Expression of POU, Sox, and Pax Genes in the Brain Ganglia of the Tropical Abalone Haliotis asinina

Expression of POU, Sox, and Pax Genes in the BrainGanglia of the Tropical Abalone Haliotis asinina

Elizabeth K. O’Brien and Bernard M. Degnan*

Department of Zoology and Entomology, University of Queensland, Brisbane, Queensland 4072, Australia

Abstract: In gastropod mollusks, neuroendocrine cells in the anterior ganglia have been shown to regulate

growth and reproduction. As a first step toward understanding the molecular mechanisms underlying the

regulation of these physiological processes in the tropical abalone Haliotis asinina, we have identified sets of

POU, Sox, and Pax transcription factor genes that are expressed in these ganglia. Using highly degenerate

oligonucleotide primers designed to anneal to conserved codons in each of these gene families, we have

amplified by reverse transcriptase polymerase chain reaction 2 POU genes (HasPOU-III and HasPOU-IV), 2 Sox

genes (HasSox-B and HasSox-C), and two Pax genes (HasPax-258 and HasPax-6). Analyses with gene-specific

primers indicated that the 6 genes are expressed in the cerebral and pleuropedal ganglia of both reproductively

active and spent adults, in a number of sensory structures, and in a subset of other adult tissues.

Key words: POU, Sox, Pax, ganglia, mollusk, lophotrochozoan.

INTRODUCTION

Regulation of molluscan growth and reproduction operates

via a first-order neurosecretory mechanism that directly af-

fects the target organ (reviewed in Geraerts et al., 1991).

Environmental regulation of these physiological processes

appears to be via the anterior ganglia, which have direct

neural connections with specialized sensory structures and

house a suite of neuroendocrine cells (Roubos and van der

Wal-Divendal, 1982; Geraerts, 1986). For example, in Lym-

naea stagnalis hormones produced by neurosecretory cells

within the cerebral ganglia directly regulate growth and re-

production and maintain an antagonism between these two

physiological states (Geraerts, 1976; reviewed in Joose,

1988).

Analysis of the neuroendocrinology of commercially

important gastropod mollusks, such as the abalone (Veti-

gastropoda: Haliotidae), has been limited. Studies on aba-

lone have identified neurosecretory cells in the cerebral gan-

glia (Yahata, 1971; Hahn 1994; Upatham et al., 1998; Je-

breen et al., in press) and correlated neurosecretory activity

in the anterior ganglia with the reproductive cycle (Yahata,

1973; Hahn, 1994; Jebreen et al., in press). Although the

abalone central nervous system (CNS) exists in the primi-

tive streptoneurous condition (Crofts, 1929) and differs

from the more complex nervous systems of pulmonates, it

has been suggested that L. stagnalis can serve as a model for

understanding the underlying mechanisms controlling

growth and reproduction in molluscan species of commer-

cial importance (Geraerts et al., 1991).

Compared with other abalone, the tropical abalone

Haliotis asinina has an extremely predictable reproductive

and spawning cycle (R.T. Counihan et al., in press), grows

Received March 21, 2000; accepted June 21, 2000.

*Corresponding author: telephone +61-7-3365 2467; fax +61-7-3365 1655; e-mail

[email protected]

Mar. Biotechnol. 2, 545–557, 2000DOI: 10.1007/s101260000039

© 2000 Springer-Verlag New York Inc.

rapidly, and has a short generation time (reviewed in

Counihan et al., 1998). These features make H. asinina a

suitable abalone for investigating the molecular and cellular

bases of growth and reproduction in this commercially im-

portant group (Counihan et al., 1998).

The role of neuropeptides in regulating gastropod

growth and reproduction is well known (reviewed in

Geraerts et al., 1991), but the transcription factors control-

ling the expression of these peptides and the molecular

circuitry linking environmental stimuli to physiological

changes are still relatively unexplored. As a first step toward

understanding the molecular cascade underlying environ-

mentally induced changes in the physiology of the abalone,

we sought to identify a suite of transcription factor genes

expressed in the adult ganglia. Differential expression of

these trans-factors may underlie changes in the physiologi-

cal state given that they control not only the expression of

neuropeptide genes but also genes encoding enzymes and

other factors required for the correct processing and secre-

tion of the peptides (e.g., Ojeda et al., 1999).

In this study we focused on the evolutionarily con-

served POU, Sox, and Pax gene families because of their

consistent and essential association, across phyla, with the

anterior CNS during development and their continued as-

sociation in maturity. Genes from the POU multigene fam-

ily encode proteins that include an approximately 75 amino

acid POU-specific domain and a 60 amino acid homeodo-

main (Herr et al., 1988). Members of this family regulate

the development of central and peripheral nervous systems

(reviewed in Ryan and Rosenfeld, 1997; Veenstra et al.,

1997), are involved in the activation of growth genes (Man-

agalam et al., 1989), and have been implicated in the neu-

roendocrine control of puberty and ovulation (Ryan and

Rosenfeld, 1997; Wierman et al., 1997; Ojeda et al., 1999)

and in the regulation of neurotransmitter synthesis (Treacy

et al., 1991). Sox, a high mobility group (HMG) gene family,

encodes a protein with a conserved HMG box of 79 amino

acids (Janzten et al., 1990; Wright et al., 1993). This family

includes gene products known to interact with POU pro-

teins (e.g., Ambrosetti et al., 1997; Kuhlbrodt et al., 1998;

Soriano and Russell, 1998) and to facilitate DNA binding

(e.g., Ma et al., 1998), as well as acting as transcription

factors in their own right in the CNS (e.g., Uwanogho et al.,

1995; Soriano and Russell, 1998). The Pax gene family

members encode proteins containing a paired domain and

in some cases an octapeptide or homeodomain or both

(reviewed in Mansouri et al., 1996). Pax genes are essential

in the developing CNS and sensory systems, such as eyes

(e.g., Tomarev et al., 1997; reviewed in Stoykova and Gruss,

1994; Mansouri et al., 1996). They are also expressed during

the morphogenesis of a variety of organs (reviewed in Dahl

et al., 1997)

Using a reverse transcriptase polymerase chain reaction

(RT-PCR) approach (Degnan et al., 1997), we have dem-

onstrated that at least 2 members of each of these 3 gene

families are expressed in the cerebral and pleuropedal gan-

glia of adult H. asinina. Each of these genes displays a

unique pattern of expression in the adult, suggesting that

they have a number of developmental and physiological

roles in the tropical abalone.

