Expression of Human Amyloid Precursor Protein Ectodomains inPichia pastoris:Analysis of Culture Conditions, Purification, and Characterization

PROTEIN EXPRESSION AND PURIFICATION 10, 283–291 (1997)ARTICLE NO. PT970748

Expression of Human Amyloid Precursor ProteinEctodomains in Pichia pastoris: Analysis of CultureConditions, Purification, and Characterization

Anna Henry, Colin L. Masters, Konrad Beyreuther,* and Roberto Cappai1

Department of Pathology, The University of Melbourne and the Mental Health Research Institute of Victoria, ParkvilleVictoria, 3052, Australia, and *Center of Molecular Biology, University of Heidelberg,Im Neuenheimer Feld 282, D-69120 Heidelberg, Germany

Received December 2, 1996, and in revised form March 24, 1997

pathogenesis of Alzheimer’s disease (AD) (1). The majorWe have examined the use of the yeast Pichia pas- component of the extracellular amyloid deposits char-

toris for expression of the human amyloid precursor acteristic of AD is the 4-kDa Ab (bA4) peptide (2, 3)protein (APP). The ectodomains of the isoforms which is produced by proteolytic cleavage of APP. Alter-APP695, APP751, and APP770 were expressed in both natively, cleavage within the Ab sequence by a putativeP. pastoris protease-deficient strain SMD1163 and a-secretase releases the soluble ectodomain of APPwild-type strain GS115, using the secretion vector (sAPPa) and precludes the formation of Ab [for review,pHIL-S1. Expression of recombinant APP in each of see (4)].these strains produced intact recombinant protein, to- The structure of APP resembles a cell surface recep-gether with a small number of breakdown products. tor, comprising a large extracellular N-terminal do-The levels of these breakdown products were not sig- main, a hydrophobic transmembrane domain, and anificantly altered by expression in the protease-defi- small intracellular C-terminal domain. Despite inten-cient strain compared with wild-type GS115. The ef- sive research, the function of APP is still unclear. APPfects of induction time and medium composition on has been shown to bind to different molecules includingrecombinant APP stability were also examined. After

heparin (5–7), tau (8,9), and metal ions including cop-optimization of expression and culture conditions, baf-per and zinc (10,11). Several putative APP functionsfled shaker flask cultures of clones selected for highhave been identified including cellular adhesion, neu-expression routinely yielded 13–24 mg/liter recombi-rite outgrowth, and wound repair [for review, see (12)].nant protein following a two-step purification proce-

Alternative splicing of the single copy APP gene givesdure. The recombinant isoforms possessed the heparinrise to at least 10 different APP isoforms (13). The pre-binding, metal binding, and Kunitz-type protease in-dominant transcripts encode polypeptides of 695 resi-hibitor properties of human brain-derived APP. Thesedues (APP695), 751 residues (APP751), and 770 resi-data indicate that P. pastoris is an appropriate labora-dues (APP770). The APP751 and APP770 isoforms con-tory-scale expression system for production of suffi-

cient quantities of recombinant APP for use in biologi- tain a 56-residue Kunitz-type protease inhibitor (KPI)cal studies. q 1997 Academic Press domain (14). In human and rat brain APP695 is the

predominant isoform, while in peripheral tissuesAPP751 and APP770 are the most abundant forms (13).

The amyloid precursor protein (APP)2 has been ex- The availability of pure APP isoforms is essentialtensively studied because of its association with the for studying their processing and biological function.

Protocols have been published for the purification of1 To whom correspondence should be addressed. Fax: /61-3-9344 rat and human brain APP (15,16); however, these pro-

4004. E-mail: [email protected]. cedures are not designed to purify individual isoforms.2 Abbreviations used: Ab, b-amyloid peptide; AD, Alzheimer’s dis-ease; AOX1,alcohol oxidase 1 gene; APP, amyloid precursor protein;BMMY, buffered minimal methanol medium; BSA, bovine serumalbumin; KPI, Kunitz-type protease inhibitor; MM, minimal metha- PCR, polymerase chain reaction; sAPPa, soluble ectodomain of amy-

loid precursor protein terminating at a-secretase site; SDS, sodiumnol medium; Mut, methanol utilization phenotype; PAGE, polyacryl-amide gel electrophoresis; PMSF, phenylmethylsulfonyl fluoride; dodecylsulfate; YPD, yeast extract–peptone–dextrose medium.

2831046-5928/97 $25.00Copyright q 1997 by Academic PressAll rights of reproduction in any form reserved.

AID PEP 0748 / 6q13$$$161 06-18-97 11:09:29 pepa AP: PEP

HENRY ET AL.284

Various expression systems have been used to produce (amino acid 611), APP751 (667), and APP770 (686) wasbiologically active APP isoforms including bacteria prepared by polymerase chain reaction (PCR) using the(APP695) (17,18) and baculovirus (APP695, -751, and forward primer 5* CCCCGGGATGCTGGAGGTACC--770) (19,20). Recently APP695, APP751, and the KPI CACTGATGG 3 * and the reverse primer 5* CCCCGG-domain of an APP homolog cloned from human pla- GTTATTGATGATGAACTTCATATCC 3 *. These oligo-centa have been expressed in the yeast Saccharomyces nucleotides include an XmaI site for cloning into thecerevisiae (21–23). The methylotrophic yeast Pichia XmaI site of the P. pastoris expression vector pHIL-S1.pastoris has been used to produce the ectodomains of The 3 * primer contained a stop codon. The pHIL-S1–APP695 and APP770 (24) and the KPI domain of APP APP constructs were linearized with NsiI and trans-(25,26). fected into P. pastoris wild-type strain GS115 (his4)

The P. pastoris eukaryotic expression system has and P. pastoris protease-deficient strain SMD1163been used to produce high levels of a wide range of (his4, pep4, prB1) using the spheroplast transforma-heterologous proteins [for reviews, see (27–29)]. Re- tion method (41).combinant protein expression is driven by the metha-

