Upload
truongdang
View
214
Download
2
Embed Size (px)
Citation preview
1
Examining the patterns and processes of speciation and species
diversity in Australian Gehyra gecko lizards
Mark J. Sistrom
A thesis submitted for the degree of
Doctor of Philosophy
School of Earth and Environmental Sciences
The University of Adelaide
September, 2011
2
“The footsteps of Nature are to be trac'd, not only in her ordinary course, but when she
seems to be put to her shifts, to make many doublings and turnings, and to use some kind
of art in endeavouring to avoid our discovery.”
— Robert Hooke, Micrographia (1665, reprint 2008), 17.
3
Declaration
This work contains no material which has been accepted for the award of any other
degree or diploma in any university or other tertiary institution to Mark Sistrom and, to
the best of my knowledge and belief, contains no material previously published or written
by another person, except where due reference has been made in the text.
I give consent to this copy of my thesis when deposited in the University Library,
being made available for loan and photocopying, subject to the provisions of the
Copyright Act 1968. The author acknowledges that copyright of published works
contained within this thesis resides with the copyright holder(s) of those works.
I also give permission for the digital version of my thesis to be made available on
the web, via the University’s digital research repository, the Library catalogue, the
Australasian Digital Theses Program (ADTP) and also through web search engines,
unless permission has been granted by the University to restrict access for a period of
time.
This work was funded by an ARC Environmental Futures Network travel award
(2008), an Adelaide University postgraduate travel award (2010) and a BushBlitz
capacity building grant (2011) awarded to the author. Core project funding was provided
by Australian Biological Resources Study grant 207-43 awarded to Dr. Mark Hutchinson
and Professor Steve Donnellan.
Mark Sistrom
4
Contents Chapter 1: General introduction
p. 10
Chapter 2: Sistrom M.J.; Hutchinson M.N.; Hutchinson R.G.; Donnellan S.C. 2009.
Molecular phylogeny of Australian Gehyra (Squamata: Gekkonidae) and taxonomic
revision of Gehyra variegata in south-eastern Australia. Zootaxa 2277:14-32.
p. 18
Chapter 3: Sistrom M.J; Donnellan S.C.; Hutchinson M.N. 2011. Species delimitation
paper.
p. 52
Chapter 4: Sistrom M.J.; Hutchinson M.N.; Bertozzi T.; Donnellan S.C.; (in review).
Estimating species trees and testing evolutionary hypotheses despite high levels of gene
tree discordance in Australian Gehyra geckos. Systematic Biology
p. 101
Chapter 5: Sistrom M.J.; Edwards D.L.; Hutchinson M.N.; Donnellan S.C. (in review).
Morphological differentiation correlates with ecological but not genetic divergence in a
Gehyra gecko. Evolution
p. 129
Chapter 6: General Discussion
p. 165
Appendix 1. Table outlining sample details for Chapter 1.
p. 178
Appendix 2: Table outlining sample details for Chapter 2.
p. 202
Appendix 3: Table outlining sample details for the dating analysis of Chapter 3
p. 206
Appendix 4: Table outlining sample details for the species tree analysis of Chapter 3
p. 212
Appendix 5: Individual gene trees taken from the species tree analysis of Chapter 3.
p. 216
Appendix 6: Table outlining sample details for Chapter 4
p. 223
5
Abstract
Understanding the process of speciation and the nature of relationships between
species is one of the fundamental aims of evolutionary biology. These processes are
integral to the study of species delimitation and taxonomy, phylogenetic reconstruction
and evolutionary history and the study of speciation processes. Under this premise I
evaluate a recently evolved and taxonomically challenging group– the Gehyra geckos of
Australia, to gain a better understanding of how the process of speciation and species
relationships have developed in this genus.
My research has three main aims:
1) Explore the adequacy of current taxonomy in accounting for species diversity
in the group and improve it where necessary: Gehyra have proven taxonomically
troublesome historically, with extensive and geographically complex arrangements of
genetic diversity apparently not associated with patterns of morphological diversity. I
explored species delimitation and the taxonomic status of lineages within the arid-
adapted Gehyra variegata species complex using multi-locus (mtDNA, nuclear loci,
karyotypes) genetic, distribution and morphological data, generating the first
comprehensive phylogenetic framework for the genus. I describe one new species and
identify an additional five putative species. I support previously hypothesized high levels
of cryptic diversity in the group and present a concentrated effort in taxonomically
resolving the genus.
2) Evaluate previously proposed evolutionary scenarios for the diversification of
the Australian Gehyra and propose a comprehensive evolutionary history of the group:
Using a multi-locus dataset (one mtDNA locus, six nuclear loci), I generated a calibrated
6
species tree of the group, which showed support for a late-Eocene to mid Miocene
introduction of the genus to Australia from Asia and for the division of the Australian
Gehyra into a tropically-adapted Gehyra australis species complex and a generally arid-
adapted Gehyra variegata species complex containing morphologically transitionary
species in the Kimberley region. My analyses did not support a previously suggested
model of chromosomally driven speciation in Australian Gehyra and assert that
diversification of both species complexes occurred simultaneously from the late Micoene
through to the present.
I undertook a quantitative evaluation of gene tree discordance in Gehyra, showing
a high degree of discordance between genes for the group, further supporting the recent
diversification of the group.
3) Examine possible processes of speciation in Australian Gehyra: I investigated
a case study in which a geographically constrained, distinct population of Gehyra was
shown to be morphologically and ecologically distinct but genetically indistinguishable
from a comparatively widespread, geographically parapatric species. This indicates a
scenario of emergent, ecological speciation and presents a model system in which the
process of ecological speciation could be observed. It also contrasts previous studies
highlighting allopatric speciation driving the Australian Gehyra radiation, showing
ecological speciation may play an important role.
In carrying out these studies, I have both explored the use of emergent methods
for delimiting species and evaluating relationships between species, and significantly
increased our understanding of the Australian Gehyra radiation. This body of work
represents an ideal framework for rapid and effective evaluation of novel Gehyra species
7
and will greatly assist in discovering and documenting the diversity of this problematic
radiation in the future.
8
Acknowledgements
I thank my supervisors for their advice, support and encouragement - and
occasional mad dash to a hospital bedside to make sure I hadn’t rattled loose all of my
marbles. I also express deep gratitude to many of the students and staff at Australian
Centre for Evolutionary Biology and Biodiversity (ACEBB) for their time, advice and
friendship over the course of my PhD – namely, but not limited to Paul Oliver, Annabel
Smith, Terry Bertozzi, Kathy Saint, Alison Fitch, Lizzie Perkins, Jaro Guzinski, Duncan
Jardine, Gaynor Dolman, Adam Skinner, Christina Adler and many others. I especially
express my deep gratitude to Kate Sanders and Ralph Foster for their professional and
personal advice, friendship and for putting a roof over my head when I had none.
