Expression of the non-structural protein 4 (nsp4) of ... · EXPRESSION OF THE NON-STRUCTURAL PROTEIN 4 (NSP4) OF ROTAVIRUS IN ESCHERICHIA COLI BASED EXPRESSION SYSTEMS . Tan Geek

EXPRESSION OF THE NON-STRUCTURAL PROTEIN 4 (NSP4) OF ROTAVIRUS IN ESCHERICHIA COLI BASED EXPRESSION SYSTEMS

Tan Geek Ching

Master of Science

Swinburne University of Technology

2011

Declaration

To the best of my knowledge, this thesis contains no material that has been accepted for the award of any other degree or diploma, or written by another person except where due reference is made in the text of the examinable outcome.

Tan Geek Ching

i

ACKNOWLEDGEMENTS

I would like to thank Associate Professor Dr Enzo Palombo and Dr Peter Anthony

Barton for their great and endless support in helping me to complete this Master thesis

project.

Also many thanks to Soula Mougos, Ngan Nguyen and Chris Key for their assistance in

helping me to carry out my laboratory work as required for my Master thesis project.

My appreciation also conveyed to Jacqui Birmingham, Kelly Walton, Carly Gamble,

Wu Hui Mei, Ng Shee Ping, Rebecca Phillips and Peter Golan for their friendly support

while I was studying at the University. A special thanks to Cameron Bentley and Scott

Gladman for designing some of the primers used in this study.

Last, but not least, I am grateful for the continuos support from my family to complete

my study.

ii

CONTENTS Page

ACKNOWLEDGEMENTS i

LIST OF FIGURES viii

LIST OF TABLES xiii

LIST OF ABBREVIATIONS xv

ABSTRACT xvii

CHAPTER 1: INTRODUCTION

1.1 Discovery of rotavirus 1

1.2 Rotavirus Genome Structure 2

1.3 Rotavirus Gene Coding Assignment and Classification 3

1.4 Rotavirus Epidemiology 5

1.5 The Rotavirus Non-structural Proteins 6

1.6 Rotavirus Non-Structural Protein 4 (NSP4) 6

1.7 NSP4 Expression in Bacterial Cell Systems 9

1.7.1 Protein Expression Using E. coli Systems 9

1.7.2 Protein Expression Using Lactococcus lactis System 16

1.8 NSP4 Expression in Insect Cell System 17

1.8.1 Protein Expression Using Recombinant Baculovirus-Sf9

Insect Cell Systems

17

1.9 NSP4 Expression in Mammalian Cell System 19

1.9.1 Protein Expression Using Dual-recombinant Vaccinia Virus

System

19

1.9.2 Protein Expression in Caco-2 cells 19

1.9.3 Protein Expression in Rotavirus-infected MA104 and HT29

Cells

19

iii

CHAPTER 2: MATERIALS AND METHODS

2.1 Sources of Human Rotavirus NSP4 Gene 21

2.2 Culture of E. coli Strains Containing Human Rotavirus NSP4 Genes 21

2.3 Plasmid DNA Minipreparation Using Alkaline Lysis with SDS

Method

22

2.4 Restriction Enzyme Digestion 24

2.5 Agarose Gel Electrophoresis 25

2.6 Construction of a C-Terminal 6xHis tagged Fusion Protein Plasmid 26

2.6.1 Construction of a C-Terminal 6xHis tagged Fusion Protein

in plasmid pQE60

26

2.6.2 Construction of a C-Terminal 6xHis tagged fusion protein in

plasmid pET28a

26

2.6.3 Polymerase Chain Reaction (PCR) amplification of NSP4

ORFs

27

2.6.4 Gel Purification of PCR Products 29

2.7 Ligation and Transformation 30

2.7.1 Ligation of PCR Products with pGEM®-T Easy Vector 30

2.7.2 Transformation of Recombinant Plasmids into E. coli Cells 31

2.8 Confirmation of NSP4 Genes in Recombinant Plasmid pGEM®-T

Easy by Restriction Enzymes Digestion and Gel Purification of

NSP4 ORFs.

32

2.9 Ligation of NSP4 ORFs into pQE60 and pET-28a(+) Expression

Vectors

34

2.9.1a Source of pQE60 Vector 37

2.9.1b Source of pET-28a(+)Vector 38

2.9.2a Ligation of linearised pQE60 vector and NSP4 ORFs 39

2.9.2b Ligation of linearised pET-28a(+) vector and RV5-NSP4

ORFs

40

2.10 Transformation of Recombinant Plasmids into E. coli JM109 and

Screening of Transformants

41

2.10a Transformation of recombinant plasmid pQE60-RV4-NSP4

and pQE60-RV5-NSP4 into E.coli JM109

41

2.10b Transformation of recombinant plasmid pET-28a(+)-RV5- 41

iv

NSP4 into E.coli JM109.

2.11 Transformation of Recombinant Plasmid into Expression Host of E.

coli M15(pREP4) and E. coli Rosseta-gami 2(DE3)pLysS5 and


42

2.11a Preparation of competent cells 42

2.11b Transformation of recombinant plasmid into expression host 43

2.12 DNA Sequencing Analysis 45

2.12.1 PCR for DNA Sequencing 45

2.12.2 Cleaning Up the PCR Products 47

2.13 Expression and Purification of NSP4 Protein from E. coli M15

[pREP4] pQE60-NSP4

48

2.13.1 E. coli Culture Growth for Preparative Purification 48

2.13.2 Measurement of the Cell Intensity at OD600 and the Viable

Cell Counting

49

2.13.3 Preparation of Cleared E. coli Lysates under Native

Conditions

50

2.13.4 Batch Purification of 6xHis tagged-NSP4 Proteins under

Native Conditions

50

2.14 Detection of Recombinant 6xHis tagged Proteins using SDS-PAGE 51

2.15 Western Blotting Detection of Purified Polyhistidine Fusion Protein

by the Polyclonal Anti-SA11 Rabbit Sera

52

2.16 Western Blotting of Detection of Polyhistidine Fusion Protein in the

E. coli M15 Cleared Lysates and Purified Polyhistidine Fusion

Protein by Monoclonal Anti-polyhistidine Clone HIS-1

53

2.17 Expression and Purification of NSP4 Protein from Host Rosetta-

gami 2(DE3)pLysS5 System

54

2.17.1 E. coli Culture Growth Under Different Conditions. 54

2.17.2 Preparation of Cleared E. coli Lysates under Denaturing

Conditions

55

2.17.3 Purification of recombinant proteins by immobilized metal

ion affinity chromatography (IMAC) pull down method

56

v

CHAPTER 3: RESULTS

3.1 Confirmation of the Source Vector Containing NSP4 Genes by

Enzymes Digestion

57

3.2 PCR Amplification of the NSP4 ORFs to Introduce 5’-NcoI and 3’-

BglII Restriction Sites

59

3.3 PCR Amplification of the RV5 NSP4 ORF to Introduce 5’-NcoI and

3’-XhoI Restriction Sites

61

3.3.1 Gel Purification of the PCR Amplicons. 63

3.4 Transformation of JM109 Bacterial Cells with the pGEM®-T Easy

Vector Ligated with the RV4 and RV5 NSP4 ORFs

64

3.4.1 Restriction Enzyme Digestion to Identify RV4 and RV5

NSP4 ORFsPresent in the pGEM®-T Easy Recombinants

65

3.4.2 Gel Purification of NcoI/BglII-digested RV4-NSP4 and

RV5-NSP4 ORFs and NcoI/XhoI-digested RV5-NSP4 ORF

from pGEM®-T Easy Recombinants

66

3.5 Cloning of RV4-NSP4 and the RV5-NSP4 genes into pQE60 67

3.5 .1 ApaI, NcoI and BglII Digestion of pREP4/pQE60-SA11-

NSP2 to prepare pQE60 for ligation with NSP4 ORFs

67

3.5 2 Purification of linearised plasmid pQE60 68

3.5.3 NcoI and BglII Digestions on E. coli JM109 pQE60-NSP4

of both RV4 and RV5 strains

69

3.6 Cloning of RV5-NSP4 gene into pET-28a(+) 70

3.6.1 NcoI and XhoI Digestion of pET-28a(+) 70

3.6.2 NcoI/XhoI Digestion of recombinant pET-28a(+)-RV5-

NSP4

71

3.7 Transformation of E. coli M15 with pQE60 carrying the RV4-NSP4

and the RV5-NSP4 genes

72

3.7.1 ApaI, NcoI and BglII Digestion on M15(pREP4)pQE60-

NSP4

72

3.8 Transformation of the Rosseta-gami 2(DE3)pLysS5 Bacterial Cells

with pET-28a(+) vectors inserted with RV5-NSP4 genes

73

vi

3.8.1 NcoI and XhoI Digestions on host Rosseta-gami

2(DE3)pLysS5 containing recombinant plasmid of pET-

28a(+)/RV5-NSP4.

73

3.9 DNA sequencing Analysis of the pQE60 vectors inserted with the

RV4-NSP4 and the RV5-NSP4 genes

74

3.10 DNA sequencing Analysis of the pET-28a(+) vector inserted with

RV5-NSP4 genes

77

3.11 Expression of the NSP4 Protein in E. coli (M15 strain) Bacterial Cell

Culture

79

3.12 Expression of the NSP4 Protein in E. coli (Rosetta-gami

2(DE3)pLysS5 strain) Bacterial Cell Culture

90

3.13 SDS-PAGE Gel Analysis of Purified Fusion Proteins Expressed in

E. coli M15

93

3.14 SDS-PAGE Gel Analysis of Fusion Proteins Expressed in E. coli

Rosseta-gami 2(DE3)pLysS5 strain

95

3.14a Bacterial culture in Terrific broth without glucose induced

by 0.5mM IPTG at 28

95

3.14b Bacterial culture in Terrific broth with 1% glucose induced

by 0.5mM IPTG at 28

96

3.14c Bacterial culture in LB broth induced by 0.8mM IPTG at 37

97

3.15 Western Blotting of Induced Cultures of M15 (pQE60-RV4/RV5-

NSP4)

98

3.15.1 Identification of RV4-NSP4 Polyhistidine Fusion Protein in

E. coli Cleared Lysates by Anti-polyhistidine Monoclonal

Antibody HIS-1

98

3.15.2 Identification of RV5-NSP4 Polyhistidine Fusion Protein in

E. coli Cleared Lysates by Anti-polyhistidine Monoclonal

Antibody HIS-1

99

3.15.3 Identification of the Purified RV4-NSP4 Polyhistidine

Fusion Protein by Anti-polyhistidine Monoclonal Antibody

HIS-1

100

3.15.4 Identification of the Purified RV5-NSP4 Polyhistidine 101

vii

Fusion Protein by Anti-polyhistidine Monoclonal Antibody

HIS-1


Fusion Protein by Polyclonal Anti-SA11 Rabbit Sera

102


Fusion Protein by Polyclonal Anti-SA11 Rabbit Sera

103

CHAPTER 4: DISCUSSION

4.1 Cloning of NSP4 genes into expression vectors 104

4.2 DNA sequencing analysis 104

4.3 Membrane Destabilising Domain in NSP4 Protein 106

4.3.1 Cell intensity and viable count of M15(pREP4)(pQE60-

NSP4)

106

4.3.2 Cell intensity of Rosseta-gami 2(DE3)pLysS5/pET-

28a(+)/RV5-NSP4

107

4.4 Expression and Detection of NSP4 Protein 109

4.5 Possible reasons for the failure of NSP4 protein expression and

suggestions to improve the success of NSP4 protein expression.

112

CHAPTER 5: CONCLUSIONS

118

CHAPTER 6: REFERENCES

120

CHAPTER 7: APPENDICES 181

viii

LIST OF FIGURES Page

Figure 1.1 The coding assignments of the rotavirus genome and the

locations of the associated encoded viral proteins within

the SA11 strain rotavirus particle.

4

Figure 1.2 The non-structural NSP4 protein 7

Figure 2.1 C-terminal 6xHis tag construct of pQE60 vector and the

its multiple cloning sites

35

Figure 2.2 Cloning/expression region of the Novagen pET-28a(+)

expression vector

36

Figure 3.1 RV4 and RV5 NSP4 ORFs present in pIND/V5-His-

Topo-NSP4 plasmids showing restriction sites for

enzymes BamHI and XbaI

57

Figure 3.2 Agarose gel electrophoresis of BamHI and XbaI

restriction enzyme digestions of pIND/V5-His-Topo-

RV4-NSP4 and pIND/V5-His-Topo-RV5-NSP4

58

Figure 3.3 NSP4 ORFs were modified by insertion of NcoI sites

upstream and BglII sites downstream of the NSP4

sequences when amplified by the forward and reverse

primers

59

Figure 3.4 Agarose gel electrophoresis of PCR products obtained

from amplification of NSP4 ORFs in pIND/V5-His-

Topo-RV4-NSP4 and pIND/V5-His-Topo-RV5-NSP4

with forward primers (NcoI-NSP4, RV5-NcoI) and

reverse primers (RV4-BglII, RV5-BglII)

60

Figure 3.5 RV5 NSP4 ORF was modified by insertion of NcoI sites

upstream and XhoI sites downstream of the NSP4

sequences when amplified by the forward and reverse

primers

61

ix

Figure 3.6 Agarose gel electrophoresis of PCR products obtained

from amplification of NSP4 ORFs in pIND/V5-His-

Topo-RV4-NSP4 and pIND/V5-His-Topo-RV5-NSP4

with forward primer (CT-RV5NcoI) and reverse primer

(CT-RV5XhoI)

62

Figure 3.7 Agarose gel electrophoresis of the purified NSP4 PCR

products

63

Figure 3.8 (a) Agarose gel electrophoresis of DNA products following

NcoI and BglII restriction enzyme digestions of pGEM®-

T Easy vector containing ORF of RV4 and RV5 NSP4

genes.

65

Figure 3.8 (b) Agarose gel electrophoresis of DNA products following

NcoI and XhoI restriction enzyme digestions of pGEM®-

T Easy vector containing ORF of RV5 NSP4 genes

65

Figure 3.9 (a) Agarose gel electrophoresis of purified 528 bp

NcoI/XhoI-digested RV5 NSP4 ORF

66

Figure 3.9 (b) Agarose gel electrophoresis of purified 528 bp

NcoI/BglII-digested RV4 NSP4 ORF (lane 2) and RV5

ORF

66

Figure 3.10 Agarose gel electrophoresis of DNA products following

ApaI/NcoI/ BglII digestion of plasmid pQE60-SA11-

NSP2 and co-purifiefd plasmid pREP4 derived from

M15

67

Figure 3.11 Agarose gel electrophoresis of purified linearised pQE60 68

Figure 3.12 Agarose gel electrophoresis of NcoI/BglII-digested

recombinant pQE60-NSP4 plasmids

69

Figure 3.13 Agarose gel electrophoresis of gel-purified NcoI/XhoI-

digested pET-28a(+)

70

Figure 3.14 Agarose gel electrophoresis of NcoI/XhoI-digested

recombinant pET-28a(+)-RV5-NSP4 plasmid

71

Figure 3.15 Agarose gel electrophoresis of DNA products following

ApaI/NcoI/BglII restriction enzyme digestion of

recombinant plasmid pQE60-NSP4

72

x

Figure 3.16 Agarose gel electrophoresis of pET-28a(+)/RV5-NSP4

DNA following NcoI/XhoI restriction enzyme digestion

73

Figure 3.17 The NCBI Align software analysis result of matching the

NCBI’s gene bank’s open frame sequence of RV4-NSP4

gene (RV4DNA) to the RV4-NSP4 gene sequence

determined by the gene sequencing method

(NcoIRV4BgIII)

74

Figure 3.18 The NCBI Align software analysis result of matching the

NCBI’s gene bank’s open frame sequence of RV5-NSP4

gene (RV5DNA) to the RV5-NSP4 gene sequence

determined by the gene sequencing method

(NcoIRV5BgIII)

76

Figure 3.19 The sequencing result of the RV5-NSP4 gene insert

within the vector pET-28a(+) as analysed by Applied

Biosystem Sequence Viewer software

77

Figure 3.20 Optical densities (600nm) of M15 bacterial cultures

throughout the eight hours of expression time for both

the non-induced (NI) and IPTG-induced (I) cultures for

RV4-NSP4 (RV4NI and RV4I)

79

Figure 3.21 Optical densities of the M15 bacterial cultures at 600nm



RV5-NSP4 (RV5NI and RV5I)

81




SA11-NSP2 (NSP2NI and NSP2I)

83




RV4-NSP4 (RV4NI and RV4I), RV5-NSP4 (RV5NI and

RV5I) and SA11-NSP2 (NSP2NI and NSP2I)

84

xi

Figure 3.24 Viable count of the M15 bacterial cultures at 10-4 dilution

factor throughout the eight hours of expression time for

both the non-induced (NI) and IPTG-induced (I) cultures

for RV4-NSP4 (RV4NI and RV4I)

86




for RV5-NSP4 (RV5NI and RV5I)

87




for SA11-NSP2 (NSP2NI and NSP2I)

88




for RV4-NSP4 (RV4NI and RV4I), RV5-NSP4 (RV5NI

and RV5I) and NSP2 (NSP2NI and NSP2I)

89

Figure 3.28 Optical densities of the Rosseta-gami 2(DE3)pLysS5

bacterial cultures at 600nm throughout the eight hours of

expression time for both the non-induced (NI) and IPTG-

induced (I) cultures for RV5-NSP4 (RV5NI and RV5I)

and for both the glucose-enriched non-induced (NI) and

IPTG-induced (I) cultures for RV5-NSP4 (RV5GNI and

RV5GI)

90

Figure 3.29 Optical densities of the Rosseta-gami 2(DE3)pLysS5

bacterial cultures at 600nm throughout the eight hours of

expression time for the IPTG-induced (I) cultures for

RV5-NSP4 (RV5I) and PINB (PI), as well as the IPTG-

induced (I) glucose-enriched cultures for RV5-NSP4

(RV5GI) and PINB (PGI)

92

Figure 3.30 SDS-PAGE gel analysis of NSP4 proteins purified by

Ni-NTA chromatography after IPTG-induced expression

in M15 culture carrying pQE60-RV4-NSP4

93

xii

Figure 3.31 SDS-PAGE gel analysis of NSP4 proteins purified by

Ni-NTA chromatography after IPTG-induced expression

in M15 culture carrying pQE60-RV5-NSP4

94

Figure 3.32 15% SDS-PAGE gel analysis of E. coli crude cell lysates

after IPTG-induced expression of NSP4 in Rosseta-gami

2(DE3)pLysS5 cultures carrying pET-28a(+)-RV5-NSP4

95

Figure 3.33 (a) 15% SDS PAGE gel analysis of bacterial cleared lysates 96

Figure 3.33 (b) SDS-PAGE gel analysis of purified 6xHis tagged NSP4

protein by IMAC pull down method after IPTG-induced

Rosseta-gami 2(DE3)pLysS5-pET-28a(+)/RV5-NSP4

culture

96

Figure 3.34 (a) 15% SDS-PAGE gel analysis of E. coli crude cell lysates

after IPTG-induced expression of Rosseta-gami

2(DE3)pLysS5 culture carrying pET-28a(+)-RV5-NSP4

97

Figure 3.34 (b) SDS-PAGE gel analysis of purified 6xHis tagged NSP4

protein by IMAC pull down method

97

Figure 3.35 Western blot of E. coli cleared lysates after IPTG-

induced expression of M15 carrying pQE60-RV4-NSP4

98

Figure 3.36 Western blot of E. coli cleared lysates after IPTG-

induced expression of M15 carrying pQE60-RV5-NSP4

99

Figure 3.37 Western blot analysis of proteins purified by Ni-NTA

chromatography after IPTG-induced expression of M15

carrying pQE60-RV4-NSP4

100




101




102




103

xiii

LIST OF TABLES Page

Table 1.1 History of the expression of NSP4 in Escherichia coli 11

Table 2.1 Human rotavirus strains which were the sources of NSP4

genes used in this study

21

Table 2.2 Reagents used in restriction enzyme digestion for

confirming NSP4 genes in the provided sources of plasmids

24

Table 2.3 Sequences of forward and reverse primers for amplifying

ORF of RV4/RV5 NSP4 genes with insertion of NcoI and

BglII sites

27

Table 2.4 Sequences of forward and reverse primers for amplifying

ORF of RV5 NSP4 genes with insertion of NcoI and XhoI

sites

27

Table 2.5 Volumes of a PCR mix for amplification of ORF of RV4

and RV5 NSP4 genes

28

Table 2.6 PCR conditions for amplification of ORF of RV4 and RV5

NSP4 genes using primer sets of NSP4-NcoI/RV4-BglII and

RV5-NcoI/RV5-BglII

28

Table 2.7 PCR conditions for amplification of ORF of RV4 and RV5

NSP4 genes using primer set of C-TRV5NcoI/C-TRV5XhoI

29

Table 2.8 Volumes of ligation mixtures for ligating PCR product and

pGEM®-T Easy Vector, including negative control

30

Table 2.9 Volumes of an enzyme digestion reaction mix required to

release ORF of NSP4 genes using NcoI and BglII

32

Table 2.10 Volumes of an enzyme digestion reaction mix required to

release ORF of NSP4 genes using NcoI and XhoI

33

Table 2.11 Volumes of an enzyme digestion mixture to obtain pQE60

vector from E. coli M15[pREP4] containing recombinant

plasmid pQE60-SA11-NSP2

37

Table 2.12 Volumes of enzyme digestion mixture to obtain lineaqrised

pET-28a(+) vector

38

Table 2.13 Reaction mixtures used to ligate pQE60 vector with RV4-

NSP4 or RV5-NSP4 ORF DNA fragments

39

xiv

Table 2.14 Reaction mixtures used to ligate pET-28a(+) vector with

RV5-NSP4 ORF DNA fragment

40

Table 2.15 Enzymes Digestion Mixture used to confirm the presence of

pQE60 vector containing RV4-NSP4 or RV5-NSP4 DNA

fragments

44

Table 2.16 Enzymes Digestion Mixture used to confirm the presence of

pET-28a(+) vector containing RV5-NSP4 DNA fragments

44

Table 2.17 Sequencing reaction mixes in DNA sequencing PCR for

recombinant plasmids pQE60-RV4-NSP4, pQE60-RV5-

NSP4 or pET-28a(+)/RV5-NSP4

46

Table 2.18 PCR Conditions for DNA sequencing of recombinant

plasmids pQE60-RV4-NSP4, pQE60-RV5-NSP4 or pET-

28a(+)/RV5-NSP4

46

Table 7.1 Reagents and solutions used in plasmid DNA extraction 181

Table 7.2 Media and reagents used in transformation 183

Table 7.3 Reagents used in expression and purification of NSP4

proteins

186

Table 7.4 Reagents used in preparation of SDS-PAGE gels 188

Table 7.5 Reagents used in Western Blotting 189

xv

LIST OF ABBREVIATIONS

AcMNPV Autographa californica multiple nuclear polyhedrosis virus

ADRV Adult Diarrhoea Rotavirus

AGRF Australian Genome Research Facility Ltd

Arg argenine

BSA bovine serum albumin

cDNAs complementary DNAs

DLPs double-layered particles

DNA deoxyribonucleic acid

dNTPs deoxynucleoside triphosphate(s)

dsRNA double stranded RNA

DTT dithiothreitol

EDTA ethylenediaminetetraacetic acid

ER endoplasmic recticulum

Ile isoleucine

IMAC immobilized metal ion affinity chromatography

IPTG isopropyl-β-D-1-thiolgalactopyranoside

LB Luria-Bertani

MCS multiple cloning site

MOPS 3 -(N-Morpholino)propanesulfonic acid

NCBI National Center for Biotechnology Information

Ni-NTA Nickel-Nitrilotriacetic Acid dithiothreitol

NSP4 non structural protein 4

ORF open reading frame

PAGE polyacrylamide gel electrophoresis

PCR polymerase chain reaction

PVDF Polyvinylidene Fluoride

RNA ribonucleic acid

RT-PCR reverse transcription-polymerase chain reaction

SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis

SOC Super Optimal Culture

TEMED N, N, N' N'- Tetramethylethylenediamine

xvi

Thr threonine

TLPs triple layer particles

Tris-HCl tris-hydrochloride

UV ultraviolet

VP structural proteins

WHO World Health Organisation

X-Gal 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside

xvii

ABSTRACT

Viral gastroenteritis infecting young children and babies remains a major medical

problem around the world and rotavirus is the major pathogen of viral gastroenteritis.

Diarrhoea resulting from viral gastroenteritis can cause severe dehydration leading to

death. The non-structural protein NSP4 was discovered as an enterotoxin that accounts

for the toxicity of the rotavirus acting against the intestinal lining of the infected hosts.

Thus, the production of abundant NSP4 proteins at the laboratory scale is required for

NSP4-orientated experiments to examine the pathology of rotavirus infection. So far,

molecular biology techniques have been successful in producing NSP4 proteins at the

laboratory scale. This was achieved by inserting the NSP4 gene into an expression

vector, such as a bacterial plasmid, and later introducing the recombinant plasmid into

an expression host like bacteria, insect cells or mammalian cells for the expression of

NSP4 proteins. The expression of NSP4 proteins in bacteria, particularly Escherichia

coli, is of particular interest as the expression system offers advantages compared with

other expression systems. First, E. coli is easily cultivated in laboratory with

inexpensive reagents and media. Second, the well-characterised genetics and biology of

E. coli enable the flexible manipulation of the bacterial cell to express the toxic NSP4

proteins. Therefore, in this study, the expression of full-length NSP4 proteins of human

RV4 and RV5 strains was attempted in two E. coli-based systems: (i) M15 strain

carrying recombinant pQE60 containing NSP4 genes and (ii) recombinant pET28a

expression vector containing NSP4 genes in the Rosetta-gami 2 (DE3) pLysS strain.

Construction of appropriate recombinant plasmids was successful. However, after

inducing the expression of NSP4 in E. coli host cells, the optical densities of the

bacterial cultures declined, indicating that the expressed NSP4 proteins were toxic to the

bacterial cells. The declining bacterial cell numbers also accounted for very low

expression levels of NSP4 proteins and made the purification of the expressed proteins

difficult. The results of this study suggested that expression of full-length human NSP4

proteins in E. coli cells is problematic and that other expression systems (e.g.

baculovirus/insect cell-based systems) are more reliable options.

1

CHAPTER 1: INTRODUCTION

1.1 Discovery of rotavirus

In 1973, the first 70-nm human rotavirus particles were discovered in the duodenal

mucosa of rotavirus-infected infants and young children by thin section electron

microscopy (Bishop et al., 1973). Subsequently, the number of reports of human

rotavirus infection increased (Flewett et al., 1974; Flewett et al., 1973; Hamilton et al.,

1974; Cruickshank et al., 1974; Kapikian et al., 1974; Holmes et al., 1974).

Prior to the discovery of rotaviruses in humans, thin-section electron microscopy was

used to identify the first virus-like particles in murine intestines, namely the epizootic

diarrhoea of infant mice (EDIM) virus (Adams and Kraft, 1963). Similar 70-nm virus

particles were also detected in velvet monkey kidney cell culture and were named as

simian agent 11 (SA11) (Malherbe and Harwin, 1963). Another virus derived from the

intestines of cattle and sheep called O (offal) agent was also isolated from intestinal

washings of cattle and sheep (Malherbe, 1967). In addition, the Nebraska calf diarrhoea

viruses (NCDV) were successfully cultivated in primary foetal bovine cell cultures

(Mebus et al., 1971). Later, rotavirus was found from faeces of animals of piglets

(Rodger et al., 1975; Lecce et a,. 1976; Woode et al., 1976), foals (Flewett et al., 1975),

lambs (Snodgrass et al., 1976), deer (Tzipori et al., 1976) and rabbits (Bryden et al.,

1976).

2

1.2 Rotavirus Genome Structure

The rotavirus genome comprises 11 segments of double stranded RNA (dsRNA) (Estes,

2001). Adenine and uridine are richly represented in the rotavirus gene sequences (58%

to 67%) and the segments contain conserved consensus sequences at their 5' and 3' ends.

Each positive-sense RNA segment starts with a 5'-guanosine followed by a conserved

non-coding sequence. After the first initiation codon, the 11 genes contain at least one

long open reading frame (ORF) that encodes the specific viral protein. A set of non-

coding sequences follows which mostly contains the consensus sequence 5'-

UGUGACC-3'. For Group A rotaviruses (see 1.3), the dsRNA segments can be

separated and visualised by electrophoresis as four larger fragments (fragment 1 to 4),

two medium-sized segments (5 and 6), a distinctive triplet of segments (7 to 9), and two

smaller segments (10 and 11) (Estes, 2001).

3

1.3 Rotavirus Gene Coding Assignment and Classification

Rotaviruses are classified into the family Reoviridae; subfamily Sedoreovirinae, under

the genus Rotavirus which are non-enveloped viruses with the viral particles about 76.5

nanometer (nm) in diameter. The Rotavirus genus has seven species which are

Rotavirus A, Rotavirus B, Rotavirus C, Rotavirus D, Rotavirus E, and two tentative

species Rotavirus F and Rotavirus G. Four subgroups are further classsifed within

Group A according to the antigenic and genomic diversity. Rotavirus Group A accounts

for the majority of the disease in human although Groups B and C have also been

detected in human infections. All the seven Groups can also cause rotaviral

gastroenteritis in animals.

Group A rotavirus classification is based on a binary system defined using the two outer

capsid proteins: the glycoprotein VP7 defining G serotypes and VP4, a protease-cleaved

protein, defining P serotypes (Estes, 2001). Based on this dual classification system, 19

VP7 (G type) and 28 VP4 (P type) gene alleles (genotypes) have been identified and

documented (Rao et al., 2000, Estes, 2001, Kapikian et al., 2001, Martella et al., 2007,

Gray et al., 2008). While it is possible to have any combination of G and P types in

rotavirus, fewer than twenty serotypes/genotypes are most commonly identified in

humans and the predominant types found are G1P1A[8], G2P1B[4], G3P1A[8],

G4P1A[8] and G9P1A[8] (Surendran, 2008, Gray et al., 2008). Genotyping of rotaviruses based on the nucleotide identity cut-off percentages of all

eleven genomic RNA segments was recently proposed for classifying rotaviruses.

According to the proposed classification system, there are 27 G genotypes, 35 P

genotypes and 14 NSP4 E genotypes (Matthijnssens et al., 2011).

However, the size of mature infectious virions, referred to as triple layer particles (TLP)

is approximately 100nm. These are comprised of three protein layers: outer, middle and

inner or core protein, with the genome contained in the innermost protein shell of the

virion. A total of twelve different viral proteins are encoded by the eleven genes of

rotavirus of which six are structural proteins (VP) and the other six are non-structural

proteins (NSP) (Figure 1.1) (Kapikian et al., 2001).

4

RNA segments 1, 2 and 3 encode structural virus proteins, designated VP1, VP2, and

VP3, respectively, that form the core or subcore of the rotaviral particle. Segment 6

encodes the middle capsid protein, VP6, which is a highly immunogenic protein.

Intermediate virus particles are called double-layered particles (DLPs) which bind to the

intracellular receptor, non structural protein 4 (NSP4), to facilitating the budding of

DLPs into the endoplasmic recticulum (ER) to form the TLP with the middle layer

protein, VP6, interacting with the outer capsid layer (VP7) and the spike protein (VP4)

(Estes, 2001). As illustrated in Figure 1.1, the six non-structural proteins which are

found in rotavirus-infected cells but not in the virion, namely NSP1, NSP2, NSP3,

NSP4, NSP5 and NSP6, are encoded by segments 5, 8, 7, 10, and 11 respectively.

Figure 1.1: The coding assignments of the rotavirus genome and the locations of

the associated encoded viral proteins within the SA11 strain rotavirus particle. On

the left is the electrophoretic pattern of the eleven segments of the SA11 genome

separated by polyacrylamide gel electrophoresis (PAGE). In the middle is the PAGE

electrophoretic pattern of the viral proteins encoded by the eleven genes. The schematic

diagram in colour shows the locations of the encoded structural proteins that form the

virion structure (Adapted on 18th June 2011 from the website of The Department of

Molecular Virology and Microbiology at Baylor College of Medicine,

http://www.bcm.edu/molvir/index.cfm?pmid=16190)

5

1.4 Rotavirus Epidemiology

The median age of children who contract primary rotavirus infection is younger in

developing countries compared with developed countries (Bresee et al., 1999). In the

developing countries, rotavirus-infected infants are typically aged from six to nine

months (median age) and 80% are less than one year old. This is in contrast to the

children in the developed countries whose median age is from nine to fifteen months

with 65% of the infected infants aged less than one year. Every year, approximately

527,000 deaths and 2 million cases of hospitalisation occur worldwide among children

aged less than five years associated with rotavirus gastroenteritis. The developing

countries, especially those located in Africa and Asia, account for 90% of the deaths

resulting from rotavirus disease (Parashar et al., 2003; Glass et al., 2005; World Health

Organisation (WHO), 2007).

A hospital study conducted in 35 WHO-representing countries between 2001 and 2008

found that an average of 40% of diarrhoeal cases detected in the children aged less than

5 years old were due to rotavirus infection (Centers for Disease Control and Prevention,

2008). Moreover, the median detection rate of rotavirus-associated hospitalisation was

34% in the Americas, 40% in both Europe and the Eastern Mediterranean, 41% in

Africa, and 45% in South East Asia and the Western Pacific (WHO, 2002 and 2008).

Apart from the major gastrointestinal infection route, the virus also attacks the

circulatory and lymphatic systems (Blutt et al., 2003; Ramig, 2004).

As such, the overall global treatment costs of rotavirus infection are enormous and thus

create huge pressure on the health budget in most countries. Vaccination is an effective

measure to prevent rotavirus infection and this can be achieved by the biomedical study

of rotavirus infection (Gray et al., 2008).

6

1.5 The Rotavirus Non-structural Proteins

The non-structural proteins exist in the subviral particles with replicase activity and

function as chaperones to transport RNAs or proteins to the sites of RNA replication,

translation, assembly and genome segment packaging (Patton, 1986). NSP1, 2, 3, 5 and

6 interact with nucleic acid and play a role in the viral replication. NSP4 is specifically

responsible for the viral morphogenesis. A basic charge is present on most of the non-

structural proteins and this confers the proteins’ ability to bind RNA (Boyle and

Holmes, 1986; Hua et al., 1994; Kattoura et al., 1992; Mattion et al., 1992; Poncet et

al., 1993).

1.6 Rotavirus Non-Structural Protein 4 (NSP4)

NSP4 was first described as the viral enterotoxin that plays a distinct role in virus

assembly, morphogenesis and pathogenesis and induces an immune response during

rotavirus infection (Ball et al.,. 1996). In addition, NSP4 genes have been used to

classify rotaviruses into 14 distinct genotypes, E1 to E14 (Matthijnssens et al., 2011).

Initially, NSP4 is expressed as a 20 kilo Dalton (kDa) primary translation product and is

co-translationally glycosylated to a 29 kDa product before becoming the mature 28 kDa

transmembrane protein of the ER by oligosaccharide processing (Ericson et al., 1983;

Kabcenell and Atkinson, 1985). During rotavirus morphogenesis, the ER-localized

NSP4 (Estes et al., 2001) acts as an intracellular receptor by binding VP6, the outer

layer of DLPs (Taylor et al., 1996) and initiating the translocation of the immature

DLPs into the ER for addition of the VP7 and VP4 protein to form the outer layer and

the spike structure of the viral particles (Maass et al., 1990). The receptor activity of

NSP4 is localized to the C-terminal cytoplasmic domain (amino acids 161 to 175) of the

28 kDa protein (Au et al., 1993; Taylor et al., 1992; Taylor et al., 1993).

There are three hydrophobic domains designated as H1, H2 and H3 at the N-terminus of

NSP4 (Chan et al., 1988). H1 starts from residues 7-21 which contain two N-linked

mannose glycosylation sites at residues 8 and 18, H2 from residues 28-47 which is a

7

transmembrane domain and H3 from residues 67-85. Within H2, the residues 24–44

form a single transmembrane domain that remains in the lumen of the ER while residues

1-23 of H1 form a short ER luminal domain (Bergmann et al., 1989). Residues 45–175

of NSP4 form the cytoplasmic domain at the C terminus of NSP4 while it may also be

responsible for removing the transient envelope from budding particles (Suzuki et al.,

1984). Many studies have been performed on the cytoplasmic domain and revealed most

of the important biological functions of this region. The proximal membrane

destabilizing domain is located at amino acids (aa) 55-69. NSP4 oligomerizes into

dimers and tetramers with the tetramerization domain at aa 86-105. Other functional

regions are: (i) heptad repeat region spanning 95-137 which suggests a α-helical coiled-

coil oligomerization domain in this region; (ii) VP4-binding region located at aa 112-

148; (iii) intracellular calcium [Ca2+] binding domain and diarrhoea-inducing region

located at aa 114-135; (iv) interspecies variable domain at aa 135-146; (v) flexible

region at aa 139-175; (vi) extracellular matrix protein binding site at aa 87-145; (vii)

microtubulin binding site at aa 156-175; and (viii) double layer particle binding region

at aa 161-175 (Rajasekaran et al., 2008). However, Jagannath et al., (2006) reported that

these domains are overlapping based on the conformation, structure and function of N-

and C-terminal regions of NSP4. All the reported functional domains on the NSP4 were

depicted in Figure 1.2.

Figure 1.2: The non-structural NSP4 protein. The green shaded regions represent the

N-terminal hydrophobic domains, H1, H2 and H3. Two N-linked mannose

glycosylation sites (Y) are located at residues 8 and 18. The blue shaded region

8

represents the coiled coil domain. The red shaded region represents the double-layered

particle-binding region.

Pathological studies have shown the peptides derived from the NSP4 sequence

(NSP4114–135 and NSP4112-175) induced age and dose-dependent diarrhoea in young mice

after the NSP4 was introduced into the mice (Zhang et al., 2000). The C-terminal NSP4

fragment NSP4114-135 induced age-dependent diarrhoea in mice and promoted chloride

secretory currents across the intestinal mucosa without any histological impairment

(Ball et al., 1996; Horie et al., 1999). A signal transduction pathway that leads to

mobilization of intracellular calcium [Ca2+]i and chloride secretion was also noted

following the extracellular introduction of NSP4 into the murine intestinal mucosal or

crypt cells as well as into the human intestinal cell lines. (Ball et al,. 1996; Dong et al.,

1997; Morris et al., 1999). In another study using a rabbit model, diarrhoea could also

be induced by the direct NSP4 inhibitory effect on the Na_-D-glucose (SGLT1) and

Na_-L-leucine symporter activity across the intestinal brush border membrane vesicles

(Halaihel et al., 2000).

9

1.7 NSP4 Expression in Bacterial Cell Systems

1.7.1 Protein Expression Using Eschericia coli Systems

Eschericia coli (E. coli) has been widely used as a protein expression host due to its

well known genetic and physiological properties (Tabandeh et al., 2004). High yields of

different types of protein have been obtained by E. coli expression systems (Choi et al.,

2004). Protein expression in E. coli also incorporates only the basic molecular biology

laboratory techniques and thus it is a quicker and cost-effective approach for protein

expression in comparison with other expression systems. In the common E. coli

expression system, the regulation of protein expression is mainly controlled by two

main elements, namely lactose utilisation (Polisky et al., 1976) and T7 polymerase

(Studier and Moffatt 1986). In term of lactose utilization, lacUV5 promoter (Amann et

al., 1983) and its derivatives, tac (De Boer et al., 1983) and trc (Brosius et al., 1985)

promoter are induced by isopropyl-β-D-1-thiolgalactopyranoside (IPTG) to initiate the

protein expression. Upon the induction by IPTG as well, L8-UV5 lac which is a lac

promoter derivate triggers the translation of T7 polymerase and T7 polymerase later

mediates the downstream expression of the targeted proteins (Grossman et al., 1998;

Pan and Malcolm, 2000). A T7 polymerase-based system is applied in the BL21 (DE3)

strain and a large number of different proteins have been successfully expressed at a

high level by using this system (Studier and Moffatt, 1986).