Media. The following media were used: YPD [1%nol-regulated promoter of the highly expressed alcohol(w/v) bacto yeast extract, 2% (w/v) peptone, 2% (w/v) D-oxidase 1 gene (AOX1) (30). A number of studies haveglucose]; minimal methanol medium (MM) [1.34% (w/v)demonstrated that glycoproteins expressed in P. pas-yeast nitrogen base without amino acids, 4 1 1005%toris are less frequently hyperglycosylated than those(w/v) biotin, 2.0% (v/v) methanol]; buffered MMproduced in S. cerevisiae (31–34); however, it should(BMMY) [MM plus 1% (w/v) bacto yeast extract, 2% (w/be noted that excessive hyperglycosylation has beenv) peptone in 0.1 M phosphate buffer, pH 6]; BMMY /reported in P. pastoris (35) and the glycosylation pat-1% (w/v) casamino acids.terns are not yet fully characterized. A number of pa-

rameters can affect foreign gene expression levels in- Screening for high-expressing clones. For each iso-cluding gene copy number, vector type, methanol utili- form, 200 clones were picked in duplicate into 2 mlzation (Mut) phenotype, and properties of the foreign YPD, grown for 48 h, and then induced in 2 ml BMMYprotein itself, such as susceptibility to proteolysis and for 24–48 h (42). Culture supernatants (1 ml) were blot-toxicity to the yeast (27, 28). Further understanding of ted in triplicate onto nitrocellulose membrane using athese parameters is required to improve the use of Bio-Dot SF Microfiltration Apparatus (Bio-Rad, Northshaker flask cultures of P. pastoris in laboratory-scale Ryde, Australia). The membrane was probed withexpression of heterologous proteins (35–38). monoclonal antibody 22C11 and immunoreactive pro-

In this study we examined the use of P. pastoris for teins were detected using 125I-protein A. The mem-high-level laboratory-scale expression of the ectodo- brane-bound 125I-protein A was visualized using a Fujixmains of APP695, APP751, and APP770. Importantly, Bas 100 phosphoimager (Fuji) and the radioactivityparameters affecting recombinant protein expression quantified using MACBAS Version 1.0.and stability were studied. The purification, biochemi-

DNA copy number determination. P. pastoris geno-cal characterization, and Western blot analysis of themic DNA was prepared by standard methods (43).recombinant proteins are described.Quantitative dot-blot and Southern analyses were per-formed according to an established method (44). The

MATERIALS AND METHODS genomic DNAs were denatured and applied to the dot-blot membrane in triplicate. The DNA probes usedPrimary antibodies. Mouse monoclonal antibodywere a 0.78-kb fragment of the P. pastoris single-copy6E10 recognizes an epitope between residues 1 and 17peroxisome assembly 8 gene (45) to standardize theof the Ab sequence of APP (39) (Senetek PLC, MO).

Mouse monoclonal antibody 22C11, raised against DNA loadings [this fragment was produced by PCR ona recombinant APP695 bacterial fusion protein (17), GS115 genomic DNA with the oligonucleotides TCG-recognizes an N-terminal epitope of APP between resi- TAATGTCGCTTATTGGCGGAGG (nucleotides 101–dues 66 and 81 of APP695 (40) (Boehringer-Mannheim, 125) and GAGCCTTCTTCGGCGTATTGGG (nucleo-Mannheim, Germany). tides 867–888)]; a 2-kb sAPP770a PCR fragment; a

The rabbit polyclonal antibody 93/28, raised in our 0.7-kb SacI/EcoRI fragment from the 5* untranslatedlaboratory against a synthetic KPI domain peptide AOX1 sequence from the P. pastoris vector pHIL-D2.(residues 344–356 of APP770) coupled to keyhole lim- The D2 probe is present in the pHIL-S1–sAPPa-trans-pet hemocyanin, recognizes KPI-containing APP iso- fected DNA and once in the GS115 genome, thusforms by Western blot analysis. allowing the APP gene copy number to be calculated.

The membrane was developed using a phosphoimagerCloning of sAPP695a, sAPP751a, and sAPP770a intoand the radioactivity quantified using MACBAS Ver-P. pastoris. DNA encoding the mature N-terminal ly-

sine (amino acid 18) to the a-secretase site of APP695 sion 1.0.


EXPRESSION OF AMYLOID PRECURSOR PROTEIN IN Pichia pastoris 285

Large-scale expression of sAPPas in P. pastoris. Heparin binding chromatography. Purified sAPP-695a, sAPP751a, sAPP770a or human brain-derivedShaker flask cultures were grown by inoculating 500sAPP (10 mg) was diluted in 5 ml of 50 mM Tris–HCl,ml YPD in a 2-liter baffled flask (Nalgene, Rochester,pH 7.4, and loaded onto a 5-ml Econo-Pac Q heparinNY). Cultures were grown for approximately 48 hcartridge (Bio-Rad, North Ryde, Australia) (flow rate(307C, 200 rpm) to a cell density from 45 1 107 to 600.25 ml/min) as described previously (6). An aliquot (501 107 cells/ml (optical density of 15–20 at 600 nm) (46).ml) from each fraction was blotted onto nitrocelluloseExpression was induced in 500 ml BMMY [2% (v/v)membrane, and immunoreactive proteins were de-methanol] for 24–48 h (307C, 200 rpm).tected with monoclonal antibody 22C11 followed byPurification of sAPP695a, sAPP751a, and sAPP- 125I-protein A as described above. The salt concentra-770a. A two-step procedure, modified from the five- tion of each fraction was determined by conductivitystep purification protocol used for human brain-derived measurements as described above.APP (16), was used to purify the recombinant sAPPas.