I also thank Lacey Knowles and her lab group for allowing me to visit for several
months and putting up with me being the dumb kid in lab meetings which hauled my
development as a scientist forward in leaps and bounds.
I express a profound level of debt and gratitude to my parents and family for
nurturing my passion for the natural world from a young age and going above and
beyond in providing me the best education possible – even when I was too myopic and
stubborn to appreciate your efforts.
Last and certainly not least I thank my wife, Dan Edwards. You have been my
closest confidant, by most scathing critic and adherent supporter throughout this journey.
Whenever I’ve needed support, you’ve been there and I am forever in your debt.
Without you all I would not have succeeded in completing the work within.
This work has been supported by funding from Australian Biological Resources Study,
ARC Environmental Futures Network, BushBlitz and The University of Adelaide.
9
Notes on chapter styles
Chapter 1 is published in the journal Zootaxa and thus follows that journal format
precisely. Chapter 2 is intended for submission in the journal Molecular Phylogneetics
and Evolution and is thus formatted in the style prescribed by that journal. Chapter 3 is
intended for submission in the journal Systematic Biology and thus follows that journal’s
style precisely. Chapter 4 is published in the Journal of Evolutionary Biology and thus
follows that journal’s style precisely.
A statement declaring co-author contributions prefaces each chapter submitted or
intended for publication.
The format of this thesis complies with that outlined in “Specifications for Thesis
2011” provided by the University of Adelaide Graduate Centre:
http://www.adelaide.edu.au/graduatecentre/pdf/specifications_thesis_2011.pdf
10
General Introduction
“I was much struck how entirely vague and arbitrary is the distinction between species
and varieties” - Charles Darwin (On the Origin of Species 1859 p.48)
Speciation, evolutionary history and taxonomy in recent radiations
The species problem (Hey 2001) is a long running and pervasive debate in the
biological sciences. Discussion regarding the intrinsically linked and simultaneously
distinct questions regarding what constitutes a species and how they are detected predates
Darwin (e.g. Ray 1686) and continues today (e.g. Bauer et al. 2011; Fujita & Leaché
2011). Despite this, “species” remains the most universally accepted and widely used
measure of organismal diversity both within the general public and scientific community,
forming a foundation for our understanding of the biota of Earth. Understanding what
constitutes a species, how to identify these entities and describe the relationships between
them is fundamental to both our basic understanding of biological diversity and further
studies of biological function.
As a result of the difficulties in defining the term species and the variety of
methodologies in identifying species, numerous definitions have been developed and
applied to the categorization of the biota of Earth (summarized in Mayden 1997). Often,
these concepts have been in conflict with one another (De Quieroz 2005) in that the
application of different concepts resulted in differential numbers of, and assignment to
species (De Quieroz 2005). However, since Simpson (1951) most species definitions
have used a form of the biological species concept (Mayr 1942) in an attempt to identify
independently evolving lineages of organisms. After many years and a vast quantity of
published discussion refining the concept of species, recent conceptual breakthroughs in
11
the generation of the general lineage concept of species (De Queiroz 2007) which defines
species as segments of evolutionary lineages and allows for their identification and
delimitation using a variety of secondary characteristics. This conceptual consensus on
the biological definition of what a species is has led to a renaissance in methodological
advancement in delimiting species (e.g. O’Meara 2010; Yang and Rannala 2010).
As biological diversification is an effectively continuous process (Wu 2001)
recently evolved species often represent extremely challenging scenarios for species
delimitation, taxonomy and systematics. This is due to young species not having
accumulated the characters generally used for the detection, description and subsequent
analyses of species relationships such as reproductive isolation, fixed apomorphies, and
reciprocal gene-tree monophyly (Shaffer & Thompson 2007). Furthermore, recently
radiated species may accumulate these differences in a manner that results in
confounding and complex patterns of diversity, which result in differential delimitation
and classification dependent on which characters are analysed (De Quieroz 2007).
Finally, the discordance between gene trees and species trees observed in many recent
radiations considerably complicates phylogenetic reconstructions of species relationships.
This makes it exceptionally challenging to both resolve taxonomically and study patterns
of evolutionary diversification in recent radiations. Despite the difficulties, recently
evolved species offer opportunities to study the process of speciation and patterns of
evolutionary divergence between related species that are not offered by older, better-
resolved groups of organisms. Understanding the processes by which organisms diversify
and therefore the conditions under which species are generated is key to basic biological
studies (Rowe et al. 2011).
12
An introduction to Gehyra
Gehyra are one of the more speciose genera of lizards from the Gekkonidae (Han
et al. 2004; Russell & Bauer, 2002; Underwood, 1954). Gehyra currently comprises 36
species, covering a wide range of habitats and distributed from Thailand through most of
the Oceanian and Melanesian islands and continental Australia (King 1979; Russell &
Bauer, 2002). However the “epicenter” of Gehyra diversity is represented by an
Australian radiation, comprising 19 largely endemic species (Horner 2005; Sistrom et al.
2009). Gehyra are climbing geckos and there is evidence that some species are substrate
specialists, preferring either rocky or vegetative habitats, where as others are more
generalist (Bustard 1968; King 1979; Moritz 1987). There is also evidence that members
of the genus are particularly good colonizers of newly available habitat, and may be
responsible for displacing other lizards, due to their territorial nature (Moritz 1987).
However it appears that once a territory has been established, Gehyra have a tendency
towards site philopatry (Bustard 1968). Gehyra show a marked ability to persist in
fragmented habitats but a degree of sensitivity to temperature, with a limited tolerance to
cold (Bustard 1967; King 1983; Moritz 1992).
The systematics of Gehyra has been long recognised as problematic (King 1979;
1984; Moritz 1984), however it has been established that they form a monophyletic clade
within the Gekkonidae (Han et al. 2004).
Since the first description of Gehyra australis (Gray 1834), several revisions have
been made to the taxonomy of the Australian Gehyra radiation, the most recent being the
description of Gehyra koira (Horner 2005). Gehyra has proven to be taxonomically
13
troublesome in the past as many osteological and morphometric characters are
continuously variable (King 1979; Moritz 1992). As such, considerable karyotypic and
allozyme variation does not manifest in easily catgegorised morphological variants.
Many of the species descriptions are based on characters that vary continuously between
species such as back pattern (King 1979) and as such, samples collected in the field are
often not placed into any recognized species with certainty. Many species comprise many
morphological isolates and distinct chromosome races and allozyme OTU’s (Adams
unpublished work; Donnellan unpublished work; King 1979; 1982; 1983; 1984; Moritz
1984; 1988; 1992). Despite widespread taxonomic uncertainty, previous work has
supported the separation of Australian Gehyra into a predominately small bodied and arid
adapted G. variegata species complex (King 1979; Mitchell 1965) and a relatively large
bodied and tropically adapted G. australis species complex (King 1983; Mitchell 1965).