Table 1.1 summarised the previous work that has been attempted on the expression of

NSP4 in E. coli. The genome of rotavirus strain SA11 (Both et al., 1983) has been used

as a template for amplification to obtain full length and partial gene fragments. The full-

length as well as the partial NSP4 peptides of rotavirus strain SA11 were expressed in

the E. coli strain BL21 (DE3) pLysS by using the plasmid pET17xb as the expression

vector (Browne et al., 2000). The host pLysS vector synthesizes T7 lysozyme can block

T7 RNA polymerase activity in terms to tightly control basal expression level of NSP4

toxic protein before induction by 1mM IPTG. Initially the DNA fragments that encode

the full-length as well as the partial domain of the NSP4 protein (NSP41-91, NSP448-91,

NSP448-175, NSP448-139, NSP486-175 and NSP486-139) were cloned into pBluescript-II. An

AUG start codon was located at the beginning of the 5’end with NdeI restriction site and

10

the stop codon was located at the 3’end with BamHI restriction site. Abundant

deoxyribonucleic acid (DNA)s of the targeted NSP4 peptides were obtained after serial

cloning experiments and finally the NSP4-DNA were inserted into the pET17xb

expression vector for NSP4 expression. As a result, high expression level of the

cytoplasmic domain (NSP486-175 and NSP486-139) but extremely poor expression level of

polypeptides containing the hydrophobic domains (full-length NSP4, NSP41-91, NSP448-

91, NSP448-175 and NSP448-139) was achieved suggesting the membrane destabilizing

domain was within this hydrophobic region from residue 48-91.

11

Table 1.1: History of the expression of NSP4s in Escherichia coli.

Researchers and Years Rotavirus strains Length of NSP4 Expression Outcome

Taylor et al., 1993 and

O’Brien et al., 2000

Simian SA11 Partial NSP450-175 and NSP485-175 Successful

Horie et al., 1999 Murine EW Full length NSP4 Unsuccessful

Horie et al., 1999 Murine EW Partial NSP486-175 in fusion with GST Successful

Browne et al., 2000 Simian SA11 Full length and partial (NSP41-91, NSP448-91,

NSP448-175, NSP448-139, NSP486-175 and NSP486-

139)

Successful only for

NSP486-175 and NSP486-

139

Enouf et al., 2001 Bovine RF Full length in fusion with maltose binding protein Successful

Sasaki et al., 2001 Group C human Ehime 9301 Partial NSP4 in fusion with GST with deletion on

residue 55-150

Successful

Mori et al., 2002 Turkey Ty-3 and Ty-1

Chicken Ch-1

Pigeon PO-13

Full length NSP4 in fusion with GST Successful

Mori et al., 2002 Pigeon PO-13 Partial NSP486-169, NSP4109-169 and NSP486-135 in

fusion with GST

Successful

Ray et al., 2003 Simian SA11, human 116E and

rhesus RRV

Full length NSP4 Unsuccessful

12

Ray et al., 2003 Human 116E and Simian SA11 Partial NSP483-175, Successful

Ray et al., 2003 Rhesus RRV Partial NSP478-175 Successful

Guzman et al., 2005 Human ADRV Full length NSP4 Successful

Sharifi et al., 2005 Human Wa Full length NSP4 Successful

Jagannath et al., 2005 Simian SA11 and bovine Hg18 Partial NSP448-175 Unsuccessful

Jagannath et al., 2005 Simian SA11 and bovine Hg18 Partial NSP458-175, NSP473-175, NSP486-175 and

NSP495-175

Successful

Hou et al., 2008 Human Wa 02K1 Partial NSP486-175 in fusion with GST Successful

13

Full-length NSP4 protein of murine rotavirus EW strain was failed to be expressed as a

glutathione S-transferase (GST) NSP4 fusion protein in E. coli (Horie et al., 1999).

Therefore, a GST-EW-NSP486-175 fusion protein was expressed in E. coli strain DH5α

with 0.5mM IPTG induction after transforming with recombinant plasmid pGEX-4T-1-

NSP486-175. The expression level of soluble fusion protein in E. coli was 100-fold lower

compared to the insoluble form. Approximately 5mg of the GST-EW NSP486-175 fusion

protein were obtained from 1 liter of bacterial cultures after soluble form protein was

purified.

Bovine rotavirus NSP4 gene was cloned into expression plasmid, pMAL-c2, as a

maltose binding protein-NSP4 fusion protein, pMAL:NSP4 and cloned into pET23b+ as

recombinant pET:NSP4. Both recombinant genes were expressed in E. coli BL21

(Enouf et al., 2001). Throughout protein expression, slight leakiness in the inducible

promoter and significantly reduced growth of the bacteria was observed after induction

and this suggested the toxicity of NSP4 against E. coli (Suter-Crazzolara et al., 1995). In

addition, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and

Western blotting could not detect any recombinant NSP4 derived from the expression

experiment.

Similarly, the partial NSP4 complementary DNA (cDNA) of Group C rotavirus strain

Ehime 9301 that encodes the truncated NSP4 peptide with the deletion of hydrophobic

region from residue 55-150 was inserted into the pGEX-4T-1 expression vector and

expressed in E. coli as GST fusion protein (Sasaki et al., 2001). GST was removed from

truncated NSP4 protein and was further purified to obtain 800µg protein from a 1.2 litre

of E. coli culture.

The full-length NSP4 proteins of pigeon (PO-13), turkey (Ty-3 and Ty-1), chicken (Ch-

1) rotavirus strains were successfully expressed as a GST fusion NSP4 proteins in E.

coli BL21 using the expression vector pGEX-2T plasmids (Mori et al., 2002). The

DNAs of the targeted NSP4 peptides were cloned in the pT7Blue T vector before being

ligated to the pGEX-2T vectors. The expressed full-length NSP4s possessed a molecular

weight of approximately 20 kDa after cleaving the GST from NSP4 protein by digesting

with thrombin proteinase. The protein was detected in SDS-PAGE coomasie brilliant

blue staining (CBB) gel and Western blotting with the aliquots of 20pmol and 0.1pmol

14

respectively. The expression of truncated NSP4-GST protein were made without

removing the GST as GST-PO-NSP486-169, GST-PO-NSP4109-169, GST-PO-NSP486-135

and GST- PO-NSP486-169∆112-133 with aliquots of 50pmol purified truncated protein were

detected on SDS-PAGE gel after CBB staining (Mori et al., 2002). Similarly, the C-

terminal cytoplasmic region of the NSP4 of simian SA11 strain was cloned into the

pGEX-2T vectors and expressed in fusion with GST proteins in E. coli DH5α cells

(Taylor et al., 1996; O’Brien et al., 2000).

Expression of full-length NSP4 was unsuccessful using plasmid pGEX-5X-1 expression

system. In contrast, truncated NSP4 proteins of the simian rotavirus strain SA11,

human rotavirus strain 116E and rhesus rotavirus strain RRV were expressed as

glutathione S-transferase (GST) fusion proteins in E. coli DH5α transformed with the

recombinant plasmid pGEX-5X-1 that carried the truncated NSP4 genes (Ray et al.,

2003). The expression of the truncated NSP4 proteins was induced by 0.1 mM IPTG.

The truncated regions of the NSP4s were amino acid residues 83-175 for SA11 (GST-

SA11-NSP483-175), 83-175 for 116E (GST-116E-NSP483-175) and 78-175 for RRV

(GST-RRV-NSP478-175). High level of expression ranging from 5 to 15 mg/L of

bacterial culture was achieved for the GST fusion NSP4 proteins of each strain. Each

fusion protein was visualised by SDS-PAGE as the approximate 38 kDa bands without

GST protein cleaved from NSP4 protein.

The gene 10 DNA of human rotavirus Wa strain was amplified by reverse transcriptase-

polymerase chain reaction (RT-PCR) and the resulting cDNA was cloned into the pBS-

KS(+) vector (Sharifi et al., 2005). The recombinant pBS-KS(+) vector was then use to

transform the E. coli TG1 strain. The NSP4 gene was later excised from the

recombinant pBS-KS(+) vector and inserted into the pQE30 expression vector. E. coli

D5α strain was then transformed with the recombinant pQE30 expression vector. The

expression system was regulated by the T5 promoter and was inducible by 1 mM IPTG.

The molecular mass of the full length NSP4 protein produced by the expression vector

was 20 kDa which showed antigenic and immunogenic property when 50µl of 1µmol

purified protein was inoculated intraperitoneally in neonate mice. Expression of Wa

NSP4 was low due to the rare codons in E. coli occurring at a frequency of 0.14% for

AGA (Argenine, Arg), 0.41% for AUA (Isoleucine, Ile) and 0.65% for ACA

15

(Threonine, Thr) compared with NSP4 gene messenger ribonucleic acid (mRNA) where

the codons occur at frequencies of 4.7%, 4.1% and 3.3% . However, the amount of

purified protein was higher under denaturing conditions rather than native conditions

where the quantity of the protein was not specified in the report (Sharifi et al., 2005).

Gene 10 of Group B rotavirus Adult Diarrhoea Rotavirus (ADRV) strain was amplified

by RT-PCR and the amplicon was cloned into the pCR2.1 vector. The full-length NSP4

gene was then inserted into the pET4215b expression vector and expressed in E. coli

BL21 (DE3) pLysS cells to produce 6xHis tagged NSP4 proteins (Guzman et al., 2005).

The protein expression was induced by 1mM IPTG with shaking for four hours at 37°C.

Protein was purified under denaturing conditions as the protein was found in the

insoluble fraction but the quantity was not specified. However, 500µl containing 200µg

of purified 6xHis tagged-NSP4-ADRV was injected intra muscularly into rabbit for

production of monospecific sera.

Modified NSP4 genes of both simian strain SA11 and bovine strain Hg18 that were

associated with residual deletion at N-terminal as well as with a few amino acid

substitutions were cloned into pET22(b+) expression vector and expressed in E. coli

BL21 (DE3) cells as N-terminal His tagged proteins by induction with 500 µM IPTG

for three hours (Jagannath et al., 2006; Rajasekaran et al., 2008). The resultant proteins

were highly soluble and were fractionated at a concentration of 2mg/ml from 3ml of

protein solution. NSP4 protein with the N-terminal deletion from the residue 1-47 could

not be expressed. The low expression level of the NSP4 protein with the N-terminal

deletion from the residue 1-57 produced low amount of the purified NSP4 protein.

Increasing protein expression level was found with the deletion of N-terminal amino

acids from aa 72.

NSP4 86-175 DNA from human rotavirus 02K1 strain of Wa was amplified and cloned

into plasmid pGEX-5X-1. The truncated protein was successfully expressed in E. coli as

a GST-NSP486-175 fusion protein which was further purified as NSP486-175 protein

without GST (Hou et al., 2008).

16

1.7.2 Protein Expression Using Lactococcus lactis System

NSP4 protein of the bovine rotavirus (RF strain) was successfully expressed in an

alternative bacterial system, Lactococcus lactis (L. lactis). The advantage of using this

expression system was that the expressed recombinant NSP4 proteins were free from

the interference by lipopolysaccharides as in E. coli expression system (Enouf et al.,

2001). DNA of the NSP4 genes was initially cloned into the pBS+ vector to produce

pNSP4. After serial cloning experiments, the NSP4 DNA was excised from the pNSP4

and cloned into the pSEC and pCYT vectors of L. lactis. Nuc genes exist in both

plasmids pSEC and pCYT and the NSP4 DNA was inserted in both plasmids to replace

the Nuc gene. pSEC plasmids differ from the pCYT plasmids in the way that pSEC

contains a gene that encodes the signal protein Usp45 which is fused to the inserted

NSP4 gene. The expression of NSP4 was induced by the introduction of nisin into the

culture of L. lactis that contained the pSEC and pCYT carrying the NSP4 gene. The

recombinant NSP4 was expressed extracellularly by the pSEC system and

intracellularly by the pCYT system. Enhanced expression level was observed in the

pSEC system and this might be that the extracellular expression of NSP4 could avoid

intracellular proteolysis. SDS-PAGE analysis showed that pSEC system produced 22

kDa (NSP4 attached to Usp45 protein), 20 kDa (mature form of rNSP4), 18 and 16.5

kDa (degradation products) bands whilst pCYT produced the similar 20 kDa and 18

kDa bands. The degradation products increased the difficulty in purifiying only the 20

kDa mature form of rNSP4.

17

1.8 NSP4 Expression in Insect Cell System

1.8.1 Protein Expression Using Recombinant Baculovirus-Sf9 Insect Cell Systems

The most common insect cell line used to express the NSP4 is Sf9 which is derived

from the fall army worm Spodoptera frugiperda (Sf). The insect cells are infected with

recombinant baculoviral vectors like Autographa californica multiple nuclear

polyhedrosis virus (AcMNPV) that carry the gene of the targeted protein to be

expressed (Davies, 1994). The protein expression is regulated by the viral polyhedrin

promoter (Janknecht et al., 1991; Zhu and Wang, 1996; Schmidt et al., 1998). Serum

free culture can be used to grow the insect cells (Agathos, 1996). However, some

problems are associated with this system, namely higher oxygen consumption and shear

sensitivity in growing the insect cells (Chalmers, 1996). In addition, protein expression

took a few days before the proteins were purified and thus exposed the protein longer to

the lytic actions of the degradative enzymes of cells (Bernard et al., 1996; Licari et al.,

1993). The main advantage of expressing proteins in insect cells is that the protein

undergoes N-glycosylation and this may confer the biological activity close to that of its

natural cognate proteins (Osterrieder et al., 1994; Toki et al., 1997; Soldatova et al.,

1998; Walravens et al., 1996 et al., 1996; Lopez et al., 1997).

The gene 10 of the SA11 rotavirus strain was inserted into the pAC461 transfer vector

(Tian et al., 1996). The Spodoptera frugiperda Sf9 insect cells were then coinfected

with the NSP4 gene-containing pAC461 transfer vector and the wild-type (wt)

baculovirus. Homologous recombination between the transfer vector and the polyhedrin

promoter gene within the baculovirus resulted in the insertion of the NSP4 gene into the

polyhedrin promoter gene. NSP4 was then expressed in the insect cells. SDS-PAGE

analysis indicated that full-length NSP4 protein was detected in double glycosylated

form (28 kDa), singly glycosylated form (26 kDa), and non-glycosylated form (20 kDa)

(Petrie et al., 1983). NSP4 oligomers ranging from 45-66 kDa were also expressed in

this system (Tian et al., 1996). However, low expression levels were noted in this

system probably due to inefficient gene recombination between the pAC461 transfer

vector and baculovirus DNA (Tian et al., 1994).

18

Purified gene 10 DNA of both the virulent and attenuated type of porcine of Gottfried

(OSU) virus was amplified by RT-PCR to obtain the cDNA of the NSP4 gene. The

NSP4 cDNA was then cloned into a “TA” vector and introduced into DH5α Max

Efficiency E. coli competent cells. Then the NSP4 cDNA was subcloned into the

baculovirus transfer vector pFastBac1 which was used to transfect the Spodoptera

frugiperda Sf9 insect cells for the expression of NSP4 (Ball et al., 1996; Mckinney et

al., 1987).

Similarly, transfection of Sf9 cells with the partial NSP4 genes that encoded amino acid

residues 112 to 175 of the NSP4 protein was achieved by the use of recombinant

pFastBac transfer vector carrying the gene 10. The truncated NSP4 peptide expressed

from the system was detected by SDS-PAGE as a 7 kDa band (Ball et al., 1996 and

Dong et al., 1997 and Tian et al., 1996).

A similar system was also used to express the 6xHis tagged NSP4 protein of four

different rotavirus strains, namely human Wa and Ito strains, porcine OSU strain and

simian SA11 strain (Rodriguez-Diaz et al., 2003). The NSP4 genes of the four strains

were inserted into the pDest10 vector and transformed into Max Efficiency DH10Bac E.

coli cells. The Sf9 insect cells were eventually transfected with the recombinant

pDest10 vector to express the NSP4 proteins. SDS-PAGE analysis revealed expression

of NSP4 monomers (21 kDa), glycosylated protein (28 kDa) and NSP4 oligomers.

NSP4Wa protein was mostly glycosylated, about half of NSP4OSU and NSP4Ito was

glycosylated and NSP4SA11 was less glycosylated.

19

1.9 NSP4 Expression in Mammalian Cell Systems

1.9.1 Protein Expression Using Dual-recombinant Vaccinia Virus System

NSP4 DNA was cloned into the vaccinia virus pTF29 transfer vector and the vector

underwent homologous recombination with the wild type NSP4 gene. The recombinant

pTF29 transfer vector then transformed with the vaccinia virus strain WR which was

used to transfect CV1 monkey kidney cells for the expression of NSP4 under the

regulation of T7 RNA polymerase by the recombinant virus (Elroy-Stein et al., 1989;

Newton et al., 1997).

1.9.2 Protein Expression in Caco-2 cells

NSP4 cDNA of the human rotavirus Wa strain, was amplified by RT-PCR and

subsequently cloned into the mammalian expression plasmid pCR3.1 carrying the

cytomegalovirus (CMV) RNA polymerase promoter gene (Ketha et al., 2000). The gene

insert was designed to express the NSP4 tagged with the influenza virus hemagglutinin

epitope. The recombinant plasmid pCR3.1 was then used to transfect the Caco-2 cells

for the expression of NSP4. The expressed NSP4 was immunoprecipitated by

hemagglutinin-specific monoclonal antibody and was found to be fully or partially

glycosylated.

1.9.3 Protein Expression in Rotavirus-infected MA104 and HT29 Cells

MA104 Monkey kidney cells and HT29 human intestine cells were infected with either

SA11 or the attenuated OSU rotavirus strains. The infected cells were then harvested

and lysed to collect the NSP4 protein derived from the virus growing within the cells.

The proteins were detected on SDS PAGE gel as 28 kDa and 26 kDa bands (Zhang et

al., 2000).

20

Conclusion

A protein does not fold properly when it becomes smaller and thus it is assumed that the

truncated NSP4 will not form its native structure as appears in the full-length NSP4

(Alberts et al., 1994). Hence, it is likely that the truncated NSP4 may differ from the

native NSP4 in term of its biological, functional and structural characteristics, like

enterotoxicity and antigenicity. This highlights the importance of producing full-length

NSP4 in large amounts for experimental purposes and expression of NSP4 in bacterial

cells is a relatively easy, cost effective and productive approach as has been extensively

documented in the literature. There are few reports of successful, high yield expression

of full-length human rotavirus NSP4. In this study, E. coli expression systems were

investigated for their suitability to express human rotavirus NSP4. In particular, the

NSP4 proteins of human strains RV4 and RV5 were the focus of this investigation as

these have not been previously expressed in a bacterial system.

21

CHAPTER 2: MATERIALS AND METHODS

2.1 Sources of Human Rotavirus NSP4 Genes Recombinant plasmids carrying NSP4 genes of the human rotavirus strains RV4 and

RV5 (Table 2.1) were previously prepared and kindly provided by the Enteric Virus

Research Group, Royal Children’s Hospital, Melbourne. Full-length cDNAs of rotavirus

genome segments 10 containing the NSP4 genes of RV4 and RV5 were amplified by

RT-PCR using primers described by Kirkwood and Palombo (1997). These cDNAs

were inserted into the mammalian expression vector pIND/V5-His-TOPO and then

transformed into E. coli JM109. The constructed recombinant plasmids (pIND-TOPO-

RV4-NSP4 and pIND-TOPO-RV5-NSP4) were the sources of NSP4 cDNA that were

used to construct new recombinant plasmids in this project.

Table 2.1: Human rotavirus strains which were the sources of NSP4 genes used in this study.

Human Rotavirus Strain Serotype [Genotype] (NSP4 Genotype)

RV4 G1 P1A[8] (E1) RV5 G2 P1B[4] (E2)

2.2 Culture of E. coli Strains Containing Human Rotavirus NSP4 Genes Glycerol stocks of E. coli JM109 (pIND-TOPO-RV4-NSP4) and E. coli JM109 (pIND-

TOPO-RV5-NSP4) were thawed on ice and a loopful of each stock was inoculated onto

a Luria-Bertani (LB) agar containing 100µg/ml of ampicillin (Sigma) (Table 7.1) to

obtain single colonies. The plates were incubated for 16-18 hours at 37°C.

22

2.3 Plasmid DNA Minipreparation Using Alkaline Lysis with SDS

Method

A single colony was picked from a LB plate and then inoculated into 2ml of LB broth

(Table 7.1) containing 100µg/ml ampicillin (Sigma). The LB broth culture was

incubated overnight at 37°C with shaking at 180 revolutions per minute (rpm). The

overnight bacterial culture was placed into a microcentrifuge tube, centrifuged at 11,000

rpm for three minutes and the supernatant was aspirated off. Two hundred microlitres of

1 X Tris EDTA (TE) buffer, pH8.0 with 100µg/ml RNaseA (Invitrogen) (Table 7.1) was

added and the bacterial pellet was resuspended thoroughly. Then, 200µl of fresh

Solution II (Table 7.1) was added and the solution was inverted gently. The suspension

was allowed to sit at room temperature (RT) for no more than five minutes, after which

200µl of Solution III (Table 7.1) was added to the side of the tube and the solution

immediately inverted three times gently. After that, tube was centrifuged at 11,000 rpm

for eight minutes and approximately 600µl of supernatant was removed and added to a

new tube.

After adding 150µl of phenol chloroform (Table 7.1) to the supernatant, the solution

was mixed by vortexing for five seconds before centrifuging at 11,000 rpm for three

minutes. Then, approximately 500µl of the upper aqueous layer was removed to a new

tube and mixed with 1ml of 100% ethanol and then let sit for five minutes at RT. After

centrifuging at 11,000 rpm for ten minutes, the ethanol was aspirated off and the pellet

was washed with 500µl of 70% ethanol. After a further centrifugation at 11,000 rpm for

five minutes, all the ethanol was aspirated off. This washing step was repeated twice.

23

Then the tube was air dried for ten minutes and the DNA pellet became transparent.

Finally, 40µl of 1X TE buffer was added to solubilise the plasmid DNA.

24

2.4 Restriction Enzyme Digestion The presence of NSP4 genes in the plasmids source were confirmed by enzyme

digestion with BamHI and XbaI. All reagents were added to a microcentrifuge tube and

incubated at 37°C for 1 to 2 hours as listed below.

Table 2.2: Reagents used in restriction enzyme digestion for confirming NSP4 genes in the provided sources of plasmids.

Reagents Volume 10X Multi-coreTM Buffer (Promega) 2.0µl Plasmid DNA (45.30ng/µl) 3.0µl BamHI (10U/µl) (Promega) 0.5µl XbaI(10U/µl) (Promega) 0.5µl Milli-Q water 14µl Total 20µl

25

2.5 Agarose Gel Electrophoresis Electrophoresis was conducted in 1% (w/v) agarose gels and in 1X Tris-Borate-EDTA

(TBE) buffer [5.4g Tris base (Sigma), 2.75g boric acid (Sigma), 0.3722g EDTA

(Calbiochem) per litre of milli-Q water] and heated in a microwave oven. Then, 0.5µl of

ethidium bromide (10mg/ml) (Sigma) was added to the molten agarose and poured into

a gel mould with an appropriate comb. After setting, appropriate amount of DNA

sample was mixed with 6X DNA loading dye (Ferrmentas), loaded into the gel,

electrophoresed for 40 minutes at 120 V and then viewed under ultraviolet (UV) light.

1KB ladder marker (Invitrogen) was used as to determine the size of DNA fragments.

26

2.6 Construction of a C-Terminal 6xHis tagged Fusion Protein Plasmid 2.6.1 Construction of a C-Terminal 6xHis tagged fusion protein in plasmid pQE60 The plasmids pIND-TOPO-RV4-NSP4 and pIND-TOPO-RV5-NSP4 contain the ORF

of the NSP4 genes without NcoI and BglII restriction sites, thus not allowing ligation

with pQE60. In this study, NcoI and BglII sites were introduced into the NSP4 ORFs by

designing a set of primers which specifically amplified the NSP4 ORFs and introduced

flanking NcoI/BglII sites. Thus, the modified NSP4 ORFs were ligated into NcoI and

BglII digested pQE60 creating C-terminal of 6xHis tagged recombinant plasmids,

namely pQE60-RV4-NSP4 and pQE60-RV5-NSP4.

2.6.2 Construction of a C-Terminal 6xHis tagged fusion protein in plasmid pET-28a(+) A similar experiment was carried out as above described (2.6.1) to create an RV5-NSP4

ORF with flanking NcoI and XhoI sites. The modified NSP4 ORFs was ligated into

NcoI and XhoI digested plasmid pET-28a(+) creating a C-terminal of 6xHis

recombinant plasmid, namely pET-28a(+)/RV5-NSP4.

27

2.6.3 Polymerase Chain Reaction (PCR) amplification of NSP4 ORFs PCR amplification of NSP4 ORF of human rotavirus RV4 and RV5 strains (with the

insertion of NcoI and BglII sites incorporated at the upstream 5’ end and and the

downstream 3’ ends, respectively) without a stop codon at the 3’ end was performed

using primer sets shown in Table 2.3.

Table 2.3: Sequences of forward and reverse primers for amplifying ORFs of

RV4/RV5 NSP4 genes with insertion of NcoI and BglII sites.

Forward Primer

Sequence (5’-3’) Target Gene

NSP4-NcoI 5’ ACCATGGATAAGCTTGCCGAC 3’ ORF of RV4 NSP4

RV5-NcoI 5’ ACCATGGAAAAGCTTACCGAC 3’ ORF of RV5 NSP4

Reverse Primer


RV4-BglII 5’ AGATCTCATGGATGCAGTCACTTC 3’ ORF of RV4 NSP4

RV5-BglII 5’ AGATCTCATCGCTGCAGTCACTTC 3’ ORF of RV5 NSP4 * Note: ACCATGG NcoI site

AGATCT BglII site

PCR amplification of NSP4 ORFs of human rotavirus RV5 strain (with the insertion of

NcoI and XhoI sites incorporated at the upstream 5’ end and and the downstream 3’

ends, respectively) without a stop codon at the 3’ end was performed using primer sets

shown in Table 2.4. These primers were kindly designed by Cameron Bentley and Scott

Gladman from Swinburne University of Technology, Melbourne, Australia.

Table 2.4: Sequences of forward and reverse primers for amplifying ORF of RV5 NSP4 genes with insertion of NcoI and XhoI sites. Forward Primer


C-T RV5 NcoI

5’ CCATGGAAAAGCTTACCGAC 3’ ORF of RV5 NSP4

Reverse Primer


C-T RV5 XhoI

5’ CTCGAGCATCGCTGCAGTC 3’ ORF of RV5 NSP4

* Note: CCATGG NcoI site

CTCGAG XhoI site

28

A PCR master mix was firstly made in a microcentrifuge tube containing 10X PCR

buffer, magnesium chloride, deoxynucleoside triphosphates (dNTPs) mix, Taq

polymerase, forward and reverse primers. Then a certain volume of master mix was

added to 37µl milli-Q water followed by 1.0µl template DNA. Template DNA was

replaced by milli-Q water in negative controls. All samples were subjected to PCR

using a Biometra Gradient instrument according to the PCR program as shown in

Tables 2.6 and 2.7.

Table 2.5: Volumes of a PCR mix for amplification of ORF of RV4 and RV5 NSP4 genes.

Reagents Volume 10X PCR Buffer (Promega) 5.0µl Magnesium Chloride (25mM) (Promega) 3.0µl dNTPs mix (2mM) (Promega) 1.0µl Forward Pimer (100ng/µl) 1.0µl Reverse Primer (100ng/µl) 1.0µl Template DNA (100ng) 1.0µl Taq Polymerase (1U/µl) (Promega) 1.0µl Milli-Q Water 37.0µl Total 50.0µl

Table 2.6: PCR conditions for amplification of ORF of RV4 and RV5 NSP4 genes using primer sets of NSP4-NcoI/RV4-BglII and RV5-NcoI/RV5-BglII.

Steps Temperature Time

Initial Denaturation 95◦C 2 min

Denaturation 95◦C 30sec 28

Annealing 50◦C 30sec cycles

Elongation 72◦C 1 min

Final elongation 72◦C 10 min

Hold 4◦C Pause

29

Table 2.7: PCR conditions for amplification of ORF of RV5 NSP4 genes using primer set of C-TRV5NcoI/C-TRV5XhoI.






Final elongation 72◦C 10 min

Hold 4◦C Pause

2.6.4 Gel Purification of PCR Products

Extraction of PCR product or DNA fragment from an agarose gel was done by using

DNA Isolation Kit (AppliChem). PCR product (45µl) was loaded and the DNA band

was excised from the gel under UV light and placed into a pre-weighed microcentrifuge

tube. The gel volume was calculated and 4.5 volumes of 6M sodium iodide (provided

by the Applichem kit,) and 0.5 volumes of 3M sodium acetate (pH5.2) (Table 7.2) were

added to the gel and incubated at 55°C for two to five minutes. The suspension was

mixed and incubated for another one to two minutes. Then, 6µl of glass powder

suspension (provided by the Applichem kit) was added and was mixed well before

incubating at 55°C for one to two minutes. The tube was centrifuged at maximum speed

for ten seconds, the supernatant was discarded and the glass pellet was rinsed with 50

volumes of wash buffer (provided by the Applichem kit) by pipetting back and forth

gently or flicking the tube. These washing steps were repeated three times. Finally, the

tube was centrifuged again to remove as much as wash buffer as possible. After that, the

glass pellet was resuspended in one to two volumes of the original glass pellet

suspension with distilled water. The DNA was eluted with incubated at 55°C for three

to five minutes with occasional mixing followed by spinning at maxiun speed for 30-45

seconds. The supernatant (eluted DNA) was transferred to a new tube.

30

2.7 Ligation and Transformation 2.7.1 Ligation of PCR Products with pGEM®-T Easy Vector

Taq polymerase PCR always produces A-tailed amplicons at both 5’ and 3’ ends which

are easily be ligated into the linear pGEM®-T Easy Vector which has T-tails at both

ends. Ligation reactions (Table 2.8) were set up for both PCR product ligation reaction

and negative control. The ligation mixtures were incubated for at least 16 hours at 4°C

and were used for transformation on the following day.

Table 2.8: Volumes of ligation mixtures for ligating PCR product and pGEM®-T

Easy Vector, including negative control.

PCR Product

Ligation

Reaction

Negative

Control

2X Rapid Ligation Buffer

(Promega)

5µl 5µl

pGEM®-T Easy Vector (50ng)

(Promega)

1µl 1µl

PCR Products (15ng/µl)) 3µl ---

T4 DNA Ligase (3U/µl)

(Promega)

1µl 1µl

Milli-Q Water --- 3µl

Total 10µl 10µl

31

2.7.2 Transformation of Recombinant Plasmids into E. coli Cells

E. coli JM109 high-efficiency competent cells (1 x 108 cfu/µg DNA) was firstly

prepared by the rubidium chloride method. Initially, E. coli JM109 cells were grown in

5ml LB broth at 37°C overnight and then 1ml of the overnight culture was transferred

into 100ml Psi broth (Table 7.2). The Psi broth culture was incubated at 37°C on a

platform shaker (230 rpm) with aeration for approximately two hours until the optical

densities reached 0.48 at 550nm. The culture was then incubated in ice for 15 minutes

and aliquoted into the round-bottom Falcon tubes. The Falcon tubes were centrifuged at

4500 x g for five minutes to obtain the cell pellet. The cell pellets were gently

resuspended with 40ml TfbI solution (pH5.8) (Table 7.2) and then incubated in ice for

15 minutes. The cell suspension was centrifuged again at 4500 x g for five minutes to

obtain the cell pellet. The final cell pellets were gently resuspended in 4ml TfbII buffer

(pH6.8) (Table 7.2) and incubated in ice for 15 minutes and stored at -70 to -80°C. The

competent JM109 cells were thawed on ice for use in the transformation protocol as

described below.

Ligation mixture (2µl) was added into a 1.5 ml tube containing 100µl of thawed JM109

competent cells and the cell suspension was flicked gently to mix it. The tube was

placed on ice for 20 minutes then placed in a water bath at exactly 42°C without shaking

for 45-50 seconds to heat-shock the cells. The tube was immediately returned to ice for

two minutes. Then, 950µl of RT Super Optimal Culture (SOC) medium (Table 7.2) was

added to the tube and incubated at 37°C for 1 to 1.5 hours with shaking. After that,

100µl of transformation culture reaction was spread onto LB agar plate containing

100µg/ml ampicillin, 0.5 mM IPTG (Table 7.2) and 80µg/ml 5-bromo-4-chloro-3-

indolyl-beta-D-galactopyranoside (X-Gal) (Table 7.2). The remaining 900µl of

transformation culture reaction was pelleted at 13,000 rpm for one minute, the

supernatant was discarded while the pellet was resuspended in 100µl of SOC medium to

become a concentrated cells mixture. The concentrated cells mixture was spread on

another labelled LB agar plate. To confirm the ampicillin was working, 100µl of thawed

JM109 competent cells only was spread onto an LB agar plate containing ampicillin,

IPTG and X-Gal. All plates were incubated for up to 24 hours at 37°C and single

colonies of transformants were observed on the following day.

32

2.8 Confirmation of NSP4 Genes in Recombinant Plasmid pGEM®-T

Easy by Restriction Enzymes Digestion and Gel Purification of NSP4

ORFs.

Selected white or pale blue colonies were subjected to alkaline lysis with SDS plasmid

mini preparation (section 2.3) to obtain recombinant plasmid pGEM®-T Easy-RV4-

NSP4 and pGEM®-T Easy-RV5-NSP4. The recombinant plasmid DNA was digested

with NcoI and BglII to release the NSP4 ORFs (with sticky ends of terminal NcoI and

BglII sites at the 5’ and 3’ ends, respectively). Similarly, the recombinant plasmid DNA

was digested with NcoI and XhoI to release the NSP4 ORFs (with sticky ends of

terminal NcoI and XhoI sites at the 5’ and 3’ ends, respectively) Enzyme digestion

mixes containing the mixture of all required reagents and volumes were prepared as

shown in Tables 2.9 and 2.10 and incubated at 37°C for 5 hours. The digested plasmid

DNA was electrophoresed in an agarose gel and the desired NSP4 gene fragments were

excised and subjected to gel purification as described in section 2.6.2.

Table 2.9: Volumes of an enzyme digestion reaction mix required to release ORF of NSP4 genes using NcoI and BglII.

Reagents Volume 10X Buffer D (Promega) 3.0µl Plasmid DNA (120ng/µl) 20.0µl NcoI (10U/µl) (Promega) 2.0µl BglII(10U/µl) (Promega) 2.0µl Bovine Serum Albumin (BSA) 1mg/ml (Promega)

3.0µl

Total 30.0µl

33

Table 2.10: Volumes of an enzyme digestion reaction mix required to release ORF of NSP4 genes using NcoI and XhoI.

Reagents Volume 10X Buffer D (Promega) 3.0µl Plasmid DNA (130ng/µl) 20.0µl NcoI (10U/µl) (Promega) 2.0µl XhoI (10U/µl) (Promega) 2.0µl Bovine Serum Albumin (BSA) 1mg/ml (Promega)

3.0µl

Total 30.0µl

34

2.9 Ligation of NSP4 ORFs into pQE60 and pET-28a(+) Expression Vectors

In order to construct a new recombinant expression plasmid, pQE60 vector (which

generates a 6xHis tag sequence at the C-terminus of the expressed protein) was chosen

in this project (Figure 2.1). The presence of NcoI and BglII restriction sites within the

multiple cloning site (MCS) of pQE60 allowed the NcoI and BglII digested RV4-NSP4

and RV5-NSP4 DNA fragments (without stop codons) to be ligated into the linearised

pQE60 vector. The resultant recombinant expression plasmids were designated pQE60-

RV4-NSP4 and pQE60-RV5-NSP4.

pET-28a(+) vectors carry an N-terminal His•Tag®/thrombin/T7•Tag® configuration

plus an optional C-terminal His•Tag sequence (Figure 2.2). Upstream of the C-terminal

His-tagged NSP4 gene amplicons is an NcoI site and downstream is an XhoI site.

Therefore, NcoI and XhoI digestion of pET-28a(+) vector will remove the N-terminal

His•Tag®/thrombin/T7•Tag® and leave only the C-terminal His•Tag sequence followed

by the stop codon. Digested RV5-NSP4 DNA fragments (without stop codon) will be

ligated into this linearised vector resulting in a recombinant expression plasmid

designated pET-28a(+)RV5-NSP4.

The restriction enzymes chosen for the above manipulations were based on: (i)

compatibility with pQE60/NSP4 and pET-28a(+)/NSP4 genes (ii) no internal restriction

sites in NSP4 gene and (iii) the correct reading frame followed by 6X histidine tag upon

insertion into pET-28a(+) and pQE60 vectors.

35

Figure 2.1: C-terminal 6xHis tag construct of pQE60 vector and the its multiple

cloning sites. (Sourced from QIAGEN QIAexpressionist Handbook, June 2003.)

36

Figure 2.2 – Cloning/expression region of the Novagen pET-28a(+) expression

vector. pET-28a(+) vector under the control of the T7 promoter is regulated by the lac

operator region. pET-28a(+) contains different multiple restriction enzymes in the

coding/expression region of and also an N-terminal His•Tag®/thrombin/T7•Tag®

configuration plus an optional C-terminal His•Tag sequence. Source from (Novagen –

Merck4Biosciences 2010).

http://www.merck-chemicals.com/chemdat/en_US/Merck-International-Site/USD/ViewProductDocuments-File?ProductSKU=EMD_BIO-69864&DocumentType=VMAP&DocumentId=%2Femd%2Fbiosciences%2Fvectormaps%2Fen-US%2FTB074VM.pdf&DocumentSource=GDS

http://www.merck-chemicals.com/chemdat/en_US/Merck-International-Site/USD/ViewProductDocuments-File?ProductSKU=EMD_BIO-69864&DocumentType=VMAP&DocumentId=%2Femd%2Fbiosciences%2Fvectormaps%2Fen-US%2FTB074VM.pdf&DocumentSource=GDS

37

2.9.1a Source of pQE60 Vector

The original pQE60 vector was not available. Instead, the vector was taken from E. coli

M15 [pREP4] containing recombinant plasmid pQE60-SA11-NSP2 (provided by Royal

Children’s Hospital) in which the ORF of the NSP2 gene of SA11 strain was inserted

into pQE60 at NcoI and BglII sites previously (John Patton, NIH, USA).

Glycerol stocks of E. coli M15 [pREP4] (pQE60-SA11-NSP2) were thawed on ice and

a loopful of bacteria culture was streaked onto LB agar containing 100µg/ml of

ampicillin and 25µg/ml of kanamycin (Table 7.2) to obtain pure single colonies. The

plate was incubated for 16-18 hours at 37°C. A single colony was cultured overnight in

2ml LB broth containing 100µg/ml of ampicillin and 25µg/ml of kanamycin. Next day,

the bacterial culture was subjected to plasmid DNA mini preparation using alkaline lysis

with SDS to obtain the plasmid DNA (section 2.3).