Metal chelate affinity chromatography. Metal bind-Ionic strength was determined using an Activon Modeling was performed as described previously (47) using301 conductivity meter (Activon, Carlton, Australia)1 mg of recombinant sAPPas or human brain-derivedwith a NaCl solution of known concentration as a stan-sAPP.dard. Filtered culture supernatants were adjusted to

an ionic strength of 0.20 by addition of 20 mM imidaz-ole, 5 mM EDTA, 10 mg/liter phenylmethylsulfonyl RESULTSfluoride (PMSF), pH 5.5. The sample was then loaded

Identification of High-Expressing sAPPa Clonesonto a Q-Sepharose column (1.6 1 25 cm, flow rate 10ml/min). The column was washed with 20 column vol A PCR fragment encoding sAPP695a, sAPP751a, orof 20 mM imidazole, 250 mM NaCl, 5 mM EDTA, 10 mg/ sAPP770a was cloned into the P. pastoris expressionliter PMSF, pH 5.5. Bound protein was eluted in 20 vector pHIL-S1 under the control of the acid phospha-mM Tris–HCl, 1 M NaCl, 5 mM EDTA, 10 mg/liter tase secretion signal sequence. Transformation of P.PMSF, pH 7.4 (flow rate 5 ml/min), and the protein pastoris is usually achieved by linearization with BglIIpeak collected (50 ml). This eluate was combined with to target integration into the AOX1 locus; however, thean equal volume of 2.4 M (NH4)2SO4 in 50 mM phos- presence of an internal BglII site in the APP gene re-phate, pH 7, and loaded onto a phenyl-Superose column quired the use of NsiI. The NsiI enzyme cuts within(0.5 1 5 cm, flow rate 0.5 ml/min) (Pharmacia Biotech, the 5* AOX1 sequence of the expression vector, favoringSweden). Bound protein was eluted from the phenyl- integration of the construct at the AOX1 locus of theSuperose column as described (16). Proteins were yeast genome by a single crossover event. This integra-buffer exchanged and concentrated using Centricon-50 tion will favor His/Mut/ Pichia recombinants by leav-concentrators (Amicon, Beverly, MA). ing an intact and functional AOX1 gene (Mut/).

Considerable clonal variation in expression occurs inGel electrophoresis and Western blotting. SamplesP. pastoris (27). To identify clones expressing high lev-were separated by sodium dodecyl sulfate (SDS)–poly-els of sAPPa, 200 clones of each isoform were grown inacrylamide gel electrophoresis and electrophoreticallysmall scale culture (42) and the supernatants analyzedtransferred onto Immobilon-P membrane (Millipore,for APP expression (see Materials and Methods). LargeBedford, MA). Primary antibodies were detected withdifferences in expression were observed between thean alkaline phosphatase-conjugated secondary anti-200 clones analyzed for each isoform. The three high-body using naphthol AS-MX phosphate and Fast Redest-expressing clones of each isoform were regrown andas substrate.the expression levels determined as before. Relative

Trypsin activity assay. Trypsin activity was as- expression levels were maintained between these twosayed from the cleavage rate of carbobenzoxy-valyl– separate experiments, indicating successful identifica-glycyl–arginine-4-nitranilide acetate (Chromozym TRY). tion of the highest-expressing clones.Aliquots of 25 ml of TBS (50 mM Tris–HCl, 150 mM High-level expression has been correlated to geneNaCl, pH 6.8) containing different concentrations of copy number (35,36,44,48,49). To determine if the high-either bovine serum albumin (BSA) or recombinant est-APP-expressing clones contained multicopy insertssAPP695a, sAPP751a, or sAPP770a were added to 150 of the APP gene, DNA dot-blot and Southern blot analy-ml TBS containing 7.5 ng (1.5 nM) of trypsin in a 96- ses were performed (44). As shown in Table 1, the high-well microtiter plate. After 15 min incubation at room est-expressing clone, sAPP695aA4, contained only onetemperature, 25 ml of 4 mM Chromzym TRY was added. copy of the APP expression cassette. The clones ex-Product generation was measured at an absorbance of pressing the highest levels of sAPP751a (A9) and414 nm over 20 min using a Bio-Rad Model 2550 EIA sAPP770a (C32) contained two and four copies of

the APP expression cassette, respectively. Clonesreader.


HENRY ET AL.286

TABLE 1 samino acids) media. Use of the BMMY (/ casaminoacids) medium resulted in 1.5- and 2-fold increases inAnalysis of APP Gene Copy Number and Clonal Variation

of sAPPa Expression Levels levels of intact protein compared with BMMY at 24 and48/72 h, respectively; however the BMMY (/ casamino

Small-scale Large-scale acids) also caused approximately 2-, 2.6-, and 3-foldAPP gene expression expression increases in the levels of the 70-kDa breakdown prod-

Clone copy number (PSL) (mg/liter) ucts compared with BMMY at 24, 48, and 72 h, respec-tively. A 24- to 48-h induction period in BMMY wassAPP695a A4 1 435.10 { 60.20 24 { 3

sAPP695a A8 2 43.92 { 1.94 — determined to be optimal for the yield of intact recombi-sAPP695a A33 6 134.10 { 10.80 — nant sAPPa versus breakdown products.sAPP751a A9 2 233.20 { 22.98 13 / 2 Proteolysis of recombinant protein may be reducedsAPP751a C4 2 30.49 { 10.81 — by adjusting the pH of the medium to a value at whichsAPP751a D47 5 93.41 { 1.53 —

degradation is reduced (27,28,35,36). We found thatsAPP770a C32 4 230.42 { 20.99 13 / 2sAPP770a B13 7 51.98 { 22.2 — buffering the induction medium from pH 3 to pH 8sAPP770a A5 7 72.65 { 8.65 — produced little change in the levels of APP breakdown

products (data not shown). A pH range of 6 to 7.5 wasNote. APP gene copy number was determined by DNA dot-blotting

found to be optimal for yields of intact APP. Most pub-(see Materials and Methods). Small-scale expression levels were de-lished protocols use 0.5–1.0% (v/v) methanol for thetermined by quantitative immunoblotting using 125I-protein A (see