The widespread presence of intermediate morphological states between genetic
and chromosomal types, in concert with the phylogenetic position of the genus is
indicative of a relatively recent evolutionary history. In light of this, King proposed that
the diversification of Australian Gehyra had been driven by the process of chromosomal
rearrangement and posed a detailed evolutionary scenario to account for the observed
patterns of chromosomal diversity in the group. In addition to general criticisms of
chromosomal models of speciation (Rieseberg 2001) attributing the diversification of the
Australian Gehyra to processes of chromosomal speciation are somewhat premature
given the lack of data relevant to reproductive isolation of races (Sites & Moritz 1987;
Moritz 1992). As such, the evolutionary processes by which Gehyra radiated in Australia
are largely unknown.
14
A single comparative, population-level genetic study has been conducted of G.
nana - a habitat specialist reliant on isolated rocky outcrops in central Australia and G.
variegata - a habitat generalist using allozyme and chromosomal data (Moritz 1987). It
revealed very low levels of genetic population structure within G. variegata in
comparison with G. nana, suggesting higher levels of migration in the hypothesized
generalist species than the hypothesized specialist species. He also concluded that genetic
diversification within each of these two species did not occur over significantly different
temporal scales (Moritz 1987).
In summary, the Australian Gehyra radiation is a recently radiated group, with
complex patterns of diversity that present a challenging biological system for taxonomic
resolution of species boundaries, species delimitation and the reconstruction of species
relationships and subsequent understanding of the mechanisms of diversification in the
group. While past research has been relatively extensive, it has led to only partial
understanding of these aspects for the group.
Advances in species delimitation and the reconstruction of species relationships
The recent conceptual advances in regards to the species problem, in concert with
the increasing ease with which large quantities of molecular genetic data can be acquired
have fueled a methodological renaissance in taxonomy, species delimitation and the
phylogenetic reconstruction of species relationships. The development of these methods
is allowing for genomic level tools to be brought to bear on questions regarding species
delimitation, assignment, description and relationships and while such techniques are not
15
without their caveats, they represent a major step forward over the previous generation of
techniques.
The advent of integrative taxonomy (Avise & Wollenberg 1997; Schlick-Steiner
et al. 2010) introduces the concept of a multisource approach to traditional taxonomy in
an effort to increase the speed and rigor of identifying and classifying species. Closely
related to species delimitation methods, integrative taxonomy seeks to use genetic,
ecological morphological, distribution and other relevant data in order to describe, define
and assign individuals to species (Cardoso et al. 2009). However the validity and roles of
varying data types in these processes is still debated (Bauer et al. 2011; Fujita & Leaché
2011).
In close association with taxonomic advances, developments in species
delimitation methods based on molecular data have allowed for quantitative testing of
gene flow between putative species (e.g. Beerli & Felsenstein 2001; Hey 2010) and the
validity of assumptions of independent evolutionary histories by combining species
phylogenies and gene genealogies via ancestral coalescent processes (Yang & Rannala
2010) or through simulation approaches (O’Meara 2010). While these methods allow for
quantitative testing of the evolutionary hypotheses that are fundamental to contemporary
species concepts and greatly increase the efficacy of identifying morphologically and
ecologically cryptic species (Rissler & Apodaca 2007; Carstens & Dewey 2010), they
can still yield misleading results in recently evolved species complexes which remain
highly challenging to delimit and therefore to describe (Schaffer & Thompson 2007).
Traditional phylogenetic approaches to reconstructing species relationships and
history relied upon concatenating data from different genes to effectively create a
16
“supergene” – a method that has been shown to be considerably inaccurate under
circumstances where gene trees are discordant (Knowles & Carstens 2007; Chung & Ané
2011). A methodological paradigm shift has occurred recently with the development of
species tree methods which consider the reconstruction of gene trees and species trees
independently (Knowles & Carstens 2007). These methods promise to be a considerably
more accurate method of estimating species relationships and histories especially in
groups where gene trees are highly discordant with one another due to processes such as
incomplete lineage sorting and horizontal gene transfer – processes which are particularly
prevalent in recently evolved lineages (Chung & Ané 2011). In concert with advances in
the application of fossil calibrations and molecular clocks to infer timing in species trees
(Drummond & Rambaut 2007), species tree methods promise to allow for a more
accurate estimation of relationships among species and the timing of diversification
between them, therefore allowing for a more accurate understanding of the evolutionary
processes driving diversification.
As a final note, recent and continuing developments in next-generation genomic
sequencing (Hudson 2008; Prosperi et al. 2011) mean that more and more genetic data
are being brought to bear on these analyses. While these methods are still in their infancy
and the implementation of these data is still being developed, rapidly increasing levels of
genetic power and thus analytical rigor is being applied through these methods, making it
an ideal time to revisit many troublesome and partially resolved groups of organisms,
both to further our understanding of these groups and refine emergent analytical
approaches with challenging empirical scenarios.
17
Resolving the systematics of Gehyra – an ideal time
Biologically, Gehyra represent a recently evolved radiation that presents
considerable challenges to taxonomy, species delimitation and phylogenetic
reconstruction. Despite these difficulties, in many respects Gehyra represent a model
system in which to explore the evolutionary biology of recent radiations. Gehyra geckos
are highly abundant and easy to collect – which has resulted in a significant body of
voucher specimens and associated tissues (n ≈ 8500) for combined morphological and
genetic study covering the majority of the known range of the group in Australia.
While past chromosomally based investigations into the diversity of the group
met with only partial success, they have yielded a significant level of understanding of
the complexity of the group, not apparent from a cursory examination of the
morphological diversity present in Australian Gehyra. They have also led to the
development of hypotheses regarding the origins, species relationships and modes of
diversification that led to this diversity. As such, the significant body of past work on
Australian Gehyra provides a strong platform on which to base future studies of the
group on.
Finally, the recent development of new molecular genetic data acquisition and
analytical techniques allows for more rigorous evaluation of the group than ever before.
Complimentary to this, the Australian Gehyra radiation provides a challenging but ideal
group of organisms on which to empirically test these new methodologies. As such, it is
presently advantageous to revisit the diversification of the Australian Gehyra geckos.
18
Molecular phylogeny of Australian Gehyra (Squamata:
Gekkonidae) and taxonomic revision of Gehyra variegata in
south-eastern Australia
Mark J. Sistrom1, Mark N. Hutchinson
1, Rhonda G. Hutchinson
2 & Stephen C.