MATERIALS AND METHODS

Animals and Larvae

Haliotis asinina were collected on the low tide, at night,

from the coral microatolls of the outer reef flat surrounding

Heron Island (23°278S; 151°558E). Spent adult abalone were

collected between June and August; and gravid abalone,

between October and April. Animals were maintained in

aquaria in flowing ambient (18–31°C) seawater and fed ad

libitum with the macroalgae Gracillaria spp. and Laurencia

spp. They were maintained in this way for no longer than 2

weeks.

Isolation of RNA

Cerebral and pleuropedal ganglionic complexes were dis-

sected from spent and gravid adult H. asinina and trimmed

of connecting nerves and the cerebropleural connectives.

Epipodial fringe, eye, tentacle, gill, gut, gonad, muscle, and

digestive gland were dissected from gravid adult abalone.

Total RNA was isolated from these tissues as described in

Chomczynski and Sacchi (1987). Ten ganglia were homog-

enized in 3 ml of ice-cold guanidinium extraction solution.

Nucleic acids were further purified by precipitation in 4 M

LiCl as described in Sambrook et al. (1989).

Reverse Transcriptase Polymerase Chain Reaction

Degenerate oligonucleotide primers (Table 1) were de-

signed to anneal to highly conserved codons of members of

the POU, Sox, and Pax multigene families. POU primers

were designed to anneal to codons 20 to 29 of the POU-

specific domain (F/LKQRRIKLG) and 156 to 164 of the POU

homeodomain (VVRVWFCNR). Sox primers annealed to

546 Elizabeth K. O’Brien and Bernard M. Degnan

codons 17 to 25 and 76 to 84 of the Sox domain, KYPDYKYRP

and MNAFMVWSR, respectively. Pax degenerate oligonucleo-

tide primers were designed to anneal to NQLGGVFVNG and

FAWEIRDR, codons 9 to 18 and 99 to 106 of the paired do-

main, respectively.

Complementary DNA was synthesized from 1 µg of

total RNA at 42°C for 1 hour using random oligonucleotide

hexamers and PCR amplified as described in Degnan and

Morse (1993). PCR products were gel purified and ligated

into EcoRV-digested pKS+ plasmid as described in Degnan

and Morse (1993). Plasmid DNA inserts were sequenced

from recombinant clones using the ABI prism dye termi-

nator kit. Sequences were analyzed using SEQUENCHER

Version 3.0 (Gene Codes Corp., 1995), and the putative

amino acid sequences were compared with those available

on the BLAST database (Altschul et al., 1997).

Using gene-specific oligonucleotide primers (Table 1),

we assessed expression of individual genes in adult tissues

with RT-PCR. One microgram of total RNA from each

tissue was reverse transcribed into cDNA. One twentieth of

the cDNA (i.e., equivalent to 50 ng of total RNA) was sub-

jected to a 28-cycle PCR amplification regimen with gene-

specific primers (Table 1; Degnan and Morse, 1993). One

tenth of that reaction was electrophoresed on a 2% agarose

gel. The results from each primer set were compared to

confirm that the RNAs from all tissue samples were viable

templates for RT-PCR. To determine if RT-PCR bands were

derived from contaminating genomic DNA, control PCRs

with each gene-specific primer set were performed on 50 ng

of total RNA isolated from each tissue.

Construction of Dendrograms

A variety of metazoan amino acid sequences for homolo-

gous gene products were collected from the NCBI database

and aligned using CLUSTAL W (Thompson et al., 1994).

The similarity between abalone and other homologous

metazoan genes was calculated taking into accounting the

following conserved amino acid sets: I = V = L; T = S; R =

K; D = E; N = Q; F = Y = W. PHYLIP Version 3.5c (Felen-

Table 1. Oligonucleotide Primer Sequences, Annealing Temperature, and Expected Product Size of RT-PCR Amplification of

Abalone RNA

Primer label Sequence 58-38

Tm

(°C)

PCR

cycles

Product

size (bp)

Degen. POU-1 TTYAARSWNMGNMGNATHAARYTNGG

Degen. POU-2 CKRTTRCARAACCANACNCKNACNAC 45 35 390–440

Degen. Sox-1 AARMGNCCNATGAAYGCNTTYATGGTNTGG

Degen. Sox-2 GGNCKRTAYTTRTARTCNCCRTRYT 45 35 213

Degen. Pax-1 AAYCARYTNGGNGGNGTNTTYGTNAAYGG

Degen. Pax-2 GKRTCNCKDATYTCCCANGMRAANAT 45 35 267

HasPOU-III-1 GCTTTACACAGGCCGATGTCGG

HasPOU-III-2 GCAGCTGATCTGCTAGTTGGC 61 28 300

HasPOU-IV-1 AGCCAAAGCACGATTTGCCGG

HasPOU-IV-2 CTAACTTCTCGGCTATCTGAGCG 61 28 265

HasSox-B-1 CGGAAGATTTCCGAAGTGTCACCCG

HasSox-B-2 CGGCTTCCTCGATGTAAGGTTGACGC 63 28 143

HasSox-C-1 CCGAAATGCACAACGCTGAAATCAGC

HasSox-C-2 CGACGGTATCGATAAGCTTGATGGGCG 70 28 114

HasPax-258-1 GCTGCCCGATGTAGTTCGTACCC

HasPax-258-2 ACTTTTGGAGTCGCCACTTTGG 60 28 261

HasPax-6-1 GACTCAACAAGTACAGAGAATCG

HasPax-6-2 CGGGCACTCGCGTTTAAACTG 61 28 220

POU, Sox, and Pax Genes in Abalone 547

stein, 1993) was used to estimate molecular distances with

a neighbor-joining method using the Dayhoff PAM matrix

model of amino acid substitution as the distance measure.

The confidence at each node was assessed by 1000 bootstrap

pseudoreplications.

RESULTS

Sequence Analysis of POU, Sox, and Pax Genes

Using degenerate oligonucleotide primers designed to an-

neal to conserved regions of POU, Sox, and Pax genes

(Table 1), we amplified complementary DNA (cDNA) de-

rived from H. asinina cerebral and pleuropedal ganglia

RNA. Ganglia samples were separated by season thus pro-

viding 4 separate pools of RNA: cerebral and pleuropedal

ganglia from winter and summer. The inability to sex in-

dividual abalone during winter precluded the analysis of

gene expression in male and female brains. The POU, Sox,

and Pax primers successfully generated RT-PCR products,

of 390–440, 213, and 267 nucleotides, respectively, from

each of the designated pools. We purified and cloned RT-

PCR products from each RNA pool separately and se-

quenced individual clones (Table 2).