Materials and Methods) and are expressed in phosphoimager PSL induction of heterologous protein expression. Titrationunits { standard errors of duplicate experiments. Large-scale ex- of the methanol concentration affected yields of all ofpression levels were achieved as described under Materials and the recombinant sAPPa isoforms. We found that 2%Methods and are expressed in mg/liter culture supernatant { stan-

methanol (v/v) was optimal for sAPPa expression indard errors of seven separate experiments.the BMMY induction medium (data not shown).Greater than 2% methanol (v/v) or repeat dosing withmethanol caused no improvement in sAPPa expressionsAPP751aA9 and sAPP751aC4 possessed the same levels (data not shown).APP gene copy number but produced different amounts

of recombinant protein. There appeared to be no corre-Expression of Recombinant sAPPas in a Protease-lation between DNA copy number and expression levels

Deficient P. pastoris Strain(Table 1). Southern blot analysis of genomic DNA fromIn further efforts to reduce proteolysis of the recombi-the three highest-expressing clones confirmed the APP

nant sAPPas, we expressed these constructs in the P.gene copy number obtained by DNA dot-blotting andpastoris protease-deficient strain SMD1163 whichrevealed that the APP expression cassettes were intactbears mutations in both the pep4 and prB1 genes.(data not shown).SDS–PAGE followed by silver stain or Western blotanalysis was used to compare the proteolytic break-Analysis of Culture Conditions Affecting sAPPadown of recombinant sAPPas expressed in the prote-Expressionase-deficient strain or wild-type GS115. RecombinantWestern blot analysis of recombinant sAPPas identi- sAPPas expressed in SMD1163 showed no significantfied a major band of the expected size and a number reductions in proteolysis either during culture (dataof breakdown products. The length of induction time, not shown) or after purification compared with GS115medium composition, and the medium pH can affect

proteolysis of recombinant protein (35, 36, 50). Wetherefore assayed the culture conditions to minimizeAPP proteolytic breakdown. Time course experimentswere performed for induction periods ranging from 12to 72 h in either BMMY, unbuffered medium (MM), orBMMY plus 1% casamino acids (Fig. 1). No sAPPa wasdetected with the MM medium. Intact protein togetherwith the smaller breakdown products were detectedafter 24 h in both the BMMY and BMMY (/ casaminoacids) media. A 4- to 5-fold increase in the level of intact

FIG. 1. Effects of medium, pH, and time on sAPP770a expression.protein was observed after 48 h compared with 24 hCulture supernatants from sAPP770a cultured in either BMMY (B),induction in both the BMMY and BMMY (/ casaminoMM (M), or BMMY/ casamino acids (BC) for 12, 24, 48, or 72 h wereacids) media. After 72 h induction there was no signifi- analyzed by SDS–PAGE, Western blotted, probed with monoclonal

cant increase in levels of intact protein compared with antibody 22C11, and developed with 125I-protein A. Positions of mo-lecular weight markers are indicated.48 h induction in both the BMMY and BMMY (/ ca-



Western Blot Analysis of Recombinant sAPPas

Analysis of purified sAPP695a, sAPP751a, andsAPP770a by Western blotting using a panel of anti-APP polyclonal and monoclonal antibodies demon-strated the presence of immunoreactive proteins (Fig.3). For each of the recombinant isoforms, the mono-clonal antibodies 22C11 and 6E10 detected a majorimmunoreactive band with an apparent molecularmass 120–130 kDa. The apparent molecular mass ofthe intact recombinant sAPPas is in agreement withthat reported for human brain-derived sAPP (16). Theanti-KPI rabbit polyclonal antibody 93/28 detected the120- to 130-kDa immunoreactive band only with theKPI-containing isoforms. Both 22C11 and 93/28 de-tected a number of smaller breakdown fragments.Comparison of proteolytic breakdown during culture(Fig. 1) with that observed after purification (Fig. 3)demonstrates that the addition of the protease inhibi-

FIG. 2. SDS–PAGE analysis of purified recombinant sAPPas ex- tor PMSF prevented any further degradation of thepressed in Pichia pastoris strains SMD1163 and GS115. Top: Silver- recombinant sAPPas during the purification proce-stained 8.5% polyacrylamide gels of sAPPas purified from SMD1163 dure. No immunoreactive proteins were detected byor GS115 culture supernatants. Bottom: Western blots of the purified

SDS–PAGE analysis of wild-type media purified in thesAPPas probed with monoclonal antibody 22C11. The sizes of themolecular weight markers (M) are indicated. same manner as the recombinant sAPPas (data not

shown).

KPI Activity of Recombinant sAPPas(Fig. 2). While sAPP695a expressed in SMD1163 con-The KPI domain activity of sAPP751a and sAPP770atained slightly reduced levels of the 69-kDa breakdown

was assayed from the cleavage rate of the syntheticproduct, increased levels of the 30-kDa breakdownsubstrate Chromozym TRY. The activity of 1.5 nM tryp-product were observed compared with GS115 (Fig. 2).sin was abolished by 25 ng of sAPP751a or sAPP770asAPP770a expressed in SMD1163 contained slightly(1.7 and 1.6 nM, respectively), indicating the KPI-con-reduced levels of the 50-kDa breakdown product com-taining isoforms had a functional KPI domain (Fig. 4).pared with GS115 (Fig. 2). No detectable changes insAPP695a and bovine serum albumin had no observ-the levels of breakdown products were observed withable effect on trypsin activity.expression of sAPP751a in SMD1163 compared with

GS115 (Fig. 2).Heparin Binding of Recombinant sAPPas

The recombinant sAPPas were found to bind to hepa-Large-Scale Expression and Purification of rin–Sepharose with elution profiles similar to that of