Donnellan1,3
1 South Australian Museum, North Terrace, Adelaide SA 5000, and School of Earth and
Environmental Sciences, University of Adelaide SA 5005, Australia
2 Dept of Genetic Medicine, Women's and Children's Hospital, North Adelaide SA 500x,
and School of Molecular and Biomedical Sciences, University of Adelaide SA 5005,
Australia
3 Australian Centre for Evolutionary Biology and Biodiversity, University of Adelaide SA
5005, Australia
Zootaxa (2009) 2277: 14-32.
19
Statement of Authorship
This chapter is a published research article and is reproduced with kind permission of
Magnolia Press (see Appendix 1)
Mark J. Sistrom (candidate)
Corresponding author: Responsible for molecular laboratory work, analysis and
interpretation, participated in manuscript preparation, produced Figures 2 and 8 and
oversaw manuscript revision.
Signed…………………………………………………………..Date……………
Mark N. Hutchinson
Sought and won funding, co-supervised direction of study, responsible for morphological
data collection, analysis and interpretation, participated in manuscript preparation, took
photographs for Figures 5 and 7 and produced Figure 6.
I give consent for M.J. Sistrom to include this paper for examination towards the degree
of Doctor of Philosophy.
Signed: Date: 16/09/2011
20
Rhonda G Hutchinson
Responsible for chromosomal laboratory work and interpretation, produced Figure 4.
I give consent for M.J. Sistrom to include this paper for examination towards the degree
of Doctor of Philosophy.
Signed: Date: 14/09/2011
Stephen C. Donnellan
Sought and won funding, co-supervised direction of project, allozyme data collection,
analysis and interpretation, participated in manuscript preparation, produced figures 1 and
3.
I give consent for M.J. Sistrom to include this paper for examination towards the degree
of Doctor of Philosophy.
Signed: Date:16/09/2011
21
Abstract
We provide the first phylogenetic hypothesis for the Australian species of the
gekkonid genus Gehyra, based on 1044bp of the mitochondrial ND2 gene. Species
representing the Asian, Melanesian and Australian radiations are resolved as separate
clades, indicating relative isolation and independence of each of these evolutionary lines.
Within the Australian radiation, the arid zone species form a monophyletic subgroup
distinct from the remaining species found in tropical and warm mesic habitats. Extensive
chromosome variation and highly variable external morphology have made species
recognition difficult within Gehyra, exacerbated by the likely presence of numerous
undescribed cryptic species. Three species of Gehyra are currently recognized in the
southeastern inland of Australia, G. variegata, G. montium and G. purpurascens. We re-
describe a fourth species, G. lazelli, to include those populations long referred to
informally as the 2n=44 chromosome ‘race’ of Gehyra variegata. Gehyra lazelli widely
overlaps the distribution of G. variegata in South Australia and the southern inland of
New South Wales, with no suggestion of intergradation in morphology, mitochondrial
DNA, allozyme variation or karyotype.
Key words: Lizards, speciation, Australia, phylogeny, taxonomy, mitochondrial DNA
22
Introduction
Gehyra is a large genus of climbing geckoes, ranging across Asia and into the
Pacific and with a large centre of endemism in Australia (Mitchell 1965). Gehyra is a
member of the clade traditionally treated as the subfamily Gekkoninae (Kluge 1987),
more recently treated as a family Gekkonidae, distinct from several other gekkonoid
families (Han et. al. 2004; Gamble et. al. 2007). Gehyra species share a distinctive toe
morphology, possessing elliptical, subterminal, adhesive toe pads and clawless first digits
on the fore and hind feet. Eighteen species are currently recognised from Australia. The
genus is conservative in morphology and many of its species differ only subtly in external
appearance. Nevertheless the group shows considerable chromosomal heterogeneity and
the present tally of species is probably an underestimate.
King (1979) published the first of a series of studies on chromosomal variation
within Gehyra, addressing populations referred to the species Gehyra punctata (Fry
1914) and G. variegata (Duméril and Bibron 1836). Six chromosome groups were
recognised within the two nominal species. Populations of ‘G. variegata’ included a 2n
=44 karyotype and two 2n=40 (40a and 40b) karyotypes, while G. ‘punctata’ included
populations with diploid numbers of 44, 42 and 38. King further expressed the view that
disjunct populations of some chromosome groups had diverged in morphology to the
point where they may represent distinct species. Thus there were two allopatric 2n=42
populations (central Northern Territory (NT) and central west of Western Australia
(WA)) and three allopatric populations of the 2n=44 karyotype (northern NT, central NT
and southern South Australia (SA)). In all, there was prima facie evidence for nine
species in this species complex.
Moritz (1986) reviewed this group, including consideration of work by Storr (1982)
23
and King (1982b) who had begun to revise the taxonomy of Gehyra. Moritz pointed out
that the attempts to delineate species within the central and northern Australian area
where populations with differing karyotypes overlapped had been only partly successful,
and his extensive sampling of central Australian populations revealed a complex and
confusing pattern of morphological and chromosomal variation. This situation was
confusing to subsequent workers because King and Moritz each used different sets of
criteria to define entities. King distinguished groups (putative species) by karyotypes only
whereas Moritz used a combination of karyotypes and unspecified morphological
variation. As an example, Moritz (1986) recognized three morphological groups in
central Australia that all shared the 2n=42a karyotype as “2n=42a montium”, 2n=42a
montium/variegata” and “2n=42a variegata”.
Based on the work of King, Moritz and Storr, there are three species of Gehyra in
the south-eastern interior of Australia. These are G. variegata, with two chromosomal
groups, the widespread 2n=40a and the 2n=44 (referred to as the 2n=44f group by
Moritz), G. purpurascens Storr 1982 (2n=40c) and G. montium Storr 1982. The last
species has been associated with a 2n=38 karyotype by Storr (1982), but populations
from the vicinity of the type locality of G. montium, Mt Lindsay in remote northwestern
SA, have not been karyotyped, and Moritz has recorded Gehyra populations with a
variety of karyotypes in the ranges straddling the SA-WA-NT borders, including 2n=40a,
2n=42a and 2n=42b, but not the 2n=38 karyotype, which was only reported from the
central ranges of the NT.
Resolution of the species identity of all of the populations assigned to either G.
montium or G. variegata will require careful programs of field sampling and correlated
24
morphological and chromosomal study to detect species boundaries. Here we begin this
process by dealing initially with the taxonomy of Gehyra from the south-eastern interior
of Australia where there is evidence for four chromosomal groups
25
Materials and methods
Specimens from the collection of the South Australian Museum, Adelaide (SAMA)
form the basis of our study, including a few of the specimens karyotyped by King (1979).
Locations of Australian sites sampled for molecular and karyotype analyses are shown in
Fig. 1. Details of the specimens used for the molecular genetic analyses are presented in
Appendix 1.