We sequenced 93 clones that contained cDNAs encod-

ing the putative transcription factors and found there were

2 POU, 2 Sox, and 2 Pax genes expressed in the anterior

CNS of the adult abalone (Table 2). A consensus sequence

for each of the 6 genes was produced (Figure 1). Each gene

was given a name that reflected the species from which the

gene was isolated and the subfamily of transcription factors

to which it was most closely related (see below). For ex-

ample, the Haliotis asinina POU gene that had greatest iden-

tity to class III genes was called HasPOU-III. As we did not

obtain PCR bands from control amplifications of RNA

samples without reverse transcriptase (not shown), we were

sure that the sequences derived by RT-PCR represented

genes expressed in these ganglia and not contaminating

genomic DNA. The degenerate oligonucleotide primers

were designed to amplify a wider range of POU, Sox, and

Pax genes than was detected in ganglia cDNA (for examples,

see Burglin et al., 1989, for POU; Kenny et al., 1999, for Sox;

Hoshiyama et al., 1998, for Pax), suggesting that not all

members of these metazoan gene families were expressed in

the adult H. asinina brain.

Comparison of the two H. asinina–derived amino acid

POU sequences with other metazoan sequences revealed

that these were members of two distinct classes of POU

genes (Figure 2, A). The portion of cDNA amplified in this

study corresponded to the regions that encode most of the

highly conserved POU-specific domain and homeodomain.

Over this highly conserved region of the protein, HasPOU-

III was 96% similar, after accounting for conserved amino

acid substitutions, to the Drosophila Cf1a protein (Johnson

and Hirsh, 1990) and Bombyx mori SGF-3 (Fukata et al.,

1993) (Figure 2, A). The highly variable linker region lo-

cated between the POU-specific domain and the POU ho-

meodomain was 17 amino acids in HasPOU-III, which was

the same length as other class III members. This gene prod-

uct also clustered with other class III POU proteins (Figure

2, B). The second abalone POU gene product, HasPOU-IV,

could be placed within the POU-IV class. This abalone gene

product was most similar to arthropod sequences, with the

Drosophila I-POU protein being 89% similar when account-

Table 2. Identity and Number of Clones Sequenced from Pooled RNA Samples of Adult Cerebral Ganglia (c.g.) and Pleuropedal Ganglia

(p.g.), During the Winter and Summer Seasons

Has

POU-III

Has

POU-IV

Has

Sox-B

Has

Sox-C

Has

Pax-258

Has

Pax-6

c.g.

Winter 2 2 5 2 5 5

Summer 4 0 11 1 1 7

p.g.

Winter 5 4 5 0 7 5

Summer 5 2 6 3 3 3

Total per gene 16 8 27 6 16 20

Total per gene family 24 33 36


ing for conserved substitutions (Figure 2, A). The linker was

also conserved in size (16 amino acids) with others in this

class. Phylogenetic analysis grouped HasPOU-IV with other

metazoan POU class IV gene products (Figure 2, B).

Alignment of the 2 abalone partial Sox gene products

with other metazoan sequences warranted the placement of

H. asinina sequences into one of the previously established

Sox groups (groups A–F; Wright et al., 1993). The abalone

sequences encoded part of the highly conserved HMG

DNA-binding domain. HasSox-B was most similar to the

mouse Sox-2 protein (96% identity) and other group B Sox

gene products (Figure 3, A). HasSox-C was most similar

(82% similarity) to group C Sox gene products, which in-

cluded mouse Sox-4, -11, and -13 (Figure 3, A). Phyloge-

netic analysis of members of this family of transcription

factors (Figure 3, B) supported the alignment data and the

classification of the H. asinina Sox gene products in groups

B and C. A bootstrap analysis was undertaken for the Sox

gene products, but the values were very low. This was prob-

ably because of the short length of the sequence and the low

number of informative characters. Without informative

bootstrap values, the strength of the assignment of the H.

asinina Sox genes to specific groups could not be assessed.

The abalone Pax-derived amino acid sequences

matched most closely to those of other mollusks. The

HasPax-258 amino acid sequence was 95% similar to the

Pax258 gene product from another gastropod, Illyanassa

obsoleta (Figure 4, A), and highly similar to mouse gene

products from this group (90%–92%). The other abalone

Pax gene product, HasPax-6, was 99% and 98% similar to

squid and mouse Pax6 amino acid sequences, respectively

(Figure 4, B). The consensus neighbor-joining tree (Figure

4, C) indicated an inherent difficulty in confidently dem-

onstrating relatedness within the Pax-6 grouping as deter-

mined by the low bootstrap values. Compared with other Pax

gene products, HasPax-6 grouped with 82% certitude with

other metazoan Pax-6 products (Figure 4, C). The Pax-258

product grouped with other Pax-258 members and was sepa-

rate from the other Pax gene classes (Balczarek et al., 1997).

Expression of POU, Sox, and Pax Genes

Using gene-specific oligonucleotide primers (Table 1), we

determined by RT-PCR amplification whether HasPOU-III,

POU-IV, Sox-B, Sox-C, Pax-258, and Pax-6 transcripts were

present in a variety of adult tissues. This approach allowed

us to determine gross levels of transcript abundance only

(i.e., presence or absence of messenger RNAs and expres-

sion at relatively high or low levels). RNAs isolated from all

adult tissues appeared to act as viable RT-PCR templates, as

each RNA sample was amplified by at least one gene-

specific oligonucleotide primer set (Figure 5). Direct PCR

amplification of equivalent amounts of RNA, not reverse

transcribed into cDNA, did not yield detectable bands with

any of the oligonucleotide primer sets (data not shown),

indicating that the bands produced in the RT-PCR ampli-

fication were derived from RNA and not contaminating

genomic DNA.

Both Has-POU genes were expressed in the cerebral

Figure 1. Consensus nucleotide sequences and derived amino

acid sequences of putative transcription factor cDNA fragments

from the adult abalone ganglia. Nucleotide and amino acid num-

bering are to the right. NCBI accession numbers: HasPOU-III,

AF231942; HasPOU-IV, AF231943; HasSox-B, AF231944; HasSox-

C, AF231945; HasPax-258, AF231946; HasPax-6, AF231947


and pleuropedal ganglia from adults collected from

winter and summer (Figure 5). Although not quanti-

tative, there appeared to be an increase in the levels of

HasPOU-III transcripts in both ganglia during the winter.