Given that the E. coli M15 also contains the helper plasmid, pREP4, in addition to

pQE60-SA11-NSP2, the DNA was cut with three enzymes - ApaI, NcoI and BglII- in

order to obtain the linearised vector pQE60, as ApaI cuts pREP4 but not pQE60. All

reagents used for this enzyme digestion were shown in Table 2.11. All required reagents

with appropriate volumes were added into a microcentrifuge tube and incubated in 37°C

waterbath for five hours. The linearised pQE60 DNA fragment gel was gel-

electrophoresed and purified as described in section 2.6.2.

Table 2.11: Volumes of an enzyme digestion mixture to obtain pQE60 vector from

E. coli M15[pREP4] containing recombinant plasmid pQE60-SA11-NSP2.

Reagents Volume 10X Buffer B (Promega) 3.0µl Plasmid pQE60-SA11-NSP2 DNA (90ng/µl)

20.0µl

ApaI (10U/µl) (Promega) 2.0µl NcoI (10U/µl) (Promega) 2.0µl BglII(10U/µl) (Promega) 2.0µl Bovine Serum Albumin (BSA) 1mg/ml (Promega)

1.0µl

Total 30.0µl

38

2.9.1b Source of pET-28a(+) Vector

Glycerol stocks of E. coli JM109 containing plasmid pET-28a(+) (Novagen) were

thawed on ice and a loopful of bacteria culture was streaked onto LB agar containing

30µg/ml of kanamycin (Table 7.2) to obtain pure single colonies. The plate was

incubated for 16-18 hours at 37°C. A single colony was cultured overnight in 10ml LB

broth containing 30µg/ml of kanamycin. The following day, the bacterial culture was

subjected to plasmid DNA mini preparation using alkaline lysis with SDS (section 2.3)

to obtain plasmid DNA.

All required reagents with appropriate volumes were added into a microcentrifuge tube

and incubated in 37°C waterbath for five hours. All reagents used for this enzyme

digestion were shown in Table 2.12. Plasmid pET-28a(+) DNA was cut with enzymes

of NcoI and XhoI and the linearised pET-28a(+) DNA fragment was excised from an

agarose gel purification as described in section 2.6.2.

Table 2.12: Volumes of enzyme digestion mixture to obtain linearised pET-28a(+) vector.

Reagents Volume 10X Buffer D (Promega) 3.0µl Plasmid DNA(90ng/µl) 20.0µl NcoI (10U/µl) (Promega) 2.0µl XhoI(10U/µl) (Promega) 2.0µl Bovine Serum Albumin (BSA) 1mg/ml (Promega)

3.0µl

Total 30.0µl

39

2.9.2a Ligation of linearised pQE60 vector and NSP4 ORFs

Purified linearised pQE60 vector and NcoI/BglII-digested ORFs of RV4-NSP4 and

RV5-NSP4 DNA fragments were ligated as described in Table 2.13.

Table 2.13: Reaction mixtures used to ligate pQE60 vector with RV4-NSP4 or

RV5-NSP4 ORF DNA fragments.

Ligation Reaction

Negative Control

2X Rapid Ligation Buffer (Promega)

5µl 5µl

NcoI and BglII cut pQE60 Vector (50ng/µl)

1µl 1µl

NcoI and BglII cut RV4-NSP4 or RV5-NSP4 (15ng/µl)

3µl ---

T4 DNA Ligase (1U/µl) (Promega) 1µl 1µl Milli-Q Water --- 3µl Total 10µl 10µl

40

2.9.2b Ligation of linearised pET-28a(+) vector and RV5-NSP4 ORFs

Purified linearised pET-28a(+) vector and NcoI/XhoI-digested RV5-NSP4 ORF DNA

fragment were ligated as described in Table 2.14.

Table 2.14: Reaction mixtures used to ligate pET-28a(+) vector with RV5-NSP4

ORF DNA fragment.

Ligation Reaction

Negative Control

10X Rapid Ligation Buffer (Promega)

1µl 1µl

NcoI and XhoI cut pET-28a(+) Vector (30ng/µl)

5µl 5µl

NcoI and XhoI cut RV5-NSP4 (15ng/µl)

3µl ---

T4 DNA Ligase (1U/µl) (Promega) 1µl 1µl Milli-Q Water --- 3µl Total 10µl 10µl

41

2.10 Transformation of Recombinant Plasmids into E. coli JM109 and


2.10a Transformation of recombinant plasmid pQE60-RV4-NSP4 and pQE60-

RV5-NSP4 into E.coli JM109.

Recombinant plasmids pQE60-RV4-NSP4 and pQE60-RV5-NSP4 were firstly

transformed into E. coli JM109, a non-expression host rather than E. coli M15 [pREP4],

the protein-expression host, because of the potential toxicity of the NSP4 protein.

Transformation was carried out as described in section 2.7.2; however, cells were plated

on media containing ampicillin only (without IPTG and X-Gal). A few transformants

were selected and grown in 2ml of LB broth containing 100µg/ml ampicillin and

incubated at 37°C overnight with shaking. After that, plasmid was isolated as previously

described (section 2.3) and was screened by NcoI and BglII digestion (section 2.8) for

the desired transformants containing the pQE60 vector with the inserted NSP4 genes.

2.10b Transformation of recombinant plasmid pET-28a(+)-RV5-NSP4 into E.coli

JM109.

Similarly, transformation of recombinant plasmid pET-28a(+)-RV5-NSP4 into E. coli

JM109 rather than the expression host, Rosseta-gami 2(DE3)pLysS5, was performed as

described above (2.10a) except that the media contained 50µg/ml of kanamycin only

and screening for the presence of NSP4 genes was carried out by NcoI and XhoI

digestion (section 2.8).

42

2.11 Transformation of Recombinant Plasmids into Expression Hosts

of E. coli M15(pREP4) and E. coli Rosseta-gami 2(DE3)pLysS5 and


2.11a Preparation of competent cells.

Competent E. coli M15[pREP4] and E. coli Rosseta-gami 2(DE3)pLysS5 cells were

prepared. E .coli M15[pREP4] was obtained from the Department of Biochemistry,

Monash University, Melbourne, while E. coli Rosseta-gami 2(DE3)pLysS5 was

purchased from Novagen. E. coli M15[pREP4] was cultured on LB agar containing

25µg/ml kanamycin, while E. coli Rosseta-gami 2(DE3)pLysS5 was cultured on LB agar

containing 34µg/ml of chloramphenicoland, 50µg/ml of streptomycin and 12.5µg/ml of

tetracycline (Table 7.2). All the plates were incubated at 37°C overnight.

A single colony of each strain was picked and inoculated into 10ml LB broth containing

appropriate antibiotics at 37°C overnight and then 1ml of the overnight culture was

transferred into 250ml of pre-warmed LB broth with appropriate antibiotics. The culture

was incubated at 37°C on a platform shaker (230 rpm) with aeration for 90-120 minutes

until the optical densities at 600nm reached 0.5. The cultures were then incubated on ice

for five minutes and aliquoted into the round-bottom Falcon tubes. The Falcon tubes

were centrifuged at 4000 x g for five minutes at 4°C to obtain the cell pellets. The cell

pellets were gently resuspended with 30ml of cold Tfb I solution (pH5.8, 4°C) (Table

7.2) and then incubated in ice for 90 minutes. The cells suspensions were centrifuged

again at 4000 x g for five minutes at 4°C to obtain the cell pellets. The final cell pellets

were gently resuspended in 4ml TfbII buffer (pH6.8) (Table 7.2) incubated on ice for 15

minutes and stored at -80°C. The competent E. coli M15[pREP4] and E. coli Rosseta-

gami 2(DE3)pLysS5 cells were thawed in an ice water bath afterwards for use in the

transformation step.

43

2.11b Transformation of recombinant plasmids into expression hosts.

Plasmids pQE60-RV4-NSP4, pQE60-RV5-NSP4 and pET-28a(+)/RV5-NSP4 were

transformed into competent expression hosts, E. coli M15[pREP4] and E. coli Rosseta-

gami 2(DE3)pLysS5, using ampicillin and kanamycin selection, respectively, as detailed

below.

One microlitre of the recombinant plasmid (2ng/µl) was added to a 1.5ml tube

containing 100µl of thawed competent cells and the cell suspension was mixed by

flicking the tube gently. The tube was placed on ice for 20 minutes then placed in a

water bath at exactly 42°C without shaking for 45-50 seconds to heat-shock the cells.

The tube was returned to ice for two minutes, then, 950µl of RT SOC medium (Table

7.2) was added and the mixture incubated at 37°C for 1-1.5 hours with shaking. After

that, 100µl of transformation culture reaction was spread onto LB agar plate containing

the appropriate antibiotic. The remaining 900µl of transformation culture reaction was

pelleted at 13,000 rpm for one minute and the supernatant was discarded while the pellet

was resuspended in 100µl of SOC medium to become a concentrated cell mixture. The

concentrated cells mixture was spread on another agar plate. For the negative control, all

the steps were same except that the isolated recombinant plasmid was replaced with 1µl

of milli-Q water. All plates were incubated for 16-24 hours at 37°C and single colonies

of transformants were observed on the next day.

The transformants were then screened by ApaI, NcoI and BglII restriction enzyme

digestion and plasmids were isolated as described in section 2.3 to obtain the desired

transformants containing the pQE60 vector with the NSP4 genes insert. Transformants

containing the pET-28a(+) vector with the RV5-NSP4 genes were identified by

digestion with NcoI and XhoI. All reagents used for these enzyme digestions were

shown in Tables 2.15 and 2.16.

44

Table 2.15: Enzymes Digestion Mixture used to confirm the presence of pQE60

vector containing RV4-NSP4 or RV5-NSP4 DNA fragments.

Table 2.16: Enzymes Digestion Mixture used to confirm the presence of pET-

28a(+) vector containing RV5-NSP4 DNA fragments.

Reagents Volume 10X Buffer B (Promega) 2.0µl BSA 1mg/ml (Promega) 2.0µl Plasmid DNA (80ng/µl) 3.0µl ApaI (10U/µl) (Promega) 0.5µl NcoI (10U/µl) (Promega) 0.5µl BglII(10U/µl) (Promega) 0.5µl Milli-Q water 11.5 µl Total 20µl

Reagents Volume 10X Buffer D (Promega) 2.0µl BSA 1mg/ml (Promega) 2.0µl Plasmid DNA (80ng/µl) 3.0µl NcoI (10U/µl) (Promega) 0.5µl XhoI(10U/µl) (Promega) 0.5µl Milli-Q water 11.5 µl Total 20µl

45

2.12 DNA Sequencing Analysis

The presence of the NSP4 ORFs in the recombinant pQE60 and pET-28a(+) plasmids

was confirmed by determining the NSP4 gene sequences and comparing these with the

respective sequences from the National Center for Biotechnology Information (NCBI)

database.

2.12.1 PCR for DNA Sequencing

A set of pQE-60 sequencing primers was synthesised by Qiagen and used for

sequencing of the NSP4 genes as follows:

Primer for promoter region designated QE1

(5’ CCCGAAAAGTGCCACCTG 3’)

Primer for reverse sequencing designated QE3

(5’ GTTCTGAGGTCATTACTGG 3’)

For recombinant plasmid pET-28a(+)/RV5-NSP4, the primers used in DNA sequencing

were the forward and reverse primers as described in Table 2.4.

46

PCR sequencing reactions were set up in a microcentrifuge tube as shown in Table 2.17.

Table 2.17: Sequencing reaction mixes in DNA sequencing PCR for recombinant plasmids pQE60-RV4-NSP4, pQE60-RV5-NSP4 or pET-28a(+)/RV5-NSP4.

Reagents Volume 5X BDT Dilution Buffer 2.75µl Only one primer (4.5pmol) 2.50µl Recombinant plasmid (pQE60-RV4-NSP4, pQE60-RV5-NSP4 or pET-28a(+)/RV5-NSP4) (150ng) 12.25µl BDT Ver.2.1 Ready Mix 0.50µl Total 20.00µl

All samples were subjected to PCR in a thermocycler (Biometra Gradient) according to

the conditions shown in Table 2.18.

Table 2.18: PCR Conditions for DNA sequencing of recombinant plasmids pQE60-RV4-NSP4, pQE60-RV5-NSP4 or pET-28a(+)/RV5-NSP4.






Hold 15◦C Pause

47

2.12.2 Cleaning Up the PCR Products

The magnesium sulphate protocol was performed to clean up sequencing reactions

before sending them to the Australian Genome Research Facility Ltd (AGRF) for DNA

sequencing. PCR products were equilibrated to room temperature before adding 75µl of

0.2mM freshly prepared magnesium sulphate (0.0024g of magnesium sulphate (Sigma)

was dissolved in a final volume of 100ml of milli-Q water). The mixture was vortexed

and allowed to sit at room temperature for at least 15 minutes followed by

centrifugation at 14500 rpm for 15 minutes. The tube was gently inverted over paper

towels for three minutes and then air dried for 30 minutes until it became dry. The tube

was wrapped with aluminium foil and sent to AGRF for sequencing with ABI Prism

BigDye Terminator.

48

2.13 Expression and Purification of NSP4 Protein from E. coli M15

[pREP4] pQE60-NSP4.

Three steps were involved in expression and purification of NSP4 protein in E. coli

M15:

1) E. coli culture growth for preparative purification.

2) Preparation of cleared E. coli lysates under native conditions.

3) Batch purification of 6xHis-tagged proteins from E. coli under native conditions

by Ni-NTA (Nickel-Nitrilotriacetic Acid) affinity purification.

E. coli M15 [pREP4] containing recombinant plasmid pQE60-SA11-NSP2 was used as

positive control to express NSP2 protein in this study. E. coli M15 [pREP4] containing

recombinant plasmid pQE60-RV4-NSP4 and pQE60-RV5-NSP4 without IPTG

induction were used as non-induced negative controls.

2.13.1 E. coli Culture Growth for Preparative Purification

A single colony of E. coli M15[pREP4] containing recombinant plasmids pQE60-RV4

or RV5-NSP4 or pQE60-SA11-NSP2 was inoculated into a culture flask containing

15ml LB broth with ampicillin (100µg/ml)and kanamycin (25µg/ml) and was shaken at

100rpm overnight at 37°C. The overnight bacterial culture was poured into 200ml of

pre-warmed LB broth containing appropriate antibiotic and was then grown further at

37°C with shaking (150 rpm) until reaching an OD600 of approximately 0.7.

Protein expression was then induced by adding 1M IPTG (Table 7.2) to a final

concentration of 1mM and the IPTG-induced bacterial culture was grown for another

eight hours. Nine non-IPTG-induced bacterial cultures and another nine IPTG-induced

bacterial cultures for the expression of NSP2, RV4-NSP4 and RV5-NSP4 protein

respectively were used in the study. Each of the nine non-IPTG-induced and the nine

IPTG-induced bacterial cultures was grown for different periods, (0, 1, 2, 3, 4, 5, 6, 7

49

and 8 hours) after the addition of IPTG into the bacterial culture. The cell intensity at

OD600 and the cell viable count (as described later in section 2.13.2) of the bacterial

culture were determined prior to the non-IPTG induction (0 hour) and at hourly intervals

of 1, 2, 3, 4, 5, 6, 7 and 8 hours following the IPTG induction.

Then, the E. coli cells were harvested by centrifugation at 4000 x g for 30 minutes at

4°C. Th cell pellet was frozen and stored overnight at -20°C for the preparation of

cleared E. coli lysates under native conditions as described later in section 2.13.3.

2.13.2 Measurement of the Cell Intensity at OD600 and the Viable Cell Counting

At every hourly interval, 1ml of E. coli culture was taken and the cell intensity at OD600

was measured by a spectrophotometer using appropriate diluent solution as a blank. The

optical densities of cells were analysed by the SPSS statistical software.

In addition, another 100µl of E. coli culture was aliquoted into a microcentrifuge tube

containing 900µl LB broth, resulting in a 1:10 dilution. The bacterial sample was mixed

well with diluent solution (LB broth), and then 10-fold serially diluted until 10-4 dilution

was achieved. Samples (100µl) from each of the four dilutions were then spreaded onto

an LB/ampicillin (100µg/ml)/kanamycin (25µg/ml) agar plate and incubated at 37°C for

18 hours. The numbers of resulting bacterial colonies were determined and the cell

viable count was analysed by the SPSS statistical software.

50

2.13.3 Preparation of Cleared E. coli Lysates under Native Conditions

Cell pellets (prepared as described in 2.13.1) were thawed for 15 minutes on ice before

resuspending with 2ml lysis buffer (Table 7.3). Freshly prepared lysozyme (Table 7.3)

was then added to 1mg/ml and cells were incubated on ice for 30 minutes. Cells were

sonicated on ice using six 10 second bursts at 200 to 300 W with a 10 second cooling

period between each burst. RNase A (Table 7.3) and DNaseI (Table 7.3) were added to

a final concentration of 10µg/ml and 5µg/ml, respectively, and incubated on ice for 10-

15 minutes to dissolve RNA and DNA. Then, lysates were centrifuged at maximum

speed for 30 minutes at 4°C to pellet the cellular debris while the supernatant which

contained the cellular protein, including the desired 6xHis tagged-RV4 or RV5-NSP4

proteins, was transferred to a new tube. The cleared E. coli lysates were used for the

next protein purification step.

2.13.4 Batch Purification of 6xHis tagged-NSP4 Proteins under Native Conditions

The Ni-NTA (Nickel-Nitrilotriacetic Acid) affinity purification method was used to

purify the desired protein. A 50% Ni-NTA slurry was firstly prepared from Ni-NTA

resin stock (Qiagen) by pre-equilibrating in lysis buffer (4ml cleared lysate require 1ml

of 50% Ni-NTA slurry). Ni-NTA resin (1 ml) was placed in a microcentrifuge tube and

centrifuged using five second pulses. The supernatant (alcohol) was removed and the

remaining resin was resuspended with an equal volume lysis buffer (approximately

500µl) to produce a 50% Ni-NTA slurry. This step was repeated three times, and then

the 1ml 50% Ni-NTA slurry was shaken gently at 4°C for 10 minutes. Then, 4ml of

cleared lysate was added to 1ml of 50% Ni-NTA slurry and was mixed on rotary shaker

for 30-60 minutes at 4°C. The mixture was centrifuged at 1500rpm for five minutes to

pellet the Ni-NTA resin and the supernatant was discarded. The Ni-NTA resin and

6xHis tagged-NSP4 proteins complex was washed with 10ml wash buffer (Table 7.3)

and was centrifuged at 1500 rpm for 5-10 minutes. The supernatant was discarded and

these washing steps were again repeated four to six times.

51

Finally, the 6xHis tagged-NSP4 protein was eluted from the resin by resuspending the

resin/protein complex in 1ml elution buffer (Table 7.3) and was shaken gently for 10

minutes. The 6xHis tagged-NSP4 protein was obtained in the supernatant (first elution

or first eluate) after centrifugation at 1500 rpm for five minutes. The second and third

protein elutions were obtained by adding elution buffer to the pelleted resin follow by

shaking and cemtrifugation as the above described. Eluate (15µl) was added to 3µl of 5x

sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer

(Table 7.3) containing 1µl of 1M dithiothreitol (DTT) (Table 7.3) and loaded on SDS-

PAGE gel for analysis.

2.14 Detection of Recombinant 6xHis tagged Proteins using SDS-

PAGE

Protein samples were loaded onto a SDS-PAGE gel and electrophoresed for

approximately 2 hours at 80 V in 1 X Tris-glycine electrophoresis buffer (Table 7.4)

using a Tris-glycine SDS-polyacrylamide gel electrophoresis system. 12% resolving gel

was made with 5% acrylamide mix (Bio-Rad), 0.2M of tris-hydrochloride (tris-HCl)

(pH8.8) (Table 7.4), 0.1% of SDS buffer, 0.1% of fresh ammonium persulphate (Table

7.4) and 0.002ml of N, N, N' N'- Tetramethylethylenediamine (TEMED) (Bio-Rad)

were mixed together to make up a resolving gel. A 5% stacking gel was made with 5%

acrylamide mix (Bio-Rad), 0.1M tris-HCl (pH6.8), 0.1% of SDS buffer, 0.1% of fresh

ammonium persulphate and 0.002ml of TEMED (Table 7.4). Following electrophoresis,

the gel was fixed with Coomassie Brilliant Blue R-250 staining solution (Table 7.4) by

gently shaking on a rocker platform overnight. On the following day, the stain was

removed from the gel by soaking in destaining solution (Table 7.4) until protein bands

were visible. Gel images were captured using a Bio-Rad imaging system. The

PageRuler™ prestained marker (Fermentas) was used as the molecular weight size

standard.

52

2.15 Western Blot Detection of Purified Polyhistidine Fusion Proteins

using Polyclonal Anti-SA11 Rabbit Sera

Three pieces of filter paper pre-soaked with Bjerrum and Schafer-Nielsen Transfer

Buffer containing SDS (Transfer Buffer) (Table 7.5) were placed onto platinum anode

of a Trans-Blot SD cell (Bio-Rad). Polyvinylidene Fluoride (PVDF) transfer membrane

(Table 7.5) was placed on top of the filter paper. Then, an SDS-PAGE gel (post-

electrophoresis) was equilibrated with Transfer Buffer and covered by another three

pieces of pre-soaked filter paper. The proteins in the gel were transferred to the PVDF

membrane for 30 minutes at 10V at 0.13 Amps. Then the PVDF membrane was

incubated in freshly prepared blocking reagent (Table 7.5) for one hour at RT. The

membrane was washed in phosphate-buffered saline-0.1% Tween 20 buffer (PBS-0.1%

T20) (Table 7.5) for five minutes followed by two more washes for 15 minutes each. 2ml

of 1:1000 diluted anti-SA11 rabbit polyclonal antibody provided by Dr Carl Kirwood

from Royal Children Hospital, Melbourne, Australia (Table 7.5) was incubated with the

membrane overnight at RT on a platform rocker.

On the following day, the membrane was washed twice in excess PBS-0.1% T20 buffer

as described above. Then, the membrane was incubated with 5ml of a 1:5000 dilution of

secondary antibody, horseradish peroxidase-anti rabbit IgG (Amersham Bioscience)

(Table 7.5) for 2.5 hours at RT. The membrane was again washed as described above.

Then, excess wash buffer was removed and the membrane and incubated (protein-side

up) with 6ml of detection reagent (Amersham Bioscience) (Table 7.5) for exactly one

minute only. Excess detection reagent was drained from the membrane before

transferred to a press seal bag with all air bubbles removed. Images were captured by a

Bio-Rad chemiluminescence imaging system. PageRuler™ prestained marker

(Fermentas) was use as the protein marker.

53

2.16 Western Blot Detection of Polyhistidine Fusion Protein in E. coli

M15 Cleared Lysates and Purified Polyhistidine Fusion Protein by

Monoclonal Anti-polyhistidine Clone HIS-1

E. coli cleared lysate and purified recombinant 6xHis tagged fusion protein samples

were subjected to Western blotting to detect the presence of polyhistidine-tagged fusion

proteins. Protein samples (16µl) were mixed with 4µl of 5 x SDS-PAGE buffer

containing 250 mM DTT (2.5µl of 1M DTT stock) and 8µl of E. coli cleared lysate was

mixed with 2µl of 5 x SDS-PAGE buffer containing 250 mM DTT before loading onto

a SDS-PAGE gel. The gel was then subjected to Western blotting as described in

section 2.15, with the exception that the primary antibody was changed to 3ml of a

1:3000 dilution of Monoclonal Anti-polyHistidine Clone HIS-1 antibody (Sigma)

(Table 7.5). PageRuler™ prestained marker was use as the protein marker.

54

2.17 Expression and Purification of NSP4 Protein using the Rosetta-

gami 2(DE3)pLysS5 System

Non-induced Rosseta-gami 2(DE3)pLysS5 containing the recombinant plasmid pET-

28a(+)/PINB was used as the negative control and as an positive control after IPTG

induction to express PINB protein. Rosseta-gami 2(DE3)pLysS5 containing the

recombinant plasmid pET-28a(+)/RV5-NSP4 was used to express the protein of

interest.

2.17.1 E. coli Culture Growth Under Different Conditions.

A single colony was inoculated into a culture flask containing 5ml Terrific broth

containing 50µg/ml streptomycin, 12.5µg/ml tetracycline, 34µg/ml chloramphenicol

and 30µg/ml kanamycin and was shaken at 200 rpm overnight at 37°C. The overnight

bacterial culture was added to 50ml of pre-warmed Terrific broth containing 1% glucose

and appropriate antibiotics. In a separate experiment, 5ml of overnight bacterial culture

was added 50ml of pre-warmed Terrific broth without glucose. The cultures were grown

for about six to seven hours at 37°C with shaking at 250 rpm until OD600 0.7-0.9 was

reached. The 50ml culture was divided into two culture flasks which served as the non-

induced control and induced cultures. Protein expression was then induced by adding

IPTG to a final concentration of 0.5 mM and cultures were incubated at 28°C. The

culture without glucose was grown for a further five hours at 28°C, while the broth

culture with glucose was incubated overnight. The OD600 of the cultures were

determined prior to the addition of IPTG induction (0 hour), and at the hourly intervals

of 1, 2, 3, 4, 5 and overnight following IPTG induction. To monitor protein expression,

time-course analysis was performed by taking 1ml of bacterial culture at 0, 1, 2, 3, 4 and

5 hours and centrifuging at 13,000 rpm for one minute. Cell pellets were resuspended in

100µl of 5x SDS-PAGE sample buffer and was boiled for 10 minutes. Samples (10µl)

were analysed by SDS-PAGE (section 2.14). The remaining cells were harvested by

centrifugation at 4000 x g for 30 minutes at 4°C after five hours or overnight induction.

The cell pellets were frozen at -20°C for the preparation of cleared E. coli lysates

(section 2.17.2).

55

A similar experiment was carried out as described above with some modifications. LB

broth was used instead of Terrific broth without adding any glucose. Protein expression

was then induced by addition of IPTG to a final concentration of 0.8 mM and the

culture was grown for five hours at 37°C. To monitor protein expression, time-course

analysis was performed by taking 1ml of bacterial culture at 0, 1, 2, 3, 4 and 5 hours and

centrifuging at 13,000 rpm for one minute.

2.17.2 Preparation of Cleared E. coli Lysates under Denaturing Conditions

Cell pellets from 15ml bacterial culture were thawed for 15 minutes on ice before

resuspending in 1-1.5ml of denaturing lysis buffer (Table 7.4) thoroughly. Cells were

resuspended by vortexing gently for 15 to 60 seconds. Then, cell lysates were

centrifuged at maximum speed for 30 minutes to pellet the cellular debris while the

supernatant, containing the cytoplasmic proteins including the desired 6xHis-tagged

RV5-NSP4 protein, was collected in a new tube. This cleared E. coli lysates was ready

for protein purification (section 2.17.3). SDS-PAGE analysis of cleared lysate was

performed by mixing10µl of cleared lysate with 10µl of 5x SDS-PAGE sample buffer

and boiled for 10 minutes, after which 15µl was loaded into an SDS-PAGE (section

2.14).

56

2.17.3 Purification of recombinant proteins by immobilized metal ion affinity

chromatography (IMAC) “pull down” method.

Ni-NTA slurry (50% w/v) was prepared from Ni Sepharose 6 Fast Flow resin stock (GE

Healthcare) by pre-equilibrating in denaturing lysis buffer. The resin (100µl) was placed

in a microcentrifuge tube and “pulse” centrifuged at 1000 rpm for one minute. The

supernatant (alcohol) was removed and the remaining resin was resuspended with an

equal volume of lysis buffer (about 50µl) to become a 50% Ni-NTA slurry. This step

was repeated three times. Cleared lysate (1ml) was added and mixed on a rotary shaker

for 40 minutes at 4°C. The resin/protein complex was washed with 6ml of wash buffer

(Table 7.4) and was centrifuged at 1500 rpm for two minutes. The supernatant was

discarded and these washing steps were repeated six times. Finally, as much as possible

of the supernatant was removed followed by the addition of 50µl of 5x SDS-PAGE

sample buffer. The sample was boiled for 10 minutes then centrifuged at 14,500 rpm for

five minutes. Twenty microlitres of supernatant (collected near the top part of resin) was

loaded on an SDS-PAGE gel for analysis as described in section 2.14.

57

CHAPTER 3: RESULTS

3.1 Confirmation of the Source Vector Containing NSP4 Genes by

Enzymes Digestion

DNA of the recombinant plasmids, pIND/V5-His-Topo-RV4-NSP4 and pIND/V5-His-

Topo-RV5-NSP4, were analysed by performing enzyme digestion using BamHI and

XbaI. Plasmid pIND/V5-His-Topo-RV4-NSP4 was digested into two fragments, one of

620bp in length which contained the RV4 NSP4 and another of approximately 5000bp.

In contrast, plasmid pIND/V5-His-Topo-RV5-NSP4 released three fragments of which

the fragments of 470bp and 150bp were derived from the RV5 NSP4 gene due to the

presence of an internal BamHI restriction site within the NSP4 ORF. The other fragment

(approximately 5000bp) represented the remainder of the plasmid. The NSP4-derived

fragments are depicted in Figure 3.1 and restriction digests are shown in Figure 3.2.

Size of DNA fragments after enzyme digestion

pIND/V5-His-Topo /-------ORF NSP4-------------/ RV4-NSP4 620bp /-------ORF NSP4-------------/ pIND/V5-His-Topo RV5-NSP4 470bp & 150bp

BamHI *BamHI XbaI

(internal enzyme digestion site) Figure 3.1: RV4 and RV5 NSP4 ORFs present in pIND/V5-His-Topo-NSP4

plasmids showing restriction sites for enzymes BamHI and XbaI.

58

1 2 3

Figure 3.2: Agarose gel electrophoresis of BamHI and XbaI restriction enzyme

digestions of pIND/V5-His-Topo-RV4-NSP4 and pIND/V5-His-Topo-RV5-NSP4.

1KB DNA ladder marker (Invitrogen) (lane 1) and DNA fragments of pIND/V5-His-

Topo-RV4 with the expected NSP4 fragment of 620bp (lane 2) and pIND/V5-His-

Topo-RV5 with the expected NSP4 fragment of 470bp (lane 3). Another DNA fragment

of 150bp in length for pIND/V5-His-Topo-RV5 was not visible on the gel. The largest

DNA fragments in lanes 2 and 3 are the plasmid pIND/V5-His-Topo remnants with the

expected size of approximately 5000bp.

620bp

470bp 506bp

396bp

5000bp 5090bp 4072bp

1080bp

59

3.2 PCR Amplification of the NSP4 ORFs to Introduce 5’-NcoI and 3’-

BglII Restriction Sites A forward primer containing an 5’-NcoI site and a reverse primer containing an 3’-BglII

site with deletion of stop codon were designed in this study to amplify the ORF of NSP4

genes from the pIND/V5-His-Topo-RV4-NSP4 and pIND/V5-His-Topo-RV5-NSP4 as

illustrated in Figures 3.3 and 3.4.

NcoI site was incorporated in the designed forward primers

5’ ACC ATGGATAAGCTTGCCGAC 3’ ---- NSP4-NcoI Forward Primers 5’ ACC ATGGAAAAGCTTACCGAC 3’ ---- RV5-NcoI

Reverse RV4-BglII --- 3’ CTTCACTGACGTAGGTACTCT AGA 5’ Primers RV5-BglII --- 3’ CTTCACTGACGTCGCTACTCT AGA 5’

BglII site was incorporated in the designed reverse primers with deletion of stop codon * Note: ORF of NSP4 genes without NcoI and BglII sites TAA and TGA are stop codons Figure 3.3: NSP4 ORFs were modified by insertion of NcoI sites upstream and BglII

sites downstream of the NSP4 sequences when amplified by the forward and reverse

primers.

RV4 5’ ATGGATAAGCTTGCCGACCTCAACTAC……………… GTCAGAAGTGACTGCATCCATGTAA 3’ RV5 5’ ATGGAAAAGCTTACCGACCTCAATTAC………………AAAAGAAGTGACTGCAGCGATGTGA 3’

60

1 2 3 4

Figure 3.4: Agarose gel electrophoresis of PCR products obtained from

amplification of NSP4 ORFs in pIND/V5-His-Topo-RV4-NSP4 and pIND/V5-His-

Topo-RV5-NSP4 with forward primers (NcoI-NSP4, RV5-NcoI) and reverse

primers (RV4-BglII, RV5-BglII). 1KB Invitrogen DNA ladder marker (lane 2) and

negative control (lane 4). PCR amplicons of RV4-NSP4 (lane 1) and RV5-NSP4 (lane

3) were each 533bp.

533 bp (amplicon)

506 bp (marker)

1080 bp (marker)

61

3.3 PCR Amplification of the RV5 NSP4 ORF to Introduce 5’-NcoI

and 3’-XhoI Restriction Sites A forward primer containing an 5’-NcoI site and a reverse primer containing an 3’-XhoI

site with deletion of stop codon were designed in this study to amplify the NSP4 ORF

from pIND/V5-His-Topo-RV5-NSP4 as illustrated in Figure 3.5 and 3.6.

NcoI site was incorporated in the designed forward primers

5’ CC ATGGAAAAGCTTACCGAC 3’ ---- CTRV5NcoI Forward primer

Reversve primer --CTRV5XhoI 3’ CTGACGTCGCTACGAG CTC 5’

XhoI site was incorporated in the designed reverse primer with deletion of stop codon * Note: ORF of NSP4 genes without NcoI and XhoI sites TGA stop codon Figure 3.5: RV5 NSP4 ORF was modified by insertion of NcoI sites upstream and

XhoI sites downstream of the NSP4 sequences when amplified by the forward and

reverse primers.

RV5 5’ ATGGAAAAGCTTACCGACCTCAATTAC………………AAAAGAAGTGACTGCAGCGATGTGA 3’

62

1 2 3

Figure 3.6: Agarose gel electrophoresis of PCR products obtained from

amplification of NSP4 ORFs in pIND/V5-His-Topo-RV5-NSP4 with forward

primer (CT-RV5NcoI) and reverse primer (CT-RV5XhoI). 1KB Invitrogen DNA

ladder marker (lane 1) and negative control (lane 2). PCR amplicon of RV5-NSP4 (lane

3) was 533bp in length.

533 bp

506 bp

1080 bp

506 bp

63

3.3.1 Gel Purification of the PCR Amplicons

NSP4 amplicons generated above were gel-purified and electrophoresed on agarsoe gels

to confirm that the purified DNA was of desired quality (Figure 3.7).

1 2 3 4

Figure 3.7: Agarose gel electrophoresis of the purified NSP4 PCR products. Lane 1

contains RV5-NSP4 ORF (533 bp) amplified by primers of CTRV5-NcoI and CTRV5-

XhoI. Lanes 2 and 4 contain RV4 NSP4 and RV5 NSP4 ORFs (533 bp) amplified by

primers NSP4-NcoI/RV4-BglII and RV5-NcoI/RV5-BglII, respectively. Lane 3 contains

Invitrogen 1Kb DNA ladder marker.

533 bp (amplicon)

1080 bp (marker)

506 bp (marker)

64

3.4 Transformation of JM109 Bacterial Cells with the pGEM®-T Easy

Vector Ligated with the RV4 and RV5 NSP4 ORFs

Sample Observation Negative Control (pGEM®-T Easy vector without insert)

All dark blue colonies.

Ampicillin Control (only JM109 competent cells)

No bacterial growth observed.

Ligation Reaction (JM109 with pGEM®-T Easy-NSP4 insert)

10% white colonies, 70% pale blue colonies and 20% dark blue colonies.

Table 3.1: White colonies and pale blue colonies represent ampicillin-resistant bacteria

that contain pGEM®-T Easy vector having the desired insert fragment (ORF of RV4-

NSP4 and the RV5-NSP4 genes) while dark blue colonies represent ampicillin-resistant

bacteria which contain pGEM®-T Easy without insert fragments.

65

3.4.1 Restriction Enzyme Digestion to Identify RV4 and RV5 NSP4

ORFs Present in the pGEM®-T Easy Recombinants

1 2 3 4 5

(a) (b)

Figure 3.8: (a) Agarose gel electrophoresis of DNA products following NcoI and

BglII restriction enzyme digestions of pGEM®-T Easy vector containing ORF of

RV4 and RV5 NSP4 genes. (b) Agarose gel electrophoresis of DNA products

following NcoI and XhoI restriction enzyme digestions of pGEM®-T Easy vector

containing ORF of RV5 NSP4 genes. The double enzymes digestions separated the

DNA products into two fragments representing completely digested plasmid pGEM®-T

Easy (approximately 3.0kb) and NSP4 ORFs (528bp). Note that some undigested

recombinant plasmid DNA is visible above the 3 kb band. Lanes 1 and 4 contain

Invitrogen 1Kb DNA ladder marker. Lane 2 contains pGEM®-T Easy - RV4

recombinants, while lanes 3 and 5 contain pGEM®-T Easy-RV5 recombinants.

3.0kb

528 bp

506 bp

3054 bp 4072 bp 3.5 kb

3.0 kb

528 bp

66

3.4.2 Gel Purification of NcoI/BglII-digested RV4-NSP4 and RV5-NSP4 ORFs and NcoI/XhoI-digested RV5-NSP4 ORFs from pGEM®-T Easy Recombinants M 1 2 M 3

(a) (b)

Figure 3.9: (a) Agarose gel electrophoresis of purified 528 bp NcoI/XhoI-digested

RV5 NSP4 ORF (lane 1). (b) Agarose gel electrophoresis of purified 528 bp

NcoI/BglII-digested RV4 NSP4 ORF (lane 2) and RV5 ORF (lane 3). Lane M

contains Invitrogen 1Kb DNA ladder marker.

528bp 506bp

528bp 506bp

1080bp

1080bp

67

3.5 Cloning of RV4-NSP4 and the RV5-NSP4 genes into pQE60 3.5.1 ApaI, NcoI and BglII Digestion of pREP4/pQE60-SA11-NSP2 to prepare pQE60 for ligation with NSP4 ORFs

Figure 3.10: Agarose gel electrophoresis of DNA products following ApaI/NcoI/

BglII digestion of plasmid pQE60-SA11-NSP2 and co-purified plasmid pREP4

derived from M15. Five fragments were generated (lane 1): linearised pQE60

(approximately 3.4kb), SA11 NSP2 gene (approximately 900bp) and three other

fragments derived from pREP4 (596bp, 1132bp and 2072bp). Plasmid pREP4 exists as

a helper plasmid in E. coli M15 and contains cut sites for enzymes NcoI and BglII to

produce two DNA fragments, one of which has a similar size to linearised pQE60

vector. Thus, a third enzyme, ApaI, was included in the digest reaction as only pREP4

contains a cut site for this enzyme. Lane M contains Invitrogen 1Kb DNA ladder

marker.

M 1

900bp

3.4kb

2072bp

1132bp

596bp

3054bp

1636bp

1018bp

506bp

4072bp

68

3.5.2 Purification of linearised plasmid pQE60

Figure 3.11: Agarose gel electrophoresis of purified linearised pQE60. Plasmid

pQE60 (lane 1) was purified after ApaI/NcoI/BglII digestion of pREP4/pQE60-SA11-

NSP2 (Figure 3.10). Lane M contains Invitrogen 1Kb DNA ladder marker.