Recombinant sAPPas human brain-derived sAPP (Fig. 5). The elution peakof both sAPP751a and sAPP770a was 340 mM NaCl.Large-scale expression was achieved in 500-ml cul-

tures using 2-liter baffled flasks. Recombinant sAPPaswere purified from culture media by anion-exchangechromatography using Q-Sepharose followed by hy-drophobic interaction chromatography using phenyl-Superose. The purified sAPPas contained no contami-nating proteins as the protein bands detected by silverstaining of SDS–PAGE were also immunoreactive byWestern blotting (Fig. 3). Routine yields of purified pro-tein were sAPP695a 24 mg/liter; sAPP751a 13 mg/liter;

FIG. 3. SDS–PAGE analysis of purified recombinant sAPPas. Left:and sAPP770a 13 mg/liter (Table 1). Culture superna-Silver-stained 8.5% polyacrylamide gel showing sAPPas purifiedtants from P. pastoris transfected with wild-type pHIL-from culture supernatants. Other panels are Western blots probedS1 vector processed through the above chromatography with monoclonal antibody 22C11, monoclonal antibody 6E10, and

scheme showed no detectable proteins by SDS–PAGE polyclonal antibody 93/28. The sizes of the molecular weight markers(M) are indicated.followed by silver staining (data not shown).


HENRY ET AL.288

FIG. 4. The KPI domain of both sAPP751a and sAPP770a inhibits the activity of trypsin in the cleavage of a synthetic substrate. A seriesof concentrations of purified (A) bovine serum albumin (BSA), (B) sAPP695a, (C) sAPP751a, and (D) sAPP770a were incubated with trypsinand a synthetic trypsin substrate. The graphs indicate the generation of the trypsin cleavage product measured by the change in absorbanceat 414 nm over time.

The elution peak of sAPP695a was 280 mM NaCl, while human brain-derived sAPP and recombinant sAPPasbound to nickel, copper, and zinc but not to aluminumthat of human brain-derived sAPP was 260 mM NaCl.(Fig. 6).

Metal Binding Activity of Recombinant sAPPasDISCUSSIONThe metal binding activity of the recombinant

sAPPas and human brain-derived sAPP was deter- This paper describes the expression characteristicsof recombinant sAPP695a, sAPP751a, and sAPP770amined by metal chelate affinity chromatography. The

FIG. 5. Heparin–Sepharose elution profiles of purified recombinant sAPP695a, sAPP751a, sAPP770a, and human brain-derived sAPP.The NaCl gradient used for elution is indicated by the dashed line. Phosphoimager (PSL) units were used as an indicator of anti-APPimmunoreactivity.



expressed in baculovirus has also been reported (19),possibly reflecting lability of the APP C-terminal do-main.

The use of protease-deficient strains of P. pastorishas been reported to reduce proteolysis (27) and in-crease yields of heterologous proteins (27,52,53). In aneffort to decrease proteolysis, we expressed the recom-binant sAPPas in the P. pastoris protease-deficientstrain SMD1163 (his4, pep4, prB1). Proteolytic break-down of the recombinant sAPPas was not significantlyreduced with the use of the protease-deficient straincompared with wild-type GS115. These data indicatethat neither proteinase A nor proteinase B, encoded by

FIG. 6. Binding of human brain-derived sAPP and recombinant PEP4 and PRB1, is responsible for proteolytic break-sAPPas to metal ions. Western blots probed with monoclonal anti- down observed during culture of the recombinantbody 6E10 showing the binding of purified human brain-derived

sAPPas.sAPP, recombinant sAPP695a, sAPP751a, and sAPP770a to nickelTo identify clones expressing high levels of sAPPas,(Ni), copper (Cu), aluminum (Al), and zinc (Zn) ions immobilized on

chelating Sepharose. W, wash; E, eluate; S, starting protein. we used small-scale shaker tube cultures (27,42) com-bined with an immunoblotting screening protocol. Thismethod successfully identified clones yielding sAPPa

in P. pastoris shaker flask cultures. Routine expression expression levels 5- to 13-fold higher than those pre-levels of 24, 13, and 13 mg purified protein/liter culture viously reported by Ohsawa et al. (24). It should besupernatant were achieved for sAPP695a, sAPP751a, noted that Ohsawa et al. used the native APP signaland sAPP770a, respectively. Biochemical analysis peptide while we used the P. pastoris acid phosphataseshowed the purified recombinant sAPPas possessed the secretion signal sequence. In addition, Ohsawa et al.expected metal binding and Kunitz protease inhibitor selected for Mut0 transformants in contrast to our se-properties. A 1:1 stoichiometry was observed in the in- lection for Mut/. It is therefore unclear whether one orhibition of trypsin activity by KPI-containing sAPPas, all of these factors was responsible for our increase inin agreement with previous studies (25,26,51). recombinant APP yields.

The binding of APP to heparin may be of physiologi- APP gene copy number analysis of clones expressingcal significance as a heparin-binding domain of APPdifferent levels of recombinant sAPPas did not revealhas been reported to be involved in the regulation ofa correlation between copy number and sAPPa expres-neurite outgrowth (6). The sAPPas bound to heparinsion levels. The clone expressing the highest level ofwith an affinity comparable to that of human brain-recombinant sAPPa (clone sAPP695a A4) possessedderived sAPP. In contrast, bacterially expressedonly one copy of the expression cassette, while copysAPP695a eluted at a much higher salt concentrationnumbers of seven produced among the lowest expres-[0.75 M NaCl (18)]. This indicates that the heparinsion levels (clones sAPP770a B13 and A5). In addition,binding sites and presumably the appropriate second-clones with the same APP gene copy produced moreary and tertiary structure are achieved in the recombi-than a 7-fold difference in levels of recombinant sAP-nant sAPPas produced by P. pastoris as opposed toPas (clones sAPP751a A9 and C4). This would seemthose produced in Escherichia coli.to indicate that other factors such as site of genomicAll the recombinant sAPPas generated a number ofintegration and protein stability must have a majorbreakdown fragments, in addition to the major intacteffect. In numerous examples the selection of multicopymolecule. Time course studies indicated the breakdowninserts has resulted in vastly improved yieldsproducts are present at the same time the intact mate-(35,36,44,48,49); however, other studies have reportedrial is produced and accumulate with increased expres-a lack of correlation between secretion level and copysion times. The use of unbuffered medium (MM) re-number or negative effects of increased copy numbersulted in no detectable expression of the sAPPas. Theon recombinant protein secretion (37,54). These obser-addition of casamino acids to the BMMY medium in-vations imply that a direct assay of recombinant pro-creased the yield of intact sAPPa; however, an eventein products may be preferable to a screening proce-greater increase in the level of the 70-kDa breakdowndure based on gene copy number (55).products was observed. Western blot analysis showed