The other abalone POU gene, HasPOU-IV, appeared to be

expressed more consistently in the ganglia throughout the

year. HasPOU-III transcripts were also detected in the epi-

podial fringe, tentacle, eye, gill, and muscle (Figure 5), al-

though transcripts appeared to be less abundant in the gill.

HasPOU-IV was also expressed in the fringe, eye, tentacle,

and gill but was undetectable in the gut, gonad, muscle, or

digestive gland.

The 2 abalone Sox genes were expressed in the adult

ganglia but exhibited different patterns of expression in the

other adult tissues (Figure 5). Except for the gut and diges-

tive gland HasSox-B expression was detected in all other

tissues examined. HasSox-C transcripts were detected in all

tissues, although transcript abundance in the muscle ap-

peared to be lower (Figure 5).

Pax gene expression also appeared to be mainly restricted

Figure 2. Classification of Haliotis

asinina POU sequences. A:

Alignment of derived amino acid

sequence of abalone POU genes

with metazoan POU sequences.

Dots indicate identity and dashes

are gaps. The first value to the

right of the sequence is percentage

of amino acid sequence identity to

the H. asinina sequence, and the

second value is percentage of

amino acid similarity, taking into

account the following conservative

amino acid substitutions: I = V =

L, W = F = Y, T = S, D = E, R =

K, N = Q. Abbreviations are as

follows: Has, Haliotis asinina; D,

Drosophila; Bo, Bombyx mori; A,

Artemia franciscana; M, mouse,

Mus musculus; Dj, planaria,

Dugesia japonica; Hc, Herdmania

curvata; Ce, Caenorhabditis elegans.

B: Unrooted consensus tree

generated by the neighbor-joining

method from a distance matrix

bootstrapped 1000 times, using

metazoan POU amino acid

sequences. H. asinina POU gene

products are boxed. Classes

determined from the literature are

listed to the right of the tree.


to adult tissues associated with the CNS including cerebral and

pleuropedal ganglia and to sensory structures such as the epi-

podial fringe, eyes, tentacles and gills, as well as in the muscle

(Figure 5). HasPax-258 mirrored HasSox-B expression in that

it was expressed in the gonad as well (Figure 5).

DISCUSSION

Using degenerate oligonucleotide primers designed to am-

plify conserved regions of members of POU, Sox, and Pax

multigene families, we identified 2 members of each of these


asinina Sox sequences. A: Alignment

of conceptual translation of H. asinina

Sox partial cDNAs with metazoan Sox

domains. See Figure 2 for description

of symbols and abbreviations. B:

Unrooted neighbor-joining tree

calculated from a distance matrix of

representative metazoan and abalone

Sox gene products; abalone genes are

boxed.


transcription factor families that are expressed in the brain

ganglia of the adult tropical abalone Haliotis asinina. Given

the known role of molluscan ganglia in integrating envi-

ronmental signals and regulating a range of physiological

processes through the regulated secretion of neuropeptides

(Roubos and van der Wal-Divendal, 1982; reviewed in

Geraerts et al., 1991), transcription factors expressed in this

tissue may have a role in regulating these events. POU, Sox,

and Pax genes are known to be widely expressed in the

developing and mature CNS in other metazoans (reviewed


asinina Pax sequences. A: Alignment

of amino acid sequences from the

paired domain of abalone and other

metazoan Pax gene products. See

Figure 2 for description of symbols

and abbreviations. II indicates

Illyanassa obsoleta; Lo, Loligo

opalescens; Ph, Phallusia mammilata;

Rw, ribbon worm, Lineus sanguineus;

Scy, scyphozoan, Chrysaora

quinquecirrha; Su sea urchin,

Paracentrotus lividus. B: Cladogram of

metazoan Pax gene products as

calculated from a distance matrix and

presented as an unrooted

neighbor-joining tree. Previously

defined groups are highlighted and

abalone genes are boxed.


in Stoykova and Gruss, 1994; Scotting and Rex, 1996) and

have been implicated in a number of physiological changes

in mammals (e.g., Wiermann et al., 1997; Hunt and Clarke,

1999).

Molecular Evolution of POU, Sox, and Pax Genes

In order to understand the function of genes in nonmodel

animals, such as the abalone, it is important to examine

their conserved roles in other, better studied animals and

the evolutionary relationship of the genes themselves. Meta-

zoan phylogenies based chiefly on small subunit ribosomal

RNA data suggest that bilaterians can be divided into 3 great

evolutionary lineages: the deuterostomes and 2 protostome

groups, the lophotrochozoans and ecdysozoans (reviewed

in Adoutte et al., 1999; Valentine et al., 1999). The Lopho-

trochozoa include mollusks, annelids, platyhelminths, and

lophophorates and a range of minor phyla. Although there

is extensive knowledge about the role of a range of POU,

Sox, and Pax genes in ecdysozoan (i.e., Drosophila and Cae-

norhabditis elegans) and deuterostome (i.e., vertebrate) rep-

resentatives, there have been only a few reports of these

genes and their expression in mollusks and their lophotro-

chozoan relatives. These include djPOU-1, a class III POU

gene isolated from a planaria (Munoz et al., 1998), and

Pax-6 homologues in squid (Tomarev et al., 1997), planaria

(Callaerts et al., 1999), and ribbonworm (Loosli et al.,

1996).

This report identifies 6 putative transcription factors, in-

cluding the first molluscan POU genes and the first lopho-

trochozoan Sox genes. These are important additions to the

lophotrochozoan molecular database. Molecular phyloge-

netic analyses classify the H. asinina genes into known

clades within the 3 gene families, indicating the antiquity of

these gene classes within the larger multigene families. That

each of these genes is expressed in the CNS and sensory

systems of representatives of the proposed superphyla, ar-

thropods (ecdysozoan), vertebrates (deuterostone), and H.

asinina (lophotrochozoan), suggests a conserved role for

these genes in the development of the bilaterian nervous

system. These data, combined with recent reports of con-

served expression for Hox genes in the CNS of abalone and

other lophotrochozoans (e.g., Kourakis et al., 1997; Irvine

and Martindale, 2000; Giusti et al., 2000), suggest that the

genetic regulatory circuitry underlying the specification,

patterning, differentiation, and maintenance of bilaterian

nervous systems is highly conserved.