The linearised pQE60 vector was ligated with the purified PCR products described

earlier and transformed into JM109. Plasmid DNA was purified from resultant colonies

and the presence of recombinants was verified by restriction enzyme digestion.

M 1

3054bp 3.4kb

4072bp

69

3.5.3 NcoI and BglII Digestions on E. coli JM109 pQE60-NSP4 of both RV4 and

RV5 strains

1 2 M

Figure 3.12: Agarose gel electrophoresis of NcoI/BglII-digested recombinant

pQE60-NSP4 plasmids. A 533 bp fragment is released from both the RV4 (lane 1) and

RV5 (lane 2) recombinants. A fragment of approximately 3.4kb represents the pQE60

vector. Lane M contains Invitrogen 1Kb DNA ladder marker.

506bp

4072 bp 3054 bp 3.4kb

533bp

70

3.6 Cloning of RV5-NSP4 gene into pET-28a(+) 3.6 .1 NcoI and XhoI Digestion of pET-28a(+)

1 2

Figure 3.13: Agarose gel electrophoresis of gel-purified NcoI/XhoI-digested pET-

28a(+) (lane 2). Lane 1 contains Invitrogen 1Kb DNA ladder marker.

5.3kb 4072bp

5090bp

6108bp

71

The linearised pET-28a(+) vector was ligated with the purified RV5-NSP4 PCR

products described earlier and transformed into JM109. Plasmid DNA was purified

from resultant colonies and the presence of recombinants was verified by restriction

enzyme digestion.

3.6.2 NcoI/XhoI Digestion of recombinant pET-28a(+)-RV5-NSP4

1 2

Figure 3.14: Agarose gel electrophoresis of NcoI/XhoI-digested recombinant pET-

28a(+)-RV5-NSP4 plasmid. A 533 bp fragment is released (lane 2) as well as fragment

of approximately 5.3 kb representing the pET-28a(+) vector. Lane M contains

Invitrogen 1Kb DNA ladder marker.

506bp

5.3kb

517 bp 506 bp

533bp

5090 bp

6108 bp

72

3.7 Transformation of E. coli M15 with pQE60 carrying the RV4-NSP4

and the RV5-NSP4 genes

Recombinant pQE60 plasmids prepared as detailed in section 3.5 were transformed into

E. coli M15. Colonies carrying the desired plasmid were selected by their ampicillin and

kanamycin resistance. Plasmid DNA was isolated and analysed by restriction enzyme

digestion to confirm the presence of pQE60-NSP4 recombinants.

3.7.1 ApaI, NcoI and BglII Digestion on M15(pREP4)pQE60-NSP4

1 2 3

Figure 3.15: Agarose gel electrophoresis of DNA products following

ApaI/NcoI/BglII restriction enzyme digestion of recombinant plasmid pQE60-

NSP4. Lanes 1 and 3 contain pQE60-RV4-NSP4 and pQE60-RV5-NSP4, respectively

Invitrogen 1Kb DNA ladder marker are in lane 2. For pQE60-NSP4 plasmids, five

fragments were generated: pQE60 (approximately 3400 bp), NSP4 genes (533 bp) and

three fragments derived from pREP4 of 2072, 1132 and 596 bp.

4072 bp

506bp

1636 bp

1018 bp

3400 bp

2072 bp

596 bp 533 bp

1132 bp

73

3.8 Transformation of the Rosseta-gami 2(DE3)pLysS5 Bacterial Cells

with pET-28a(+) vectors inserted with RV5-NSP4 genes

Recombinant pET-28a(+) plasmids prepared as detailed in section 3.6 were transformed

into E. coli Rosseta-gami 2(DE3)pLysS5. Colonies carrying the desired plasmid were

selected by their streptomycin, tetracycline, chloramphenicol and kanamycin resistance.

Plasmid DNA was isolated and analysed by restriction enzyme digestion to confirm the

presence of pET-28a(+)/RV5-NSP4 recombinants.

3.8.1 NcoI and XhoI Digestions on host Rosseta-gami 2(DE3)pLysS5 containing

recombinant plasmid of pET-28a(+)/RV5-NSP4.

1 2

Figure 3.16: Agarose gel electrophoresis of pET-28a(+)/RV5-NSP4 DNA following

NcoI/XhoI restriction enzyme digestion. Lanes 1 contains Invitrogen 1Kb DNA

ladder marker. Lane 2 contains pET-28a(+)/RV5-NSP4 fragments of the expected sizes:

approximately 5300 bp of the vector and 533 bp of the inserted RV5 NSP4 ORF.

5300 bp

533 bp

5090 bp

517 bp, 506 bp

74

3.9 DNA sequencing Analysis of the pQE60 vectors inserted with the

RV4-NSP4 and the RV5-NSP4 genes

The sequences of the inserted DNA in pQE60-RV4-NSP4 and RV5-NSP4 recombinants

was determined to confirm the presence of the correct ORF and to detect any

mismatched bases compared to the sequences deposited in the GenBank database. The

sequences are presented below.

NcoIRV4BgII CCATGGATAAGCTTGCCGACCTCAACTACACATTGAGTGTAATCACTTTAATGAATGACA RV4DNA CCATGGATAAGCTTGCCGACCTCAACTACACATTGAGTGTAATCACTTTAATGAATGACA NcoIRV4BgII CATTGCATTCTATAATTGAAGATCCTGGAATGGCGTATTTTCCATATATTGCATCTGTTC RV4DNA CATTGCATTCTATAATTCAAGATCCTGGAATGGCGTATTTTCCATATATTGCATCTGTTC NcoIRV4BgII TAACAGTTTTGTTCGCATTACATATAGCTTCAATTCCAACCATGAAAATAGCATTGAAAG RV4DNA TAACAGTTTTGTTCGCATTACATATAGCTTCAATTCCAACCATGAAAATAGCATTGAAAG NcoIRV4BgII CATCAAAATGTTCATATAAAGTGATTAAATATTGTATAGTCACGATCATTAATACTCTTT RV4DNA CATCAAAATGTTCATATAAAGTGATTAAATATTGTATAGTCACGATCATTAATACTCTTT NcoIRV4BgII TAAAATTGGCTGGATATAAAGAGCAGGTTACTACAAAAGACGAAATTGAACAACAGATGG RV4DNA TAAAATTGGCTGGATATAAAGAGCAGGTTACTACAAAAGACGAAATTGAACAACAGATGG NcoIRV4BgII ACAGAATTGTGAAAGAGATGAGACGTCAGCTGGAGATGATTGATAAACTAACTACTCGTG RV4DNA ACAGAATTGTTAAAGAGATGAGACGTCAGCTGGAGATGATTGATAAACTAACTACTCGTG NcoIRV4BgII AAATTGAACAGGTTGAATTGCTTAAACGTATACATGACAACCTGATAACTAGACCAGTTG RV4DNA AAATTGAACAGGTTGAATTGCTTAAACGTATACATGACAACCTGATAACTAGACCAGTTG NcoIRV4BgII ACGTTATAGATATGTCGAAGGAATTCAATCAGAAAAACATCAAAACGCTAGATGAATGGG RV4DNA ACGTTATAGATATGTCGAAGGAATTCAATCAGAAAAACATCAAAACGCTAGATGAATGGG NcoIRV4BgII AGAGTGGAAAAAATCCATATGAACCGTCAGAAGTGACTGCATCCATGAGATCTCATCACC RV4DNA AGAGTGGAAAAAATCCATATGAACCGTCAGAAGTGACTGCATCCATGAGATCT------- NcoIRV4BgII ATCACCATCACTAA RV4DNA --------------

Figure 3.17: The NCBI Align software analysis result of matching the NCBI’s gene

bank’s open frame sequence of RV4-NSP4 gene (RV4DNA) (GenBank ID

U59108.1) to the RV4-NSP4 gene sequence determined by the gene sequencing

75

method (NcoIRV4BgIII). Both sequences were flanked by the modified 5’ NcoI

(CCATGG) and 3’ BgIII (AGATCT) restriction sites (both sites are highlighted in

yellow). NcoIRV4BgIII sequence contained the histidine tag site (highlighted in

magenta) and stop codons (highlighted in grey) at the 3’ end. The two mismatched base

pairs were highlighted in blue indicates the compatibility result is 98% between the gen

bank DNA sequences and the study analysed DNA sequences.

76

NcoIRV5BgII CCATGGAAAAGCTTACCGACCTCAATTACACATTGAGTGTAATCACTTTAATGAATAATA RV5DNA CCATGGAAAAGCTTACCGACCTCAATTACACATTGAGTGTAATCACTTTAATGAATAATA NcoIRV5BgII CATTACACACAATACTAGAGGATCCAGGAATGGCGTATTTTCCCTATATTGCATCTGTCC RV5DNA CATTACACACAATACTAGAGGATCCAGGAATGGCGTATTTTCCCTATATTGCATCTGTCC NcoIRV5BgII TGATAGTTTTATTCACATTACACAAAGCGTCAATTCCAACAATGAAAATAGCATTGAAGA RV5DNA TGATAGTTTTATTCACATTACACAAAGCGTCAATTCCAACAATGAAAATAGCATTGAAGA NcoIRV5BgII CGTCAAAATGTTCATATAAAGTAGTAAAGTATTGTATTGTAACGATCTTTAATACATTAT RV5DNA CGTCAAAATGTTCATATAAAGTAGTAAAGTATTGTATTGTAACGATCTTTAATACATTAT NcoIRV5BgII TAACACTAGCAGGTTACAAAGAACAAATTACTACTAAAGATGAAATAGAAAAGCAAATGG RV5DNA TAACACTAGCAGGTTACAAAGAACAAATTACTACTAAAGATGAAATAGAAAAGCAAATGG NcoIRV5BgII ACAGAGTTGTTAAAGAAATGAGACGTCAATTAGAAATGATTGATAAACTAACTACACGTG RV5DNA ACAGAGTTGTTAAAGAAATGAGACGTCAATTAGAAATGATTGATAAACTAACTACACGTG NcoIRV5BgII AAATTGAGCAAGTTGAATTACTTAAACGTATCTATGATAAATTGATGGTGCGATCGACTG RV5DNA AAATTGAGCAAGTTGAATTACTTAAACGTATCTACGATAAATTGATGGTGCGATCGACTG NcoIRV5BgII GCGAGATAGATATGAGAAAAGAAATTAATCAAAAGAATGTGAGAACGCTAGAAGAGTGGG RV5DNA GCGAGATAGATATGACAAAAGAAATTAATCAAAAGAATGTGAGAACGCTAGAAGAGTGGG NcoIRV5BgII AGAATGGAAAAAATCCTTATGAACCAAAAGAAGTGACTGCAGCGATGAGATCTCATCACC RV5DNA AGAATGGAAAAAATCCTTATGAACCAAAAGAAGTGACTGCAGCGATGAGATCT-------

NcoIRV5BgII ATCACCATCACTAA RV5DNA --------------

Figure 3.18: The NCBI Align software analysis result of matching the NCBI’s gene

bank’s open frame sequence of RV5-NSP4 gene (RV5DNA) (GenBank ID

U59103.1) to the RV5-NSP4 gene sequence determined by the gene sequencing

method (NcoIRV5BgIII). Both sequences were flanked by the modified 5’ NcoI

(CCATGG) and 3’ BgIII (AGATCT) restriction sites (both sites are highlighted in

yellow). NcoIRV5BgIII sequence contained the histidine tag site (highlighted in

magenta) and stop codons (highlighted in grey) at the 3’ end. The two mismatched base

pairs were highlighted in blue indicates the compatibility result is 98% between the gen

bank DNA sequences and the study analysed DNA sequences.

77

3.10 DNA sequencing Analysis of the pET-28a(+) vector inserted with

RV5-NSP4 genes

The sequences of the inserted DNA in pET-28a(+)-RV5-NSP4 recombinants was

determined to confirm the presence of the correct ORF and to detect any mismatched

bases compared to the sequences deposited in the GenBank database. The sequence are

presented below. pET28aRV5 47 ----------------------------------------CCATGGAAAA 96 combinedFR 201 CTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGAAAA 250 pET28aRV5 97 GCTTACCGACCTCAATTACACATTGAGTGTAATCACTTTAATGAATAATA 146 combinedFR 251 GCTTACCGACCTCAATTACACATTGAGTGTAATCACTTTAATGAATAATA 300 pET28aRV5 147 CATTACACACAATACTAGAGGATCCAGGAATGGCGTATTTTCCCTATATT 196 combinedFR 301 CATTACACACAATACTAGAGGATCCAGGAATGGCGTATTTTCCCTATATT 350 pET28aRV5 197 GCATCTGTCCTGATAGTTTTATTCACATTACACAAAGCGTCAATTCCAAC 246 combinedFR 351 GCATCTGTCCTGATAGTTTTATTCACATTACACAAAGCGTCAATTCCAAC 400 pET28aRV5 247 AATGAAAATAGCATTGAAGACGTCAAAATGTTCATATAAAGTAGTAAAGT 296 combinedFR 401 AATGAAAATAGCATTGAAGACGTCAAAATGTTCATATAAAGTAGTAAAGT 450 pET28aRV5 297 ATTGTATTGTAACGATCTTTAATACATTATTAACACTAGCAGGTTACAAA 346 combinedFR 451 ATTGTATTGTAACGATCTTTAATACATTATTAACACTAGCAGGTTACAAA 500 pET28aRV5 347 GAACAAATTACTACTAAAGATGAAATAGAAAAGCAAATGGACAGAGTTGT 396 combinedFR 501 GAACAAATTACTACTAAAGATGAAATAGAAAAGCAAATGGACAGAGTTGT 550 pET28aRV5 397 TAAAGAAATGAGACGTCAATTAGAAATGATTGATAAACTAACTACACGTG 446 combinedFR 551 TAAAGAAATGAGACGTCAATTAGAAATGATTGATAAACTAACTACACGTG 600 pET28aRV5 447 AAATTGAGCAAGTTGAATTACTTAAACGTATCTATGATAAATTGATGGTG 496 combinedFR 601 AAATTGAGCAAGTTGAATTACTTAAACGTATCTACGATAAATTGATGGTG 650 pET28aRV5 497 CGATCGACTGGCGAGATAGATATGAGAAAAGAAATTAATCAAAAGAATGT 546 combinedFR 651 CGATCGACTGGCGAGATAGATATGACAAAAGAAATTAATCAAAAGAATGT 700 pET28aRV5 547 GAGAACGCTAGAAGAGTGGGAGAATGGAAAAAATCCTTATGAACCAAAAG 596 combinedFR 701 GAGAACGCTAGAAGAGTGGGAGAATGGAAAAAATCCTTATGAACCAAAAG 750 pET28aRV5 597 AAGTGACTGCAGCGATGCTCGAG--------------------------- 640 combinedFR 751 AAGTGACTGCAGCGATGCTCGAGCACCACCACCACCACCACTGA------ 800

Figure 3.19: The sequencing result of the RV5-NSP4 gene insert within the vector

pET-28a(+) as analysed by Applied Biosystem Sequence Viewer software. Using

both sequencing primers CTRV5-NcoI and CTRV5-XhoI, the sequence of the RV5-

78

NSP4 DNA insert (combinedFR) was obtained by gene sequencing. The sequence was

preceded by the 5’ NcoI (CCATGG) and contained the XhoI (CTCGAG) restriction

sites, the histidine tag site (highlighted in magenta) and stop codons (highlighted in

grey) at the 3’ end. Both the restriction sites are highlighted in red. RV5 open frame

sequences (pET28aRV5) derived from NCBI gene bank was also flanked by both the

modified 5’ NcoI and the XhoI restriction sites. The two mismatched base pairs are

highlighted in blue indicates the compatibility result is 98% between the gen bank DNA

sequences and the study analysed DNA sequences.

79

3.11 Expression of the NSP4 Proteins in E. coli (M15 strain) Bacterial Cell Culture

Figure 3.20: Optical densities (600nm) of M15 bacterial cultures throughout the eight hours of expression time for both the non-induced

(NI) and IPTG-induced (I) cultures for RV4-NSP4 (RV4NI and RV4I). The optical densities of the induced culture was significantly lower

80

than that of the non-induced culture from the second to the seventh hour post induction (P<0.05). Standard error bars are shown at each time

point.

81


(NI) and IPTG-induced (I) cultures for RV5-NSP4 (RV5NI and RV5I). Standard error bars are shown at each time point. The optical

82

densities of the induced culture was significantly lower than that of the non-induced culture from the third to the eighth hour post induction

(P<0.05).

83


(NI) and IPTG-induced (I) cultures for SA11-NSP2 (NSP2NI and NSP2I). Standard error bars are shown at each time point.

84


(NI) and IPTG-induced (I) cultures for RV4-NSP4 (RV4NI and RV4I), RV5-NSP4 (RV5NI and RV5I) and SA11-NSP2 (NSP2NI and

NSP2I). Standard error bars are shown at each time point. For the RV4 culture, the optical densities of the induced culture was significantly

85

lower than that of the non-induced culture from the second to the seventh hour post induction (P<0.05). For the RV5 culture, the optical densities

of the induced culture was significantly lower than that of the non-induced culture from the third to the eighth hour post induction (P<0.05).

86

Figure 3.24: Viable count of the M15 bacterial cultures at 10-4 dilution factor throughout the eight hours of expression time for both the

non-induced (NI) and IPTG-induced (I) cultures for RV4-NSP4 (RV4NI and RV4I). Standard error bars are shown at each time point. The

viable count of the induced culture was significantly lower than that of the non-induced culture post induction until the eighth hour post induction

(P<0.05).

87


non-induced (NI) and IPTG-induced (I) cultures for RV5-NSP4 (RV5NI and RV5I). The viable count of the induced culture was

significantly lower than that of the non-induced culture post induction until the eighth hour post induction (P<0.05). Standard error bars are

shown at each time point.

88


non-induced (NI) and IPTG-induced (I) cultures for SA11-NSP2 (NSP2NI and NSP2I). Standard error bars are shown at each time point.

89


non-induced (NI) and IPTG-induced (I) cultures for RV4-NSP4 (RV4NI and RV4I), RV5-NSP4 (RV5NI and RV5I) and NSP2 (NSP2NI

and NSP2I). Standard error bars are shown at each time point. For both the RV4 and RV5 culture, the viable count of the induced culture was

significantly lower than that of the non-induced culture post induction until the eighth hour post induction (P<0.05).

90

3.12 Expression of the NSP4 Protein in E. coli (Rosetta-gami 2(DE3)pLysS5 strain) Bacterial Cell Culture

Figure 3.28: Optical densities (600nm) of Rosseta-gami 2(DE3)pLysS5 bacterial cultures throughout the eight hours of expression time

for both the non-induced (NI) and IPTG-induced (I) cultures for RV5-NSP4 (RV5NI and RV5I) and for both the glucose-enriched non-

induced (NI) and IPTG-induced (I) cultures for RV5-NSP4 (RV5GNI and RV5GI). For the normal culture, the optical densities of the

91

induced culture was significantly lower than that of the non-induced culture from the third till the fifth hour post induction (P<0.05). For the

glucose-enriched culture, the optical densities of the induced culture was significantly lower than that of the non-induced culture from the second

till the fifth hour post induction (P<0.05). For the non-induced culture, the optical densities of the glucose-enriched culture was significantly

higher than that of the normal culture from the first till the third hour post induction (P<0.05). For the induced culture, the optical densities of the

glucose-enriched culture was significantly higher than that of the normal culture between the second and the third hour post induction (P<0.05).

Standard error bars are shown at each time point.

92

Figure 3.29: Optical densities (600nm) of Rosseta-gami 2(DE3)pLysS5 bacterial cultures throughout the five hours of expression time for

the IPTG-induced (I) cultures for RV5-NSP4 (RV5I) and PINB (PI), the IPTG-induced (I) glucose-enriched cultures for RV5-NSP4

(RV5GI) and PINB (PGI) and the non-IPTG-induced (NI) cultures for PINB (PNI) and glucose-enriched cultures for PINB (PGNI).

Standard error bars are shown at each time point.

93

3.13 SDS-PAGE Gel Analysis of Purified Fusion Proteins Expressed in

E. coli M15 1 2 3 4 5 6 7 8 9 10 11

Figure 3.30: SDS-PAGE gel analysis of NSP4 proteins purified by Ni-NTA

chromatography after IPTG-induced expression in M15 culture carrying pQE60-

RV4-NSP4. The protein expression was conducted from 1 to 8 hours represented by

lanes 4-11. SA11-NSP2 protein (36kDa) was used as positive control (lane 1). pQE60-

RV4-NSP4 non-induced control was used as negative control (lane 3). The gel results

showed the absence of RV4-NSP4 proteins (approximately 20 kDa). However, SA11-

NSP2 protein (expressed from pQE60-SA11-NSP2) was successfully purified as

evidenced by a protein of approximately 36kDa in lane 1. Lane 2 contains PageRuler™

prestained marker (Fermentas).

26kDa

34kDa

17kDa

36kDa

94

1 2 3 4 5 6 7 8 9 10 11

Figure 3.31: SDS-PAGE gel analysis of NSP4 proteins purified by Ni-NTA

chromatography after IPTG-induced expression in M15 culture carrying pQE60-

RV5-NSP4. The protein expression was conducted from 1 to 8 hours represented by

lanes 3 and 5-11. SA11-NSP2 protein (36kDa) was used as positive control (lane 1).

pQE60-RV5-NSP4 non-induced control was used as negative control (lane 2). The gel

results showed the absence of RV5-NSP4 proteins (approximately 20 kDa). However,

SA11-NSP2 protein (expressed from pQE60-SA11-NSP2) was successfully purified as

evidenced by a protein of approximately 36kDa in lane 1. Lane 4 contains PageRuler™


34kDa

26kDa

17kDa

36kDa

95

3.14 SDS-PAGE Gel Analysis of Fusion Proteins Expressed in E. coli Rosseta-gami 2(DE3)pLysS5 strain 3.14a Bacterial culture in Terrific broth without glucose induced by 0.5mM IPTG at 28

C. 1 2 3 4 5 6 7 8 9 10

Figure 3.32: 15% SDS-PAGE gel analysis of E. coli crude cell lysates after IPTG-

induced expression of NSP4 in Rosseta-gami 2(DE3)pLysS5 cultures carrying pET-

28a(+)/RV5-NSP4. Protein expression was conducted from 1 to 5 hour (Lanes 1, 3, 5, 7

and 9). The gel results showed the absence of NSP4 proteins (approximately 20 kDa)

suggesting that proteins were not expressed by 0.5mM IPTG-induction at 28°C. Lane 10

contains low molecular weight (LMW) marker (GE Healthcare). Crude cell lysates of

uninduced PINB at 1, 2, 3 and 4 hours are shown in lanes 2, 4, 6 and 8, respectively.

.

14 kDa

20.4 kDa

30 kDa

96

3.14b Bacterial culture in Terrific broth with 1% glucose induced by 0.5mM IPTG

at 28

C.

1 2 3 4 1 2 3 4 5

. (a) (b)

Figure 3.33: (a) 15% SDS PAGE gel analysis of bacterial cleared lysates. No NSP4

protein was found in cleared lysate of overnight induced RV5-NSP4 (lane 2) but the

20kDa PINB protein was detected in cleared lysate of induced PINB at 5 hour post

expression (positive control) in lane 4. Lane 1 contained LMW marker (GE Healthcare)

and lane 3 was negative control of uninduced cleared lysate of PINB at 5 hour post-

expression. (b) SDS-PAGE gel analysis of purified 6xHis tagged NSP4 protein by

IMAC pull down method after IPTG-induced Rosseta-gami 2(DE3)pLysS5-pET-

28a(+)/RV5-NSP4 culture. The protein was purified at 5 hour post-expression (RV5-

NSP4; lane 4) or after overnight expression (RV5-NSP4; lane 2). PINB protein

expression overnight (lane 1) or after 5 hours (lane 3) was used as positive control. Non-

induced PINB culture expressed for 5 hours was used as negative control (lane 5). The

gel results showed the absence of RV5-NSP4 proteins (approximately 20 kDa). In

contrast, PINB protein was successfully purified as a protein of approximately 20kDa.

.

14 kDa

20.4 kDa

30 kDa

45 kDa

20kDa

97

3.14c Bacterial culture in LB broth induced by 0.8mM IPTG at 37

C 1 2 3 4 5 6 7 1 2

(a) (b)

Figure 3.34: (a) 15% SDS-PAGE gel analysis of E. coli crude cell lysates after

IPTG-induced expression of Rosseta-gami 2(DE3)pLysS5 culture carrying pET-

28a(+)-RV5-NSP4 (b) SDS-PAGE gel analysis of purified 6xHis tagged NSP4

protein by IMAC pull down method. The protein expression was conducted from 1 to

5 hours (lanes 2, 3, 4, 5 and 6). PINB non-induced culture was used as negative control

(lane 7). Lane 1 contained LMW marker (GE Healthcare) (lane 1). The gel results

showed the absence of RV5-NSP4 proteins (approximately 20 kDa) in lanes 2-6. In

addition, no purified NSP4 protein was detected at 5 hour post-expression by IMAC

pull down method in (b) (lane 1).

14 kDa

20.4 kDa

30 kDa

20.4 kDa

30 kDa

14 kDa

98

3.15 Western Blotting of Induced Cultures of M15 (pQE60-RV4/RV5-

NSP4).

3.15.1 Identification of RV4-NSP4 Polyhistidine Fusion Protein in E. coli Cleared

Lysates by Anti-polyhistidine Monoclonal Antibody HIS-1

1 2 3 4 5 6 7 8 9 10 11 12 13

Figure 3.35: Western blot of E. coli cleared lysates after IPTG-induced expression

of M15 carrying pQE60-RV4-NSP4. The protein expression was conducted from 1 to

8 hour (lane 3-10). (His)6-p53 protein was used as the positive control (lane 13). M15

(pQE60-SA11-NSP2) cleared lysate (lane 11) and purified NSP2 protein (lane 12)

showed the presence of the expected 36kDa protein. Lanes 3-10 showed the absence of

proteins reactive to the anti-polyhistidine monoclonal antibody suggesting that NSP4

proteins were not expressed by IPTG-induction. Lane 2 contained non-induced pQE60-

RV4-NSP4. Lane 1 contained PageRuler™ prestained marker (Fermentas).

34kDa

26kDa

17kDa

53kDa

36kDa

55kDa 43kDa

99

3.15.2 Identification of RV5-NSP4 Polyhistidine Fusion Protein in E. coli Cleared

Lysates by Anti-polyhistidine Monoclonal Antibody HIS-1

1 2 3 4 5 6 7 8 9 10 11 12 13

Figure 3.36: Western blot of E. coli cleared lysates after IPTG-induced expression

of M15 carrying pQE60-RV5-NSP4. The protein expression was conducted from 1 to

8 hour (lane 3-10). (His)6-p53 protein was used as the positive control (lane 12). M15

(pQE60-SA11-NSP2) cleared lysate (lane 11) and purified NSP2 (lane 13) showed the

presence of the expected 36kDa protein. Lanes 3-10 showed the absence of proteins

reactive to the anti-polyhistidine monoclonal antibody suggesting that NSP4 proteins

were not expressed by IPTG-induction. Lane 2 contained non-induced pQE60-RV5-

NSP4. Lane 1 contained PageRuler™ prestained marker (Fermentas).

34kDa

26kDa

17kDa

53kDa

36kDa

55kDa 43kDa

100

3.15.3 Identification of the Purified RV4-NSP4 Polyhistidine Fusion Protein by

Anti-polyhistidine Monoclonal Antibody HIS-1

1 2 3 4 5 6 7 8 9 10 11 12 13

Figure 3.37: Western blot analysis of proteins purified by Ni-NTA

chromatography after IPTG-induced expression of M15 carrying pQE60-RV4-

NSP4. The protein expression was conducted from 1 to 8 hour (lane 3-10). (His)6-p53

protein was used as the positive control (lane 13). The purified NSP2 protein with the

molecular size of 36kDa appeared on lane 12. Lanes 3-10 showed the absence of

proteins purified by Ni-NTA chromatography reactive to the anti-polyhistidine

monoclonal antibody suggesting that NSP4 proteins were not expressed by IPTG-

induction. Lane 2 and 11 represented the purified proteins of the non-induced pQE60-

RV4-NSP4 and pQE60-SA11-NSP2 respectively. Lane 1 contained PageRuler™


34kDa

26kDa

17kDa

53kDa

36kDa

55kDa 43kDa

101


Anti-polyhistidine Monoclonal Antibody HIS-1

1 2 3 4 5 6 7 8 9 10 11 12 13



NSP4. The protein expression was conducted from 1 to 8 hour (lane 3-10). (His)6-p53

protein was used as the positive control (lane 13). The purified NSP2 protein with the

molecular size of 36kDa appeared on lane 12. Lanes 3-10 showed the absence of

proteins purified by Ni-NTA chromatography reactive to the anti-polyhistidine

monoclonal antibody, suggesting that NSP4 proteins were not expressed by IPTG-

induction. Lane 2 and 11 represented the purified proteins of the non-induced pQE60-

RV5-NSP4 and pQE60-SA11-NSP2 respectively. Lane 1 contained PageRuler™


34kDa

36kDa

26kDa

53kDa 34kDa 43kDa

102


Polyclonal Anti-SA11 Rabbit Sera

1 2 3 4 5 6 7 8 9 10 11 12



NSP4. The protein expression was conducted from 1 to 8 hour (lane 3-10). Purified

SA11-NSP2 (lane 12) showed the presence of the expected 36kDa protein. Lanes 3-10

showed the absence of proteins purified by Ni-NTA chromatography reactive to

polyclonal anti-SA11 rabbit serum suggesting that NSP4 proteins were not expressed by

IPTG-induction. Lane 2 and 11 represented the purified proteins of the non-induced

pQE60-RV4-NSP4 and pQE60-SA11-NSP2 respectively. Lane 1 contained

PageRuler™ prestained marker (Fermentas). Note: non-specific reactive bands are

observed in lanes 3-5 but these are not of the size of the expected NSP4 protein.

34kDa 36kDa

26kDa

43kDa

103


Polyclonal Anti-SA11 Rabbit Sera

1 2 3 4 5 6 7 8 9 10 11 12



NSP4. The protein expression was conducted from 1 to 8 hour (lane 3-10). Purified

SA11-NSP2 (lane 12) showed the presence of the expected 36kDa protein. Lanes 3-10

showed the absence of proteins purified by Ni-NTA chromatography reactive to

polyclonal anti-SA11 rabbit serum suggesting that NSP4 proteins were not expressed by

IPTG-induction. Lane 2 and 11 represented the purified proteins of the non-induced

pQE60-RV5-NSP4 and pQE60-SA11-NSP2 respectively. Lane 1 contained

PageRuler™ prestained marker (Fermentas). Note: non-specific reactive bands are

observed in lanes 2-5 but these are not of the size of the expected NSP4 protein.

34kDa 36kDa

26kDa

43kDa

104

CHAPTER 4: DISCUSSION

The major objective of this study was to introduce the open reading frames of the NSP4

genes of human rotavirus strains RV4 and RV5 into E. coli expression vectors to enable

large-scale production of the proteins. Given the potential toxic nature of NSP4, the

expression systems selected involved plasmid vectors where the transcription of cloned

genes was under the control of inducible promoters.

4.1 Cloning of NSP4 genes into expression vectors

The results of cloning experiments showed all the PCR-induced NSP4 gene

modifications were successful to enable the NSP4 genes of both the RV4 and RV5

strains to be ligated into the pQE60 expression vector. These recombinants plamsids

were then introduced into E. coli M15 cells to facilitate expression of the NSP4

proteins. Similarly, the NSP4 genes of RV5 strain was successfully cloned into the pET-

28a(+) expression plasmid and introduced into E. coli Rosetta-gami 2(DE3)pLysS5

cells. The expression of NSP4 by both pQE60 and pET-28a(+) was induced by IPTG.

The presence of the NSP4 ORFs was confirmed the source recombinant plasmids,

namely pIND/V5-His-Topo-RV4-NSP4 and pIND/V5-His-Topo-RV5-NSP4, by

performing enzyme digestion using BamHI and XbaI. Differences in the digestion

patterns of the plasmids confirmed the presence of an additional BamHI site in the RV5

ORF (Figure 3.2) as predicted by the RV5 NSP4 sequence.

All the designed primers successfully amplified both the RV4-NSP4 and RV5-NSP4

giving DNA amplicons with the expected size of 533bp (Figures 3.4 and 3.6). The use

of Taq polymerase with its 3'-terminal transferase activity (adding a single

deoxyadenosine in a template-independent fashion to the 3' end of PCR products:

Promega – Protocols Directory 2010 enabled the modified PCR products to be directly

ligated to the poly T-tailed pGEM®-T Easy cloning vector and transformed into E. coli

JM109. Recombinant pGEM®-T Easy vectors isolated from JM109 were subjected to

restriction enzyme analysis which revealed a 528bp long fragment corresponding to the

http://www.promega.com/tbs/tm042/tm042.html

105

expected size of the NSP4 ORF. This indicated the successful cloning of NSP4 gene in

pGEM®-T Easy vectors (Figure 3.8).

Both NSP4 genes and the expression vectors of pQE60 and pET-28a(+) were digested

with appropriate enzymes and recovered by gel purification instead of solution

purification to remove any residual nicked and supercoiled plasmid after digestion, as

such plasmids will transform efficiently relative to the ligation mixture products. The

resulted transformants M15 (pREP4) (QE60-NSP4) were selected by their simultaneous

kanamycin and ampicillin resistance encoded by pREP4 and pQE60, respectively. In

contrast, transformed Rosseta-gami 2(DE3)pLysS5 (pET-28a(+)/RV5-NSP4) were

selected by their simultaneous streptomycin, tetracycline, chloramphenicol and

kanamycin resistance encoded by the host and pET-28a(+), respectively. The pQE60-

NSP4 and pET-28a(+)/RV5-NSP4 plasmids were extracted and subjected to enzyme

digestion as well as the DNA sequencing which indicated the presence of the NSP4

genes in both expression vectors and successful transformation into the respective

protein expression hosts 2(DE3)pLysS5 (Figures 3.15 and 3.16).

4.2 DNA sequencing analysis

The results of DNA sequence analysis confirmed that the sequences of the cloned genes

corresponded to the RV4 and RV5 NSP4 gene sequence available in GeneBank (Figures

3.17, 3.18 and 3.19) with only two mismatched bases in RV4 and RV5 strains,

indicating 98% identity between the GenBank DNA sequences and the DNA sequences

analysed in this study. Sequence analysis also showed that the cloned DNAs were in the

correct reading frame to express NSP4 with a C-terminal 6xHis-tag.

106

4.3 Membrane Destabilising Domain in NSP4 Protein

4.3.1 Cell intensity and viable count of M15(pREP4)(pQE60-NSP4)

M15 (pREP4) and Rosseta-gami 2(DE3)pLysS5 were successfully transformed with

pQE60-NSP4 and pET-28a(+)/RV5-NSP4, respectively. Colonies were cultured in LB

broth and Terrific broth, respectively, for the expression of the NSP4 proteins. The

growth of M15(pREP4)(pQE60-NSP2) was compared with M15(pREP4)(pQE60-

NSP4) to investigate their growth pattern throughout the eight-hour protein expression

period. The optical densities and the viable counts of both the non-induced and IPTG-

induced NSP2 culture showed a significant upward trend compared with non-induced

and IPTG-induced NSP4 throughout the protein expression period. This indicated that

expression of the NSP2 protein did not affect the growth and viability of M15 cells

(Figure 3.22, 3.23, 3.26 and 3.27). Unlike M15(pREP4)(pQE60-NSP2), the optical

densities and viable counts of the IPTG-induced M15(pREP4)(pQE60-NSP4) culture

was significantly lower than their non-induced counterparts within the first hour through

to their eighth hour of the expression time (Figure 3.20, 3.21, 3.24 and 3.25). In IPTG-

induced M15 bacterial cultures carrying the pQE60-NSP4 clones, the cell intensities

increased during the first hour of induction but decreased afterwards until 3-hours post-

induction. Then, the cell intensities increased slowly until 8-hours post-induction

(Figure 3.20 and 3.21). Overall, the cell intensities of induced M15 carrying pQE60-

RV5-NSP4 were higher than induced M15 carrying pQE60-RV4-NSP4 which may

suggest that the RV4-NSP4 protein is more toxic than the RV5-NSP4 protein. This is

apparent when the growth of cultures carrying pQE60-RV5-NSP4 and pQE60-RV4-

NSP4 were compared directly (Figure 3.23). Moreover, the significant downward trend

of the IPTG-induced M15(pREP4)(pQE60-NSP4) viable count in contrast to the upward

trend of the non-induced cultures viable count further indicated the proteins expressed

in the M15 were inhibiting the growth of the bacterial cells and affecting their viability

(Figure 3.27). The viable count results showed a decrease of the cell numbers at the

point of induction until 8 hours post-induction.

107

4.3.2 Cell intensity of Rosseta-gami 2(DE3)pLysS5 (pET-28a(+)/RV5-NSP4)

Rosseta-gami 2(DE3)pLysS5 (pET-28a(+)/RV5-NSP4) was cultured in Terrific broth

and LB broth. It was found that, overall, the cell intensities of the bacterial culture in

Terrific broth were higher than the cell intensities of M15 bacterial cultures in LB broth

indicating the Terrific broth is more suitable to support the growth of bacteria which

carrying the toxic target protein and, indirectly, may increase the yield of the target

protein. Glucose (0.5–1.0 %) was added to cultures expressing toxic NSP4 protein to

help in maintaining the lowest basal levels of toxic target protein in cultures grown to

stationary phase and to maintain plasmid stability. Glucose also prevents

overproduction of T7 lysozyme by plasmid pLysS in the expression host which can

lower the level of induced target protein (Grossman et al., 1998; Novy et al., 2001). The

viability of the Rosetta-gami 2(DE3)pLysS5 cells improved with the addition of 1%

glucose into the culture media. In both the non-IPTG -induced and IPTG-RV5-induced

cultures, the optical densities of the glucose-enriched culture was higher than that of the

glucose-free culture (Figure 3.28). This suggests that the glucose not only helps to

maintain low basal expression and plasmid stability, but also enables the cells to reach

log phase in a shorter period of time. The significant downward trend of the optical

densities of Rosseta-gami 2(DE3)pLysS5 (pET-28a(+)-RV5-NSP4) cells starting after 2

hours post-induction was also recognised (Figure 3.28) in both glucose-enriched and

glucose-free media. This result indicated that the toxic NSP4 protein impaired the

growth of bacteria at 2 hours post-induction regardless of the presence of glucose. In

contrast, the optical density of both the IPTG-induced and non-induced PINB culture

expressing non-toxic proteins grew exponentially after IPTG induction in both glucose-

enriched culture and glucose-free culture (Figure 3.29). As a conclusion, Terrific broth

and glucose help in the growth of bacteria carrying a toxic gene. This was seen when the

growth of M15(pREP4)(pQE60-NSP4) was compared to Rosseta-gami

2(DE3)pLysS5(pET28a(+)-RV5-NSP4) where the cell intensities of the former were

lower. In addition, the growth of Rosseta-gami 2(DE3)pLysS5 (pET28a(+)-RV5-NSP4)

was impared after 2 hour post-induction compared with the growth of

M15(pREP4)(pQE60-NSP4) where growth impairment was seen at the first hour post-

induction (Figure 3.20, 3.21 and 3.28).