Morphology. The Australian species of Gehyra are distinguished morphologically
using a relatively small set of qualitative characters (e.g. see Storr 1979; 1982, King
1982b). The condition of the expanded subdigital lamellae (fully divided as opposed to
undivided or merely notched) is a primary feature separating typically arid zone species
from tropical/mesic species. Colour pattern, whether spotted, lined or weakly marked,
and overall colour hue (reddish versus greyish) is also used, even though colour shades
and patterns are unstable in preserved specimens. Informative scalation features include
the shape of the rostral scale (angular at its dorsal apex, or flat) and the number and
relative sizes of the scales surrounding the nostril. The set of scales surrounding the
nostril comprises the rostral, which has a partial mediodorsal vertical division ('rostral
crease'), a large anterior supranasal, a smaller posterior supranasal, and two postnasals,
each usually about the same size as the posterior supranasal, and the first infralabial. The
two anterior supranasals may contact or be separated by one or more smaller scales.
Enlarged chin shields always comprise a pair of elongate postmentals that contact only
the first infralabial, flanked by a pair of shields that contact the first and second
infralabials. Sometimes there is a third pair of chin shields that contacts the second or the
second and third infralabials. The presence and contacts of this third pair varies between
26
species. In all four of the Gehyra discussed below, a secondary scale row (the sublabials,
King 1982b) is developed, ventral and parallel to the infralabials, starting from a notch in
either the second or third infralabial.
We assessed all of these features in the populations that occur across South
Australia and the adjacent inland of New South Wales (NSW), Victoria (Vic) and
southwestern Queensland (Qld). All length measures are in mm.
FIGURE 1. Map showing distribution of Australian sample locations for molecular and
karyotype analyses. Key to symbols: australis ; borroloola ; catenata ; dubia ;
27
ipsa ; koira ; lazelli ; minuta ; montium ; nana ; occidentalis F; pamela ;
pilbara ; punctata ; purpurascens ; robusta ; variegata ; xenopus .
We assessed all of these features in the populations that occur across South
Australia and the adjacent inland of New South Wales (NSW), Victoria (Vic) and
southwestern Queensland (Qld). All length measures are in mm.
Mitochondrial DNA sequencing. The nucleotide sequence of the entire NADH
dehydrogenase subunit 2 (ND2) was determined for 70 individuals representing all
currently recognized species of Gehyra from Australia, four species from Oceania and
Melanesia and three outgroups from the genera Cyrtodactylus, Hemiphyllodactylus and
Lepidodactylus [Aaron Bauer pers. comm.]. DNA was extracted from frozen and alcohol
preserved liver tissue stored in the Australian Biological Tissue Collection (ABTC) at the
South Australian Museum (SAMA) using a PuregeneTM DNA Isolation Tissue Kit D-
7000a (Gentra Systems) following the manufacturer's guidelines. ND2 and partial
flanking tRNA's were amplified using the primers M112F (5'-
AAGCTTTCGGGGCCCATACC- 3') and M1123R (5'-
GCTTAATTAAAGTGTYTGAGTTGC - 3') designed in the flanking methionine and
alanine tRNA's. Amplifications were carried out in 25μL volumes using standard buffer
and MgCl2 concentrations, 0.1 mM each dNTP, 0.2 μM each primer, 0.75 U AmpliTaq
Gold® DNA Polymerase (Applied Biosystems) and approximately 100ng of genomic
DNA. Thermocycler profiles were: 9 min at 94oC, then 35 cycles of: 45 s at 94oC, 45 s at
60oC and 1 min at 72oC for 1 min with a final extension step of 6 min at 72oC. The PCR
product was purified using a Millipore Montage® PCR384
Cleanup Kit (Millipore Corporation) following the manufacturer’s guidelines.
G D ^
28
One microlitre of purified product was used as template for a BigDye Terminator
sequencing reaction, which was carried out in 20μL reactions, consisting of 1μL of
BigDye (Applied Biosystems), 7μL of 2.5x buffer and 1μL of 5pmol/μL primer.
Sequenced products were separated on an Applied Biosystems 3730xl capillary
sequencer.
The protein-coding region of ND2 was translated into amino acid sequences using
the vertebrate mitochondrial genetic code and was compared to Gekko gecko (GenBank
accession EU054288) translations to check for unexpected stop codons and frame shifts.
We obtained both forward and reverse sequences for each PCR product. Sequence
alignments were carried out using Geneious version 3.8.5 (Drummond et al. 2008).
GenBank accession numbers for the ND2 sequences are: GQ257742-GQ257811.
Phylogenetic analysis. Phylogenetic analyses used maximum likelihood (ML)
and Bayesian methods. Aligned sequences were partitioned according to codon position
and Modeltest version 3.06 (Posada & Crandall 1998) was used to evaluate different
models of nucleotide substitution. The model GTR+I+G was selected for codon positions
1 and 2, with the model GTR+I selected for 3rd codon positions. ML analysis with 100
bootstrap replicates was carried out using the RAxML BlackBox web server (Stamatakis
2006; Stamatakis et. al. 2008). Bayesian analysis was conducted using MrBayes version
3.1 (Ronquist & Huelsenbeck 2003). Data were partitioned for each codon position and
branch lengths unlinked. Convergence was assessed from multiple ruins and plots of
likelihood against generation. For the final analysis, 5 million MCMC chains were run,
sampled every 100 generations, with the first 5000 samples discarded as burn-in, leaving
95 000 trees for construction of a majority rule consensus.
29
The number of net nucleotide substitutions per site between populations (Da
value) (Nei 1987) for ND2 sequences of 2n=40a and 2n=44f variegata samples was
calculated using the program DnaSP 4.90 (Rozas et. al. 2003) in order to assess
nucleotide divergence.
Allozyme electrophoresis. Allozyme electrophoresis of liver homogenates was
conducted on cellulose acetate gels (“Cellogel”, Chemetron) according to the methods of
Richardson et al. (1986). The proteins and enzyme products of 31 presumed loci were
scored (Table 1). Alleles were identified by comparison with samples that were
repeatedly included on each gel (internal controls) and through critical side-by-side
comparisons (line-ups; see Richardson et al. 1986).
Karyotypes. We obtained karyotypes from tissue cultures prepared from
reproductive tract epithelia (oviducts in females, efferent ducts in males). Tissues were
cultured at 32o C using AmnioMAX-11 (Gibco) complete media. Standard tissues culture
methods were used to establish cultures, harvest and stain metaphase spreads for
karyotypic analysis (Freshney 2000).
30
Results
Mitochondrial nucleotide sequences. Fig. 2 shows the phylogenetic
relationships among ND2 sequences of Gehyra and three outgroups as determined by
Bayesian inference. The tree also indicates nodes where Bayesian posterior probabilities
and maximum likelihood non-parametric bootstrap proportions where the values were >
95% and >70% respectively.