In this study we focused solely on POU, Sox, and Pax

genes expressed in the anterior ganglia of H. asinina. This

approach identified only a subset of the known members of

these gene families. In previous studies similar primer sets

have successfully amplified a wider range of gene classes

from invertebrate taxa (e.g., POU, Burglin et al., 1989; Sox,

Kenny et al., 1999; Pax, Hoshiyama et al., 1998). Combined,

these data suggest that only a subset of the total number of

POU, Sox, and Pax genes in the H. asinina genome are

expressed in adult brain ganglia.

POU Gene Expression and Evolution

Of the 6 classes of POU genes present in the bilaterians,

only 3—classes II, III, and IV—appear to be represented

in invertebrates (see Figure 2, B). Molecular phylogenetic

analyses predict that in addition to the HasPOU-III and

HasPOU-IV genes, the H. asinina genome should possess

a class II representative. However, POU-II transcripts in

invertebrates appear to be expressed only in the larval

stages (reviewed in Veenstra et al., 1997). HasPOU-III and

HasPOU-IV, as is the case with other POU-III and POU-IV

genes, are expressed in the adult CNS and several sensory

tissues (epipodial fringe, eye, cephalic tentacle, and gills).

Vertebrate, insect, and nematode homologues of

HasPOU-III play a variety of roles in the adult, including

Figure 5. RT-PCR analysis of POU, Sox, and Pax gene expression

in Haliotis asinina adult brain ganglia and tissues. Total RNA (50

ng) was RT-PCR amplified with gene-specific primers (Table 1).

One tenth of PCR amplification product was resolved on a 2%

agarose gel. PCR amplification of an equivalent amount of RNA,

not reverse transcribed into cDNA, did not produce a detectable

band in any of the tissue-primer combinations. At least one set of

primers amplified every RNA sample, indicating that RNAs from

all tissues were viable RT-PCR templates.


the regulation of expression of mammalian hormones

(Wierman et al., 1997; Murphy et al., 1998; Ramkumar and

Adler, 1999) and Ddc (dopa decarboxylase) in Drosophila,

which catalyzes the formation of the neurotransmitters do-

pamine and serotonin (Johnson and Hirsh, 1990).

HasPOU-IV homologues can function both as tran-

scriptional activators and as repressors in the CNS. For

example, mouse Brn-3b, a POU-IV gene, activates the ex-

pression of the estrogen receptor gene (Budhram-Mahadeo

et al., 1998) and represses a-internexin and SNAP-25 ex-

pression (Budhram-Mahadeo et al., 1995; Lakin et al., 1995;

Morris et al., 1997; Gay et al., 1998). The POU-IV Dro-

sophila homologue, I-POU, can function as an activator or

a repressor, depending on the isoform (Treacy et al., 1992).

I-POU forms a stable heterodimer with Cfla (POU class III)

preventing it from transactivating the Ddc gene (Treacy et

al., 1991). Given that class III and IV POU gene products

have been shown to interact in both mammals and insects,

there is a possibility that HasPOU-III and HasPOU-IV in

the H. asinina ganglia are operating in a similar fashion. The

titer and ratio of these factors in the nuclei of brain cells

may dictate the profile of genes that are expressed, for ex-

ample, during reproductive and nonreproductive seasons.

Changes in transcription factor concentrations as small as

2-fold to 3-fold have been shown to result in differential

regulation of target genes (Struhl et al., 1989; Kolman et al.,

1992). In the present study we did not determine relative

levels of HasPOU-III and HasPOU-IV transcripts or pro-

teins.

Expression and Possible Function of Sox Genes

The H. asinina Sox genes expressed in the brain and a wide

range of adult tissues appear to be members of the Sox B

and C groups. It is likely that the abalone genome encodes

more representatives from the Sox family, as Sox transcripts

from groups D and F are expressed in other invertebrates.

However, on the basis of the RT-PCR approach used in this

study, they do not appear to be expressed in the adult

ganglia of abalone. Although vertebrate and abalone Sox B

and C genes are expressed in a wide range of tissues (e.g.,

van der Wetering et al., 1993; Collingnon et al., 1996;

Czerny et al., 1997; Jay et al., 1997; Hunt and Clarke, 1999),

on the basis of the expression patterns of Sox homologues in

other invertebrates (Ma et al., 1998; Soriano and Russell,

1998), it appears that their conserved role may be in CNS

development and maintenance.

There are also a number of studies reporting the inter-

action of POU and Sox proteins (e.g., Yuan et al., 1995;

Ambrosetti et al., 1997; Kuhlbrodt et al., 1998; Ma et al.,

1998). For example, mouse Sox 11 (group C) interacts with

Brn 1 (POU class III) during oligodendrocyte development

(Kuhlbrodt et al., 1998). Sox2 (group B) and Oct-3 (POU

class IV) act in synergy to activate fibroblast growth factor

(FGF-4) gene expression (Yuan et al., 1995; Ambrosetti et

al., 1997). It has been also been suggested that the Dro-

sophila Sox 2 homologue Fish-hook can interact with Cfla

(POU class III) (Soriano and Russell, 1998).

Conservation of Pax Gene Expression

Pax genes are an ancient group of metazoan transcription

factors that have been detected in all taxa surveyed, includ-

ing sponges (Hoshiyama et al., 1998). There are 5 major

classes of Pax genes. In this survey, we have detected only 2

abalone Pax genes, HasPax-258 and HasPax-6, expressed in

the adult abalone brain ganglia. Homologues of these genes

play central roles in the development of metazoan nervous

and sensory systems (e.g., Czerny et al., 1997; Kozmik et al.,

1997; Pfeffer et al., 1998), and a number of these genes have

previously been isolated from mollusks; Pax-6 is expressed

during eye development in squid (Tomarev et al., 1997).

Pax genes are also expressed in the brain and reproductive

system of bilaterian adults (reviewed in Strachan and Read,

1994). As we initially isolated HasPax-258 and HasPax-6

from ganglia, we infer that these genes are playing a role in

the abalone CNS beyond its initial development. Both

HasPax-258 and HasPax-6 also are expressed in a range of

abalone tissues known to have photosensory and chemo-

sensory capabilities: epipodial fringe, eye, cephalic tentacle,

and gill. In addition, HasPax-258 is expressed in the gonad.