108

Hence, all these results affirmed that the NSP4 proteins expressed in E. coli cells were

toxic NSP4 and there was a small amount basal level expression that impaired the cells

growth even the hosts were tightly controlled for the leaky expression before IPTG

induction. This was apparent by the higher optical densities in positive control of

M15(pREP4)(pQE60-NSP2) and Rosseta-gami 2(DE3)pLysS5(pET28a(+)/PINB)

compared with M15 and Rosseta-gami 2(DE3)pLysS5 carrying NSP4 clones before

IPTG induction (Figure 3.23 and 3.29). In addition, this may explain the undetectable

levels of purified NSP4 observed by SDS-PAGE or Western blot analysis. The findings

support a previous study which showed that the optical density of NSP4 expressed in

BL21(DE3)pLysS declined after IPTG induction (Browne et al., 2000). The expressed

NSP4 disintegrates the bacterial membrane resulting in the release of T7 lysozyme and

eventually causing cell lysis (Browne et al., 2000). A protein region rich in basic amino

acid from residue 48 to 91 (proximal membrane destabilising region) of the SA11 NSP4

protein was found to be associated with the declining optical density of the bacterial

culture expressing either the full-length NSP4 or the truncated NSP4 (residue 48 to 91).

Residues 48-91 of NSP4 were found to contribute to the membrane destabilising

activity of the protein (Browne et al., 2000). In addition, the membrane destabilising

activity was enhanced by the α-helical coiled-coil domain of the cytoplasmic tail

comprising residues 97-137 (Browne et al., 2000). The expression of the truncated

NSP4 that contained both regions (residues 48-91 and 97-137) resulted in declining

optical densities of the E. coli culture, which is similar to the observations of this study.

In contrast, the cytoplasmic domain consisting of residues 86-175 was expressed at a

high level. Moreover, the α-helical structure between residues 54 and 74 as proposed by

Browne et al., (2000) was shown to contribute to the membrane destabilising and

permeabilisation activity. Reduced optical density, indicating the impaired growth of E.

coli cultures, has also been observed in other studies (Tian et al., 1996; Guzman et al.,

2005).

109

4.4 Expression and Detection of NSP4 Protein

In previous studies investigating the expression of NSP4, a number of complications

were found. The full-length NSP4 could not be expressed in some pGEX-based system

(Ray et al., 2003). This supports the previous finding that SDS-PAGE and Western blot

analysis failed to detect NSP4 expressed by some pET vectors (Enouf et al. 2001). In

the present study, 1 mM IPTG was used to induce protein expression in

M15(pREP4)(pQE60-NSP4) and M15(pREP4)(pQE60-NSP2) cultures in LB broth at

37°C. NSP2 is a non-toxic protein encoded by rotavirus genome 8. Plasmid pQE60

contains two lac operator sequences for the binding of lac repressor to control its

powerful T5 promoter to prevent leaky expression. NSP4 expression by pQE60 was

initiated by T5 polymerase produced by pREP4. By tightly contolling the basal level of

expression in M15, the amount of toxic NSP4 protein produced will be greatly reduced

prior to IPTG induction. Surprisingly, SDS-PAGE did not show the presence of the

expected RV4-NSP4 and RV5-NSP4 proteins (20 kDa) after Ni-NTA chromatography

purification of the M15 cleared lysate (Figures 3.30 and 3.31). However, the NSP2

protein (positive control) was detected as a 36kDa protein, confirming that expression

was induced in the M15 system. Time-course analysis showed no NSP4 proteins were

detected at 1, 2, 3, 4, 5, 6, 7, and 8 hours post-induction. As optical densities and viable

counts dropped within 1 hour post-induction, it was presumed that NSP4 would not be

detected from the second hour post-induction. The results of the Western blot further

indicated that RV4-NSP4 and RV5-NSP4 were not purified by Ni-NTA

chromatography. Western blot can usually detect low amounts of protein compared with

SDS-PAGE. However, neither anti-polyhistidine monoclonal antibody (that would

target the histidine tag of the NSP4) or polyclonal anti-SA11 rabbit sera (that would

target NSP4 directly) were able to detect proteins of 20kDa region (Figures 3.37, 3.38,

3.39 and 3.40). In contrast, both antibodies were able to detect the histidine-tagged

NSP2, even though the antibodies also showed non-specific reactivity to some E. coli

proteins (Figure 3.37 and 3.39) indicating that the expression and purification methods

worked as expected. Therefore if a protein is detected around the 20kDa region on the

Western blot, it was likely those proteins are the NSP4 despite the lack of specificity of

antibodies in targeting the NSP4 alone.

110

The NSP4 proteins in Figure 3.30, 3.31, 3.34 and 3.35 were extracted by nondenaturing

lysis buffer however urea denaturing lysis buffer were also used but data were not

shown as those results were negative.

An alternative expression system was used in this study: Rosseta-gami 2(DE3)pLysS5

carrying recombinant plasmid pET-28a(+)/RV5-NSP4 inducible by T7 RNA

polymerase. The pET-28a(+) contains the T7lac promoter and the coding sequence for

the lac repressor (lacI) to control basal level expression. There are two repression sites

for the lac repressor. Firstly, the lacUV5 promoter in the E. coli chromosome and

secondly the T7lac promoter of the pET-28a(+) plasmid vector. The repression of

lacUV5 promoter suppresses the transcription of the T7 RNA polymerase gene by the

host polymerase. The repression on T7lac promoter halts the transcription of the target

gene by the T7 RNA polymerase expressed initially in place (Dubendorff et al., 1991).

Moreover, the pLysS plasmids in host Rosseta-gami 2(DE3)pLysS5 cells also release T7

lysozyme to suppress T7 RNA polymerase before IPTG induction. Together, all these

features would control the basal level of expression of the toxic NSP4 expression and

help bacteria to grow vigorously and to express high levels of protein. NSP4 of RV4

and RV5 strains contains two cysteine proteins at aa 63 and 71 which will form

disulfide bonds within the NSP4 protein. An added advantage of using Rosetta-gami

2(DE3)pLysS5 as the expression host is that the bacteria carry the thioredoxin reductase

(trxB) and glutathione reductase (gor) mutation for enhancing the disulfide bond

formation in E. coli cytoplasm, meaning the expressed protein will be properly folded to

avoid degradation or the formation of inclusion bodies, thus enhance the solubility of

the expressed protein. Sometimes the expression of eukaryotic proteins that need the

codons rarely found in E. coli can cause translational problems including translational

stalling, frameshifting, premature termination and amino acid mislocation. In this study,

Rosetta-gami 2(DE3)pLysS5 (which contains seven rare tRNAs codons: AUA, AGG,

AGA, CUA, CCC, GGA and CGG) was used to eliminate this potential problem when

expressing the NSP4 proteins (Brinkmann et al., 1989; Kane, 1995; Kurland et al.,

1996; Rosenberg et al., 1993; Del Tito et al., 1995), which may have been a reason for

poor expression in M15.

111

There were two different expression conditions used for Rosseta-gami

2(DE3)pLysS5(pET28a(+)/RV5-NSP4) and Rosseta-gami 2(DE3)pLysS5

(pET28a(+)/PINB). PINB is a non-toxic protein and acted as both a positive and

negative control in the Rosseta-gami 2(DE3)pLysS5 protein expression system. Initially,

bacterial cultures in LB broth were induced by 0.8 mM IPTG and incubated at 37°C.

Time-course analysis showed no NSP4 proteins were detected in crude cell lysates at 1,

2, 3, 4 and 5 hours post-induction (Figure 3.34). There is a possibility of proteins

forming inclusion bodies when bacteria are grown at 37°C while incubation of cultures

at 30°C or prolonged overnight incubation at lower temperatures may help to express

more soluble and, therefore, active proteins (Schein, 1989). Thus, the conditions were

changed to induce bacteria cultures in Terrific broth containing 1% glucose by adding

0.5 mM IPTG at 28°C. Another set of bacterial cultures in Terrific broth without

glucose were induced under the same conditions. Glucose and Terrific broth can help in

bacterial growth and increase the optical densities which may help in higher level

protein expression after IPTG induction. However, time-course analysis showed no

NSP4 proteins were detected in crude cell lysates at 1, 2, 3, 4 and 5 hours post-induction

(Figure 3.32). The bacterial cell pellet was resuspended in lysis buffer containing 8 M of

urea to solubilise any protein forming inclusion bodies and assist in purification of

protein in soluble form. Again, no NSP4 protein was detected in cleared lysates (Figure

3.33a). The cleared lysates were subjected to purification by IMAC to concentrate the

purified target protein if present at low levels. However, no purified NSP4 proteins were

detected after IMAC (Figure 3.33b). PINB protein (positive control) was detected in

both cleared lysates and after IMAC indicating that protein expression was successful

using the Rosseta-gami 2(DE3)pLysS5 system.

In conclusion, SDS-PAGE and the Western blot results collectively indicated a failure

to purify NSP4 expressed in the M15(pREP4)(pQE60-NSP4) and Rosseta-gami

2(DE3)pLysS5(pET-28a(+)/RV5-NSP4) cultures under different protein expression

conditions. The possible reasons behind the failure will be discussed as follows.

112

4.5 Possible reasons for the failure of NSP4 protein expression and

suggestions to improve the success of NSP4 protein expression.

E. coli was chosen to express NSP4 in this study due to its genetic and physiological

properties as well as its strong protein expression characteristics that have been

extensively studied (Tabandeh et al., 2004). In addition, E. coli can be cultivated cost-

effectively by easy laboratory techniques and high cell densities can be achieved

quickly after cultivation. However, some potential problems with the expression of

NSP4 in E. coli expression systems have been identified. The amino terminus of NSP4

has been shown to destabilise bacterial membranes making purification of this protein

difficult (Browne et al., 2000). The toxicity of NSP4 as well as slightly leakiness in the

inducible promoter may impair the expression of NSP4 in bacterial systems (Enouf et

al., 2001). Similarly, the atypical mRNA codons like AGG (Arg) and AUA (Ile) in the

cloned protein gene within the expression plasmid could impair protein expression

(Lakey et al., 2000; Wada et al., 1991).

The basal expression of potentially toxic NSP4 prior to IPTG induction must be tightly

regulated to ensure the expressed protein level inside the bacterial cells will not threaten

the viability of cells. Even the pREP4 that expresses lac repressor proteins already

present in M15 cells before the transformation of M15 cells with NSP4 gene-inserted

pQE60, the experiment results of NSP4 expression indicated that prior to IPTG

induction, the basal expression in E. coli might have produced the protein level that had

greatly decreased the growth of bacterial cells. A change of expression vector may solve

this problem. A previous study had suggested the pBAD expression vectors could

minimise the basal expression of toxic gene products (Guzman et al., 1995). Highly

toxic archeal RNase P was successfully expressed with the pBAD expression system

(Boomershine et al., 2003). The efficiency of toxic protein expression within E. coli

hosts was not affected as pBAD plasmids grew abundantly during the growth phase.

Also glucose and glucose-6-phosphate can be added to further reduce the basal

expression.

113

Modulation of the number of expression plasmids was another approach used to express

highly toxic proteins such as colicin E3 (Bowers et al., 2004). The approach is to

minimise the basal expression of toxic proteins. T7-based pETcoco-1TM is a plasmid

which can be amplified from 1-2 copies per cell to 20-50 copies per cell by arabinose

induction. Arabinose initiates the expression of the trfA gene that encodes RK-2 derived

trfA replicator protein. The replicator protein acts on the γ replication origin (ori) locus

of the plasmid to amplify the copy numbers of the plasmid that also carries the toxic

gene products.

Similarly, pUC19 or pET9 expression vectors were inserted into a commercial E. coli

strain called CopyCutterTM EPI400TM to restrict their copy number prior to the protein

expression. The bacterial cell carries the promoter-inducible ColE1-type plasmid with

the modified pcnB gene to control the copy number of the co-existing expression

plasmids within the bacterial cells. For protein expression, the ColE1-type plasmid is

induced to amplify the copy number of pUC19 or pET9 expression vectors from

approximately 9 to 216 copies per cell and 9 to 33 copies per cell, respectively. The

regB protein was successfully expressed by T7 expression vector pET11a with this

system (Haskins, 2004).

Competitor plasmids together with the expression vector plasmid can be introduced into

E. coli hosts to suppress the toxicity of the expressed toxic products. Both vectors are

regulated by the T7 promoter. For example, BL21(DE3) cells were inserted with both

the HIV-1 protease gene in the pAR3040 expression vector and the pACYCT7pmt

competitor plasmid (Rosenberg et al., 1987). During the protein expression, ampicillin

was used to select the ampicillin-resistant pAR3040 expression plasmids during the

growth phase. Based on this strategy, the introduction of competitor plasmids

containing the promoter genes of lac operon into the E. coli cells before their

transformation with the expression vectors may help to minimise the basal expression.

In order to obtain the greater protein yield, the copy number of the competitor plasmids

must be optimised to retain more expression vector-containing transformants as well as

to suppress the toxicity of the toxic proteins during the growth phase.

114

Throughout the bacterial growth during the protein expression procedures, kanamycin

and ampicillin were used to select the E. coli cells that carried either pQE60 or pET28a

vectors. Theoretically this will eliminate all the pQE60-free cells which will compete

with the NSP4-expressing cells for the nutrients in the culture. However, antibiotic-

sensitive plasmid-free cells were previously found to survive in cultures containing the

antibiotics that acted against them (Wood et al., 1990). In this case, the more viable

plasmid-free cells eventually outnumbered the growth-stressed protein-expressing cells

and further decreased the expressed protein yield. The insertion of parB and ccd cell-

death-related loci into the expression vector-free E. coli cells may help to circumvent

this problem (Gerdes et al., 1997). parB and ccd, respectively, encode for Hok and

CcdB proteins that lead to cell death. In contrast, the Hok/CcdB-inhibiting genes were

introduced into the expression vectors to prevent the cell death of the protein-expressing

cells. Previous studies found almost 100% of the protein-expressing cells survived by

this molecular technique compared with only 10% cell survival observed in the

antibiotic-selection method (Mishima et al., 1997).

T7-based expression vectors have been used extensively to express NSP4. Within the E.

coli cells, T7 RNA polymerase (T7 RNAP) encoding T7 gene φ10 promoter (T7

promoter) is repressed by lacUV5 promoter (Studier and Moffatt, 1986). The repression

tightly controls the basal expression of the toxic protein by not expressing T7 RNAP.

However, there was an exceptional case which the T7 gene I (T7 promoter gene) within

the BL21(DE3) strain was poorly repressed by lacUV5 promoter and resulted in the

unrestricted basal expression of the toxic protein. The insertion of the T7 promoter

gene-containing phage λ derivatives like M13, λDE3 and λCE6 into the T7 gene 1-

lacking E. coli cells is effective in suppressing the basal expression of toxic proteins.

This resulted in the successful expression of the HIV-1 protease, phage T4 translational

repressor RegA, the phage T4 restriction endoribonuclease RegB and the transcriptional

activator MotA of both RegA / RegB (Unnithan et al., 1990; Komai et al., 1997; Sanson

et al., 2000). In addition, plasmids like pLysS (used in the current study) and pLysE

also express the T7 RNAP-inhibiting T7 lyzozyme to keep the basal expression of target

proteins to a minimum (Studier, 1991).

Inconsistencies have been found among cells of the same T7 promoter-based E. coli

strains in terms of maintenance of the gene encoding the toxic protein within the

115

expression host. Some BL21(DE3)pLysS cells could not maintain the HIV-2 protease

gene, while other same cells that were able to stabilise the HIV-2 protease gene within

them (Chen et al., 1997). A slower mRNA accumulation rate was observed in those

HIV-2 protease “gene-friendly” BL21(DE3)pLysS cells (Miroux and Walker 1996;

Chen et al., 1997). Furthermore, the slower accumulation of mRNA as well as its lower

basal level after induction was noted in two BL21(DE3)pLysS derivative strains that

also tolerated two highly toxic genes, namely C41(DE3) and C43(DE3) (Miroux and

Walker, 1996). The expression of the unstable Mycobacterium tuberculosis genes also

singled out a unique derivative strain called BL21(DE3)NH with its formation of small

opaque colonies with long bacillary shape (Poletto et al., 2004). Based on these studies,

the suitability of a bacterial cell variant to express toxic proteins can be determined by

its phenotype, basal expression levels of T7 RNAP and the accumulation kinetics of

gene products.

The insertion of additional repression sites into expression vectors acting on the lac

promoter region could also enhance the control of basal expression of toxic protein. For

example, the repression of the lac promoter/operator region of pLAC11 plasmids is

achieved by the binding of cAMP-activated protein (CAP) to the lac operator O1 site

together with the interaction of CAP with the O2 operator site downstream of the coding

region or O3 operator site upstream of the CAP binding site (Muller-Hill, 1975;

Reznikoff, 1992; Warren et al., 2000). Unlike pLAC11, only one repressor site exists in

the lac operator O1 site in the T7-based pET vectors. It has been showed that 84-fold

lower basal expression level was achieved in pLAC11 plasmids compared with the

pET-21(+)/pLysS system.

Several studies showed that some genes encoding highly toxic proteins cloned in pET

expression plasmids were difficult to be maintained in either T7 RNAP-based or T7

RNAP-free E. coli strains (Bouet et al., 1998; Manco et al., 1998; Brown and Campbell

1993; Saida et al., 2003). This was due to the highly efficient ribosome-binding site

(RBS) for example, the phage T7 gene φ10 RBS in pET expression plasmids. Another

study found that the lower efficiency of the ribosome binding site of pET15b carrying

the gene of toxic phage T4 regB protein is critical for the maintenance of the vector

within a T7 RNAP-free strain. Therefore, impairment of the RNA polymerase-mediated

read-through transcription derived from the base-pairing between the target protein

116

mRNA and the 16S rRNA might prevent over-expression of the toxic gene products

(Saida et al., 2003). In this case, the insertion of a transcription terminator preceding the

target gene promoter or coding sequence region will help to lower the expression level

by compromising the high efficiency of the RBS, for example, the rho-independent

transcription terminators T1 and T2 from the E. coli rrnB operon (Brosius, 1984; Brown

and Campbell, 1993) and E. coli rpoC terminator (Unnithan et al., 1990).

Some toxic proteins have been expressed as a fusion protein with another type of

protein that could neutralise the cytotoxic effect of the expressed protein. The

mammalian apoptosis modulator protein Bax caused lysis of E. coli cells even when the

protein was expressed alone at low concentration (Asoh et al., 1998). However, when

Bax was expressed in fusion with a 17 residue-long leader peptide so that the peptide

probably bound to the GroEL-binding loop of the E. coli cochaperone, GroES (S-loop),

this avoided the interaction of the toxic Bax with the cellular components that would

otherwise disrupt the cellular membrane. Another cytolytic agent, Buforin II derived

from the amphibian Bufo gargarizans, was expressed as a fusion protein with a

neutralising acidic peptide (Lee et al., 1998). The E. coli-lethal cytokine receptor

homology domain (CRH) of granulocyte-colony-stimulating factor (G-CSF) receptor

was expressed by fusion with thioredoxin (Tatsuda et al., 2001). Maltose-binding

protein MalE and glutathione S-transferase are the other common fusion proteins co-

expressed with the toxic proteins.

In the case where a particular protein region that could not be expressed in E. coli cells,

a semi-synthetic technique has been adopted to produce the full-length toxic protein like

the restriction endonuclease of Haemophilus parainfluenzae (HpaI) (Evans et al., 1998;

Amitai and Pietrokovski 1999). The first 223 residues of HpaI were expressed in E. coli

as a fusion protein to intein. Then the intein of the purified fusion protein was cleaved to

produce a reactive thioester at the C-terminal alpha carbon of the partial HpaI fusion

protein. The remaining 28 residue-long HpaI peptide was synthesised chemically and

was ligated to the fusion protein by the nucleophilic reaction on the reactive thioester.

There were some toxic proteins like phage T4 ndd gene that can mobilise from the

expression site to E. coli nucleoid and disrupt the nucleoid resulting in the loss of the

targeted gene (Bouet et al., 1996). To solve this problem, the UAC codon (located at

position 121 of the ndd gene) was mutated to an UAG stop codon and the gene was

117

expressed in E. coli strain PB4144 (Kimura et al., 1979). In addition to lacZ promoter

repression, the bacterial cell contained a temperature sensitive supF suppressor gene

that allowed the cells to grow exponentially at 42°C without losing the ndd gene. Then

the temperature of the culture was lowered to 30°C before adding IPTG to induce the

expression of ndd gene (Bouet et al., 1996).

118

CHAPTER 5: CONCLUSIONS

Rotavirus is the major cause of the viral gastroenteritis contracted by young children

and infants worldwide. Death and hospitalisation resulting from the rotavirus disease

has enormously burdened the healthcare system in many countries, especially in the

developing countries. Therefore, much research on rotavirus disease has been carried

out to formulate treatment and prevention strategies for the disease. The non-structural

protein 4 (NSP4) has been identified as the antigenic enterotoxin that contributes to the

pathogenicity of rotavirus. As such, there is a broad interest in the biochemical

characteristics of NSP4 in order to discover any potential therapeutic and vaccination

application of the protein against rotavirus infection. Owing to this, abundant

production of NSP4 at the laboratory scale is needed for investigations of NSP4.

One of the commonest approaches to produce NSP4 in the laboratory setting is by

expressing the protein in Escherichia coli cells that carried the NSP gene-containing

expression plasmid. In this study, the NSP4 genes of both RV4 and RV5 human

rotavirus strain were cloned into T5 promoter and the T7 promoter based expression

plasmids, namely pQE60 and pET-28a(+), respectively. RNA polymerases mediate the

expression of NSP4 by both types of expression vectors which were also induced by

isopropyl-β-D-1-thiolgalactopyranoside (IPTG). The basal expression of the NSP4

protein was suppressed by the lac repressor acting on pQE60 as well as T7 lysozyme

acting on pET-28a(+).

Upon the IPTG induction of the NSP4 expression in E. coli, declining optical densities

of the bacterial culture profoundly indicated that NSP4 is toxic to the bacterial cells. The

NSP4 has likely distorted the bacterial membrane integrity and caused the lysis of

bacterial cells by the enzymatic mechanism. The delay observed in the decrease in

optical densities of the Rosetta-gami 2(DE3)pLysS5 cultures in comparison to M15

cultures suggested that the former cells were more tolerant to NSP4. This was further

supported by the higher overall optical densities of the Rosetta-gami 2(DE3)pLysS5

culture when compared to the M15 cultures. This could be due to the tighter control of

the basal NSP4 expression by the pLysS5 plasmids with their release of T7 lysozyme

119

that restricts the transcription of T7 RNA polymerase. Also, the use of Terrific broth to

cultivate the Rosetta-gami 2(DE3)pLysS5 cells may have enhanced the vitality of the

cells. Moreover, the vitality of the Rosetta-gami 2(DE3)pLysS5 cells was also improved

with the addition of glucose into the bacterial culture. The rare tRNA codon supplied by

the Rosetta-gami 2(DE3)pLysS5 cells support the complete expression of the full-length

NSP4. The Rosetta-gami 2(DE3)pLysS5 cells were also expected to be capable to

enhance the solubility of the expressed NSP4 to avoid inclusion bodies and protein

degradation .

The purification of abundant NSP4 proteins out of the E. coli cells remained a challenge

during this study. Lowering the cultivation temperature, decreasing the IPTG

concentration for induction and adding urea into the lysis buffer did not help in

obtaining NSP4 in abundance during the purification step. A possible solution to this

problem is to enhance the survival of E. coli cells when expressing the toxic NSP4 so

that NSP4 can be maintained in the bacterial cells without any exposure to protein

degradation. Hence, future experiments can be orientated at optimising the expression of

NSP4 in the E. coli cells. Firstly the basal expression of the toxic NSP4 needs to be

addressed. Possible solutions include the use of a new expression vector, changing to a

new bacterial host, the insertion of more repressor-acting sites on the promoter gene, the

modification of tRNA codons, reducing the copy number of the expression vectors prior

to the protein expression, the deactivation of RNA polymerase and the addition of

competitor plasmids. Another solution is the insertion of the cytolytic genes to remove

the expression vector-free cells during protein expression. In term of the protein

generation, the expressable NSP4 protein region may be co-expressed in fusion with

other type of non-toxic proteins such as glutathione S-transferase (GST), or ligated to a

synthetic peptide that represents the unexpressed or the toxic region of the NSP4.

120

CHAPTER 6: REFERENCES

Aalberse, R. C., and van Ree, R. (1997). Crossreactive carbohydrate determinants.

Clinical reviews in allergy and immunology, 15(4), 375-387.

Adams WR, Kraft L. (1963). Epizootic dirrhea of infant mice: Identification of the

etiologic agent. Science 141, 359-360.

Aeed, P. A., and Elhammer, A. P. (1994). Glycosylation of recombinant prorenin in

insect cells: The insect cell line Sf9 does not express the mannose 6-phosphate

recognition signal. Biochemistry, 33(29), 8793-8797.

Agathos, S. N. (1996). Insect cell bioreactors. Cytotechnology, 20(1-3), 173-189.

Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., and Watson, J. D. (1994).

Macromolecules: Structure, shape, and information. Molecular Biology of the Cell, 89-

138.

Aldinucci, D., Olivo, K., Lorenzon, D., Poletto, D., Gloghini, A., Carbone, A., and

Pinto, A. (2005). The role of interleukin-3 in classical Hodgkin's disease. Leuk

Lymphoma 46(3), 303-11.

Aldinucci, D., Poletto, D., Lorenzon, D., Nanni, P., Degan, M., Olivo, K., Rapana, B.,

Pinto, A., and Gattei, V. (2004). CD26 expression correlates with a reduced sensitivity

to 2'-deoxycoformycin-induced growth inhibition and apoptosis in T-cell

leukemia/lymphomas. Clin Cancer Res 10(2), 508-20.

Ali Mirazimi, Karl-Eric Magnusson and Lennart Svensson (2003). A cytoplasmic

region of the NSP4 enterotoxin of rotavirus is involved in retention in the endoplasmic

reticulum. Journal of General Virology (2003), 84, 875–883.

Altmann, F. (1996). N-glycosylation in insects revisited. Trends in Glycoscience and

Glycotechnology, 8(40), 101-114.

121

Altmann, F. (1997). More than silk and honey - or, can insect cells serve in the

production of therapeutic glycoproteins? Glycoconjugate Journal, 14(5), 643-646.

Altmann, F., and Marz, L. (1995). Processing of asparagine-linked oligosaccharides in

insect cells: Evidence for α-mannosidase II. Glycoconjugate Journal, 12(2), 150-155.

Altmann, F., Kornfeld, G., Dalik, T., Staudacher, E., and Glossl, J. (1993). Processing

of asparagine-linked oligosaccharides in insect cells. N-acetylglucosaminyltransferase I

and II activities in cultured lepidopteran cells. Glycobiology, 3(6), 619-625.

Altmann, F., Schweiszer, S., and Weber, C. (1995). Kinetic comparison of peptide: N-

glycosidases F and A reveals several differences in substrate specificity. Glycoconjugate

Journal, 12(1), 84-93.

Altmann, F., Schwihla, H., Staudacher, E., Glossl, J., and Marz, L. (1995). Insect cells

contain an unusual membrane-bound β-N-acetylglucosaminidase probably involved in

the processing of protein N-glycans. Journal of Biological Chemistry, 270(29), 17344-

17349.

Amann, E., Brosius, J., and Ptashne, M. (1983). Vectors bearing a hybrid trp-lac

promoter useful for regulated expression of cloned genes in Escherichia coli. Gene,

25(2-3), 167-178.

Amitai, G., and Pietrokovski, S. (1999). Fine-tuning an engineered intein. Nature

Biotechnology, 17(9), 854-855.

Amitai, G., and Pietrokovski, S. (1999). Fine-tuning an engineered intein. Nat

Biotechnol 17(9), 854-5.

Andrade, M. A., Chacon, P., Merelo, J. J., and Moran, F. (1993). Evaluation of

secondary structure of proteins from UV circular dichroism spectra using an

unsupervised learning neural network. Protein Engineering, 6(4), 383-390.

122

Angel, J., Tang, B., Feng, N., Greenberg, H. B., and Bass, D. (1998). Studies of the role

for NSP4 in the pathogenesis of homologous murine rotavirus diarrhea. Journal of

Infectious Diseases, 177(2), 455-458.

Anna, D. F., Rosa, M., Emilia, P., Simonetta, B., and Mosè, R. (2003). High-level

expression of Aliciclobacillus acidocaldarius thioredoxin in Pichia pastoris and Bacillus

subtilis. Protein Expression and Purification, 30(2), 179-184.

Arechaga, I., Miroux, B., Karrasch, S., Huijbregts, R., De Kruijff, B., Runswick, M. J.,

and Walker, J. E. (2000). Characterisation of new intracellular membranes in

Escherichia coli accompanying large scale over-production of the b subunit of F1F(o)

ATP synthase. FEBS Letters, 482(3), 215-219.

Armarego, W. L. F., Cotton, R. G. H., Dahl, H. H. M., and Dixon, N. E. (1989). High-

level expression of human dihydropteridine reductase (EC 1.6.99.7), without N-terminal

amino acid protection, in Escherichia coli. Biochemical Journal, 261(1), 265-268.

Arroyo, J., Boceta, M., Gonzalez, M. E., Michel, M., and Carrasco, L. (1995).

Membrane permeabilization by different regions of the human immunodeficiency virus

type 1 transmembrane glycoprotein gp41. Journal of Virology, 69(7), 4095-4102.

Asoh, S., Nishimaki, K., Nanbu-Wakao, R., and Ohta, S. (1998). A trace amount of the

human pro-apoptotic factor Bax induces bacterial death accompanied by damage of

DNA. Journal of Biological Chemistry, 273(18), 11384-11391.

Au, K. S., Chan, W. K., Burns, J. W., and Estes, M. K. (1989). Receptor activity of

rotavirus nonstructural glycoprotein NS28. Journal of Virology, 63(11), 4553-4562.

Au, K. S., Mattion, N. M., and Estes, M. K. (1993). A subviral particle binding domain

on the rotavirus nonstructural glycoprotein NS28. Virology, 194(2), 665-673.

Awram, P., and Smit, J. (1998). The Caulobacter crescentus paracrystalline S-layer

protein is secreted by an ABC transporter (Type I) secretion apparatus. Journal of

Bacteriology, 180(12), 3062-3069.

123

Ball, J. M., Mitchell, D. M., Gibbons, T. F., and Parr, R. D. (2005). Rotavirus NSP4: A

multifunctional viral enterotoxin. Viral Immunology, 18(1), 27-40.

Ball, J. M., Tian, P., Zeng, C. Q. Y., Morris, A. P., and Estes, M. K. (1996). Age-

dependent diarrhea induced by a rotaviral nonstructural glycoprotein. Science,

272(5258), 101-104.

Ball, J. M., Swaggerty, C. L., Pei, X., Lim, W. S., Xu, X., Cox, V. C., & Payne, S. L.

(2005). SU proteins from virulent and avirulent EIAV demonstrate distinct biological

properties. Virology, 333(1), 132-144.

Baneyx, F. (1999). Recombinant protein expression in Escherichia coli. Current

Opinion in Biotechnology, 10(5), 411-421.

Barnard, G. C., Henderson, G. E., Srinivasan, S., and Gerngross, T. U. (2004). High

level recombinant protein expression in Ralstonia eutropha using T7 RNA polymerase

based amplification. Protein Expression and Purification, 38(2), 264-271.

Barnes, L. M., Bentley, C. M., and Dickson, A. J. (2003). Stability of protein production

from recombinant mammalian cells. Biotechnology and Bioengineering, 81(6), 631-639.

Baumert, T. F., Ito, S., Wong, D. T., and Liang, T. J. (1998). Hepatitis C virus structural

proteins assemble into viruslike particles in insect cells. Journal of Virology, 72(5),

3827-3836.

Becker, G. W., Miller, J. R., Kovacevic, S., Ellis, R. M., Louis, A. I., Small, J. S., Stark,

D. H., Roberts, E. F., Wyrick, T. K., Hoskins, J., Chiou, X. G., Sharp, J. D., McClure,

D. B., Riggin, R. M., and Kramer, R. M. (1994). Characterization by electrospray mass

spectrometry of human Ca2+- sensitive cytosolic phospholipase A2 produced in

baculovirus-infected insect cells. Bio/Technology, 12(1), 69-74.

Beckwith, J. R., and Zipser, D. (1970). The Lactose Operon.

124

Belyaev, A. S. (1995). High-level expression of five foreign genes by a single

recombinant baculovirus. Gene, 156(2), 229-233.

Bergmann, C. C., Maass, D., Poruchynsky, M. S., Atkinson, P. H., and Bellamy, A. R.

(1989). Topology of the non-structural rotavirus receptor glycoprotein NS28 in the

rough endoplasmic reticulum. EMBO Journal, 8(6), 1695-1703.

Bernard, A. R., Kost, T. A., Overton, L., Cavegn, C., Young, J., Bertrand, M., Yahia-

Cherif, Z., Chabert, C., and Mills, A. (1994). Recombinant protein expression in a

Drosophila cell line: comparison with the baculovirus system. Cytotechnology, 15(1-3),

139-144.

Bernard, A. R., Lusti-Narasimhan, M., Radford, K. M., Hale, R. S., Sebille, E., and

Graber, P. (1996). Downstream processing of insect cell cultures. Cytotechnology, 20(1-

3), 239-257.

Bessette, P. H., Åslund, F., Beckwith, J., and Georgiou, G. (1999). Efficient folding of

proteins with multiple disulfide bonds in the Escherichia coli cytoplasm. Proceedings of

the National Academy of Sciences of the United States of America, 96(24), 13703-

13708.

Betton, J. M. (2003). Rapid Translation System (RTS): A promising alternative for

recombinant protein production. Current Protein and Peptide Science, 4(1), 73-80.

Bingle, W. H., Nomellini, J. F., and Smit, J. (2000). Secretion of the Caulobacter

crescentus S-layer protein: Further localization of the C-terminal secretion signal and its

use for secretion of recombinant proteins. Journal of Bacteriology, 182(11), 3298-3301.

Bishop RF, D. G., Holmes IH, Ruck BJ. (1973). Virus particles in epithelial cells of

duodenal mucosa from children with acute non-bacterial gastroenteritis. Lancet 2, 1281-

1283.

Bok, K., Bishop, R. F., and Conner, M. E. (2003). Rotavirus antigenaemia and viraemia:

A common event? Lancet, 362(9394), 1445-1449.

125

Bocanegra, J. A., Bejarano, L. A., and Valdivia, M. M. (1997). Expression of the highly

toxic centromere binding protein CENP-B in E. coli using the pET system in the

absence of the inducer IPTG. BioTechniques, 22(5), 798-802.

Boomershine, W. P., Raj, M. L. S., Gopalan, V., and Foster, M. P. (2003). Preparation

of uniformly labeled NMR samples in Escherichia coli under the tight control of the

araBAD promoter: Expression of an archaeal homolog of the RNase P Rpp29 protein.

Protein Expression and Purification, 28(2), 246-251.

Both, G. W., Siegman, L. J., Bellamy, A. R., and Atkinson, P. H. (1983). Coding

assignment and nucleotide sequence of simian rotavirus SA11 gene segment 10:

Location of glycosylation sites suggests that the signal peptide is not cleaved. Journal of

Virology, 48(2), 335-339.

Bouet, J. Y., Campo, N. J., Krisch, H. M., and Louarn, J. M. (1996). The effects on

Escherichia coli of expression of the cloned bacteriophage T4 nucleoid disruption (ndd)

gene. Molecular Microbiology, 20(3), 519-528.

Bouet, J. Y., Krisch, H. M., and Louarn, J. M. (1998). Ndd, the bacteriophage T4

protein that disrupts the Escherichia coli nucleoid, has a DNA binding activity. Journal

of Bacteriology, 180(19), 5227-5230.

Bowers, L. M., Lapoint, K., Anthony, L., Pluciennik, A., and Filutowicz, M. (2004).

Bacterial expression system with tightly regulated gene expression and plasmid copy

number. Gene, 340(1), 11-18.

Boyle, J. F., and Holmes, K. V. (1986). RNA-binding proteins of bovine rotavirus. J

Virol 58(2), 561-8.

Braaz, R., Wong, S. L., and Jendrossek, D. (2002). Production of PHA depolymerase A

(PhaZ5) from Paucimonas lemoignei in Bacillus subtilis. FEMS Microbiology Letters,

209(2), 237-241.

126

Bravo-Luna, M., Orsatti, M., and Poletto, L. (2000). Tachycardia: an autosomal,

monogenic, biallelic, recessive trait. Med Hypotheses 54(2), 307-9.

Brawner, M. E. (1994). Advances in heterologous gene expression by streptomyces.

Current Opinion in Biotechnology, 5(5), 475-481.

Bresee, J. S., Parashar, U. D., Gentsch, J. R., and Glass, R. I. (1999). Rotavirus

vaccines: Review, rationale and prospects. Vaccines: Children and Practice, 2(1), 8-11.

Brinkmann, U., Mattes, R. E., & Buckel, P. (1989). High-level expression of

recombinant genes in Escherichia coli is dependent on the availability of the dnaY gene

product. Gene, 85(1), 109-114.

Brosius, J. (1984). Toxicity of an overproduced foreign gene product in Escherichia coli

and its use in plasmid vectors for the selection of transcription terminators. Gene, 27(2),

161-172.

Brosius, J., Erfle, M., and Storella, J. (1985). Spacing of the -10 and -35 regions in the

tac promoter. Effect on its in vivo activity. Journal of Biological Chemistry, 260(6),

3539-3541.

Brown, W. C., and Campbell, J. L. (1993). A new cloning vector and expression

strategy for genes encoding proteins toxic to Escherichia coli. Gene, 127(1), 99-103.

Browne, E. P., Bellamy, A. R., and Taylor, J. A. (2000). Membrane-destabilizing

activity of rotavirus NSP4 is mediated by a membrane-proximal amphipathic domain. J

Gen Virol, 81(Pt 8), 1955-1959.

Bryden, A. S., Thouless, M. E., and Flewett, T. H. (1976). Rotavirus and rabbits.

Veterinary Record, 99(16), 323.

Buckingham, S. D., Matsuda, K., Hosie, A. M., Baylis, H. A., Squire, M. D., Lansdell,

127

S. J., Millar, N. S., and Sattelle, D. B. (1996). Wild-type and insecticide-resistant homo-

oligomeric GABA receptors of Drosophila melanogaster stably expressed in a

Drosophila cell line. Neuropharmacology, 35(9-10), 1393-1401.

Burger, S., Tatge, H., Hofmann, F., Genth, H., Just, I., and Gerhard, R. (2003).

Expression of recombinant Clostridium difficile toxin A using the Bacillus megaterium

system. Biochemical and Biophysical Research Communications, 307(3), 584-588.

Bylund, F., Castan, A., Mikkola, R., Veide, A., and Larsson, G. (2000). Influence of

scale-up on the quality of recombinant human growth hormone. Biotechnology and

Bioengineering, 69(2), 119-128.

Cahoreau, C. (1994). Evidence for N-glycosylation and ubiquitination of the prolactin

receptor expressed in a baculovirus-insect cell system. FEBS Letters, 350(2-3), 230-234.

Carrasco, L. (1995). Modification of membrane permeability by animal viruses.

Advances in Virus Research, 45, 61-112.

Chalmers, J. J. (1996). Shear sensitivity of insect cells. Cytotechnology, 20(1-3), 163-

171.