In summary, our studies have identified a numberthat monoclonal antibody 6E10, which recognizes theof parameters affecting sAPPa expression in shakerC-terminal end of sAPPa, reacts only with the intactflask cultures. We conclude that P. pastoris is suitableprotein. This indicates the breakdown is occurring from

the C terminus. Breakdown of recombinant sAPPas for the production of sufficient quantities of biologically


HENRY ET AL.290

sor and the mechanism of Alzheimer’s disease. Annu. Rev. Cellactive recombinant APP for use in most, if not all, com-Biol. 10, 373–403.mon biological studies.

13. Sandbrink, R., Masters, C. L., and Beyreuther, K. (1994) BetaA4-amyloid protein precursor mRNA isoforms without exon 15

ACKNOWLEDGMENTS are ubiquitously expressed in rat tissues including brain, butnot in neurons. J. Biol. Chem. 269, 1510–1517.

We thank Ben Kreunen for help with the figures. Antiserum 93/14. Ponte, P., Gonzale-DeWhitt, P., Schilling, J., Miller, J., Hsu, D.,28 was a gift from Dr. G. Evin. We thank Robert Cherny and Kathy

Greenberg, B., Davis, K., Wallace, W., Lieberburg, I., Fuller, F.,Derry for providing the purified human brain APP. This work wasand Cordell, B. (1988) A new A4 amyloid mRNA contains a do-supported in part by grants from The National Health and Medicalmain homologous to serine protease inhibitors. Nature 331, 525–Research Council of Australia to C.L.M. K.B. is supported by the527.Deutsche Forschungsgemeinschaft and the Bundesministerium fur

15. Potempska, A., Styles, J., Mehta, P., Kim, K. S., and Miller, D. L.Forschung und Technologie.(1991) Purification and tissue level of the beta-amyloid peptideprecursor of rat brain. J. Biol. Chem. 266, 8464–8469.

REFERENCES16. Moir, R. D., Martins, R. N., Bush, A. I., Small, D. H., Milward,

E. A., Rumble, B. A., Multhaup, G., Beyreuther, K., and Masters,1. Kang, J., Lemaire, H. G., Unterbeck, A., Salbaum, J. M., Mas-C. L. (1992) Human brain beta A4 amyloid protein precursor ofters, C. L., Grzeschik, K. H., Multhaup, G., Beyreuther, K., andAlzheimer’s disease: Purification and partial characterization.Muller-Hill, B. (1987) The precursor of Alzheimer’s disease amy-J. Neurochem. 59, 1490–1498.loid A4 protein resembles a cell-surface receptor. Nature 325,

733–736. 17. Weidemann, A., Konig, G., Bunke, D., Fischer, P., Salbaum,J. M., Masters, C. L., and Beyreuther, K. (1989) Identification,2. Glenner, G. G., and Wong, C. W. (1984) Alzheimer’s disease: Ini-biogenesis and localization of precursors of Alzheimer’s diseasetial report of the purification of a novel cerebrovascular amyloidA4 amyloid protein. Cell 57, 115–126.protein. Biochem. Biophys. Res. Commun. 120, 885–890.

18. Roch, J. M., Shapiro, I. P., Sundsmo, M. P., Otero, D. A., Refolo,3. Masters, C. L., Simms, G., Weinman, N. A., Multhaup, G., Mc-L. M., Robakis, N. K., and Saitoh, T. (1992) Bacterial expression,Donald, B. L., and Beyreuther, K. (1985) Amyloid plaque corepurification, and functional mapping of the amyloid beta/A4 pro-protein in Alzheimer disease and Down syndrome. Proc. Natl.tein precursor. J. Biol. Chem. 267, 2214–2221.Acad. Sci. USA 82, 4245–4249.

19. Bhasin, R., Van Nostrand, W. E., Saitoh, T., Donets, M. A.,4. Evin, G., Beyreuther, K., and Masters, C. L. (1994) Alzheimer’sBarnes, E. A., Quitschke, W. W., and Goldgaber, D. (1991) Ex-disease amyloid precursor protein (AbPP): Proteolytic pro-pression of active secreted forms of human amyloid beta-proteincessing, secretases and bA4 amyloid production. Int. J. Exp.precursor by recombinant baculovirus-infected insect cells. Proc.Clin. Invest. 1, 263–280.Natl. Acad. Sci. USA 88, 10307–10311.5. Schubert, D., LaCorbiere, M., Saitoh, T., and Cole, G. (1989)

20. Knops, J., Johnson-Wood, K., Schenk, D. B., Sinha, S., Lieber-Characterization of an amyloid b precursor protein that bindsburg, I., and McConlogue, L. (1991) Isolation of baculovirus-de-heparin and contains tyrosine sulphate. Proc. Natl. Acad. Sci.rived secreted and full-length beta-amyloid precursor protein. J.USA 86, 2066–2069.Biol. Chem. 266, 7285–7290.6. Small, D. H., Nurcombe, V., Reed, G., Clarris, H., Moir, R.,

21. Zhang, H., Komano, H., Fuller, R. S., Gandy, S. E., and Frail,Beyreuther, K., and Masters, C. L. (1994) A heparin-binding do-D. E. (1994) Proteolytic processing and secretion of human beta-main in the amyloid protein precursor of Alzheimer’s disease isamyloid precursor protein in yeast. Evidence for a yeast secre-involved in the regulation of neurite outgrowth. J. Neurosci. 14,tase activity. J. Biol. Chem. 269, 27799–27802.2117–2127.