The Melanesian and New Guinean species included in the phylogeny, G. baliola
(Duméril and Duméril 1851), G. membranacruralis King and Horner 1989, G. mutilata
(Wiegmann 1835) and G. oceanica (Lesson 1830), are highly distinct from the Australian
taxa. The analysis indicates a relationship between G. baliola and G. oceanica, however
the relationships among the deeply divergent clades within the genus are not resolved
with our data.
31
32
FIGURE 2. Bayesian majority rule consensus phylogenetic tree showing relationships
among mitochondrial ND2 haplotypes in Gehyra. Asterisks indicate nodes that had
Bayesian posterior probabilities > 95% and non-parametric bootstrap proportions from
1000 ML pseudoreplicates of > 70%. The outgroups Cyrtodactylus, Hemiphyllodactylus
and Lepidodactylus were used to root the tree. See Appendix for specimen numbers
(either ABTC [no letter at beginning of specimens number] or WAM registration number
[begins with W]) and other details.
The Australian taxa fall into two clades with G. australis, G. borroloola, G.
catenata, G. dubia, G. ipsa, G. koira, G. occidentalis, G. pamela and G. robusta forming
one and G. minuta, G. montium, G. pilbara, G. punctata, G. purpurascens, two nominal
groups of G. variegata, and G. xenopus forming the other. These represent the G.
australis complex (King 1983a) and G. variegata-punctata complex (King 1979),
respectively, with considerable accuracy.
The phylogenetic analyses show that four distinct clades of Gehyra exist in south-
eastern Australia, representing G. montium, G. purpurascens and two nominal groups of
G. variegata representing the 2n=40a and the 2n=44f karyotype groups. A considerable
level of divergence between the latter is evident, as shown by the Da value between
2n=40a sequences and 2n=44f sequences being 0.159 ± 0.027 (Nei 1987).
Given the partially sympatric distribution of clades, the high level of phylogenetic
structure among the south-eastern Australian haplotypes is strongly indicative of a
significant period of reproductive isolation and therefore potentially speciation between
the G. variegata 2n=40a and 2n=44f karyotype groups and between these and the other
33
two south-eastern Australian species. Furthermore the G. variegata 2n=44f karyotype
group is the sister clade to not just all of the other south-eastern Australian clades but also
to G. minuta, G. nana, G. pilbara and G. punctata, which is prima facie evidence that
two G. variegata karyotype groups are separate species under a phylogenetic species
concept.
Allozyme Electrophoresis. We collected specimens of G. variegata in sympatry at
Lancoona Station, northeast of Hillston, NSW, where Moritz (pers. com.) had earlier
recorded individuals with both the 2n=40a and 2n=44f karyotypes,. The external
morphology of these was the same as in the South Australian populations (see below),
and a subsequent collection of a further four specimens with the colour pattern of the
2n=40a group and three with that of the 2n=44f group was used to examine the
possibility of gene flow between the two. We also included a selection of other Gehyra
taxa from SA and adjacent areas of WA and the NT for comparative purposes.
Table 1 shows the allele frequencies for the 31 loci among the 10 operational taxonomic
units (OTUs) genotyped. See Appendix 1 for locations included in each OTU. The
specimens from Lancoona matching the two chromosome races were also unambiguously
separated by allozymes. The two colour pattern types showed fixed differences at nine
loci (Acoh-2, Gapdh, Aat-2, Idh-1, Idh-2, PepB-1, PepB-2, PepD, Iddh), and almost fixed
differences at three others (Acoh-1, Fbp, Gpdh). Considering only the nine loci showing
fixed differences, the probability that only a single species is represented by the seven
specimens can be calculated. Population allelic frequencies, p and q from the Hardy-
Weinberg theorem, for each locus are notionally 0.57 and 0.43. If a single freely
interbreeding population is present, then the probability of obtaining no heterozygotes
34
among seven individuals at nine loci by chance is (1–2 x 0.57 x 0.43)7 x 9 = 3.7 x 10-19.
Accordingly, the hypothesis of a single species at this site is very unlikely, and a
reasonable alternative is that two genetically independent species are present.
TABLE 1. Allele distributions (frequencies expressed as percent) among 10 OTUs of
Gehyra based on 31 enzyme loci. See Appendix 1 for locations included in each OTU.
The abbreviations for proteins/loci used and Enzyme Commission numbers are listed in
Murphy et al. (1996). Numbers in brackets are sample sizes. The following loci were
invariant: Ca, Gpi, Ldh-1, Ldh-2, Mdh-2, Pgam, Pk, Sod, and Tpi.
minuta 2n=42a 2n=40a
variegata
purpurascens 2n=44f
OTU 1 2 3 4 5 6 7 8 9 10
Locus (5) (6) (4) (9) (4) (11) (4) (3) (9) (3)
Aat-2 c c c(75) c(94) a c b c b b
b(25) a(6)
Acoh-1 c b b b c b b b(67) a a
a(17)
c(17)
Acoh-2 d b(50) d(50) c(50) e(83) c(86) c(63) c e d(50)
c(33) c(38) d(33) d(17) e(14) d(25) e(50)
a(8) b(12) b(17) e(12)
d(9)
Adh-2 c c c c c c c(63) c(88) c(89) c(67)
a(25) d(12) b(11) b(33)
b(12)
Eno a a a a a(83) a a a a a
b(17)
Fbp a a(80) a a(83) b a a a(88) a(94) a
b(20) b(17) b(12) b(6)
Gapdh a a a a b a a a a a
Gpdh a a(62) a(38) b(88) b(83) a a(83) a b a(83)
b(38) b(62) a(12) a(17) b(17) b(17)
35
Gtdh a a a a a a a a a a(83)
b(17)
Iddh a a a a(78) a a a b b b
b(22)
Idh-1 a a a a b a a a b b
Idh-2 b a(92) a a(88) b a a a b b
c(8) c(12)
Lgl b a(8) b(88) b(94) b b b b b b
b(84) c(12) a(6)
d(8)
Mdh-1 b b b(75) b b(83) b a b b b
a(25) a(17)
Mpi b(90) b(83) b(88) b(89) b b(95) b b(88) b b
a(10) c(17) a(12) a(11) a(5) a(12)
PepA a a a a a a(82) a a a a
b(18)
PepB-1 e c(50) c c(89) a c c(50) c a a
f(33) b(11) b(38)
g(17) d(12)
PepB-2 b(50) a a(88) a c(67) a b a c c
a(40) b(12) d(33)
c(10)
PepD a(10) b b(88) b(94) c b b(50) b b c(83)
b(90) d(12) d(6) c(38) b(17)
d(12)
Pgdh b(80) a(50) a(62) b(61) a(67) a a(75) a(50) a a(50)
a(20) b(50) b(38) a(39) b(33) b(25) b(50) b(50)
Pgm a a a a a a a(62) a a a
b(38)
36
FIGURE 3. Neighbour-joining network of Cavalli-Sforza chord distances among OTUs
based on frequencies. See Appendix 1 for locations included in each OTU.