Chan, L. C. L., Greenfield, P. F., and Reid, S. (1998). Optimising fed-batch production

of recombinant proteins using the baculovirus expression vector system. Biotechnology

and Bioengineering, 59(2), 178-188.

Chan, W. K., Au, K. S., and Estes, M. K. (1988). Topography of the simian rotavirus

nonstructural glycoprotein (NS28) in the endoplasmic reticulum membrane. Virology,

164(2), 435-442.

Chen, E. (1995). Host strain selection for bacterial expression of toxic proteins. Methods

in Enzymology, 241, 29-46 Publication year 1994.

128

Chen, J. M., Dando, P. M., Rawlings, N. D., Brown, M. A., Young, N. E., Stevens, R.

A., Hewitt, E., Watts, C., and Barrett, A. J. (1997). Cloning, isolation, and

characterization of mammalian legumain, an asparaginyl endopeptidase. J Biol Chem

272(12), 8090-8.

Chen, W., Shen, Q. X., and Bahl, O. P. (1991). Carbohydrate variant of the recombinant

β-subunit of human choriogonadotropin expressed in baculovirus expression system.

Journal of Biological Chemistry, 266(7), 4081-4087.

Cho, H. Y., Yukawa, H., Inui, M., Doi, R. H., and Wong, S. L. (2004). Production of

minicellulosomes from Clostridium cellulovorans in Bacillus subtilis WB800. Applied

and Environmental Microbiology, 70(9), 5704-5707.

Choi, J. H., and Lee, S. Y. (2004). Secretory and extracellular production of

recombinant proteins using Escherichia coli. Applied Microbiology and Biotechnology,

64(5), 625-635.

Chung, I. S., Taticek, R. A., and Shuler, M. L. (1993). Production of human alkaline

phosphatase, a secreted, glycosylated protein, from a baculovirus expression system and

the attachment-dependent cell line Trichoplusia ni BTI-Tn 5B1-4 using a split-flow, air-

lift bioreactor. Biotechnology Progress, 9(6), 675-678.

Comacchio, F., D'Eredita, R., Poletto, E., Poletti, A., and Marchiori, C. (1995).

Hemangiopericytoma of the skull base and Collet-Sicard syndrome: a case report. Ear

Nose Throat J 74(12), 845-7.

Cruickshank, J. G., Axton, J. H., and Webster, O. F. (1974). Letter: Viruses in

gastroenteritis. Lancet, 1(7870), 1353.

Daguer, J. P., Chambert, R., and Petit-Glatron, M. F. (2005). Increasing the stability of

sacB transcript improves levansucrase production in Bacillus subtilis. Letters in Applied

Microbiology, 41(2), 221-226.

129

Dai, X., Willis, L. G., Palli, S. R., and Theilmann, D. A. (2005). Tight transcriptional

regulation of foreign genes in insect cells using an ecdysone receptor-based inducible

system. Protein Expression and Purification, 42(2), 236-245.

Daly, R., and Hearn, M. T. W. (2005). Expression of heterologous proteins in Pichia

pastoris: A useful experimental tool in protein engineenring and production. Journal of

Molecular Recognition, 18(2), 119-138.

Davies, A. H. (1994). Current methods for manipulating baculoviruses. Bio/Technology,

12(1), 47-50.

Davies, A., and Morgan, B. P. (1993). Expression of the glycosylphosphatidylinositol-

linked complement-inhibiting protein CD59 antigen in insect cells using a baculovirus

vector. Biochemical Journal, 295(3), 889-896.

Davis, T. R., and Wood, H. A. (1995). Intrinsic glycosylation potentials of insect cell

cultures and insect larvae. In Vitro Cellular and Developmental Biology - Animal, 31(9),

659-663.

Davis, T. R., Shuler, M. L., Granados, R. R., and Wood, H. A. (1993). Comparison of

oligosaccharide processing among various insect cell lines expressing a secreted

glycoprotein. In Vitro Cellular and Developmental Biology - Animal, 29 A(11), 842-

846.

de Alteriis, E., Silvestro, G., Poletto, M., Romano, V., Capitanio, D., Compagno, C.,

and Parascandola, P. (2004). Kluyveromyces lactis cells entrapped in Ca-alginate beads

for the continuous production of a heterologous glucoamylase. J Biotechnol 109(1-2),

83-92.

De Boer, H. A., Comstock, L. J., and Vasser, M. (1983). The tac promoter: a functional

hybrid derived from the trp and lac promoters. Proceedings of the National Academy of

Sciences of the United States of America, 80(1), 21-25.

130

Deepa, R., Jagannath, M. R., Kesavulu, M. M., Rao, C. D., & Suguna, K. (2004).

Expression, purification, crystallization and preliminary crystallographic analysis of the

diarrhoea-causing and virulence-determining region of rotaviral nonstructural protein

NSP4. Acta Crystallographica Section D: Biological Crystallography, 60(1), 135-136.

Degenkolb, J., Takahashi, M., Ellestad, G. A., and Hillen, W. (1991). Structural

requirements of tetracycline-Tet repressor interaction: Determination of equilibrium

binding constants for tetracycline analogs with the Tet repressor. Antimicrobial Agents

and Chemotherapy, 35(8), 1591-1595.

Delisa, M. P., Li, J., Rao, G., Weigand, W. A., and Bentley, W. E. (1999). Monitoring

GFP-operon fusion protein expression during high cell density cultivation of

Escherichia coli using an on-line optical sensor. Biotechnology and Bioengineering,

65(1), 54-64.

Del Tito Jr, B. J., Ward, J. M., Hodgson, J., Gershater, C. J. L., Edwards, H., Wysocki,

L. A., Watson, F. A., Sathe, G., & Kane, J. F. (1995). Effects of a minor isoleucyl tRNA

on heterologous protein translation in Escherichia coli. Journal of Bacteriology,

177(24), 7086-7091.

Desplancq, D., Bernard, C., Sibler, A. P., Kieffer, B., Miguet, L., Potier, N., Van

Dorsselaer, A., and Weiss, E. (2005). Combining inducible protein overexpression with

NMR-grade triple isotope labeling in the cyanobacterium Anabaena sp. PCC 7120.

BioTechniques, 39(3), 405-411.

Dong, H., Nilsson, L., and Kurland, C. G. (1996). Co-variation of tRNA abundance and

codon usage in Escherichia coli at different growth rates. Journal of Molecular Biology,

260(5), 649-663.

Dong, Y., Zeng, C. Q. Y., Ball, J. M., Estes, M. K., & Morris, A. P. (1997). The

rotavirus enterotoxin NSP4 mobilizes intracellular calcium in human intestinal cells by

stimulating phospholipase C-mediated inositol 1,4,5-trisphosphate production.

Proceedings of the National Academy of Sciences of the United States of America,

94(8), 3960-3965.

131

Donnelly, M. I., Stevens, P. W., Stols, L., Xiaoyin Su, S., Tollaksen, S., Giometti, C.,

and Joachimiak, A. (2001). Expression of a highly toxic protein, bax, in Escherichia coli

by attachment of a leader peptide derived from the GroES cochaperone. Protein

Expression and Purification, 22(3), 422-429.

Dubendorff, J. W., and Studier, F. W. (1991). Controlling basal expression in an

inducible T7 expression system by blocking the target T7 promoter with lac repressor.

Journal of Molecular Biology, 219(1), 45-59.

Edward P. Browne, A. Richard Bellamy and John A. (2000). Membrane-destabilizing

activity of rotavirus NSP4 is mediated by a membrane-proximal amphipathic domain.

Journal of General Virology, 81, 1955–1959.

Egan, S. M., and Schleif, R. F. (1993). A regulatory cascade in the induction of

rhaBAD. Journal of Molecular Biology, 234(1), 87-98.

Einspahr, K. J., Maeda, M., and Thompson, G. A., Jr. (1988). Concurrent changes in

Dunaliella salina ultrastructure and membrane phospholipid metabolism after

hyperosmotic shock. J Cell Biol 107(2), 529-38.

Elhammer, A. P. (1991). Characterization of oligosaccharide structures on a chimeric

respiratory syncytial virus protein expressed in insect cell line Sf9. Biochemistry,

30(11), 2863-2868.

Elroy-Stein, O., Fuerst, T. R., & Moss, B. (1989). Cap-independent translation of

mRNA conferred by encephalomyocarditis virus 5' sequence improves the performance

of the vaccinia virus/bacteriophage T7 hybrid expression system. Proceedings of the

National Academy of Sciences of the United States of America, 86(16), 6126-6130.

Elvin, C. M., Thompson, P. R., Argall, M. E., Hendry, P., Stamford, N. P. J., Lilley, P.

E., and Dixon, N. E. (1990). Modified bacteriophage lambda promoter vectors for

overproduction of proteins in Escherichia coli. Gene, 87(1), 123-126.

132

Enfors, S. O. (1992). Control of in vivo proteolysis in the production of recombinant

proteins. Trends in Biotechnology, 10(9), 310-315.

England, D. F., Penfold, R. J., Delaney, S. F., and Rogers, P. L. (1997). Isolation of

Bacillus megaterium mutants that produce high levels of heterologous protein, and their

use to construct a highly mosquitocidal strain. Current Microbiology, 35(2), 71-76.

Enouf V, Langella P, Commissaire J, Cohen J, Corthier G. (2001). Bovine rotavirus

nonstructural protein 4 produced by Lactococcus lactis is antigenic and immunogenic.

Appl Environ Microbiol. 2001 Apr;67(4):1423-8.

Epand, R. M., Shai, Y., Segrest, J. P., and Anantharamaiah, G. M. (1995). Mechanisms

for the modulation of membrane bilayer properties by amphipathic helical peptides.

Biopolymers - Peptide Science Section, 37(5), 319-338.

Ericson, B. L., Graham, D. Y., & Mason, B. B. (1983). Two types of glycoprotein

precursors are produced by the simian rotavirus SA11. Virology, 127(2), 320-332.

Ernst, W. J., Grabherr, R. M., and Katinger, H. W. D. (1994). Direct cloning into the

Autographa californica nuclear polyhedrosis virus for generation of recombinant

baculoviruses. Nucleic Acids Research, 22(14), 2855-2856.

Ernst, W., Grabherr, R., Wegner, D., Borth, N., Grassauer, A., and Katinger, H. (1998).

Baculovirus surface display: Construction and screening of a eukaryotic epitope library.

Nucleic Acids Research, 26(7), 1718-1723.

Estes, M. (2001). Rotaviruses and Their Replication. Fourth ed. In "Fields virology" (P.

M. H. D. M. Knipe, D. E. Griffin, R. A. Lamb, M. A. Martin, B. Roizman, and S. E.

Straus, Ed.), pp. 1747-1785. Lippincott Williams and Wilkins, Philadelphia, Pa.

Estes, M. K. (1996). Rotavirus and their Replication. Virology III.

Evans Jr, T. C., Benner, J., and Xu, M. Q. (1998). Semisynthesis of cytotoxic proteins

using a modified protein splicing element. Protein Science, 7(11), 2256-2264.

133

Fabian, J. R., Kimball, S. R., and Jefferson, L. S. (1998). Reconstitution and purification

of eukaryotic initiation factor 2B (eIF2B) expressed in Sf21 insect cells. Protein


FitzGerald, K. A., and Lidstrom, M. E. (2003). Overexpression of a heterologous

protein, haloalkane dehalogenase, in a poly-β-hydroxybutyrate-deficient strain of the

facultative methylotroph Methylobacterium extorquens AM1. Biotechnology and

Bioengineering, 81(3), 263-268.

Flewett, T. H., Bryden, A. S., and Davies, H. (1975). Letter: Virus diarrhoea in foals

and other animals. Veterinary Record, 96(21).

Flewett, T. H., Bryden, A. S., and Davies, H. (1974). Relation between viruses from

acute gastroenteritis of children and newborn calves. Lancet, 2, 61-63.

Flewett, T. H., Bryden, A. S., and Davies, H. (1973). Letter: Virus particles in

gastroenteritis. Lancet, 2, 1497.

Foster, J. M., Yudkin, B., Lockyer, A. E., and Roberts, D. B. (1995). Cloning and

sequence analysis of GmII, a Drosophila melanogaster homologue of the cDNA

encoding murine Golgi α-mannosidase II. Gene, 154(2), 183-186.

Funke, C., Becker, S., Dartsch, H., Klenk, H. D., and Muhlberger, E. (1995). Acylation

of the Marburg virus glycoprotein. Virology, 208(1), 289-297.

Gazzano, A. M., Poletto, T. A., Gorgerino, F., and Sapienza, S. (1974). [Poisoning by

sedatives]. Ann Osp Maria Vittoria Torino 17(1-6), 101-21.

Geissendorfer, M., and Hillen, W. (1990). Regulated expression of heterologous genes

in Bacillus subtilis using the Tn10 encoded tet regulatory elements. Applied

Microbiology and Biotechnology, 33(6), 657-663.

134

Georgiou, G., and Segatori, L. (2005). Preparative expression of secreted proteins in

bacteria: Status report and future prospects. Current Opinion in Biotechnology, 16(5),

538-545.

Gerdes, K., Jacobsen, J. S., and Franch, T. (1997). Plasmid stabilization by post-

segregational killing. Genetic engineering, 19, 49-61.

Glass, R. I., Bresee, J. S., Turcios, R., Fischer, T. K., Parashar, U. D., and Steele, A. D.

(2005). Rotavirus vaccines: Targeting the developing world. Journal of Infectious

Diseases, 192(SUPPL. 1), S160-S166.

Goldman, E., Rosenberg, A. H., Zubay, G., and Studier, F. W. (1995). Consecutive low-

usage leucine codons block translation only when near the 5' end of a message in

Escherichia coli. Journal of Molecular Biology, 245(5), 467-473.

Gorczyca, M. G., Phillis, R. W., and Budnik, V. (1994). The role of tinman, a

mesodermal cell fate gene, in axon pathfinding during the development of the transverse

nerve in Drosophila. Development, 120(8), 2143-2152.

Grabenhorst, E., Hofer, B., Nimitz, M., Jager, V., and Conradt, H. S. (1993).

Biosynthesis and secretion of human interleukin 2 glycoprotein variants from

baculovirus-infected Sf21 cells. European Journal of Biochemistry, 215(1), 189-197.

Gray, J., Vesikari, T., Van Damme, P., Giaquinto, C., Mrukowicz, J., Guarino, A.,

Dagan, R., Szajewska, H., and Usonis, V. (2008). Rotavirus. Journal of Pediatric

Gastroenterology and Nutrition, 46(SUPPL. 2), S24-S31.

Gronenborn, B. (1976). Overproduction of phage lambda repressor under control of the

lac promoter of Escherichia coli. Molecular and General Genetics, 148(3), 243-250.

Grossman, T. H., Kawasaki, E. S., Punreddy, S. R., and Osburne, M. S. (1998).

Spontaneous cAMP-dependent derepression of gene expression in stationary phase

plays a role in recombinant expression instability. Gene, 209(1-2), 95-103.

135

Guinea, R. (1994). Influenza virus M2 protein modifies membrane permeability in E.

coli cells. FEBS Letters, 343(3), 242-246.

Gutiérrez, J., Bourque, D., Criado, R., Choi, Y. J., Cintas, L. M., Hernández, P. E., and

Míguez, C. B. (2005). Heterologous extracellular production of enterocin P from

Enterococcus faecium P13 in the methylotrophic bacterium Methylobacterium

extorquens. FEMS Microbiology Letters, 248(1), 125-131.

Guzman, E., and McCrae, M. A. (2005). Molecular characterization of the rotavirus

NSP4 enterotoxin homologue from group B rotavirus. Virus Research, 110(1-2), 151-

160.

Guzman, L. M., Belin, D., Carson, M. J., and Beckwith, J. (1995). Tight regulation,

modulation, and high-level expression by vectors containing the arabinose P(BAD)

promoter. Journal of Bacteriology, 177(14), 4121-4130.

Halaihel, N., Lievin, V., Ball, J. M., Estes, M. K., Alvarado, F., & Vasseur, M. (2000).

Direct inhibitory effect of rotavirus NSP4(114-135) peptide on the Na+-D-glucose

symporter of rabbit intestinal brush border membrane. Journal of Virology, 74(20),

9464-9470.

Haldimann, A., Daniels, L. L., and Wanner, B. L. (1998). Use of new methods for

construction of tightly regulated arabinose and rhamnose promoter fusions in studies of

the Escherichia coli phosphate regulon. Journal of Bacteriology, 180(5), 1277-1286.

Hall, T. A., and Brown, J. W. (2002). Archaeal RNase P has multiple protein subunits

homologous to eukaryotic nuclear RNase P proteins. RNA, 8(3), 296-306.

Hamilton, J. R., Middleton, P. J., and Gall, D. G. (1974). Virus particles in duodenal

biopsy specimens. Lancet, 1(7858), 633.

Hannig, G., and Makrides, S. C. (1998). Strategies for optimizing heterologous protein

expression in Escherichia coli. Trends in Biotechnology, 16(2), 54-60.

136

Hansson, M., Samuelson, P., Nguyen, T. N., and Ståhl, S. (2002). General expression

vectors for Staphylococcus carnosus enabled efficient production of the outer membrane

protein A of Klebsiella pneumoniae. FEMS Microbiology Letters, 210(2), 263-270.

Hard, K., Van Doorn, J. M., Thomas-Oates, J. E., Kamerling, J. P., and Van der Horst,

D. J. (1993). Structure of the Asn-linked oligosaccharides of apolipophorin III from the

insect Locusta migratoria. Carbohydrate-linked 2-aminoethylphosphonate as a

constituent of a glycoprotein. Biochemistry, 32(3), 766-775.

Harris, L. J., Baillie, D. L., and Rose, A. M. (1988). Sequence identity between an

inverted repeat family of transposable elements in Drosophila and Caenorhabditis.

Nucleic Acids Res 16(13), 5991-8.

Hasan, N., and Szybalski, W. (1987). Control of cloned gene expression by promoter

inversion in vivo: construction of improved vectors with a multiple cloning site and the

ptac promoter. Gene, 56(1), 145-151.

Hase, S., Koyama, S., Daiyasu, H., Takemoto, H., Hara, S., Kobayashi, Y., Kyogoku,

Y., and Ikenaka, T. (1986). Structure of a sugar chain of a protease inhibitor isolated

from Barbados pride (Caesalpinia pulcherrima Sw.) seeds. Journal of Biochemistry,

100(1), 1-10.

Hasemann, C. A., and Capra, J. D. (1990). High-level production of a functional

immunoglobulin heterodimer in a baculovirus expression system. Proceedings of the


Haskins, D. (2004) EPICENTRE Forum 11 (5), 6.

Heldens, J. G. M., Kester, H. A., Zuidema, D., and Vlak, J. M. (1997). Generation of a

p10-based baculovirus expression vector in yeast with infectivity for insect larvae and

insect cells. Journal of Virological Methods, 68(1), 57-63.

137

Henner, D. J. (1990). Inducible expression of regulatory genes in Bacillus subtilis.

Methods in Enzymology, 185, 223-228.

Hillen, W., and Berens, C. (1994). Mechanisms underlying expression of Tn10 encoded

tetracycline resistance. Annual Review of Microbiology, 48, 345-369.

Hink, W. F. (1991). Expression of Three Recombinant Proteins Using Baculovirus

Vectors in 23 Insect Cell Lines. Biotechnology Progress, 7(1), 9-14.

Hockney, R. C. (1994). Recent developments in heterologous protein production in

Escherichia coli. Trends in Biotechnology, 12(11), 456-463.

Hogeland Jr, K. E., and Deinzer, M. L. (1994). Mass spectrometric studies on the N-

linked oligosaccharides of baculovirus-expressed mouse interleukin-3. Biological Mass

Spectrometry, 23(4), 218-224.

Hollister, J. R., Shaper, J. H., and Jarvis, D. L. (1998). Stable expression of mammalian

β1,4-galactosyltransferase extends the N-glycosylation pathway in insect cells.

Glycobiology, 8(5), 473-480.

Holmes, I. H., Mathan, M., Bhat, P., Albert, M. J., Swaminathan, S. P., Maiya, P. P.,

Pereira, S. M., and Baker, S. J. (1974). Letter: Orbiviruses and gastroenteritis. Lancet,

2(7881), 658-659.

Horie, Y., Nakagomi, O., Koshimura, Y., Nakagomi, T., Suzuki, Y., Oka, T., Sasaki, S.,

Matsuda, Y., and Watanabe, S. (1999). Diarrhea induction by rotavirus NSP4 in the

homologous mouse model system. Virology, 262(2), 398-407.

Horinouchi, S., and Weisblum, B. (1982). Nucleotide sequence and functional map of

pE194, a plasmid that specifies inducible resistance to macrolide, lincosamide, and

streptogramin type B antibiotics. Journal of Bacteriology, 150(2), 804-814.

138

Hou, Z., Huang, Y., Huan, Y., Pang, W., Meng, M., Wang, P., Yang, M., Jiang, L., Cao,

X., and Wu, K. K. (2008). Anti-NSP4 antibody can block rotavirus-induced diarrhea in

mice. Journal of Pediatric Gastroenterology and Nutrition, 46(4), 376-385.

Hsieh, P., and Robbins, P. W. (1984). Regulation of asparagine-linked oligosaccharide

processing. Oligosaccharide processing in Aedes albopictus mosquito cells. Journal of

Biological Chemistry, 259(4), 2375-2382.

Hsu, T. A., and Betenbaugh, M. J. (1997). Coexpression of molecular chaperone BiP

improves immunoglobulin solubility and IgG secretion from trichoplusia ni insect cells.

Biotechnology Progress, 13(1), 96-104.

Hsu, T. A., Eiden, J. J., and Betenbaugh, M. J. (1994). Engineering the assembly

pathway of the baculovirus-insect cell expression system. Annals of the New York

Academy of Sciences, 721, 208-217.

Hsu, T. A., Eiden, J. J., Bourgarel, P., Meo, T., and Betenbaugh, M. J. (1994). Effects of

co-expressing chaperone BiP on functional antibody production in the baculovirus

system. Protein Expression and Purification, 5(6), 595-603.

Hsu, T. A., Takahashi, N., Tsukamoto, Y., Kato, K., Shimada, I., Masuda, K., Whiteley,

E. M., Fan, J. Q., Lee, Y. C., and Betenbaugh, M. J. (1997). Differential N-glycan

patterns of secreted and intracellular IgG produced in Trichoplusia ni cells. Journal of


Hua, J., Chen, X., and Patton, J. T. (1994). Deletion mapping of the rotavirus

metalloprotein NS53 (NSP1): the conserved cysteine-rich region is essential for virus-

specific RNA binding. J Virol 68(6), 3990-4000.

Huang, H. C., Sherman, M. Y., Kandror, O., and Goldberg, A. L. (2001). The Molecular

Chaperone DnaJ Is Required for the Degradation of a Soluble Abnormal Protein in

Escherichia coli. Journal of Biological Chemistry, 276(6), 3920-3928.

139

Huybrechts, R., Vulsteke, V., Poels, J., Lauwers, E., Broeck, J. V., and De Loof, A.

(1997). Recombinant protein expression in insect cell systems. Belgian Journal of

Zoology, 127(1), 35-45.

Ichikawa, Y., Yamagata, H., Tochikubo, K., and Udaka, S. (1993). Very efficient

extracellular production of cholera toxin B subunit using Bacillus brevis. FEMS

Microbiology Letters, 111(2-3), 219-224.

Ikonomou, L., Schneider, Y. J., and Agathos, S. N. (2003). Insect cell culture for

industrial production of recombinant proteins. Applied Microbiology and


Imperiali, B., and Rickert, K. W. (1995). Conformational implications of asparagine-

linked glycosylation. Proceedings of the National Academy of Sciences of the United

States of America, 92(1), 97-101.

Inoue, Y., Ohta, T., Tada, H., Iwasa, S., Udaka, S., and Yamagata, H. (1997). Efficient

production of a functional mouse/human chimeric Fab' against human urokinase-type

plasminogen activator by Bacillus brevis. Applied Microbiology and Biotechnology,

48(4), 487-492.

Ioffe, E., and Stanley, P. (1994). Mice lacking N-acetylglucosaminyltransferase I

activity die at mid- gestation, revealing an essential role for complex or hybrid N-linked

carbohydrates. Proceedings of the National Academy of Sciences of the United States of

America, 91(2), 728-732.

Ishihara, H., Takahashi, N., Oguri, S., and Tejima, S. (1979). Complete structure of the

carbohydrate moiety of stem bromelain. An application of the almond glycopeptidase

for structural studies of glycopeptides. Journal of Biological Chemistry, 254(21),

10715-10719.

Jagannath, M. R., Kesavulu, M. M., Deepa, R., Sastri, P. N., Kumar, S. S., Suguna, K.,

& Rao, C. D. (2006). N- and C-terminal cooperation in rotavirus enterotoxin: Novel

mechanism of modulation of the properties of a multifunctional protein by a structurally

140

and functionally overlapping conformational domain. Journal of Virology, 80(1), 412-

425.

Jäger, V. (1996). Perfusion bioreactors for the production of recombinant proteins in

insect cells. Cytotechnology, 20(1-3), 191-198.

Jäger, V., Chico, F., Ackermann, M., Nimtz, N., Grabenhorst, E., and Conradt, H. S.

(1998). Proc Int Glyco Bio Technology Symp Braunschweig, 1, 13.

James, D. C., Freedman, R. B., Hoare, M., Ogonah, O. W., Rooney, B. C., Larlonov, O.

A., Dobrovolsky, V. N., Lagutin, O. V., and Jenkins, N. (1995). N-glycosylation of

recombinant human interferon-χ produced in different animal expression systems.

Bio/Technology, 13(6), 592-596.

James, D. C., Goldman, M. H., Hoare, M., Jenkins, N., Oliver, R. W. A., Green, B. N.,

and Freedman, R. B. (1996). Posttranslational processing of recombinant human

interferon-γ in animal expression systems. Protein Science, 5(2), 331-340.

Jan, L. Y., and Jan, Y. N. (1982). Antibodies to horseradish peroxidase as specific

neuronal markers in Drosophila and in grasshopper embryos. Proceedings of the


Janknecht, R., De Martynoff, G., Lou, J., Hipskind, R. A., Nordheim, A., and

Stunnenberg, H. G. (1991). Rapid and efficient purification of native histidine-tagged

protein expressed by recombinant vaccinia virus. Proceedings of the National Academy

of Sciences of the United States of America, 88(20), 8972-8976.

Jarvis, D. L., and Finn, E. E. (1996). Modifying the insect cell N-glycosylation pathway

with immediate early baculovirus expression vectors. Nature Biotechnology, 14(10),

1288-1292.

Jarvis, D. L., and Summers, M. D. (1989). Glycosylation and secretion of human tissue

plasminogen activator in recombinant baculovirus-infected insect cells. Molecular and

Cellular Biology, 9(1), 214-223.

141

Jarvis, D. L., Bohlmeyer, D. A., Liao, Y. F., Lomax, K. K., Merkle, R. K., Weinkauf,

C., and Moremen, K. W. (1997). Isolation and characterization of a class II α-

mannosidase cDNA from lepidopteran insect cells. Glycobiology, 7(1), 113-127.

Jensen, E. B., and Carlsen, S. (1990). Production of recombinant human growth

hormone in Escherichia coli: Expression of different precursors and physiological

effects of glucose, acetate, and salts. Biotechnology and Bioengineering, 36(1), 1-11.

Johansson, J., Mandin, P., Renzoni, A., Chiaruttini, C., Springer, M., and Cossart, P.

(2002). An RNA thermosensor controls expression of virulence genes in Listeria

monocytogenes. Cell, 110(5), 551-561.

Joly, J. C. (1994). Protein folding activities of escherichia coli protein disulfide

isomerase. Biochemistry, 33(14), 4231-4236.

Jonasson, P., Liljeqvist, S., Nygren, P. A., and

hl, S. (2002). Genetic design for facilitated production and recovery of recombinant proteins in Escherichia coli. Biotechnology and Applied Biochemistry, 35(2), 91-105. Jones, I., and Morikawa, Y. (1996). Baculovirus vectors for expression in insect cells. Current Opinion in Biotechnology, 7(5), 512-516. Kabcenell, A. K., and Atkinson, P. H. (1985). Processing of the rough endoplasmic reticulum membrane glycoproteins of rotavirus SA11. J Cell Biol 101(4), 1270-80. Kajino, T., Ohto, C., Muramatsu, M., Obata, S., Udaka, S., Yamada, Y., and Takahashi, H. (2000). A protein disulfide isomerase gene fusion expression system that increases the extracellular productivity of Bacillus brevis. Applied and Environmental Microbiology, 66(2), 638-642. Kajino, T., Saito, Y., Asami, O., Yamada, Y., Hirai, M., and Udata, S. (1997). Extracellular production of an intact and biologically active human growth hormone by the Bacillus brevis system. Journal of Industrial Microbiology and Biotechnology, 19(4), 227-231.

142

Kajino, T., Takahashi, H., Hirai, M., and Yamada, Y. (2000). Efficient production of

artificially designed gelatins with a Bacillus brevis system. Applied and Environmental


Kane, J. F. (1995). Effects if rare codon clusters on high-level expression of

heterologous proteins in Echerichia coli. Current Opinion in Biotechnology, 6(5), 494-

500.

Kapikian, A. Z., and Chanock, R. M. (1990). Rotaviruses. Rotaviruses.

Kapikian, A. Z., Wha Kim, H., and Wyatt, R. G. (1974). Reoviruslike agent in stools:

association with infantile diarrhea and development of serologic tests. Science,

185(4156), 1049-1053.

Kapikian, A. Z., Y. Hoshino, and R. M. Chanock (2001). Rotaviruses. Fourth ed. In

"Fields virology" (P. M. H. D. M. Knipe, D. E. Griffin, R. A. Lamb, M. A. Martin, B.

Roizman, and S. E. Straus, Ed.), pp. 1787-1833. Lippincott Williams and Wilkins,

Philadelphia, Pa.

Kashima, Y., and Udaka, S. (2004). High-level production of hyperthermophilic

cellulase in the Bacillus brevis expression and secretion system. Bioscience,

Biotechnology and Biochemistry, 68(1), 235-237.

Katanosaka, K., Tokunaga, F., Kawamura, S., and Ozaki, K. (1998). N-Linked

glycosylation of Drosophila rhodopsin occurs exclusively in the amino-terminal domain

and functions in rhodopsin maturation. FEBS Letters, 424(3), 149-154.

Katelaris, P. M., Cossart, Y. E., Rose, B. R., Thompson, C. H., Sorich, E., Nightingale,

B., Dallas, P. B., and Morris, B. J. (1988). Human papillomavirus: the untreated male

reservoir. J Urol 140(2), 300-5.

143

Kato, C., Kobayashi, T., and Kudo, T. (1987). Construction of an excretion vector and

extracellular production of human growth hormone from Escherichia coli. Gene, 54(2-

3), 197-202.

Kattoura, M. D., Clapp, L. L., and Patton, J. T. (1992). The rotavirus nonstructural

protein, NS35, possesses RNA-binding activity in vitro and in vivo. Virology 191(2),

698-708.

Kawamura, F., and Doi, R. H. (1984). Construction of a Bacillus subtilis double mutant

deficient in extracellular alkaline and neutral proteases. Journal of Bacteriology, 160(1),

442-444.

Kawar, Z., Herscovics, A., and Jarvis, D. L. (1997). Isolation and characterization of an

α1,2-mannosidase cDNA from the lepidopteran insect cell line Sf9. Glycobiology, 7(3),

433-443.

Kelly, W. G., and Hart, G. W. (1989). Glycosylation of chromosomal proteins:

Localization of O-linked N-acetylglucosamine in Drosophila chromatin. Cell, 57(2),

243-251.

Kerscher, S., Albert, S., Wucherpfennig, D., Heisenberg, M., and Schneuwly, S. (1995).

Molecular and genetic analysis of the Drosophila mas-1 (mannosidase-1) gene which

encodes a glycoprotein processing α1,2-mannosidase. Developmental Biology, 168(2),

613-626.

Ketha V. Krishna Mohan, Terence S. Dermody, and Chintamani D. Atreya. (2000).

Mutations Selected in Rotavirus Enterotoxin NSP4 Depend on the Context of Its

Expression. Virology, 275, 125-32.

Kim, L., Mogk, A., and Schumann, W. (1996). A xylose-inducible Bacillus subtilis

integration vector and its application. Gene, 181(1-2), 71-76.

144

Kimura, M., Miki, T., and Hiraga, S. (1979). Conditionally lethal amber mutations in

the dnaA region of the Escherichia coli chromosome that affect chromosome

replication. Journal of Bacteriology, 140(3), 825-834.

Kirkwood, C. D., & Palombo, E. A. (1997). Genetic Characterization of the Rotavirus

Nonstructural Protein, NSP4. Virology, 236(2), 258-265.

Klenk, H. D. (1996). Post-translational modifications in insect cells. Cytotechnology,

20(1-3), 139-144.

Koch, G., Van Roozelaar, D. J., Verschueren, C. A. J., Van Der Eb, A. J., and Noteborn,

M. H. M. (1995). Immunogenic and protective properties of chicken anaemia virus

proteins expressed by baculovirus. Vaccine, 13(8), 763-770.

Komai, T., Ishikawa, Y., Yagi, R., Suzuki-Sunagawa, H., Nishigaki, T., and Handa, H.

(1997). Development of HIV-1 protease expression methods using the T7 phage

promotor system. Applied Microbiology and Biotechnology, 47(3), 241-245.

Konishi, H., Sato, T., Yamagata, H., and Udaka, S. (1990). Efficient production of

human α-amylase by a Bacillus brevis mutant. Applied Microbiology and


Korpela, M. T., Kurittu, J. S., Karvinen, J. T., and Karp, M. T. (1998). A recombinant

Escherichia coli sensor strain for the detection of tetracyclines. Analytical Chemistry,

70(21), 4457-4462.

Korth, K. L., and Levings Iii, C. S. (1993). Baculovirus expression of the maize

mitochondrial protein URF13 confers insecticidal activity in cell cultures and larvae.


90(8), 3388-3392.

Kramerov, A. A., Mikhaleva, E. A., Rozovsky, Y. M., Pochechueva, T. V., Baikova, N.

A., Arsenjeva, E. L., and Gvozdev, V. A. (1997). Insect mucin-type glycoprotein:

145

Immunodetection of the O-glycosylated epitope in Drosophila melanogaster cells and

tissues. Insect Biochemistry and Molecular Biology, 27(6), 513-521.

Kretzschmar, E., Geyer, R., and Klenk, H. D. (1994). Baculovirus infection does not

alter N-glycosylation in Spodoptera frugiperda cells. Biological Chemistry Hoppe-

Seyler, 375(5), 323-327.

Ku, N. O., and Omary, M. B. (1994). Expression, glycosylation, and phosphorylation of

human keratins 8 and 18 in insect cells. Experimental Cell Research, 211(1), 24-35.

Kubelka, V., Altmann, F., and Marz, L. (1995). The asparagine-linked carbohydrate of

honeybee venom hyaluronidase. Glycoconjugate Journal, 12(1), 77-83.

Kubelka, V., Altmann, F., Kornfeld, G., and Marz, L. (1994). Structures of the N-linked

oligosaccharides of the membrane glycoproteins from three lepidopteran cell lines (Sf-

21, IZD-Mb-0503, Bm-N). Archives of Biochemistry and Biophysics, 308(1), 148-157.

Kubelka, V., Altmann, F., Staudacher, E., Tretter, V., Marz, L., Hard, K., Kamerling, J.

P., and Vliegenthart, J. F. G. (1993). Primary structures of the N-linked carbohydrate

chains from honeybee venom phospholipase A2. European Journal of Biochemistry,

213(3), 1193-1204.

Kulakosky, P. C. (1998). N-glycosylation of a baculovirus-expressed recombinant

glycoprotein in three insect cell lines. In Vitro Cellular and Developmental Biology -

Animal, 34(2), 101-108.

Kulakosky, P. C., Hughes, P. R., and Wood, H. A. (1998). N-linked glycosylation of a

baculovirus-expressed recombinant glycoprotein in insect larvae and tissue culture cells.


Kumar, R., Yang, J., Eddy, R. L., Byers, M. G., Shows, T. B., and Stanley, P. (1992).

Cloning and expression of the murine gene and chromosomal location of the human

gene encoding N-acetylglucosaminyltransferase I. Glycobiology, 2(4), 383-393.

146

Kurland, C., and Gallant, J. (1996). Errors of heterologous protein expression. Current

Opinion in Biotechnology, 7(5), 489-493.

Kuroda, K., Geyer, H., Geyer, R., Doerfler, W., and Klenk, H. D. (1990).

Theoligosaccharides of influenza virus hemagglutinin expressed in insect cells by a

baculovirus vector. Virology, 174(2), 418-429.

Kuroda, K., Veit, M., and Klenk, H. D. (1991). Retarded processing of influenza virus

hemagglutinin in insect cells. Virology, 180(1), 159-165.

Kurosaka, A., Yano, A., Itoh, N., Kuroda, Y., Nakagawa, T., and Kawasaki, T. (1991).

The structure of a neural specific carbohydrate epitope of horseradish peroxidase

recognized by anti-horseradish peroxidase antiserum. Journal of Biological Chemistry,

266(7), 4168-4172.

Lakey, D. L., Voladri, R. K., Edwards, K. M., Hager, C., Samten, B., Wallis, R. S.,

Barnes, P. F., and Kernodle, D. S. (2000). Enhanced production of recombinant

Mycobacterium tuberculosis antigens in Escherichia coli by replacement of low-usage

codons. Infect Immun, 68(1), 233-238.

Lam, K. H. E., Chow, K. C., and Wong, W. K. R. (1998). Construction of an efficient

Bacillus subtilis system for extracellular production of heterologous proteins. Journal of


Lama, J., and Carrasco, L. (1992). Expression of poliovirus nonstructural proteins in

Escherichia coli cells: Modification of membrane permeability induced by 2B and 3A.


Landry, T. D., Chew, L., Davis, J. W., Frawley, N., Foley, H. H., Stelman, S. J.,

Thomas, J., Wolt, J., and Hanselman, D. S. (2003). Safety evaluation of an α-amylase

enzyme preparation derived from the archaeal order Thermococcales as expressed in

Pseudomonas fluorescens biovar I. Regulatory Toxicology and Pharmacology, 37(1),

149-168.

147

Larruquert, J. I., Aznarez, J. A., Mendez, J. A., Malvezzi, A. M., Poletto, L., and

Covini, S. (2004). Optical properties of scandium films in the far and the extreme

ultraviolet. Appl Opt 43(16), 3271-8.

Larsen, J. E. L., Gerdes, K., Light, J., and Molin, S. (1984). Low-copy-number plasmid-

cloning vectors amplifiable by derepression of an inserted foreign promotor. Gene,

28(1), 45-54.

Le Grice, S. F. J. (1990). Regulated promoter for high-level expression of heterologous

genes in Bacillus subtilis. Methods in Enzymology, 185, 201-214.

Lecce, J. G., King, M. W., and Mock, R. (1976). Reovirus like agent associated with

fatal diarrhea in neonatal pigs. Infection and Immunity, 14(3), 816-825.

Lee, J. H., Minn, I., Park, C. B., and Kim, S. C. (1998). Acidic peptide-mediated

expression of the antimicrobial peptide buforin II as tandem repeats in Escherichia coli.