Mouse Pax2 and Pax5 genes are also expressed in adult

reproductive organs (Strachan and Read, 1994), suggesting

a conserved role for this gene orthologue group in animal

reproduction.

Conclusions

A number of POU, Sox, and Pax genes that are known to

play important roles in regulating gene transcription during

nervous system development of other bilaterians are ex-

pressed in the brain ganglia and sensory tissues of the tropi-

cal abalone Haliotis asinina. To date, there is a paucity of

information about the expression of these genes in mollusks

and other lophotrochozoans; we have identified the first

molluscan POU genes (HasPOU-III and HasPOU-IV) and


the first lophotrochozoan Sox genes (HasSox-B and HasSox-

C). The expression of these genes in the adult brain suggests

that they may have a role in regulating the expression of

genes directly responsible for controlling growth and repro-

duction in the abalone.

ACKNOWLEDGMENTS

We thank the staff at the Heron Island Research Station for

their assistance in maintenance of abalone. This work was

supported by Australian Research council grants to B.M.D.

REFERENCES

Adoutte, A., Balavoine, G., Latillot, N., and de Rosa, R. (1999).

Animal evolution: the end of intermediate taxa? Trends Genet 15:

104–108.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z.,

Miller, W., and Lipman, D.J. (1997). Gapped BLAST and PSI-

BLAST: a new generation of protein database search programs.

Nucleic Acids Res 25:2289–3402.

Ambrosetti, D.C., Basilico, C., and Dailey, L. (1997). Synergistic

activation of the fibroblast growth factor 4 enhancer by Sox2 and

Oct-3 depends on protein-protein interactions facilitated by a spe-

cific spatial arrangement of factor binding sites. Mol Cell Biol

17:6321–6329.

Balczarek, K.A., Lai, Z.C., and Kumar, S. (1997). Evolution and

functional diversification of the paired box (Pax) DNA-binding

domains. Mol Biol Evol 14:829–842.

Budhram-Mahadeo, V., Morris, P.J., Lakin, N.D., Theil, T., Ching,

G.Y., Lillycrop, K.A., Moroy, T., Liem, R.K.H., and Latchman, D.S.

(1995). Activation of the a-internexin promoter by the Brn-3a

transcription factor is dependent on the N-terminal region of the

protein. J Biol Chem 270:5853–5858.

Budhram-Mahadeo, V., Parker, M., and Latchman, D.S. (1998).

POU transcription factors Brn-3a and Brn-3b interact with the

estrogen receptor and differentially regulate transcriptional activ-

ity via an estrogen response element. Mol Cell Biol 18:1029–1041.

Burglin, T.R., Finney, M., Coulson, A., and Ruvkun, G. (1989)

Caenorhabolitis has scores of homeobox-containing genes. Nature

341:239–243.

Callaerts, P., Munoz Marmol, A.M., Glardon, S., Castillo, E., Sun,

H., Li, W.H., Gehring, W.J., and Salo, E. (1999). Isolation and

expression of a Pax-6 gene in the regenerating and intact planar-

ian, Dugesia(G) tigrina. Proc Natl Acad Sci USA 96:558–563.

Chomczynski, P., and Sacchi, N. (1987). Single-step method of

RNA isolation by acid-guanidinium-thiocyanate-phenol-

chloroform extraction. Anal Biochem 162:156–159.

Collignon, J., Sockananthan, S., Hacker, A., Cohen Tannoudji, M.,

Norris, D., Rastan, D., Stevanovic, M., Godfellow, P.N., and Lov-

ell-Badge, R. (1996). A comparison of the properties of Sox-3 with

Sry and two related genes, Sox-1 and Sox-2. Development 122:509–

520.

Counihan, R.T., McNamora, D.C., Souter, D.C., Jebreen, E.J., Pre-

ston, N.P., Johnson, C.R., and Degnan, B.M. (2001) Pattern, Syn-

chrony and predictability of spawning of the tropical abalone

Haliotis asinina from Heron Reef, Australia. Mar. Ecol. Prog. Ser.

(in press).

Counihan, R.T., Preston, N.P., and Degnan, B.M. (1998). The

tropical abalone, Haliotis asinina, as a model species to investigate

the molecular and cellular mechanisms controlling growth in aba-

lone. In: New Developments in Marine Biotechnology, Le Gal, Y.,

and Halvorson, H.O. (eds.). New York: Plenum Publishing, 135–

140.

Crofts, D.R. (1929). Haliotis. Liverpool Mar Biol Comm Memoirs

Typical Br Mar Plants Animals 29:1–174.

Czerny, C., Bouchard, T., Kozmik, M., and Busslinger, Z. (1997).

The characteristics of novel Pax genes of the sea urchin and Dro-

sophila reveal an ancient evolutionary origin of Pax2/5/8 subfam-

ily. Mech Dev 67:179–192.

Dahl, E., Koseki, H., and Balling, R. (1997). Pax genes and or-

ganogenesis. Bioessays 19:755–765.

Degnan, B.M., and Morse, D.E. (1993). Identification of eight

homeobox-containing transcripts expressed during larval develop-

ment and at metamorphosis in the gastropod mollusc Haliotis

rufescens. Mol Mar Biol Biotechnol 2:1–9.

Degnan, B.M., Degnan, S.M., and Morse, D.E. (1997). Muscle-

specific regulation of tropomyosin gene expression and myofibril-

logenesis differs among muscle systems examined at metamorpho-

sis of the gastropod Haliotis rufescens. Dev Genes Evol 206:464–471.

Felenstein, J. (1993). PHYLIP: Phylogenetic Inference Package. Ver-

sion 3.5C. University of Washington, Seattle.

Fukata, M., Matsuno, K., Hui, C.C., Nagata, T., Takiya, S., Xu,

P.X., Ueno, K., and Suzuki, Y. (1993). Molecular cloning of a POU

domain-containing factor involved in the regulation of the Bom-

byx sericin-1 gene J Biol Chem 268:19471–19475.

Gay, R.D., Dawson, S.J., Murphy, W.J., Russell, S.W., and Latch-

man, D.S. (1998). Activation of the iNOS gene promoter by Brn-3

POU family transcription factors dependent upon the octamer

motif in the promoter. Biochim Biophys Acta 1443:315–322.


Geraerts, W.P.M. (1976). The role of the lateral lobes in the con-

trol of growth and reproduction. Gen Comp Endocrinol 29:97–108.

