. L. C. Woo, and B. W.O'Malley. 1984. Heterogeneous initiation regions for transcrip-tion of the chicken ovomucoid gene. Nucleic Acids Res.10:5553-5567.

20. Loenen, W. A. M., and W. J. Brammar. 1980. A bacteriophagelambda vector for cloning large DNA fragments made withseveral restriction enzymes. Gene 20:249-259.

21. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning (a laboratory manual). Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

22. Maquat, L. E., A. J. Kinniburgh, E. A. Rachmilewitz, and J.Ross. 1981. Unstable P-globin mRNA in mRNA-deficient 130thalassemia. Cell 27:543-553.

23. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labelledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

24. Mullins, J. J., D. W. Burt, J. D. Windass, P. McTurk, H.George, and W. J. Brammar. 1982. Molecular cloning of twodistinct renin genes from the DBA/2 mouse. EMBO J. 1:1461-1466.

25. Nagata, S., N. Matei, and C. Weissman. 1980. The structure ofone of the eight or more distinct chromosomal genes for humaninterferon-d. Nature (London) 287:401-408.

26. Nordheim, A., and A. Rich. 1983. Negatively supercoiled simianvirus 40 DNA contains Z-DNA elements within transcriptionalenhancer sequences. Nature (London) 303:674-679.

27. Palmiter, R. D., G. Norstedt, R. E. Gelinas, R. E. Hammer, and

MOL. CELL. BIOL.

MURINE RENIN GENES: STRUCTURE AND EXPRESSION 2331

R. L. Brinster. 1983. Metallothionein-human GH fusion genesstimulate growth of mice. Science 222:809-814.

28. Panthier, J.-J., S. Foote, B. Chambraud, A. D. Strosberg, P.Corvol, and F. Rougeon. 1982. Complete amino acid sequenceand maturation of the mouse submaxillary gland renin precur-sor. Nature (London) 298:90-92.

29. Panthier, J.-J., T. Holm, and F. Rougeon. 1982. The mouse Rnlocus: S allele of the renin regulator gene results from a singlestructural gene duplication. EMBO J. 1:1417-1421.

30. Panthier, J.-J., and F. Rougeon. 1983. Kidney and submaxillarygland renins are encoded by two non-allelic genes in Swiss mice.EMBO J. 2:675-678.

31. Piccini, N., J. L. Knopf, and K. W. Gross. 1982. A DNApolymorphism, consistent with gene duplication, correlates withhigh renin levels in the mouse submaxillary gland. Cell 30:205-213.

32. Rigby, P. W. J., M. Dieckmann, C. Rhodes, and P. Berg. 1977.Labeling deoxyribonucleic acid to high specific activity in vitroby nick translation with DNA polymerase-I. J. Mol. Biol.113:237-231.

33. Schibler, U., 0. Hagenbuchle, P. K. Wellauer, and A. C. Pittet.1983. Two promoters of different strengths control the transcrip-tion and the mouse alpha-amylase gene Amy-la in the parotidgland and liver. Cell 33:501-508.

34. Schon, E., T. Evans, J. Welsh, and A. Efstratiadis. 1983.Conformation of promoter DNA: fine mapping of Si-hypersen-sitive sites. Cell 35:837-848.

35. Sharp, S., D. DeFranco, T. Dingeman, P. Farrell, and D. Soil.1981. Internal control regions for transcription of eukaryotictRNA genes. Proc. Natl. Acad. Sci. U.S.A. 78:6657-6661.

36. Southern, E. M. 1975. Detection of specific sequences amongDNA fragments separated by gel electrophoresis. J. Mol. Biol.98:503-517.

37. Tanaka, T., E. W. Gresik, A. M. Michelakis, and T. Barka.1980. Immunocytochemical localization of renin in kidneys and

submandibular glands of SWR/J and C57BL/6J mice. J. Histo-chem. Cytogen. 28:1113-1118.

38. Trifonov, E. N. 1980. Sequence-dependent deformational an-isotropy of chromatin DNA. Nucleic Acids Res. 8:4041-4053.

39. Vieira, J., and J. Messing. 1982. The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencingwith synthetic universal primers. Gene 19:259-268.

40. Walker, M. D., T. Edlund, A. M. Boulet, and W. J. Rutter. 1983.Cell-specific expression controlled by the 5'-flanking region ofinsulin and chymotrypsin genes. Nature (London) 306:557-561.

41. Weaver, R. F., and C. Weissmann. 1979. Mapping of RNA by amodification of the Berk-Sharp procedure: the 5' termini of 15S,-globin mRNA precursor and mature 10S f-globin mRNA haveidentical map coordinates. Nucleic Acids Res. 7:1175-1193.

42. Werle, E., R. Vogel, and L. F. Goldel. 1957. Uber em Blutdruck-steigerudes Prinzip in Extrakten aus der Glandula Submaxillar-ies der Weissen Maus. Arch. Exp. Pathol. Pharmakol. 230:236-241.

43. Whitton, J. L., and J. B. Clements. 1984. Replication origins anda sequence involved in coordinate induction of the immediate-early gene family are conserved in an intergenic region of herpessimplex virus. Nucleic Acids Res. 12:2061-2079.

44. Wilson, C. M., M. Cherry, B. A. Taylor, and J. D. Wilson. 1981.Genetic and endocrine control of renin activity in submaxillarygland of the mouse. Biochem. Genet. 19:509-523.

45. Wilson, C. M., E. G. Erdos, J. D. Wilson, and B. A. Taylor.1978. Location on chromosome 1 of Rnr, a gene that regulatesrenin in the submaxillary gland of the mouse. Proc. Natl. Acad.Sci. U.S.A. 75:5623-5626.

46. Wilson, C. M., and B. A. Taylor. 1982. Genetic regulation ofthermostability of mouse submaxillary gland renin. J. Biol.Chem. 257:217-223.

47. Wu, H.-M., and D. M. Crothers. 1984. The locus of sequence-directed and protein-induced DNA bending. Nature (London)308:509-513.

VOL. 4, 1984