Lee, S. Y. (1996). High cell-density culture of Escherichia coli. Trends in


Lenhard, T., and Reiländer, H. (1997). Engineering the folding pathway of insect cells:

Generation of a stably transformed insect cell line showing improved folding of a

recombinant membrane protein. Biochemical and Biophysical Research

Communications, 238(3), 823-830.

Lesser, C. F., and Miller, S. I. (2001). Expression of microbial virulence proteins in

Saccharomyces cerevisiae models mammalian infection. EMBO Journal, 20(8), 1840-

1849.

Lesuisse, E., Schanck, K., and Colson, C. (1993). Purification and preliminary

characterization of the extracellular lipase of Bacillus subtilis 168, an extremely basic

pH-tolerant enzyme. European Journal of Biochemistry, 216(1), 155-160.

148

Li, W., Zhou, X., and Lu, P. (2004). Bottlenecks in the expression and secretion of

heterologous proteins in Bacillus subtilis. Research in Microbiology, 155(8), 605-610.

Licari, P. J., Jarvis, D. L., and Bailey, J. E. (1993). Insect cell hosts for baculovirus

expression vectors contain endogenous exoglycosidase activity. Biotechnology

Progress, 9(2), 146-152.

Linder, M. E., Middleton, P., Hepler, J. R., Taussig, R., Gilman, A. G., and Mumby, S.

M. (1993). Lipid modifications of G proteins: α Subunits are palmitoylated.


90(8), 3675-3679.

Lisa M. Bowers, K. L., Larry Anthony, Anna Pluciennik, Marcin Filutowicz (2004).

Bacterial expression system with tightly regulated gene expression and plasmid copy

number Gene 340(1), 11-18.

Liu, Y., Dunn, G. S., and Aronson Jr, N. N. (1996). Purification, biochemistry and

molecular cloning of an insect glycosylasparaginase from Spodoptera frugiperda.


Lopes, A., Poletto, A. H., Carvalho, A. L., Ribeiro, E. A., Granja, N. M., and Rossi, B.

M. (2004). Pelvic exenteration and sphincter preservation in the treatment of soft tissue

sarcomas. Eur J Surg Oncol 30(9), 972-5.

Lopez, M., Coddeville, B., Langridge, J., Plancke, Y., Sautière, P., Chaabihi, H., Chirat,

F., Harduin-Lepers, A., Cerutti, M., Verbert, A., and Delannoy, P. (1997).

Microheterogeneity of the oligosaccharides carried by the recombinant bovine

lactoferrin expressed in Mamestra brassicae cells. Glycobiology, 7(5), 635-651.

Lopez, M., Gazon, M., Juliant, S., Plancke, Y., Leroy, Y., Strecker, G., Cartron, J. P.,

Bailly, P., Cerutti, M., Verbert, A., and Delannoy, P. (1998). Characterization of a

149

UDP-Gal:Galβ1-3GalNAc α1,4- galactosyltransferase activity in a mamestra brassicae

cell line. Journal of Biological Chemistry, 273(50), 33644-33651.

Love, C. A., Lilley, P. E., and Dixon, N. E. (1996). Stable high-copy-number

bacteriophage λ promoter vectors for overproduction of proteins in Escherichia coli.

Gene, 176(1-2), 49-53.

Lowman, H. B., and Bina, M. (1990). Temperature-mediated regulation and

downstream inducible selection for controlling gene expression from the bacteriophage

λ p(L) promoter. Gene, 96(1), 133-136.

Luckow, V. A. (1995). Protein production and processing from baculovirus expression

vectors. Baculovirus Expression Systems and Biopesticides, 51-90.

Luna, M. B., Orsatti, M., and Poletto, L. (1998). Lerner's homeostasis and blood

pressure. Med Hypotheses 51(2), 89-93.

Lutz, R., and Bujard, H. (1997). Independent and tight regulation of transcriptional units

in escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements.

Nucleic Acids Research, 25(6), 1203-1210.

Maass, D., and P.H. Atkinson. (1990). Rotavirus proteins VP7, NS28, and VP4 form

oligomeric structures. Journal Virology, 64, 2641.

MacDonald, H. L., and Neway, J. O. (1990). Effects of medium quality on the

expression of human interleukin-2 at high cell density in fermentor cultures of

Escherichia coli K-12. Applied and Environmental Microbiology, 56(3), 640-645.

Maeda, S., Kawai, T., and Obinata, M. (1985). Production of human α-interferon in

silkworm using a baculovirus vector. Nature, 315(6020), 592-594.

Mahiouz, D. L., Aichinger, G., Haskard, D. O., and George, A. J. T. (1998). Expression

of recombinant anti-E-selectin single-chain Fv antibody fragments in stably transfected

insect cell lines. Journal of Immunological Methods, 212(2), 149-160.

150

Makrides, S. C. (1996). Strategies for achieving high-level expression of genes in

Escherichia coli. Microbiological Reviews, 60(3), 512-538.

Malherbe and Harwin (1963). The cytopathic effects of vervet monkey viruses. The

South African Medical Journal 37(Apr), 407-11.

Malherbe, H H (1967). Simian virus SA11 and the related O agent. Archiv fur die

gesamte Virusforschung 22(1), 235-45.

Malten, M., Hollmann, R., Deckwer, W. D., and Jahn, D. (2005). Production and

secretion of recombinant Leuconostoc mesenteroides dextransucrase DsrS in Bacillus

megaterium. Biotechnology and Bioengineering, 89(2), 206-218.

Manco, G., Adinolfi, E., Pisani, F. M., Ottolina, G., Carrea, G., and Rossi, M. (1998).

Overexpression and properties of a new thermophilic and thermostable esterase from

Bacillus acidocaldarius with sequence similarity to hormone-sensitive lipase subfamily.

Biochemical Journal, 332(1), 203-212.

Manneberg, M., Friedlein, A., Kurth, H., Lahm, H. W., and Fountoulakis, M. (1994).

Structural analysis and localization of the carbohydrate moieties of a soluble human

interferon γ receptor produced in baculovirus-infected insect cells. Protein Science,

3(1), 30-38.

Margot, P., and Karamata, D. (1996). The wprA gene of Bacillus subtilis 168, expressed

during exponential growth, encodes a cell-wall-associated protease. Microbiology,

142(12), 3437-3444.

Martella, V., Ciarlet, M., Bányai, K., Lorusso, E., Arista, S., Lavazza, A., Pezzotti, G.,

Decaro, N., Cavalli, A., Lucente, M. S., Corrente, M., Elia, G., Camero, M., Tempesta,

M., and Buonavoglia, C. (2007). Identification of group A porcine rotavirus strains

bearing a novel VP4 (P) genotype in Italian swine herds. Journal of Clinical


151

Martial, J. A., Hallewell, R. A., Baxter, J. D., and Goodman, H. M. (1979). Human

growth hormone: Complementary DNA cloning and expression in bacteria. Science,

205(4406), 602-607.

Maruniak, J. E. (1996). Productivity of insect cells for recombinant proteins.

Cytotechnology, 20(1-3), 145-148.

Marz, L., Altmann, F., Staudacher, E., and Kubelka, V. (1995). Protein glycosylation in

insects. Glycoproteins, 543-563.

Marz, L., Kuhne, C., and Michl, H. (1983). The glycoprotein nature of phospholipase

A2, hyaluronidase and acid phosphatase from honey-bee venom. Toxicon, 21(6), 893-

896.

Matthijnssens, J., Ciarlet, M., Rahman, M., Attoui, H., Bányai, K., Estes, M., Gentsch,

J., Iturriza-Gómara, M., Kirkwood, C., Martella, V., Mertens, P., Nakagomi, O., Patton,

J., Ruggeri, F., Saif, L., Santos, N., Steyer, A., Taniguchi, K., Desselberger, U., & Van

Ranst, M. (2008). Recommendations for the classification of group A rotaviruses using

all 11 genomic RNA segments. Archives of Virology, 153(8), 1621-1629.

Matthijnssens, J., Ciarlet, M., McDonald, S., Attoui, H., Bányai, K., Brister, J., Buesa,

J., Esona, M., Estes, M., Gentsch, J., Iturriza-Gómara, M., Johne, R., Kirkwood, C.,

Martella, V., Mertens, P., Nakagomi, O., Parreño, V., Rahman, M., Ruggeri, F., Saif, L.,

Santos, N., Steyer, A., Taniguchi, K., Patton, J., Desselberger, U., & Van Ranst, M.

(2011). Uniformity of rotavirus strain nomenclature proposed by the Rotavirus

Classification Working Group (RCWG). Archives of Virology, 156(8), 1397-1413.

Mattion, N. M., Cohen, J., Aponte, C., and Estes, M. K. (1992). Characterization of an

oligomerization domain and RNA-binding properties on rotavirus nonstructural protein

NS34. Virology 190(1), 68-83.

Mayer, M. P. (1995). A new set of useful cloning and expression vectors derived from

pBlueScript. Gene, 163(1), 41-46.

152

McCarroll, L., and King, L. A. (1997). Stable insect cell cultures for recombinant

protein production. Current Opinion in Biotechnology, 8(5), 590-594.

McKenzie, T., Hoshino, T., Tanaka, T., and Sueoka, N. (1986). The nucleotide

sequence of pUB110: Some salient features in relation to replication and its regulation.

Plasmid, 15(2), 93-103.

Mckinney M M, Parkinson A. (1987). A simple, non-chromatographic procedure to

purify immunoglobulins from serum and ascites fluid. J Immunol Methods.

1987;96:271–278.

Mebus CA, K. M., Underdahl NR, Twiehaus MJ. (1971). Cell culture propagation of

neonatal calf diarrhea (scours) virus. Can Vet J. 12(3), 69-72.

Meinhardt, F., Stahl, U., and Ebeling, W. (1989). Highly efficient expression of

homologous and heterologous genes in Bacillus megaterium. Applied Microbiology and


Menart, V., Jevševar, S., Vilar, M., Trobiš, A., and Pavko, A. (2003). Constitutive

versus thermoinducible expression of heterologous proteins in Escherichia coli based on

strong PR,PL promoters from phage lambda. Biotechnology and Bioengineering, 83(2),

181-190.

Mergulhão, F. J. M., and Monteiro, G. A. (2004). Secretion capacity limitations of the

Sec pathway in Escherichia coli. Journal of Microbiology and Biotechnology, 14(1),

128-133.

Mergulhão, F. J. M., Summers, D. K., and Monteiro, G. A. (2005). Recombinant protein

secretion in Escherichia coli. Biotechnology Advances, 23(3), 177-202.

Metzler, M., Gertz, A., Sarkar, M., Schachter, H., W.schrader, J., and Marth, J. D.

(1994). Complex asparagine-linked oligosaccharides are required for morphogenic

events during post-implantation development. EMBO Journal, 13(9), 2056-2065.

153

Michelangeli, F., Ruiz, M. C., Del Castillo, J. R., Ludert, J. E., and Liprandi, F. (1991).

Effect of rotavirus infection on intracellular calcium homeostasis in cultured cells.

Virology, 181(2), 520-527.

Miroux, B., and Walker, J. E. (1996). Over-production of proteins in Escherichia coli:

Mutant hosts that allow synthesis of some membrane proteins and globular proteins at

high levels. Journal of Molecular Biology, 260(3), 289-298.

Mishima, N., Mizumoto, K., Iwasaki, Y., Nakano, H., and Yamane, T. (1997). Insertion

of stabilizing loci in vectors of T7 RNA polymerase-mediated Escherichia coli

expression systems: A case study on the plasmids involving foreign phospholipase D

gene. Biotechnology Progress, 13(6), 864-868.

Moffatt, B. A., and Studier, F. W. (1987). T7 lysozyme inhibits transcription by T7

RNA polymerase. Cell, 49(2), 221-227.

Moore, S. (1981). Pancreatic DNase. The Enzymes, 14, 281-296.

Mori, Y., Borgan, M. A., Ito, N., Sugiyama, M., and Minamoto, N. (2002). Diarrhea-

inducing activity of avian rotavirus NSP4 glycoproteins, which differ greatly from

mammalian rotavirus NSP4 glycoproteins in deduced amino acid sequence in suckling

mice. J Virol 76(11), 5829-34.

Morris, A. P., Scott, J. K., Ball, J. M., Zeng, C. Q. Y., O'Neal, W. K., and Estes, M. K.

(1999). NSP4 elicits age-dependent diarrhea and Ca2+-mediated I- influx into intestinal

crypts of CF mice. American Journal of Physiology - Gastrointestinal and Liver

Physiology, 277(2 40-2), G431-G444.

Mossel, E. C., and Ramig, R. F. (2003). A Lymphatic Mechanism of Rotavirus

Extraintestinal Spread in the Neonatal Mouse. Journal of Virology, 77(22), 12352-

12356.

Muller-Hill, B. (1975). Lac repressor and lac operator. Prog Biophys Mol Biol 30(2-3),

227-52.

154

Muller-Hill, B. (1976). Lac repressor and Lac operator. Progress in Biophysics and

Molecular Biology, 30(C), 227-252.

Munier-Lehmann, H., Mauxion, F., and Hoflack, B. (1996). Function of the two

mannose 6-phosphate receptors in lysosomal enzyme transport. Biochemical Society

Transactions, 24(1), 133-136.

Murashima, K., Chen, C. L., Kosugi, A., Tamaru, Y., Doi, R. H., and Wong, S. (2002).

Heterologous production of Clostridium cellulovorans engB, using protease-deficient

Bacillus subtilis, and preparation of active recombinant cellulosomes. Journal of

Bacteriology, 184(1), 76-81.

Nakamura, K., Furusato, T., Shiroza, T., and Yamane, K. (1985). Stable hyper-

production of Escherichia coli β-lactamase by Bacillus subtilis grown on a 0.5 M

succinate-medium using a B. subtilis α-amylase secretion vector. Biochemical and

Biophysical Research Communications, 128(2), 601-606.

Neerathilingam, M., Greene, L. H., Colebrooke, S. A., Campbell, I. D., and Staunton, D.

(2005). Quantitation of protein expression in a cell-free system: Efficient detection of

yields and 19F NMR to identify folded protein. Journal of Biomolecular NMR, 31(1),

11-19.

Newton, K., Meyer, J. C., Bellamy, A. R., and Taylor, J. A. (1997). Rotavirus

nonstructural glycoprotein NSP4 alters plasma membrane permeability in mammalian

cells. Journal of Virology, 71(12), 9458-9465.

Ng, G. Y. K. (1993). Human serotonin1B receptor expression in Sf9 cells:

Phosphorylation, palmitoylation, and adenylyl cyclase inhibition. Biochemistry®,

32(43), 11727-11733.

Nisoli, M., Sansone, G., Stagira, S., De Silvestri, S., Vozzi, C., Pascolini, M., Poletto,

L., Villoresi, P., and Tondello, G. (2003). Effects of carrier-envelope phase differences

of few-optical-cycle light pulses in single-shot high-order-harmonic spectra. Phys Rev

155

Lett 91(21), 213905.

Nordstrom, K., and Uhlin, B. E. (1992). Runaway-replication piasmids as tools to

produce large quantities of proteins from cloned genes in bacteria. Nature


O'Brien, J. A., Taylor, J. A., and Bellamy, A. R. (2000). Probing the structure of

rotavirus NSP4: A short sequence at the extreme C terminus mediates binding to the

inner capsid particle. Journal of Virology, 74(11), 5388-5394.

O'Connor, C. D., and Timmis, K. N. (1987). Highly repressible expression system for

cloning genes that specify potentially toxic proteins. Journal of Bacteriology, 169(10),

4457-4462.

Ogonah, O. W., Freedman, R. B., Jenkins, N., Patel, K., and Rooney, B. C. (1996).

Isolation and characterization of an insect cell line able to perform complex N-linked

glycosylation on recombinant proteins. Bio/Technology, 14(2), 197-202.

Oka, T., Nakagomi, T., and Nakagomi, O. (2001). A lack of consistent amino acid

substitutions in NSP4 between rotaviruses derived from diarrheal and

asymptomatically-infected kittens. Microbiology and Immunology, 45(2), 173-177.

Olmos-Soto, J., and Contreras-Flores, R. (2003). Genetic system constructed to

overproduce and secrete proinsulin in Bacillus subtilis. Applied Microbiology and


Osterrieder, N., Wagner, R., Pfeffer, M., and Kaaden, O. R. (1994). Expression of

equine herpesvirus type 1 glycoprotein gp14 in Escherichia coli and in insect cells: A

comparative study on protein processing and humoral immune responses. Journal of

General Virology, 75(8), 2041-2046.

Otero, J. C., Proske, A., Vallilengua, C., Lujan, M., Poletto, L., Otero, J. R., Pezzotto, S.

M., and Celoria, G. (2008). Gallbladder carcinoma: intraoperative imprint cytology, a

helpful and valuable screening procedure. J Hepatobiliary Pancreat Surg 15(2), 157-60.

156

Page, M. J., Hall, A., Rhodes, S., Skinner, R. H., Murphy, V., Sydenham, M., and

Lowe, P. N. (1989). Expression and characterization the Ha-ras p21 protein produced at

high levels in the insect/baculovirus system. Journal of Biological Chemistry, 264(32),

19147-19154.

Palva, I. (1982). Molecular cloning of α-amylase gene from Bacillus amyloliquefaciens

and its expression in B. subtilis. Gene, 19(1), 81-87.

Palva, I., Lehtovaara, P., and Kaariainen, L. (1983). Secretion of interferon by Bacillus

subtilis. Gene, 22(2-3), 229-235.

Pan, S. H., and Malcolm, B. A. (2000). Reduced background expression and improved

plasmid stability with pET vectors in BL21 (DE3). BioTechniques, 29(6), 1234-1238.

Pang, W., Huang, Y., and Mong, M. (2005). NSP4 proteins expression of two Wa

strains of human rotavirus and their different virulence in ICR neonatal mice. J Med

Molec Biol, 2, 94-97.

Parashar, U. D., Gibson, C. J., Bresee, J. S., and Glass, R. I. (2006). Rotavirus and

severe childhood diarrhea. Emerging Infectious Diseases, 12(2), 304-306.

Parashar, U. D., Hummelman, E. G., Bresee, J. S., Miller, M. A., and Glass, R. I.

(2003). Global illness and deaths caused by rotavirus disease in children. Emerging

Infectious Diseases, 9(5), 565-572.

Parker, C. G., Fessler, L. I., Nelson, R. E., and Fessler, J. H. (1995). Drosophila UDP-

glucose:Glycoprotein glucosyltransferase: Sequence and characterization of an enzyme

that distinguishes between denatured and native proteins. EMBO Journal, 14(7), 1294-

1303.

Parker, G. F., Williams, P. J., Butters, T. D., and Roberts, D. B. (1991). Detection of the

lipid-linked precursor oligosaccharide of N-linked protein glycosylation in Drosophila

melanogaster. FEBS Letters, 290(1-2), 58-60.

157

Parodi, A. J. (1998). The quality control of glycoprotein folding in the endoplasmic

reticulum, a trip from trypanosomes to mammals. Brazilian Journal of Medical and

Biological Research, 31(5), 601-614.

Parr, R. D., Storey, S. M., Mitchell, D. M., McIntosh, A. L., Zhou, M., Mir, K. D., and

Ball, J. M. (2006). The rotavirus enterotoxin NSP4 directly interacts with the caveolar

structural protein caveolin-1. Journal of Virology, 80(6), 2842-2854.

Patton, J. T. (1986). Synthesis of simian rotavirus SA11 double-stranded RNA in a cell-

free system. Virus Res 6(3), 217-33.

Peter, G. (2009). Detailed Review Paper on Rotavirus Vaccines. In: WHO Strategic

Advisory Group of Experts (SAGE) on Immunization.

Petsch, D., and Anspach, F. B. (2000). Endotoxin removal from protein solutions.

Journal of Biotechnology, 76(2-3), 97-119.

Peyresblanques, J., Saint Val, C., Poletto, B. B., Chenut, J. L., Dussarte, A. M., and

Duvezin-Caubet, P. (1978). [A case of Purtscher's syndrome; angiographic and

therapeutic aspects]. Bull Soc Ophtalmol Fr 78(12), 975-82.

Pezzotto, S. M., Mahuad, R., Bay, M. L., Morini, J. C., and Poletto, L. (1993). Variation

in smoking-related lung cancer risk factors by cell type among men in Argentina: a

case-control study. Cancer Causes Control 4(3), 231-7.

Phillips, T. A., VanBogelen, R. A., and Neidhardt, F. C. (1984). Lon gene product of

Escherichia coli is a heat-shock protein. Journal of Bacteriology, 159(1), 283-287.

Pinheiro, C. E., Poletto, M. I., and Pinheiro, C. F. (1989). A simplified method for the

partial purification and enzyme assay of glucosyltransferase from human dental plaque.

Rev Odontol Univ Sao Paulo 3(2), 368-70.

Pinheiro, C. E., Poletto, M. I., Pinheiro, C. F., and Negrato, M. L. (1989). Factors that

158

influence the in vitro synthesis of extracellular insoluble polysaccharides of human

dental plaque. Rev Odontol Univ Sao Paulo 3(1), 258-61.

Pinheiro, C. E., Poletto, M. I., Pinheiro, C. R., and Negrato, M. L. (1989). In vitro effect

of inhibitors on the activity of glucosyltransferase, isolated from human dental plaque.

Rev Odontol Univ Sao Paulo 3(2), 334-7.

Podhajska, A. J., Hasan, N., and Szybalski, W. (1985). Control of cloned gene

expression by promoter inversion in vivo: Construction of the heat-pulse-activated att-

nutL-p-att-N module. Gene, 40(1), 163-168.

Poletto, A. H., Lopes, A., Carvalho, A. L., Ribeiro, E. A., Vieira, R. A., Rossi, B. M.,

Aguiar, S., Jr., Guimaraes, G. C., Ferreira Fde, O., and Nakagawa, W. T. (2004). Pelvic

exenteration and sphincter preservation: an analysis of 96 cases. J Surg Oncol 86(3),

122-7.

Poletto, C. J., Verdun, L. P., Strominger, R., and Ludlow, C. L. (2004). Correspondence

between laryngeal vocal fold movement and muscle activity during speech and

nonspeech gestures. J Appl Physiol 97(3), 858-66.

Poletto, E. (1952). Considerations on diagnosis and treatment of ictus hemorrhagicus in

extrauterine pregnancy with rupture.]. Bol Trab Acad Argent Cir 36(8), 234-48.

Poletto, L., and Morini, J. C. (1990). Cancer mortality and some socio economic

correlates in Rosario, Argentina. Cancer Lett 49(3), 201-5.

Poletto, L., and Thomas, R. J. (2004). Stigmatic spectrometers for extended sources:

design with toroidal varied-line-space gratings. Appl Opt 43(10), 2029-38.

Poletto, L., Pezzotto, S. M., and Morini, J. C. (1989). Parity and risk for breast cancer in

Rosario. Medicina (B Aires) 49(5), 547-8.

Poletto, L., Pezzotto, S., and Morini, J. (1992). Blood lipid associations in 18 year-old

men. Rev Saude Publica 26(5), 316-20.

159

Poletto, L., Tondello, G., and Villoresi, P. (2003). Optical design of a spectrometer-

monochromator for the extreme-ultraviolet and soft-x-ray emission of high-order

harmonics. Appl Opt 42(31), 6367-73.

Poletto, S. S., Da Fonseca, I. O., De Carvalho, L. P. S., Basso, L. A., and Santos, D. S.

(2004). Selection of an Escherichia coli host that expresses mutant forms of

Mycobacterium tuberculosis 2-trans enoyl-ACP(CoA) reductase and 3-ketoacyl-

ACP(CoA) reductase enzymes. Protein Expression and Purification, 34(1), 118-125.

Poletto, T. A. (1974). Dissociative anesthesia, with special reference to psychological

disorders caused by ketamine]. Ann Osp Maria Vittoria Torino 17(1-6), 122-30.

Polisky, B., Bishop, R. J., and Gelfand, D. H. (1976). A plasmid cloning vehicle

allowing regulated expression of eukaryotic DNA in bacteria. Proceedings of the


Poncet, D., Aponte, C., and Cohen, J. (1993). Rotavirus protein NSP3 (NS34) is bound

to the 3' end consensus sequence of viral mRNAs in infected cells. J Virol 67(6), 3159-

65.

Prenner, C., Mach, L., Glossl, J., and Marz, L. (1992). The antigenicity of the

carbohydrate moiety of an insect glycoprotein, honey-bee (Apis mellifera) venom

phospholipase A2. The role of α1,3-fucosylation of the asparagine-bound N-

acetylglucosamine. Biochemical Journal, 284(2), 377-380.

Puyet, A., Sandoval, H., and Lopez, P. (1987). A simple medium for rapid regeneration

of Bacillus subtilis protoplasts transformed with plasmid DNA. FEMS Microbiology

Letters, 40(1), 1-5.

Quick, M., and Wright, E. M. (2002). Employing Escherichia coli to functionally

express, purify, and characterize a human transporter. Proceedings of the National

Academy of Sciences of the United States of America, 99(13), 8597-8601.

160

Rajasekaran, D., Sastri, N. P., Marathahalli, J. R., Indi, S. S., Pamidimukkala, K.,

Suguna, K., & Rao, C. D. (2008). The flexible C terminus of the rotavirus non-structural

protein NSP4 is an important determinant of its biological properties. Journal of

General Virology, 89(6), 1485-1496.

Ramig, R. F. (2004). Pathogenesis of intestinal and systemic rotavirus infection. Journal

of Virology, 78(19), 10213-10220.

Rao, D. C., Gowda, K., and Yugandhar Reddy, B. S. (2000). Sequence analysis of VP4

and VP7 genes of nontypeable strains identifies a new pair of outer capsid proteins

representing novel P and G genotypes in bovine rotaviruses. Virology, 276(1), 104-113.

Ray, P., Malik, J., Singh, R. K., Bhatnagar, S., Bahl, R., Kumar, R., & Bhan, M. K.

(2003). Rotavirus nonstructural protein NSP4 induces heterotypic antibody responses

during natural infection in children. Journal of Infectious Diseases, 187(11), 1786-1793.

Reis, U., Blum, B., Von Specht, B. U., Domdey, H., and Collins, J. (1992). Antibody

production in silkworm cells and silkworm larvae infected with a dual recombinant

Bombyx mori nuclear polyhedrosis virus. Bio/Technology, 10(8), 910-912.

Ren, J., Castellino, F. J., and Bretthauer, R. K. (1997). Purification and properties of α-

mannosidase II from Golgi-like membranes of baculovirus-infected Spodoptera

frugiperda (IPLB-SF-21AE) cells. Biochemical Journal, 324(3), 951-956.

Renesto, P., and Raoult, D. (2003). vol. 990 (pp. 642-652).

Reverey, H., Veit, M., Ponimaskin, E., and Schmidt, M. F. G. (1996). Differential fatty

acid selection during biosynthetic S-acylation of a transmembrane protein (HEF) and

other proteins in insect cells (Sf9) and in mammalian cells (CV1). Journal of Biological

Chemistry, 271(39), 23607-23610.

Reznikoff, W. S. (1992). The lactose operon-controlling elements: A complex

paradigm. Molecular Microbiology, 6(17), 2419-2422.

161

Rhodes, D. J. (1996). Economics of baculovirus - Insect cell production systems.

Cytotechnology, 20(1-3), 291-297.

Rinas, U. (1996). Synthesis rates of cellular proteins involved in translation and protein

folding are strongly altered in response to overproduction of basic fibroblast growth

factor by recombinant Escherichia coli. Biotechnology Progress, 12(2), 196-200.

Ritz, D., Lim, J., Reynolds, C. M., Poole, L. B., and Beckwith, J. (2001). Conversion of

a peroxiredoxin into a disulfide reductase by a triplet repeat expansion. Science,

294(5540), 158-160.

Robert Novy, D. D., Keith Yaeger, Robert Mierendorf (2001). Overcoming the codon

bias of E. coli for enhanced protein expression. inNovations, vol. 12 (pp. 1-3): Novagen

Inc.

Roberts, D. B., Mulvany, W. J., Dwek, R. A., and Rudd, P. M. (1998). Mutant analysis

reveals an alternative pathway for N-linked glycosylation in Drosophila melanogaster.

European Journal of Biochemistry, 253(2), 494-498.

Roberts, T. E., and Faulkner, P. (1989). Fatty acid acylation of the 67K envelope

glycoprotein of a baculovirus: Autographa californica nuclear polyhedrosis virus.

Virology, 172(1), 377-381.

Rodger, S. M., Craven, J. A., and Williams, I. (1975). Letter: Demonstration of

reovirus-like particles in intestinal contents of piglets with diarrhoea. Australian

veterinary journal, 51(11), 536.

Rodriguez-Diaz J, Lopez-Andujar P, Garcia-Diaz A, Cuenca J, Montava R, Buesa J.

(2003). Expression and purification of polyhistidine-tagged rotavirus NSP4 proteins in

insect cells. Protein Expr Purif, 31(2):207-12

Roehr, B. (2003). The many faces of human growth hormone. BETA bulletin of

experimental treatments for AIDS : a publication of the San Francisco AIDS

foundation, 15(4), 12-16.

162

Rose, J. K., and Doms, R. W. (1988). Regulation of protein export from the

endoplasmic reticulum. Annu Rev Cell Biol 4, 257-88.

Rose, R. E. (1988). The nucleotide sequence of pACYC184. Nucleic Acids Research,

16(1), 355.

Rosenberg, A. H., Lade, B. N., Dao-shan, C., Lin, S. W., Dunn, J. J., and Studier, F. W.

(1987). Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene,

56(1), 125-135.

Rosenberg, H. F. (1998). Isolation of recombinant secretory proteins by limited

induction and quantitative harvest. BioTechniques, 24(2), 188-192.

Rosenberg, A. H., Goldman, E., Dunn, J. J., Studier, F. W., & Zubay, G. (1993). Effects

of consecutive AGG codons on translation in Escherichia coli, demonstrated with a

versatile codon test system. Journal of Bacteriology, 175(3), 716-722.

Roth, J., Kempf, A., Reuter, G., Schauer, R., and Gehring, W. J. (1992). Occurrence of

sialic acids in Drosophila melanogaster. Science, 256(5057), 673-675.

Roy, P., Bishop, D. H. L., LeBlois, H., and Erasmus, B. J. (1994). Long-lasting

protection of sheep against bluetongue challenge after vaccination with virus-like

particles: Evidence for homologous and partial heterologous protection. Vaccine, 12(9),

805-811.

Ryan, R. O., Anderson, D. R., Grimes, W. J., and Law, J. H. (1985). Arylphorin from

Manduca sexta: Carbohydrate structure and immunological studies. Archives of

Biochemistry and Biophysics, 243(1), 115-124.

Rygus, T., and Hillen, W. (1991). Inducible high-level expression of heterologous genes

in Bacillus megaterium using the regulatory elements of the xylose-utilization operon.

Applied Microbiology and Biotechnology, 35(5), 594-599.

163

Rygus, T., Scheler, A., Allmansberger, R., and Hillen, W. (1991). Molecular cloning,

structure, promoters and regulatory elements for transcription of the Bacillus

megaterium encoded regulon for xylose utilization. Archives of Microbiology, 155(6),

535-542.

Sagiya, Y., Yamagata, H., and Udaka, S. (1994). Direct high-level secretion into the

culture medium of tuna growth hormone in biologically active form by Bacillus brevis.

Applied Microbiology and Biotechnology, 42(2-3), 358-363.

Saïda, F., Odaert, B., Uzan, M., and Bontems, F. (2004). First structural investigation of

the restriction ribonuclease RegB: NMR spectroscopic conditions, 13C/15N double-

isotopic labelling and two-dimensional heteronuclear spectra. Protein Expression and

Purification, 34(1), 158-165.

Saïda, F., Uzan, M., Lallemand, J. Y., and Bontems, F. (2003). New system for positive

selection of recombinant plasmids and dual expression in yeast and bacteria based on

the restriction ribonuclease RegB. Biotechnology Progress, 19(3), 727-733.

Sanson, B., Hu, R. M., Troitskaya, E., Mathy, N., and Uzan, M. (2000).

Endoribonuclease RegB from bacteriophage T4 is necessary for the degradation of early

but not middle or late mRNAs. Journal of Molecular Biology, 297(5), 1063-1074.

Sansone, G., Vozzi, C., Stagira, S., Pascolini, M., Poletto, L., Villoresi, P., Tondello, G.,

De Silvestri, S., and Nisoli, M. (2004). Observation of carrier-envelope phase

phenomena in the multi-optical-cycle regime. Phys Rev Lett 92(11), 113904.

Santacruz-Toloza, L., Huang, Y., John, S. A., and Papazian, D. M. (1994).

Glycosylation of shaker potassium channel protein in insect cell culture and in Xenopus

oocytes. Biochemistry, 33(18), 5607-5613.

and Carrasco, L. (1994). Semliki forest virus 6K protein

modifies membrane permeability after inducible expression in Escherichia coli cells.


164

Sasaki, S., Horie, Y., Nakagomi, T., Oseto, M., and Nakagomi, O. (2001). Group C

rotavirus NSP4 induces diarrhea in neonatal mice. Archives of Virology, 146(4), 801-

806.

Satoh, M., Miyamoto, C., Terashima, H., Tachibana, Y., Wada, K., Watanabe, T.,

Hayes, A. E., Gentz, R., and Furuichi, Y. (1997). Human endothelin receptors ET(A)

and ET(B) expressed in baculovirus-infected insect cells. Direct application for signal

transduction analysis. European Journal of Biochemistry, 249(3), 803-811.

Schachter, H. (1991). The 'yellow brick road' to branched complex N-glycans.


Schagger, H., and Von Jagow, G. (1987). Tricine-sodium dodecyl sulfate-

polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to

100 kDa. Analytical Biochemistry, 166(2), 368-379.

Schärer, C. G., Naim, H. Y., and Koblet, H. (1993). Palmitoylation of Semliki Forest

virus glycoproteins in insect cells (C 6/36) occurs in an early compartment and is

coupled to the cleavage of the precursor p 62. Archives of Virology, 132(3-4), 237-254.

Schein, C. H. (1989). Production of soluble recombinant proteins in bacteria.

Bio/Technology, 7(11), 1141-1149.

Schlaeger, E. J. (1996). Medium design for insect cell culture. Cytotechnology, 20(1-3),

57-70.

Schmid, G. (1996). Insect cell cultivation: Growth and kinetics. Cytotechnology, 20(1-

3), 43-56.

Schmidt, F. R. (2004). Recombinant expression systems in the pharmaceutical industry.

Applied Microbiology and Biotechnology, 65(4), 363-372.

Schmidt, M., Tuominen, N., Johansson, T., Weiss, S. A., Keinänen, K., and Oker-Blom,

C. (1998). Baculovirus-mediated large-scale expression and purification of a

165

polyhistidine-tagged rubella virus capsid protein. Protein Expression and Purification,

12(3), 323-330.

Schneider, J. C., Jenings, A. F., Mun, D. M., McGovern, P. M., and Chew, L. C. (2005).

Auxotrophic markers pyrF and proC can replace antibiotic markers on protein

production plasmids in high-cell-density Pseudomonas fluorescens fermentation.

Biotechnology Progress, 21(2), 343-348.

Schulman, L. H., and Pelka, H. (1985). In vitro conversion of a methionine to a

glutamine-acceptor tRNA. Biochemistry, 24(25), 7309-7314.

Sears, C.L., R.L. Guerrant, and J.B. Kaper. 1995. Enteric bacterial toxins, pp. 617–634.

In: M.J. Blaser, P.D. Smith, J.I. Ravdin, et al. (eds.), Infections of the Gastrointestinal

Tract. Raven Press, New York.

Seong, B. L., Lee, C. P., and RajBhandary, U. L. (1989). Suppression of amber codons

in vivo as evidence that mutants derived from Escherichia coli initiator tRNA can act at

the step of elongation in protein synthesis. Journal of Biological Chemistry, 264(11),

6504-6508.

Sharifi, Z., Yakhchali, B., and Shahrabadi, M.S. (2005). Expression and One Step

Purification of The Full-length Biologically Active, Nsp4 Of Human Rotavirus Wa

Strain. International Journal of Molecular Medicine and Advance Sciences

1(3), 206-212.

Shiga, Y., Maki, M., Ohta, T., Tokishita, S. I., Okamoto, A., Tsukagoshi, N., Udaka, S.,

Konishi, A., Kodama, Y., Ejima, D., Matsui, H., and Yamagata, H. (2000). Efficient

Production of N-terminally Truncated Biologically Active Human Interleukin-6 by

Bacillus brevis. Bioscience, Biotechnology and Biochemistry, 64(3), 665-669.

Shin, C. S., Hong, M. S., Bae, C. S., and Lee, J. (1997). Enhanced production of human

mini-proinsulin in fed-batch cultures at high cell density of Escherichia coli

BL21(DE3)[pET-3aT2M2]. Biotechnology Progress, 13(3), 249-257.

166

Shin, C. S., Hong, M. S., Kim, D. Y., Shin, H. C., and Lee, J. (1998). Growth-associated

synthesis of recombinant human glucagon and human growth hormone in high-cell-

density cultures of Escherichia coli. Applied Microbiology and Biotechnology, 49(4),

364-370.

Shin, N. K., Kim, D. Y., Shin, C. S., Hong, M. S., Lee, J., and Shin, H. C. (1998). High-

level production of human growth hormone in Escherichia coli by a simple recombinant

process. Journal of Biotechnology, 62(2), 143-151.

Shinkai, A., Shinoda, K., Sasaki, K., Morishita, Y., Nishi, T., Matsuda, Y., Takahashi,

I., and Anazawa, H. (1997). High-level expression and purification of a recombinant

human α-1,3-fucosyltransferase in baculovirus-infected insect cells. Protein Expression

and Purification, 10(3), 379-385.

Shokri, A., Sandén, A. M., and Larsson, G. (2003). Cell and process design for targeting

of recombinant protein into the culture medium of Escherichia coli. Applied

Microbiology and Biotechnology, 60(6), 654-664.

Shotkoski, F., Zhang, H. G., Meyer, B. J., and Ffrench-Constant, R. H. (1996). Stable

expression of insect GABA receptors in insect cell lines promoters for efficient

expression of Drosophila and mosquito Rdl GABA receptors in stably transformed

mosquito cell lines. FEBS Letters, 380(3), 257-262.

Silvestri, L. S., Tortorici, M. A., Vasquez-Del Carpio, R., and Patton, J. T. (2005).

Rotavirus glycoprotein NSP4 is a modulator of viral transcription in the infected cell.

Journal of Virology, 79(24), 15165-15174.

Singh, S. M., and Panda, A. K. (2005). Solubihzation and refolding of bacterial

inclusion body proteins. Journal of Bioscience and Bioengineering, 99(4), 303-310.

Skerra, A. (1994). Use of the tetracycline promoter for the tightly regulated production

of a murine antibody fragment in Escherichia coli. Gene, 151(1-2), 131-135.

Slepoy, V. D., Pezzotto, S. M., Kraier, L., Burde, L., Wohlwend, K., Razzari, E., and

167

Poletto, L. (1999). Irritable bowel syndrome: clinical and psychopathological

correlations. Dig Dis Sci 44(5), 1008-12.

Snodgrass, D. R., and Wells, P. W. (1976). Rotavirus infection in lambs: studies on

passive protection. Archives of Virology, 52(3), 201-205.