Geraerts, W.P.M. (1986). Environmental endocrinology and the

control of reproductive season in molluscs. Adv Invert Reprod

4:151–162.

Geraerts, W.P.M., Smit, A.B., Li, K.W., Hordijk, P.L., and Joosse,

J. (1991). Molecular biology of hormones involved in the regula-

tion of reproduction and growth in molluscs. Bull Inst Zool Acad

Sinica Monogr 16:387–440.

Giusti, A.F., Hinman, V.F., Degnan, S.M., Degnan, B.M., Morse,

D.E. (2000). Expression of a Hox5/Scr gene in the larval central

nervo is system of the gastropod Haliotis, a non-segmented spira-

lian lophotrocozoan. Evol Dev 2:294–302.

Hahn, K.O. (1994). The neurosecretory staining in the cerebral

ganglia of the Japanese abalone (ezowabi), Haliotis discus hannai,

and its relationship to reproduction. Gen Comp Endocrinol 93:

295–303.

Herr, W., Sturm, R.A., Clerc, R.G., Corcoran, L.M., Baltimore, D.,

Sharp, P.A., Ingraham, H.A., Rosenfeld, M.G., Finney, M., Ruv-

kun, G., and Horvitz, H.R. (1988). The POU domain: a large

conserved region in the mammalian pit-1, oct-1, oct-2 and Cae-

norhabditis elegans unc-86 gene products. Genes Dev 2:1513–1516.

Hoshiyama, D., Suga, H., Iwabe, N., Koyanagi, M., Nikoh, N.,

Kuma Ke’i, I., Matsuda, F., Honjo, T., and Miyata, T. (1998).

Sponge Pax cDNA related to Pax-2/5/8 and ancient gene duplica-

tions in the Pax family. J Mol Evol 47:640–648.

Hunt, S.M.N., and Clarke, C.L. (1999). Expression and hormonal

regulation of the Sox4 gene in mouse female reproductive tissues.

Biol Reprod 61:476–481.

Hussain, M.A., and Habener, J.F. (1999). Glucagen gene transcrip-

tion activation mediated by synergistic interactions of Pax-6 and

Cdx-2 with the p300 co-activator. J Biol Chem 274:28950–28957.

Irvine, S.Q., and Martindale, M.Q. (2000). Expression patterns of

anterior Hox genes in the polychaete Chaetopterus: correlation

with morphological boundaries. Dev Biol 217:333–351.

Jantzen, H.M., Admon, A., Bell, S.P., and Tijan, R. (1990). Nucleo-

lar transcription factor hUBF contains a DNA-binding motif with

homology to the HMG proteins. Nature 344:830–836.

Jay, P., Sahly, I., Goze, C., Taviaux, S., Poulat, F., Couly, F., Abit-

bol, M., and Berta, P. (1997). SOX22 is a new member of the Sox

gene family mainly expressed in the human nervous tissue. Hum

Mol Genet 6:1069–1077.

Johnson, W.A., and Hirsh, J. (1990). Binding of a Drosophila

POU-domain protein to a sequence element regulating gene ex-

pression in specific dopaminergic neurons. Nature 343:467–470.

Joose, J. (1988). The hormones of molluscs. In: Endocrinology of

Selected Invertebrate Types, Laufer, H., and Downer, G.H. (eds.).

New York: Alan R. Liss, 89–140.

Kenny, A.P., Kozlowski, D., Oleksyn, D.W., Angerer, L.M., and

Angerer, R.C. (1999) Sp Sox Bl, a maternally encoded transcrip-

tion factor asymmetrically distributed amoung early sea urchin

blastomeres. Development 126:5473–5483.

Kourakis, M.J., Master, V.A., Lokhorst, D.K., Nardelli-Haefliger,

D., Wedeen, C.J., Martindale, M.Q., and Shankland, M. (1997).

Conserved anterior boundaries of Hox gene expression in the

central nervous system of the leech Helobdella. Dev Biol 190:284–

300.

Kolman, A., Bohusova, T., Lambert, B., and Simons, J.W.I.M.

(1992). Induction of 6-thioguanine-resistant mutants in human

diploid fibroblasts in vitro with ethylene oxide. Environ Mol Mu-

tagen 19:93–97.

Kozmik, Z., Czerny, T., and Busslinger, M. (1997). Alternatively

spliced insertions in the paired domain restrict the DNA sequence

specificity of Pax-6 and Pax-8. EMBO J 16:6793–6803.

Kuhlbrodt, K., Herbarth, B., Sock, E., Enderich, J., HermansBorg-

meyer, I., and Wegner, M. (1998). Cooperative function of POU

proteins and Sox proteins in glial cells. J Biol Chem 273:16050–

16057.

Lakin, N., Morris, P., Theil, T., Sato, T., Moroy, T., Wilson, M.,

and Latchman, D. (1995). Regulation of neurite outgrowth and

SNAP-25 gene expression by the Brn-3a transcription factor. J Biol

Chem 270:15858–15863.

Loosli, F., KmitaCunisse, M., and Gehring, W.J. (1996). Isolation

of a Pax-6 homolog from the ribbonworm Lineus sanguineus. Proc

Natl Acad Sci USA 93:2658–2663.

Ma, Y., Niemitz E.L., Nambu P.A., Shan, X., Sackerson, C., Fu-

jioka, M., Goto, T., and Nambu J.R. (1998). Gene regulatory func-

tions of Drosophila fish-hook, a high mobility group domain Sox

protein. Mech Dev 73:169–182.

Mangalam, H.J., Albert, V.R., Ingraham, H.A., Kapiloff, M., Wil-

son, L., Nelson, C., Elsholtz, H., and Rosenfeld, M.G. (1989). A

pituitary POU domain protein, Pit-1, activates both growth hor-

mone and prolactin promoters transcriptionally. Genes Dev 3:946–

958.

Mansouri, A., Hallonet, M., and Gruss, P. (1996). Pax genes and

their roles in cell differentiation and development. Curr Opin Cell

Biol 8:851–857.

Morris, P.J., Theil, T., Ring, C.I.A., Lillycrop, K.A., Moroy, T., and

Latchman, D.S. (1994). The opposite and antagonistic effects of

the closely related POU family transcription factors Brn-3a and

Brn-3b on the activity of a target promoter are dependent on

differences in the POU domain. Mol Cell Biol 14:6907–6914.

Morris, P.J., Dawson, S.J., Wilson, M.C., and Latchman, D.S.