Morphology and karyotypes. We obtained karyotypes from populations where
published data (King 1979; Moritz 1984, 1986) indicated that more than one karyotype
was present, in order to determine the degree to which a particular karyotype correlated
with external morphology.
In each case we found that the karyotype was correlated with morphology. The
2n=40c specimen (SAMA R51606) was consistent with the description of G.
purpurascens (Storr 1982) and the 2n=42 specimens were consistent with Storr’s (1982)
G. montium.
The remaining two karyotypes (2n=40a, 2n=44f – Fig. 4) pertain to populations
traditionally referred to G. variegata. We confirmed syntopy of animals with the the
37
2n=40a (SAMA R51832) and 2n=44f (SAMA R51801) karyotypes at Mudlapena Spring,
Flinders Ranges, SA, to add to the syntopy already recorded by Moritz at Lancoona
Station, NSW (e.g. SAMA R38942 and R38943, respectively).
Animals with each karyotype consistently differed in colour pattern. The colour
pattern of the 2n=40a animals varied, but consistently included continuous temporal lines
and dark markings that often formed continuous longitudinal and transverse lines, which
were coordinated with light markings that acted as edges or highlights for the dark lines
(Fig. 7). In contrast, 2n=44f animals had no continuous dark, light edged lines. Instead
the dark markings were present as short, irregular dark speckles and ‘squiggles’, varying
from sparse to so continuous as to form a reticulum over the dorsal surface. White
markings were present as discrete circular spots, arranged independently of the dark
markings (Figs 5, 7). Other morphological features (scalation) were generally similar in
these two, as they are in G. purpurascens, but the males showing the colour pattern
associated with the 2n=44f karyotype had consistently higher numbers of preanal pores
than those showing the colour pattern seen in the 2n=40a males.
38
FIGURE 4. A. Metaphase karyotypes of the two chromosomal forms occurring in the
Flinders Ranges, South Australia: G. lazelli (2n=44f), SAMAR52012, Warden Hill, and
G. variegata (2n=40a), SAMAR51962, Moosha Bore. Boxes in B show the two
chromosome pairs (5 and 7) that King (1979) suggested were fusion products from a
primitive 2n=44 kartyotype like that shown in A.
Systematics. There is now extensive evidence available to show that populations
traditionally referred to Gehyra variegata that have the 2n=44f karyotype belong to a
distinct species. The phylogenetic relationships shown by the mitochondrial nucleotide
sequence data unambiguously show that the two karyotypic groups are independent
lineages, with the 2n=44f species branching close to the base of the arid zone radiation
39
within Gehyra, while 2n=40a G. variegata is nested among several other
morphologically and karyotypically distinct species. In areas of sympatry (Flinders
Ranges, SA; Lancoona, NSW;) the absence of heterozygotes for allozyme markers and
chromosome rearrangements indicate the absence of gene flow between the two
karyotypic groups, and the colour patterns and other aspects of morphology are
consistently distinguishable. The holotype (and only) specimen of Wells and
Wellington’s (1983) Dactyloperus lazelli shows the colour pattern and preanal pore count
of the 2n=44f species, and we therefore assign the G. variegata 2n=44f to this species
and redescribe it. The 2n=40a populations are left in G. variegata for the present, as the
large task of genetic sampling across the range of G. variegata, both the 2n=40a and
2n=40b groups of King (1979) is still in progress.
Gekkonidae
Gehyra lazelli (Wells & Wellington, 1985) Southern Rock Dtella Figs. 5–8
Dactyloperus lazelli Wells & Wellington, 1985: p. 11. Holotype: AMS R116972
(formerly AMS Field Series 16793), adult male, from “Mt Colley”, Cocoparra National
Park, near Griffith, N.S.W. (Fig. 5a).
Dactyloperus annettae Wells & Wellington, 1985: p. 11. Holotype: AMS
R116971 (formerly AMS Field Series 16789), adult female, from Willandra National
Park, near Hillston, N.S.W. (Fig. 5b).
40
FIGURE 5. The type specimens of A) Dactyloperus lazelli and B) D. annettae.
41
Diagnosis. A moderate sized Gehyra (max. Snout-vent length (SVL) 59 mm) with
divided subdigital lamellae, two or three pairs of enlarged chin shields, a dorsal pattern
combining small pale spots and irregular, dark spots or short wavy lines, and a diploid
chromosome number of 44. Most similar to G. nana, from which it differs in grey to
brown rather than rufous dorsal colouring with more prominent black flecks and lines.
Gehyra lazelli is sympatric or parapatric with two other species, G. variegata (2n=40a
form) and G. purpurascens. Distinguished from G. variegata by fine spotted rather than
ladder-like colour pattern, the white spots not margining the dark markings, slightly
larger size, higher preanal pore counts and (in syntopy) rock- dwelling rather than
arboreal habits. Distinguished from G. purpurascens (2n=40c) by bolder spotted pattern,
with larger black flecks and wavy lines and numerous white spots present in adults, and
smaller size (max. SVL of G. purpurascens 65 mm) .
Description. SVL36–59 mm (mean 51.2, n= 46). Length of tail 46–49 mm (mean
92% SVL, n=3).
Rostral flat dorsally to weakly gabled, with a median groove descending to about
50% of the height of the scale. Nostril surrounded by rostral, first supralabial, two
subequal postnasals and a larger supranasal. Internasals 0 to 3, mode 1. Supralabials 8–
10, mode 9. Infralabials 8–10, mode 9. Two pairs of enlarged chin shields always present;
a third pair sometimes present and contacting the second infralabial but not the third (Fig.
6). Sublabial scale row starts at a notched infralabial, the second or third with similar
frequencies. Lamellae under pad of fourth toe divided, 7 pairs showing obvious surface
architecture of fine hairscales. Preanal pores in males 12–18 (mean=15, n=22), arranged
in a chevron with median pore anteriormost.
42
In preservative (Fig. 6a), dorsum light grey to light brown with irregular dark spots,
short wavy lines or streaks and numerous small, circular, white to pale grey spots. Spots
usually forming regular transverse series around (original) tail but arranged more
haphazardly on the head and body. White and black markings mostly not contacting one
another.
In life (Fig. 7), the dorsal background colour during the day can be considerably
darker grey-brown to brown. At night, in common with most Gehyra, the contrast in the
colour pattern is greatly reduced and paler overall.