Snow, P. M., Patel, N. H., Harrelson, A. L., and Goodman, C. S. (1987). Neural-specific

carbohydrate moiety shared by many surface glycoproteins in Drosophila and

grasshopper embryos. Journal of Neuroscience, 7(12), 4137-4144.

Soldatova, L. N., Crameri, R., Gmachl, M., Kemeny, D. M., Schmidt, M., Weber, M.,

and Mueller, U. R. (1998). Superior biologic activity of the recombinant bee venom

allergen hyaluronidase expressed in baculovirus-infected insect cells as compared with

Escherichia coli. Journal of Allergy and Clinical Immunology, 101(5), 691-698.

Sørensen, H. P., and Mortensen, K. K. (2005). Advanced genetic strategies for

recombinant protein expression in Escherichia coli. Journal of Biotechnology, 115(2),

113-128.

Stacey, G., and Possee, R. (1996). Safety aspects of insect cell culture. Cytotechnology,

20(1-3), 299-304.

Stahl, M. L., and Ferrari, E. (1984). Replacement of the Bacillus subtilis subtilisin

structural gene with an in vitro-derived deletion mutation. Journal of Bacteriology,

158(2), 411-418.

Staudacher, E., and

rz, L. (1998). Strict order of (Fuc to Asn-linked GlcNAc) fucosyltransferases forming core-difucosylated structures. Glycoconjugate Journal, 15(4), 355-360. Staudacher, E., Altmann, F., Glossl, J., Marz, L., Schachter, H., Kamerling, J. P., Hard, K., and Vliegenthart, J. F. G. (1991). GDP-fucose: β-N-acetylglucosamine (Fuc to (Fucα1→6GlcNAc)-Asn-peptide) α1→3-fucosyltransferase activity in honeybee (Apis

168

mellifica) venom glands. The difucosylation of asparagine-bound N-acetylglucosamine.

European Journal of Biochemistry, 199(3), 745-751.

Staudacher, E., Altmann, F., Marz, L., Hard, K., Kamerling, J. P., and Vliegenthart, J. F.

G. (1992). α1-6(α1-3)-Difucosylation of the asparagine-bound N-acetylglucosamine in

honeybee venom phospholipase A2. Glycoconjugate Journal, 9(2), 82-85.

Staudacher, E., Kubelka, V., and Marz, L. (1992). Distinct N-glycan fucosylation

potentials of three lepidopteran cell lines. European Journal of Biochemistry, 207(3),

987-993.

Storey, S. M., Gibbons, T. F., Williams, C. V., Parr, R. D., Schroeder, F., and Ball, J.

M. (2007). Full-length, glycosylated NSP4 is localized to plasma membrane caveolae

by a novel raft isolation technique. Journal of Virology, 81(11), 5472-5483.

Studier, F. W. (1991). Use of bacteriophage T7 lysozyme to improve an inducible T7

expression system. Journal of Molecular Biology, 219(1), 37-44.

Studier, F. W., and Moffatt, B. A. (1986). Use of bacteriophage T7 RNA polymerase to

direct selective high-level expression of cloned genes. Journal of Molecular Biology,

189(1), 113-130.

Sugyiama, K., Ahorn, H., Maurer-Fogy, I., and Voss, T. (1993). Expression of human

interferon-α2 in Sf9 cells. Characterization of O-linked glycosylation and protein

heterogeneities. European Journal of Biochemistry, 217(3), 921-927.

Surendran, S. (2008). Rotavirus infection: molecular changes and pathophysiology

EXCLI Journal, 7, 154-162.

Suter-Crazzolara, C., and Unsicker, K. (1995). Improved expression of toxic proteins in

E. coli. BioTechniques, 19(2), 202-204.

169

Suzuki, H., Sato, T., Konno, T., Kitaoka, S., Ebina, T., and Ishida, N. (1984). Effect of

tunicamycin on human rotavirus morphogenesis and infectivity. Brief report. Arch Virol

81(3-4), 363-9.

Swaggerty, C.L., A. Frolov, M.J. McArthur, et al. 2000. The envelope glycoprotein of

simian immunodeficiency virus contains an enterotoxin domain. Virology 277:250–261.

Swaggerty, C.L., Huang, H., McArthur, M.J., et al. 2004. Comparison of

SIVmac259(352-382) and SIVpbj41 (360-390) enterotoxic synthetic peptides. Virology

320:243–257.

Tabandeh, F., Shojaosadati, S. A., Zomorodipour, A., Khodabandeh, M., Sanati, M. H.,

and Yakhchali, B. (2004). Heat-induced production of human growth hormone by high

cell density cultivation of recombinant Escherichia coli. Biotechnology Letters, 26(3),

245-250.

Tabandeh, F., Yakhchali, B., Shojaosadati, S. A., Khodabandeh, M., and Sanati, M. H.

(2003). Growth kinetics and human growth hormone production of a heat inducible

recombinant Escherichia coli during batch fermentation. Iranian J. Sci. Technol.

Tabor, S., and Richardson, C. C. (1985). A bacteriophage T7 RNA

polymerase/promoter system for controlled exclusive expression of specific genes.


82(4), 1074-1078.

Takimura, Y., Kato, M., Ohta, T., Yamagata, H., and Udaka, S. (1997). Secretion of

Human Interleukin-2 in Biologically Active Form by Bacillus brevis Directly into

Cultute Medium. Bioscience, Biotechnology and Biochemistry, 61(11), 1858-1861.

Taticek, R. A., Lee, C. W. T., and Shuler, M. L. (1994). Large-scale insect and plant cell

culture. Current Opinion in Biotechnology, 5(2), 165-174.

Tatsuda, D., Arimura, H., Tokunaga, H., Ishibashi, M., Arakawa, T., and Tokunaga, M.

(2001). Expression and purification of cytokine receptor homology domain of human

170

granulocyte-colony-stimulating factor receptor fusion protein in Escherichia coli.


Taylor, J. A., O'Brien, J. A., and Yeager, M. (1996). The cytoplasmic tail of NSP4, the

endoplasmic reticulum-localized non-structural glycoprotein of rotavirus, contains

distinct virus binding and coiled coil domains. EMBO Journal, 15(17), 4469-4476.

Taylor, J. A., O'Brien, J. A., Lord, V. J., Meyer, J. C., and Bellamy, A. R. (1993). The

RER-localized rotavirus intracellular receptor: A truncated purified soluble form is

multivalent and binds virus particles. Virology, 194(2), 807-814.

Taylor, J. A., Meyer, J. C., Legge, M. A., O'Brien, J. A., Street, J. E., Lord, V. J.,

Bergmann, C. C., & Bellamy, A. R. (1992). Transient expression and mutational

analysis of the rotavirus intracellular receptor: The C-terminal methionine residue is

essential for ligand binding. Journal of Virology, 66(6), 3566-3572.

Thomsen, D. R., Post, L. E., and Elhammer, A. P. (1990). Structure of O-glycosidically

linked oligosaccharides synthesized by the insect cell line Sf9. Journal of Cellular

Biochemistry, 43(1), 67-79.

Tian, P., Ball, J. M., Zeng, C. Q. Y., and Estes, M. K. (1996). The rotavirus

nonstructural glycoprotein NSP4 possesses membrane destabilization activity. Journal

of Virology, 70(10), 6973-6981.

Tian, P., Estes, M. K., Hu, Y., Ball, J. M., Zeng, C. Q. Y., and Schilling, W. P. (1995).

The rotavirus nonstructural glycoprotein NSP4 mobilizes Ca2+ from the endoplasmic

reticulum. Journal of Virology, 69(9), 5763-5772.

Tian, P., Hu, Y., Schilling, W. P., Lindsay, D. A., Eiden, J., and Estes, M. K. (1994).

The nonstructural glycoprotein of rotavirus affects intracellular calcium levels. Journal

of Virology, 68(1), 251-257.

171

Tjalsma, H., Bolhuis, A., Jongbloed, J. D. H., Bron, S., and Van Dijl, J. M. (2000).

Signal peptide-dependent protein transport in Bacillus subtilis: A genome-based survey

of the secretome. Microbiology and Molecular Biology Reviews, 64(3), 515-547.

Toki, D., Sarkar, M., Yip, B., Reck, F., Joziasse, D., Fukuda, M., Schachter, H., and

Brockhausen, I. (1997). Expression of stable human 0-glycan core 2 β-1,6-N-

acetylglucosaminyltransferase in Sf9 insect cells. Biochemical Journal, 325(1), 63-69.

Tonuttia, E., Bassetti, D., Piazza, A., Visentini, D., Poletto, M., Bassetto, F., Caciagli,

P., Villalta, D., Tozzoli, R., and Bizzaro, N. (2004). Diagnostic accuracy of ELISA

methods as an alternative screening test to indirect immunofluorescence for the

detection of antinuclear antibodies. Evaluation of five commercial kits. Autoimmunity

37(2), 171-6.

Tramper, J., Vlak, J. M., and De Gooijer, C. D. (1996). Scale up aspects of sparged

insect-cell bioreactors. Cytotechnology, 20(1-3), 221-229.

Tretter, V., Altmann, F., and Marz, L. (1991). Peptide-N4-(N-acetyl-β-

glucosaminyl)asparagine amidase F cannot release glycans with fucose attached α1→3

to the asparagine-linked N-acetylglucosamine residue. European Journal of

Biochemistry, 199(3), 647-652.

Tretter, V., Altmann, F., Kubelka, V., Marz, L., and Becker, W. M. (1993). Fucose α1,3

linked to the core region of glycoprotein N-glycans creates an important epitope for IgE

from honeybee venom allergic individuals. International Archives of Allergy and

Immunology, 102(3), 259-266.

Trombetta, E. S., and Helenius, A. (1998). Lectins as chaperones in glycoprotein

folding. Current Opinion in Structural Biology, 8(5), 587-592.

Tzipori, S., Caple, I. W., and Butler, R. (1976). Isolation of a rotavirus from deer.

Veterinary Record, 99(20), 398.

172

Udaka, S., and Yamagata, H. (1993). High-level secretion of heterologous proteins by

Bacillus brevis. Methods in Enzymology, 217, 23-33.

Ulmanen, I., Lundstrom, K., and Lehtovaraa, P. (1985). Transcription and translation of

foreign genes in Bacillus subtilis by the aid of a secretion vector. Journal of

Bacteriology, 162(1), 176-182.

Umelo-Njaka, E., Nomellini, J. F., Bingle, W. H., Glasier, L. G. M., Irvin, R. T., and

Smit, J. (2001). Expression and testing of Pseudomonas aeruginosa vaccine candidate

proteins prepared with the Caulobacter crescentus S-layer protein expression system.

Vaccine, 19(11-12), 1406-1415.

Umelo-Njaka, E., Nomellini, J. F., Yim, H., and Smit, J. (2001). Development of small

high-copy-number plasmid vectors for gene expression in Caulobacter crescentus.

Plasmid, 46(1), 37-46.

Unnithan, S., Green, L., Morrissey, L., Binkley, J., Singer, B., Karam, J., and Gold, L.

(1990). Binding of the bacteriophage T4 regA protein to mRNA targets: An initiator

AUG is required. Nucleic Acids Research, 18(23), 7083-7092.

Van Den Eijnden, D. H., Bakker, H., Neeleman, A. P., Van Den Nieuwenhof, I. M., and

Van Die, I. (1997). Novel pathways in complex-type oligosaccharide synthesis: New

vistas opened by studies in invertebrates. Biochemical Society Transactions, 25(3), 887-

893.

Van Die, I., Van Tetering, A., Bakker, H., Van Den Eijnden, D. H., and Joziasse, D. H.

(1996). Glycosylation in Lepidopteran insect cells: Identification of a β1 → 4-N-

acetylgalactosaminyltransferase involved in the synthesis of complex-type

oligosaccharide chains. Glycobiology, 6(2), 157-164.

Van Kuik, J. A., Hoffmann, R. A., and Mutsaers, J. H. G. (1986). A 500-MHz 1H-NMR

study on the N-linked carbohydrate chain of bromelain. 1H-NMR structural-reporter-

groups of fucose α(1-3)-linked to asparagine-bound N-acetylglucosamine.

Glycoconjugate Journal, 3(1), 27-34.

173

Van Kuppeveld, F. J. M., Hoenderop, J. G. J., Smeets, R. L. L., Willems, P. H. G. M.,

Dijkman, H. B. P. M., Galama, J. M. D., and Melchers, W. J. G. (1997). Coxsackievirus

protein 2B modifies endoplasmic reticulum membrane and plasma membrane

permeability and facilitates virus release. EMBO Journal, 16(12), 3519-3532.

Van Melderen, L. (2001). Molecular interactions of the CcdB poison with its bacterial

target, the DNA gyrase. International Journal of Medical Microbiology, 291(6-7), 537-

544.

Varki, A. (1993). Biological roles of oligosaccharides: All of the theories are correct.


Varshney, U., and RajBhandary, U. L. (1990). Initiation of protein synthesis from a

termination codon. Proceedings of the National Academy of Sciences of the United

States of America, 87(4), 1586-1590.

Vary, P. S. (1994). Prime time for Bacillus megaterium. Microbiology, 140(5), 1001-

1013.

Veit, M., Nurnberg, B., Spicher, K., Harteneck, C., Ponimaskin, E., Schultz, G., and

Schmidt, M. F. G. (1994). The α-subunits of G-proteins G12 and G13 are palmitoylated,

but not amidically myristoylated. FEBS Letters, 339(1-2), 160-164.

Veit, M., Ponimaskin, E., Baiborodin, S., Gelderblom, H. R., and Schmidt, M. F. G.

(1996). Intracellular compartmentalization of the glycoprotein B of herpesvirus simian

agent 8 expressed with a baculovirus vector in insect cells. Archives of Virology,

141(10), 2009-2017.

Velardo, M. A., Bretthauer, R. K., Boutaud, A., Reinhold, B., Reinhold, V. N., and

Castellino, F. J. (1993). The presence of UDP-N-acetylglucosamine:α-3-D-mannoside

β1,2-N- acetylglucosaminyltransferase I activity in Spodoptera frugiperda cells (IPLB-

SF-21AE) and its enhancement as a result of baculovirus infection. Journal of


174

Villoresi, P., Bonora, S., Pascolini, M., Poletto, L., Tondello, G., Vozzi, C., Nisoli, M.,

Sansone, G., Stagira, S., and De Silvestri, S. (2004). Optimization of high-order

harmonic generation by adaptive control of a sub-10-fs pulse wave front. Opt Lett 29(2),

207-9.

Vorobjeva, I. P., Khmel, I. A., and Alfoldi, I. (1980). Transformation of Bacillus

megaterium protoplasts by plasmid DNA. FEMS Microbiology Letters, 7(3), 261-263.

Voss, T., Ergulen, E., Ahorn, H., Kubelka, V., Sugiyama, K., Maurer-Fogy, I., and

Glossl, J. (1993). Expression of human interferon ω1 in Sf9 cells. No evidence for

complex-type N-linked glycosylation or sialylation. European Journal of Biochemistry,

217(3), 913-919.

Wada, K., Wada, Y., Doi, H., Ishibashi, F., Gojobori, T., and Ikemura, T. (1991). Codon

usage tabulated from the GenBank genetic sequence data. Nucleic Acids Res, 19 Suppl,

1981-1986.

Wagner, R., Geyer, H., Geyer, R., and Klenk, H. D. (1996). N-acetyl-β-glucosaminidase

accounts for differences in glycosylation of influenza virus hemagglutinin expressed in

insect cells from a baculovirus vector. Journal of Virology, 70(6), 4103-4109.

Wagner, R., Liedtke, S., Kretzschmar, E., Geyer, H., Geyer, R., and Klenk, H. D.

(1996). Elongation of the N-glycans of fowl plague virus hemagglutinin expressed in

Spodoptera frugiperda (Sf9) cells by coexpression of human β1,2-N-

acetylglucosaminyltransferase I. Glycobiology, 6(2), 165-175.

Walravens, K., Matheise, J. P., Knott, I., Coppe, P., Collard, A., Didembourg, C.,

Dessy, F., Kettmann, R., and Letesson, J. J. (1996). Immunological response of mice to

the bovine respiratory syncytial virus fusion glycoprotein expressed in recombinant

baculovirus infected insect cells. Archives of Virology, 141(12), 2313-2326.

175

Wang, B. Y., Yang, X. Q., and Wu, R. (1993). High-Level Production of the Mouse

Epidermal Growth Factor in a Bacillus brevis Expression System. Protein Expression


Wang, R. F., and Kushner, S. R. (1991). Construction of versatile low-copy-number

vectors for cloning, sequencing and gene expression in Escherichia coli. Gene, 100,

195-199.

Wang, X., Sun, B., Yasuyama, K., and Salvaterra, P. M. (1994). Biochemical analysis

of proteins recognized by anti-HRP antibodies in Drosophila melanogaster:

Identification and characterization of neuron specific and male specific glycoproteins.

Insect Biochemistry and Molecular Biology, 24(3), 233-242.

Ward, R. L., Mason, B. B., Bernstein, D. I., Sander, D. S., Smith, V. E., Zandle, G. A.,

and Rappaport, R. S. (1997). Attenuation of a human rotavirus vaccine candidate did

not correlate with mutations in the NSP4 protein gene. Journal of Virology, 71(8), 6267-

6270.

Warren, J. W., Walker, J. R., Roth, J. R., and Altman, E. (2000). Construction and

characterization of a highly regulable expression vector, pLAC11, and its multipurpose

derivatives, pLAC22 and pLAC33. Plasmid, 44(2), 138-151.

Westers, L., Westers, H., and Quax, W. J. (2004). Bacillus subtilis as cell factory for

pharmaceutical proteins: A biotechnological approach to optimize the host organism.

Biochimica et Biophysica Acta - Molecular Cell Research, 1694(1-3 SPEC.ISS.), 299-

310.

Whiteley, E. M., Hsu, T. A., and Betenbaugh, M. J. (1997). Modeling assembly,

aggregation, and chaperoning of immunoglobulin G production in insect cells.

Biotechnology and Bioengineering, 56(1), 106-116.

Williams, P. J., Wormald, M. R., Dwek, R. A., Rademacher, T. W., Parker, G. F., and

Roberts, D. R. (1991). Characterisation of oligosaccharides from Drosophila

176

melanogaster glycoproteins. Biochimica et Biophysica Acta - General Subjects, 1075(2),

146-153.

Wilms, B., Hauck, A., Reuss, M., Syldatk, C., Mattes, R., Siemann, M., and

Altenbuchner, J. (2001). High-cell-density fermentation for production of L-N-

carbamoylase using an expression system based on the Escherichia coli rhaBAD

promoter. Biotechnology and Bioengineering, 73(2), 95-103.

Wilson, I. B. H., and Altmann, F. (1998). Concanavalin A binding and endoglycosidase

D resistance of β1,2- xylosylated and a1,3-fucosylated plant and insect

oligosaccharides. Glycoconjugate Journal, 15(2), 203-206.

Wilson, I. B. H., and Altmann, F. (1998). Structural analysis of N-glycans from

allergenic grass, ragweed and tree pollens: Core α1,3-linked fucose and xylose present

in all pollens examined. Glycoconjugate Journal, 15(11), 1055-1070.

Wilson, I. B. H., Harthill, J. E., Mullin, N. P., Ashford, D. A., and Altmann, F. (1998).

Core α1,3-fucose is a key part of the epitope recognized by antibodies reacting against

plant N-linked oligosaccharides and is present in a wide variety of plant extracts.


Wojdyla, D., Poletto, L., Cuesta, C., Badler, C., and Passamonti, M. E. (1996). Cluster

analysis with constraints: its use with breast cancer mortality rates in Argentina. Stat

Med 15(7-9), 741-6.

Wong, S. L., Kawamura, F., and Doi, R. H. (1986). Use of the Bacillus subtilis

subtilisin signal peptide for efficient secretion of TEM β-lactamase during growth.

Journal of Bacteriology, 168(2), 1005-1009.

Wood, T. K., Kuhn, R. H., & Peretti, S. W. (1990). Enhanced plasmid stability through

post-segregational killing of plasmid-free cells. Biotechnology Techniques, 4(1), 39-44.

177

Woode, G. N., Bridger, J., and Hall, G. A. (1976). The isolation of reovirus like agents

(rotaviruses) from acute gastroenteritis of piglets. Journal of Medical Microbiology,

9(2), 203-209.

Worrall, A. F., and Connolly, B. A. (1990). The chemical synthesis of a gene coding for

bovine pancreatic DNase I and its cloning and expression in Escherichia coli. Journal of


Wu, S. C., and Wong, S. L. (2002). Engineering of a Bacillus subtilis strain with

adjustable levels of intracellular biotin for secretory production of functional

streptavidin. Applied and Environmental Microbiology, 68(3), 1102-1108.

Wu, S. C., and Wong, S. L. (2005). Engineering soluble monomeric streptavidin with

reversible biotin binding capability. Journal of Biological Chemistry, 280(24), 23225-

23231.

Wu, S. C., Yeung, J. C., Duan, Y., Ye, R., Szarka, S. J., Habibi, H. R., and Wong, S. L.

(2002). Functional production and characterization of a fibrin-specific single-chain

antibody fragment from Bacillus subtilis: Effects of molecular chaperones and a wall-

bound protease on antibody fragment production. Applied and Environmental

Microbiology, 68(7), 3261-3269.

Wu, X. C., Lee, W., Tran, L., and Wong, S. L. (1991). Engineering a Bacillus subtilis

expression-secretion system with a strain deficient in six extracellular proteases. Journal

of Bacteriology, 173(16), 4952-4958.

Wülfmg, C., and Plückthun, A. (1993). A versatile and highly repressible Escherichia

coli expression system based on invertible promoters: Expression of a gene encoding a

toxic product. Gene, 136(1-2), 199-203.

Xu, A., Bellamy, A. R., and Taylor, J. A. (2000). Immobilization of the early secretory

pathway by a virus glycoprotein that binds to microtubules. EMBO Journal, 19(23),

6465-6474.

178

Yamagata, H., Nakahama, K., Suzuki, Y., Kakinuma, A., Tsukagoshi, N., and Udaka, S.

(1989). Use of Bacillus brevis for efficient synthesis and secretion of human epidermal

growth factor. Proceedings of the National Academy of Sciences of the United States of

America, 86(10), 3589-3593.

Yang, S., Huang, H., Zhang, R., Huang, X., Li, S., and Yuan, Z. (2001). Expression and

purification of extracellular penicillin G acylase in Bacillus subtilis. Protein Expression


Ye, R., Kim, J. H., Kim, B. G., Szarka, S., Sihota, E., and Wong, S. L. (1999). High-

level secretory production of intact, biologically active staphylokinase from Bacillus

subtilis. Biotechnology and Bioengineering, 62(1), 87-96.

Yeh, J. C., Seals, J. R., Murphy, C. I., Van Halbeek, H., and Cummings, R. D. (1993).

Site-specific N-glycosylation and oligosaccharide structures of recombinant HIV-1

gp120 derived from a baculovirus expression system. Biochemistry, 32(41), 11087-

11099.

Yike, I., Zhang, Y., Ye, J., and Dearborn, D. G. (1996). Expression in Escherichia coli

of cytoplasmic portions of the cystic fibrosis transmembrane conductance regulator:

Apparent bacterial toxicity of peptides containing R-domain sequences. Protein


Závodzky, P., and Cseh, S. (1996). Production of multidomain complement

glycoproteins in insect cells. Cytotechnology, 20(1-3), 279-288.

Zen, K. C., Choi, H. K., Krishnamachary, N., Muthukrishnan, S., and Kramer, K. J.

(1996). Cloning, expression, and hormonal regulation of an insect β-N-

acetylglucosaminidase gene. Insect Biochemistry and Molecular Biology, 26(5), 435-

444.

Zhang, C. C., Glenn, K. A., Kuntz, M. A., and Shapiro, D. J. (2000). High level

expression of full-length estrogen receptor in Escherichia coli is facilitated by the

179

uncoupler of oxidative phosphorylation, CCCP. Journal of Steroid Biochemistry and

Molecular Biology, 74(4), 169-178.

Zhang, M., Zeng, C. Q. Y., Dong, Y., Ball, J. M., Saif, L. J., Morris, A. P., and Estes,

M. K. (1998). Mutations in rotavirus nonstructural glycoprotein NSP4 are associated

with altered virus virulence. Journal of Virology, 72(5), 3666-3672.

Zhang, M., Zeng, C. Q. Y., Morris, A. P., and Estes, M. K. (2000). A functional NSP4

enterotoxin peptide secreted from rotavirus-infected cells. Journal of Virology, 74(24),

11663-11670.

Zhang, X. W., Sun, T., Liu, X., Gu, D. X., and Huang, X. N. (1998). Human growth

hormone production by high cell density fermentation of recombinant Escherichia coli.

Process Biochemistry, 33(6), 683-686.

Zhao, Y., and Sane, D. C. (1993). Expression of a recombinant baculovirus for

vitronectin in insect cells: Purification, characterization of post-translational

modifications and functional studies of the recombinant protein. Archives of

Biochemistry and Biophysics, 304(2), 434-442.

Zhu, A., and Wang, Z. K. (1996). Expression and characterization of recombinant α-

galactosidase in baculovirus-infected insect cells. European Journal of Biochemistry,

235(1-2), 332-337.

(2002). Generic protocol for (i) hospital-based surveillance to estimate the burden of

rotavirus among children and (ii) a community-based survey on utilization of health

care services for gastroenteritis in children. In: W. H. Organization. Geneva,

Switzerland.

(2007). Rotavirus vaccines. Weekly Epidemiological Record. vol. 32 (pp. 285-296):

World Health Organization.

(2008). Rotavirus surveillance – Worldwide, 2001-2008. MMWR 2008, vol. 57 (pp.

1255-1258): Centers for Disease Control and Prevention.

180

(2008). World Health Organization. Summary report on meeting to standardize new

vaccines surveillance data to be collected, shared and reported. World Health

Organization.

181

CHAPTER 7: APPENDICES Table 7.1: Reagents and solutions used in plasmid DNA extraction.

REAGENT/SOLUTION COMPOSITION

LB medium 10g Bacto®-tryptone (Difco), 5g Bacto®-yeast extract

(Difco) and 10g sodium chloride (BDH) was dissolved

in 800ml of distilled water, then pH was adjusted to

7.0 with NaOH. Solution was made up to 1000ml.

LB agar with 100µg/ml

ampicillin

15g agar (Difco) was added into of LB medium and

made to 1000 ml. The medium was allowed to cool to

50°C after autoclaving, then 1ml of 100mg/ml

ampicillin was added.

100mg/ml ampicillin 1g of ampicillin (Sigma) was dissolved in 10ml of

milli-Q water.

1 x TE buffer, pH8.0 with RNaseA (100µg/ml)

0.788g of Tris base (MP Biomedicals) and 0.1861g of

ethylenediaminetetraacetic acid (EDTA) (Calbiochem)

were dissolved in 400ml milli-Q water and pH was

adjusted to 8.0 with concentrated NaOH. Then, 1ml of

RNase A (10mg/ml stock) was added into 1 x TE

buffer.

Tris-Cl (1M), pH 7.4 121.1g of Tris base (MP Biomedicals) was dissolved

in 800ml of milli-Q water. The pH of the solution was

adjusted to 7.4 by adding the desired volume of

concentrated HCl (MP Biomedicals). The solution was

made up with milli-Q water up to 1000ml.

RNase A (10mg/ml) 10mg of pancreatic RNase A (Sigma) was dissolved in

1ml of 0.01M sodium acetate (pH5.2) (Sigma) (Table

7.2) and heated to 100°C for 15 minutes. After

cooling, the pH was adjusted by adding 0.1 volume of

1M Tris-Cl (pH7.4) and stored in aliquots at -20°C.

4M NaOH (100ml) 16g of NaOH was dissolved in 100ml of milli-Q water.

10% w/v SDS (100ml) 10g of electrophoresis-grade SDS (Bio-Rad) was

dissolved in 100ml milli-Q water.

182

Solution III, 5M potassium

acetate (100ml)

29.442g of potassium acetate (MP Biomedicals) was

dissolved in 60ml of milli-Q water then adding 11.5ml

glacial acetic acid (Merck) and top up to 100ml with

milli-Q water.

Phenol chloroform 25ml of phenol (Merck), 24ml of chloroform (Merck)

and 1ml of isoamyl alcohol (BDH) were mixed in a

ratio of 25:24:1.

Solution II 1000µl of 10% (w/v) SDS was mixed with 500µl 4M

sodium hydroxide and 8500µl milli-Q water.

183

Table 7.2: Media and reagents used in transformation.

MEDIUM/REAGENT COMPOSTION

SOC medium (100ml) 2g Bacto®-tryptone (Difco), 0.5g Bacto®-yeast

extract (Difco), 1ml of 1M NaCl, 0.25ml of

1M KCl was dissolved into 97ml milli-Q water

and autoclaved. Medium was cooled to RT and

added with 1ml of 2M Mg2+ and 1ml of 2M

glucose then was topped up to 100ml with

sterile distilled water. Medium was filtered

through a 0.2µm microfilter (Millipore) and

final pH was 7.0.

1M NaCl (100ml) 5.844g of NaCl (BDH) was dissolved in a final

volume of 100ml milli-Q water followed by

autoclaving.

1M KCl 7.455g of KCl (BDH) was dissolved in a final

volume of 100ml milli-Q water followed by

autoclaving.

2M Mg2+ 20.33g MgCl2·6H2O (Calbiochem) and 24.65g

MgSO4·7H2O (Calbiochem) were dissolved in

milli-Q water and topped up to 100ml followed

by filter sterilization.

2M glucose (100ml) Milli-Q water was added until 100ml to

dissolve 36.03g glucose (Sigma) and filter-

sterilized through a 0.2µm filter unit

(Millipore) and stored at -20°C.

X-Gal (50mg/ml) 100mg of X-Gal (Invitrogen) was dissolved in

2ml of N, N’-dimethylformamide and stored

at-20°C with aluminium foil cover.

1M IPTG 238mg of IPTG powder (Roche) was dissolved

in 1ml of milli-Q water and filtered sterile

before stored in aliquots of -20°C.

184

3M sodium acetate, pH5.2 40.824g of NaOAc-3H2O (Sigma) was

dissolved in 800ml milli-Q water and pH was

adjusted to 5.2 with glacial acetic acid

(Merck). Solution was brought to a final

volume of 100ml with milli-Q water.

Psi broth 5g Bacto yeast extract (Difco), 20g Bacto

Tryptone (Difco) and 5g magnesium sulfate

(Sigma) were dissolved in 800ml of milli-Q

water, solution pH was adjusted with 1M

potassium hydroxide to pH 7.6 and made up to

1000ml.

TbfI solution 0.588g potassium acetate (Sigma), 2.42g

rubidium chloride (Sigma), 0.294g calcium

chloride (MP Biomedicals), 2.0g manganese

chloride (Sigma) and 30ml of glycerol (Sigma)

dissolved in final volume of 200ml milli-Q

water. Solution pH was before adjusted with

dilute acetic acid (BDH) to pH 5.8.

TbfII solution 0.21g MOPS (3 -(N-

Morpholino)propanesulfonic acid) (Sigma), 1.1

g calcium chloride , 0.121 g rubidium chloride

and 15 ml of glycerol were dissolved in 100ml

of milli-Q water. The pH of the solution was

adjusted with dilute NaOH to pH 6.5.

Kanamycin 100mg/ml 100mg kanamycin (Sigma) was dissolved in

1ml milli-Q water, filter sterilized and stored at

-20

Chloramphenicol 2.5mg/ml 2.5mg chloramphenicol (Sigma) was dissolved

in 1m milli-Q water, filter sterilized and stored

at -20

Streptomycin 50mg/ml 50mg streptomycin (Sigma) was dissolved in

1m milli-Q water, filter sterilized and stored at

185

-20

Tetracycline 1mg/ml 1mg streptomycin (Sigma) was dissolved in

1m milli-Q water, filter sterilized and stored at

20

One litre of LB/Kanamycin (25µg/ml)

broth

250µl of 100mg/ml kanamycin was added to 1

litre of LB medium.

LB/Ampicillin(100µg/ml)/Kanamycin

(25µg/ml) agar plate

15g agar (Difco) was added to LB medium and

made up to 1 litre. The medium was allowed to

cool to 50°C after autoclaving, then 1ml of

100mg/ml ampicillin and 250µl of 100mg/ml

kanamycin were added.

LB/ Kanamycin (30µg/ml) agar 15g agar (Difco) was added into LB medium

and topped up to one litre. The medium was

allowed to cool to 50°C after autoclaving, then

300µl of 100mg/ml kanamycin was added.

LB/Kanamycin(30µg/ml)/Tetracycline

(12.5µg/ml), Streptomycin (50µg/ml)

and Chloramphenicol (34µg/ml) agar

15g agar (Difco) was added into LB medium

and topped up to one litre. The medium was

allowed to cool to 50°C after autoclaving, then

adding 300µl of 100mg/ml kanamycin, 12.5ml

of 12.5µg/ml tetracycline, 1ml of 50µg/ml

streptomycin and 12.6ml of 34µg/ml

chloramphenicol were aded.

1M potassium hydroxide solution 59.1g potassium hydroxide (Sigma) in 1000ml

milli-Q water.

186

Table 7.3: Reagents used in expression and purification of NSP4 proteins.

REAGENT COMPOSITION

1M DTT 3.09g of DTT (Promega) was dissolved in 20ml of 0.01M

sodium acetate (pH5.2)

Lysozyme (10mg/ml) 10mg of lysozyme powder (Roche) was dissolved in 1ml of

10mM Tris-Cl (pH8.0).

DNase I (1mg/ml)

2mg of pancreatic DNase I (Sigma) was dissolved in 1ml of

10mM Tris-Cl (pH7.5), 150mM NaCl, 1mM MgCl2 and

followed by addition of 1ml of glycerol (Sigma) to the

solution. The solution was mixed gently and stored in

aliquots of -20°C.

10% w/v bromophenyl

blue

10g bromophenyl blue (Boehringer) in 100ml distilled

water.

5 x SDS-PAGE

sample buffer

1.3 g SDS (Bio-Rad) was dissolved in 5.2 ml of 1M Tris

pH6.8 and then 6.5 ml glycerol (Sigma) was added to the

solution. 130 µl of 10% w/v bromophenyl blue was finally

added and mixed for 30 minutes.

Lysis buffer, pH8 6.9g of NaH2PO4 (Sigma), 17.54g of NaCl (BDH), 0.68g of

imidazole (Calbiochem) were dissolved in 800ml milli-Q

water and pH was adjusted to 8.0 using NaOH. Solution was

made up to 1 litre and autoclaved.

Wash buffer, pH8 6.9g of NaH2PO4 (Sigma), 17.54g of NaCl (BDH), 1.36g of

imidazole (Calbiochem) was dissolved in 800ml milli-Q



Elution buffer, pH8 6.9g of NaH2PO4 (Sigma), 17.54g of NaCl (BDH), 17.0g of

imidazole (Calbiochem) was dissolved in 800ml milli-Q



Terrific broth 12g of tryptone (Calbiochem), 24g of yeast extract

(Calbiochem) and 4ml of glycerol (Calbiochem) was

dissolved in 900ml milli-Q water. 2.31g of KH2PO4

187

(Calbiochem) and 12.54g K2HPO4 (Calbiochem) was

dissolved in 100ml of milli-Q water. Both solutions were

autoclaved and cooled to 60

Denaturing Lysis

Buffer

8M of urea, 500mM NaCl and 20mM Tris-HCI was

resolved and pH was adjusted to 8.0.

10% Glucose (100ml) Dextrose (D-glucose) 20g was dissolved in 90ml of milli-Q

water. Solution was made up to 100ml and autoclaved.

188

Table 7.4: Reagents used in preparation of SDS-PAGE gels.

REAGENT/BUFFER COMPOSITION

1 x Tris-glycine electrophoresis

buffer

3.03g of Tris base (MP Biomedicals) and 19g of

glycine (BDH) were mixed with 10ml of 10% SDS

and was made up to 500ml with milli-Q water.

1.5 M Tris-HCl, pH8.8 18.165g of Tris base (MP Biomedicals) was

dissolved in 80ml of milli-Q water and made up to

100ml with milli-Q water after adding

concentrated HCl to adjust pH to 8.8.

1M Tris-HCl, pH6.8 12.11g of Tris base (MP Biomedicals) was

dissolved in 80ml of milli-Q water and made up to

100ml with milli-Q water after adding

concentrated HCl to adjust pH to 6.8.

10% Ammonium Persulphate 0.1g of ammonium persulphate (Bio-Rad) was

dissolved in 1ml of milli-Q water.

200ml of Coomassie Brilliant

Blue R-250 staining solution

0.5g of Coomassie brilliant blue R-250 (Bio-Rad)

was dissolved in 70ml of ethanol, 10ml of milli-Q

water and 20ml of glacial acetic acid. Solution was

filtered through a Whatman No.1 filter.

200ml of Destaining solution 70ml of ethanol (Merck), 10ml of milli-Q water

and 20ml of glacial acetic acid (Merck).

189

Table 7.5: Reagents used in Western Blotting.

REAGENT/BUFFER COMPOSITION

Bjerrum and Schafer-

Nielsen transfer

buffer containing

SDS

(transfer buffer)

5.82 g of Trizma base (MP Biomedicals) and 2.93 g of glycine

(BDH) were dissolved in about 700 ml of milli-Q water

followed by adding 1.875 ml of 20% SDS and 200 ml of

methanol (BDH). Finally volume was adjusted to 1 litre with

milli-Q water.

PVDF membrane PVDF transfer membrane (Invitrogen) was soaked in 100%

methanol for 15 sec at RT and washed under running tap

distilled water followed by milli-Q water on the platform rocker

for five minutes. Membrane was then incubated in Bjerrum and

Schafer-Nielsen transfer buffer containing SDS for 30 minutes

on a platform rocker.

20% SDS 20 g SDS (Bio-Rad) was dissolved in 90 ml milli-Q water with

gentle stirring and made up to 100 ml with milli-Q water.

Filter papers Whatman 3MM filter paper (100mm x 73mm) were soaked in

Bjerrum and Schafer-Nielsen transfer buffer containing SDS for

30 minutes on platform rocker.

Blocking reagent, 1%

bovine serum

albumin (BSA)

0.2g BSA (Sigma) was dissolved in 20 ml PBS-0.1% T20 buffer.

PBS-0.1%-T20 buffer 8g NaCl (BDH), 0.2g KCl (BDH) and 1.44g Na2HPO4 (Sigma)

were dissolved in 800ml milli-Q water and pH was adjusted to

7.4 with concentrated HCl. Milli-Q water was added to one

litre. Finally, PBS solution was mixed well with 1ml of Tween

20.

1:1000 dilution of

anti-SA11 rabbit

polyclonal antibody

1µl of anti-SA11 rabbit polyclonal antibody was diluted in

1000µl of PBS-0.1% T20 buffer.

1:5000 horseradish

peroxidase-anti

rabbit IgG

1µl of horseradish peroxidase-anti rabbit IgG (Amersham

Biosciences) was diluted in 4999µl of PBS-0.1% T20 buffer.

190

Detection reagent Detection reagent 1 (Amersham Bioscience) was mixed with

detection reagent 2 (Amersham Bioscience) in a ratio of 1:1.

1:3000 dilution of

Monoclonal Anti-

polyHistidine Clone

HIS-1 antibody

1µl of monoclonal anti-poly-Histidine Clone HIS-1 antibody

(Sigma) was diluted in 3000µl of PBS-0.1% T20 buffer.