22. Hines, V., Zhang, W., Ramakrishna, N., Styles, J., Mehta, P.,7. Multhaup, G., Mechler, H., and Masters, C. L. (1995) Character-Kim, K. S., Innis, M., and Miller, D. L. (1994) The expressionization of the high affinity heparin binding site of the Alzheimer’sand processing of human b-amyloid peptide precursors in Sac-disease bA4 amyloid precursor protein (APP) and its enhance-charomyces cerevisiae: Evidence for a novel endopeptidase in thement by zinc(II). J. Mol. Recog. 8, 247–257.yeast secretory system. Cell. Mol. Biol. Res. 40, 273–284.8. Smith, M. A., Siedlak, S. L., Richey, P. L., Mulvihill, P., Ghiso,

23. Peterson, P. C., Bjorn, S. E., Norris, F., Norris, K., Sprecher, C.,J., Frangione, B., Tagliavini, F., Giaccone, G., Bugiani, O., Pra-and Foster, D. C. (1994) Expression, purification and character-protnik, D., Kalaria, R. N., and Perry, G. (1995) Tau proteinization of a Kunitz-type protease inhibitor domain from humandirectly interacts with the amyloid b-protein precursor: Implica-amyloid precursor protein homolog. FEBS Lett. 338, 53–57.tions for Alzheimer’s disease. Nature Med. 1, 365–369.

24. Ohsawa, I., Hirose, Y., Ishiguro, M., Imai, Y., Ishiura, S., and9. Giaccone, G., Pedrotti, B., Migheli, A., Verga, L., Perez, J., Ra-Kohsaka, S. (1995) Expression, purification and neurotrophiccagni, G., Smith, M. A., Perry, G., De Gioia, L., Selvaggini, C.,activity of amyloid precursor protein-secreted forms produced bySalmona, M., Ghiso, J., Frangione, B., Islam, K., Buguani, O.,yeast. Biochem. Biophys. Res. Commun. 213, 52–58.and Tagliavini, F. (1996) bPP and tau interaction: A possible

link between amyloid and neurofibrillary tangles in Alzheimer’s 25. Van Nostrand, W. E., Schmaier, A. H., Siegel, R. S., Wagner,disease. Am. J. Pathol. 148, 79–87. S. L., and Raschke, W. C. (1995) Enhanced plasmin inhibition

by a reactive center lysine mutant of the Kunitz-type protease10. Hesse, L., Beher, D., Masters, C. L., and Multhaup, G. (1994)inhibitor domain of the amyloid b-protein precursor. J. Biol.The beta A4 amyloid precursor protein binding to copper. FEBSChem. 270, 22827–22830.Lett. 349, 109–116.

26. Wagner, S. L., Siegel, R. S., Vedvick, T. S., Raschke, W. C., and11. Bush, A. I., Multhaup, G., Moir, R. D., Williamson, T. G., Small,Van Nostrand, W. E. (1992) High level expression, purificationD. H., Rumble, B., Pollwein, P., Beyreuther, K., and Masters,and characterization of the Kunitz-type protease inhibitor do-C. L. (1993) A novel zinc(II) binding site modulates the functionmain of protease nexin-2/amyloid b-protein precursor. Biochem.of the beta A4 amyloid protein precursor of Alzheimer’s disease.Biophys. Res. Commun. 186, 1138–1145.J. Biol. Chem. 268, 16109–16112.

12. Selkoe, D. J. (1994) Cell biology of the amyloid b-protein precur- 27. Cregg, J. M., Vedvick, T. S., and Raschke, W. C. (1993) Recent



advances in the expression of foreign genes in Pichia pastoris. 43. Holm, C., Meeks-Wagner, D. W., Fangman, W. L., and Botstein,D. (1986) A rapid, efficient method for isolating DNA from yeast.Bio/Technology 11, 905–910.Gene 42, 169–173.28. Romanos, M. (1995) Advances in the use of Pichia pastoris for

44. Clare, J. J., Rayment, F. B., Ballantine, S. P., Sreekrishna, K.,high-level gene expression. Curr. Opin. Biotechnol. 6, 527–533.and Romanos, M. A. (1991) High-level expression of tetanus29. Sberna, G., Cappai, R., Henry, A., and Small, D. H. (1996) Ad-toxin fragment C in Pichia pastoris strains containing multiplevantages of the methylotrophic yeast Pichia pastoris for high-tandem integrations of the gene. Bio/Technology 9, 455–460.level expression and purification of heterologous proteins. Aus-

45. McCollum, D., Monosov, E., and Subramani, S. (1993) The pas8tralas. Biotechnol. 6, 82–87.mutant of Pichia pastoris exhibits the peroxisomal protein im-30. Ellis, S. B., Brust, P. F., Koutz, P. J., Waters, A. F., Harpold,port deficiencies of Zellweger syndrome cells: The PAS8 proteinM. M., and Gingeras, T. R. (1985) Isolation of alcohol oxidasebinds to the COOH-terminal tripeptide peroxisomal targetingand two other methanol regulatable genes from the yeast Pichiasignal, and is a member of the TPR protein family. J. Cell. Biol.pastoris. Mol. Cell Biol. 5, 1111–1121.121, 761–774.31. Tschopp, J. F., Sverlow, G., Kosson, R., Cragi, W., and Grinna,

46. ‘‘Invitrogen Manual,’’ Version 1.6, p. 31.L. (1987) High-level secretion of glycosylated invertase in the47. Bush, A. I., Pettingell, W. H. J., de Paradis, M., Tanzi, R. E., andmethylotrophic yeast Pichia pastoris. Bio/Technology 5, 1305–