(1997). A single residue within the homeodomain of the Brn-3

POU family transcription factors determines whether they activate

or repress the SNAP-25 promoter. NeuroReport 8:2041–2045.


Munoz, M.M., Casali, A., Miralles, A., Bueno, D., Bayascas, J.R.,

Romero, R.L., and Salo, E. (1998). Characterization of platyhel-

minth POU domain genes: ubiquitous and specific anterior nerve

cell expression of different epitopes of GtPOU-1. Mech Dev 76:

127–140.

Murphy, D., Si-Hoe, S.L., Brenner, S., and Venkatesh, B. (1998).

Something fishy in the rat brain: molecular genetics of the hypo-

thalamo-neurohypophysial system. Bioassays 20:741–749.

Ojeda, S., Hill, J., Hill, D., Costa, M.E., Tapia, V., Cornea, A., and

Ma, Y. (1999). The Oct-2 POU domain gene in the neuroendo-

crine brain: atranscriptional regulator of mammalian puberty. En-

docrinology 140:3774–3789.

Pfeffer, P.L., Gerster, T., Lun, K., Brand, M., and Busslinger, Z.

(1998). Characterisation of three novel members of the zebrafish

Pax2/5/8 family: dependency of Pax5 and its expression on the

Pax2.1 (noi) function. Development 125:3063–3074.

Ramkumar, T., and Adler, S. (1999). A requirement for the POU

transcription factor, Brn-2, in corticotropin-releasing hormone

expression in a neuronal cell line. Mol Endocrinol 13:1237–1248.

Ryan, A.K., and Rosenfeld, M.G. (1997). POU domain family val-

ues: flexibility, partnerships, and developmental codes. Genes Dev

11:1207–1225.

Roubos, E.W., and van der Wal-Divendal, R.M. (1982). Sensory

input to growth stimulating neuroendocrine cells of Lymnaea stag-

nalis. Cell Tissue Res 227:371–386.

Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular

Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, N.Y.:

Cold Spring Harbor Laboratory Press.

Scotting, P.J., and Rex, M. (1996). Transcription factors in early

development of the central nervous system. Neuropathol Appl

Neurobiol 22:469–481.

Soriano, N.S., and Russell, S. (1998). The Drosophila SOX-domain

protein Dichaete is required for the development of the central

nervous system midline. Development 125:3989–3996.

Stoykova, A., and Gruss, P. (1994). Roles of Pax genes in devel-

oping and adult brain as suggested by expression patterns. J Neu-

rosci 14:1395–1412.

Strachan, T., and Read, A.P. (1994). Pax genes. Curr Opin Genet

Dev 4:427–438.

Struhl, G., Struhl, K. and Macdonald, P.M. (1989). The gradient

morphogen bicoid is a concentration-dependent transcriptional

activator. Cell 57:1259–1274.

Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). Clustal

W: improving the sensitivity of progressive multiple sequence

alignment through sequence weighting, positions-specific gap

penalties and weight matrix choice. Nucleic Acids Res 22:4673–

4680.

Tomarev, S.I., Callaerts, P., Kos, L., Zinovieva, R., Halder, G.,

Gehring, W., and Piatigorsky, J. (1997). Squid Pax-6 and eye de-

velopment. Proc Natl Acad Sci USA 94:2421–2426.

Treacy, M.N., He, X., and Rosenfeld, M.G. (1991). I-POU: a POU-

domain protein that inhibits neuron-specific gene activation. Na-

ture 350:577–584.

Treacy, M.N., Neilson, L.I., Turner, E.E., He, X., and Rosenfeld,

M.G. (1992). Twin of I-POU: a two amino acid difference in the

I-POU homeodomain distinguishes an activator from an inhibitor

of transcription. Cell 68:491–506.

Upatham, E.S., Thongkukiatkul, A., Kruatrachue, M., Wanicha-

non, C., Chitramvong, Y.P., Sahavacharin, S., and Sobhon, P.

(1998). Classification of neurosecretory cells, neurons, neuroglia

in the cerebral ganglia of Haliotis asinina, Linnaeus by light mi-

croscopy. J Shellfish Res 17:737–742.

Uwanogho, D., Rex, M., Cartwright, E.J., Pearl, G., Healy, C.,

Scotting, P.J., and Sharpe, P.T. (1995). Embryonic expression of

the chicken Sox2, Sox3 and Sox11 genes suggests an interactive role

in neuronal development. Mech Dev 49:23–36.

Valentine, J.W., Jablonski, D., and Erwin, D.H. (1999). Fossils,

molecules and embryos: new perspectives on the Cambrian explo-

sion. Development 126:851–859.

Van der Wetering, M., Oosterwegel, M., van Norren, K., and Clev-

ers, H. (1998). Sox-4, an Sry-like HMG box protein is a transcrip-

tional activator in lymphocytes. EMBO J 12:3847–3854.

Veenstra, G.J.C., Van Der Vliet, P.C., and Destree, O.H.J. (1997).

POU domain transcription factors in embryonic development.

Mol Biol Rep 24:139–155.

Wierman, M.E., Xiong, X., Kepa, J.K., Spaudling, A.J., Jacobsen,

B.M., Fang, Z., Nilaver, G., and Ojeda, S.R. (1997). Repression of

gonadotropin-releasing hormone promoter activity by the POU

homeodomain transcription factor SCIP/Oct-6/Tst-1: a regulatory

mechanism of phenotype expression. Mol Cell Biol 17:1652–1665.

Wright, E.M., Snopek, B., and Koopman, P. (1993). Seven new

members of the Sox gene family expressed during mouse devel-

opment. Nucleic Acids Res 21:744.

Yahata, T. (1971). Demonstration of neurosecretory cells in the

cerebral ganglion of the abalone, Nordotid discus. Bull Fac Fish

Hokkaido Univ 22:207–214.

Yahata, T. (1973). Induced spawning of abalone (Nordotis discus)

injected with ganglional suspensions. Bull Jpn Soc Sci Fish 39:1117–

1122.

Yuan, H.B., Corbi, N., Basilico, C., and Dailey, L. (1995). Devel-

opmental-specific activity of the FGF-4 enhancer requires the syn-

ergistic action of Sox2 and Oct-3. Genes Dev 9:2635–2645.


Documents

Expression of POU, Sox, and Pax Genes in the Brain Ganglia of the Tropical Abalone Haliotis asinina