Wasco, W. (1994) The amyloid beta-protein precursor and its1308.mammalian homologues: Evidence for a zinc-modulated heparin-32. Kukuruzinska, M. A., Bergh, M. L. E., and Jackson, B. J. (1987)binding superfamily. J. Biol. Chem. 269, 26618–26621.Protein glycosylation in yeast. Annu. Rev. Biochem. 56, 915–

48. Romanos, M. A., Clare, J. J., Beesley, K. M., Rayment, F. B., Bal-944.lantine, S. P., Makoff, A. J., Dougan, G., Fairweather, N. F., and33. Grinna, L. S., and Tschopp, J. F. (1989) Size distribution andCharles, I. G. (1991) Recombinant Bordetella pertussis pertactingeneral structural features of N-linked oligosaccharides from the(P69) from the yeast Pichia pastoris: High-level production andmethylotrophic yeast, Pichia pastoris. Yeast 5, 107–115.immunological properties. Vaccine 9, 901–906.

34. Trimble, R. B., Atkinson, P. H., Tschopp, J. F., Townsend, R. R.,49. Vedvick, T., Buckholtz, R. G., Engel, M., Urcan, M., Kinney, J.,and Maley, F. (1991) Structure of oligosaccharides on Saccharo-

Provow, S., Siegel, R. S., and Thill, G. P. (1991) High-level secre-myces SUC2 invertase secreted by the methylotrophic yeasttion of biologically active aprotinin from the yeast Pichia pas-Pichia pastoris. J. Biol. Chem. 266, 22807–22817.toris. J. Ind. Microbiol. 7, 197–202.

35. Scorer, C. A., Buckholz, R. G., Clare, J. J., and Romanos, M. A.50. Higgins, D. R. (1996) in ‘‘Current Protocols in Protein Science’’(1993) The intracellular production and secretion of HIV-1 enve-

(Coligan, J. E., Ed.), pp. 5.7.1–5.7.22, Wiley, New York.lope protein in the methylotrophic yeast Pichia pastoris. Gene51. Van Nostrand, W. E., Schmaier, A. H., Neiditch, B. R., Siegel,136, 111–119.

R. S., Raschke, W. C., Sisodia, S. S., and Wagner, S. L. (1994)36. Clare, J. J., Romanos, M. A., Rayment, F. B., Rowedder, J. E.,Expression, purification, and characterization of the Kunitz-typeSmith, M. A., Payne, M. M., Sreekrishna, K., and Henwood, C. A.proteinase inhibitor domain of the amyloid beta-protein precur-(1991) Production of mouse epidermal growth factor in yeast:sor-like protein-2. Biochim. Biophys. Acta. 1209, 165–170.High-level secretion using Pichia pastoris strains containing

52. Brankamp, R. G., Sreekrishna, K., Smith, P. L., Blankenship,multiple gene copies. Gene 105, 205–212.D. T., and Cardin, A. D. (1995) Expression of a synthetic gene37. Despreaux, C. W., and Manning, R. F. (1993) The dacA gene ofencoding the anticoagulant–antimetastatic protein ghilanten byBacillus stearothermophilus coding for D-alanine carboxypepti-the methylotropic yeast Pichia pastoris. Protein Expressiondase: Cloning, structure and expression in Escherichia coli andPurif. 6, 813–820.Pichia pastoris. Gene 131, 35–41.

53. Weib, H. M., Haase, W., Michel, H., and Reilander, H. (1995)38. Sun, J., Coughlin, P., Salem, H. H., and Bird, P. (1995) Produc-Expression of functional mouse 5-Ht5A serotonin receptors intion and characterisation of recombinant human proteinase in-the methylotrophic yeast Pichia pastoris: Pharmacological char-hibitor 6 expressed in Pichia pastoris. Biochim. Biophys. Actaacterization and localization. FEBS Lett. 377, 451–456.1252, 28–34.

54. Thill, G. P., Davis, G. R., Stillman, C., Holtz, G., Brierly, R.,39. Kim, K. S., Wen, G. Y., Bancher, C., Chen, C. M. J., Sapienza, Engel, M., Buckholtz, R., Kenney, J., Provow, S., Vedvick, T.,V. J., Hong, H., and Wisniewski, H. M. (1990) Detection and and Siegel, R. S. (1990) Positive and negative effects of multi-quantitation of amyloid b-peptide with 2 monoclonal antibodies. copy integrated expression vectors on protein expression inNeurosci. Res. Commun. 7, 113–121. Pichia pastoris, in ‘‘Proceedings of the 6th International Sympo-40. Hilbich, C., Monning, U., Grund, C., Masters, C. L., and Beyre- sium on the Genetics of Industrial Microorganisms’’ (Heslot, H.,

uther, K. (1993) Amyloid-like properties of peptides flanking the Davies, J., Florent, J., Bobichon, L., Durand, G., and Penasse,epitope of amyloid precursor-specific monoclonal antibody L., Eds.), pp. 477–490. Societe Francaise de Microbiologie, Paris.22C11. J. Biol. Chem. 268, 26571–26577. 55. Laroche, Y., Storme, V., De Meutter, J., Messens, J., and Lauw-

41. ‘‘Invitrogen Manual,’’ Version 3.0, pp. 29–34. ereys, M. (1994) High-level secretion and very efficient isotopiclabelling of tick anticoagulant peptide (tap) expressed in the42. Barr, K. A., Hopkins, S. A., and Sreekrishna, K. (1992) Protocol

for efficient secretion of HSA developed from Pichia pastoris. methylotrophic yeast, Pichia pastoris. Bio/Technology 12, 1119–1124.Pharm. Eng. 12, 48–51.


Documents

Expression of Human Amyloid Precursor Protein Ectodomains inPichia pastoris:Analysis of Culture Conditions, Purification, and Characterization