FIGURE 6. Chin shield scalation and rostral-nasal scalation in Gehyra lazelli. A) tip of
snout of SAMA R56407 showing typical arrangement of scales. This specimen has one
internasal scale wedged between the supranasals; rostral apex is almost flat in this
43
specimen. B) chin shield arrangement of the holotype (AMS R116972) showing one of
the common arrangements. C) chin shields of another specimen (SAMA R63427)
showing an additional small chin shield pair contacting the second infralabial. In both,
the sublabial row starts at the notched second infralabial. Abbreviations: cc: chin shields
(excluding postmentals), il: infralabials, m: mental, pm: postmental, pn: postnasal, r:
rostral, sbl: sublabials, sl: supralabials, sn: supranasal.
Distribution. Rocky ranges and outcrops in the Gawler, Flinders and Mt Lofty
Ranges of South Australia, extending eastwards into south-central New South Wales and
southwest to the coast of the Great Australian Bight as far west as Ceduna and the Nuyts
Archipelago (Fig. 8).
Comments. Wells & Wellington (1985) described three species of Gehyra (as
Dactylopterus (Fitzinger 1843)) from western NSW. Dactyloperus annettae (type locality
near Hillston, NSW), is a female that has greatly faded in preservative, but its colour
pattern is still discernible, consisting of scattered small dark flecks that fail to form lines
or continuous series. Dactyloperus lazelli, from near Griffith, NSW, is a male in much
better condition, with a colour pattern of blackish speckles forming a reticulum over the
entire head and body, with no continuous light-edged lines on the head or back, and 17
preanal pores. Neither specimen preserves any white markings, but this is a frequent
artifact in preserved specimens of Gehyra. Their third new species, D. kingi, from
Walgett, was synonymized by Bauer and Henle (1994) with G. variegata, but our
examination of the type shows it to be indistinguishable from populations currently
referred to Gehyra dubia (Macleay, 1877) (Cogger 2000; King 1983).
44
FIGURE 7. Live specimens of A) G. lazelli from the Middleback Range, SA, and B) G.
variegata from Merbein, Victoria.
45
The original descriptions of both D. annettae and D. lazelli list a series of character
states for the two holotypes, but do not provide differential diagnoses. We regard these
two specimens and the 2n=44f chromosome group as conspecific. Of the two, described
on the same page in the same publication, we propose that the holotype of D. lazelli, with
its better preserved colour pattern and diagnostic preanal pore count, is the more
unambiguous choice in applying a name to the 2n=44f chromosome group (Fig. 5).
Accordingly we propose that the 2n=44f variegata should be known as Gehyra lazelli
(Wells & Wellington, 1985), new combination, with Dactyloperus annettae as a junior
synonym. The stated collecting locality, Mount Colley, could not be found in a gazetteer
for any landmarks in the Cocoparra National Park or adjacent area. However there is a
Mount Caley within the park, which may be the correct name for the type locality. Mount
Caley is 25 km ENE of Griffith, at 34° 10’ 48’ S, 146° 17’ 23” E.
One other older name that we considered was Gecko grayi Steindachner, 1867. The
holotype specimen (NMW 19800:1) was said to have come from New South Wales, but
with no other data (Steindachner 1867; Cogger et al. 1983; Tiedemann et al. 1994). The
name was regarded by Tiedemann & Häupl (1980) and Tiedemann et al (1994) as a
synonym of G. australis Gray, 1845, by Cogger et al. (1983) as a synonym of Gehyra
variegata (Duméril & Bibron, 1836), while Bauer & Henle (1994) considered it a
possible senior synonym of Gehyra dubia (Macleay, 1877). The specimen is in poor
condition (photographs provided by F. Tiedemann and H.G. Cogger), with only traces of
colour pattern visible on the body, and some weak dark transverse lines on the tail
(detached). However the specimen can be excluded from either lazelli or variegata by
virtue of its notched but mostly undivided toe pad lamellae and its chin shield
46
arrangement (Fig. 3 in Steindachner 1867, Tafel I), the third pair of chin shields being
relatively large and wedged between the second and third infralabials, the sublabial row
starting from a notched fourth infralabial. This combination is seen on some eastern
Australian species presently referred to G. dubia and some G. catenata, but not on
Gehyra from the south-eastern interior of Australia.
FIGURE 8. Distribution map of museum specimens identified as G. lazelli.
Gehyra in the south-eastern interior of Australia. Four nominal species are now known
from this region, namely G. lazelli, G. montium, G. purpurascens and G. variegata. All
overlap to some degree in morphology and distribution, so that in most areas at least two
and sometimes three species can occur in close proximity.
47
The difficulty in allocating specimens to species is made somewhat easier because
three of the species, G. lazelli, G. montium and G. purpurascens, show a limited amount
of morphological variation and are fairly tightly associated with particular microhabitats.
The confusion is generally due to variation in G. variegata, which shows a wide variety
of colour pattern variants and overlaps in size and habits with each of the other three. In
practice, difficulty is experienced most often in distinguishing between juvenile and
subadult G. purpurascens and G. variegata as these two may at times be found on the
same tree, and G. lazelli and G. variegata, which overlap widely. The distinctions
between G. lazelli and G. variegata are noted above in the re-description of G. lazelli,
while most G. purpurascens can be recognized by a combination of a relatively broader
rostral, fewer preanal pores and weaker colour pattern, especially the dark markings
being small, numerous and scattered rather than bolder and more continuous. However,
some preserved specimens from among these three species may not be certainly
identifiable from morphology alone. Where species identity is essential, our data show
that each of the three is readily separable by ND2 sequences.
48
Discussion
Gehyra has long been considered as a relatively ‘recent’ arrival in Australia with its
origins in South-East Asia supported by the presence there of species assigned to the
genus (Cogger & Heatwole 1981; Taylor 1963). Recent broad phylogenetic comparisons
across gekkonines support an Asian relationship, but within this broader region, Gehyra
seems to be anchored close to Australia; the sister taxa of Gehyra are Perochirus and
Hemiphyllodactylus, both centered on the Indonesia-Malaysia-Philippines region rather
than the south- east Asian mainland itself (A. M. Bauer, pers. comm.). As might be
expected from this relationship, most of the morphological variation, and nearly all of the
species, are found in Australia and Melanesia with only a minor group of small species
resembling G. mutilata being typical of mainland South-East Asia. The results of our
initial survey of the relationships among the nominal Australian species, and
representatives from outside Australia, are in accord with geography. We find five major
clades within our sampling of Gehyra: the Asian G. mutilata, two clades among the
Melanesian samples (one comprising only G. membranacruralis alone, and the other G.
baliola and G. oceanica), a clade of tropical Australian species and a clade of
predominantly semi-arid to arid zone species. While these five clades are well supported,
the branching order is not robust at present.
Results from phylogenetic analyses suggest several details regarding the
evolutionary history of the group within Australia. The genetic distinctiveness of the
Australian and Melanesian Gehyra clades suggest that, while sharing a common ancestry,
speciation has proceeded independently within the two regions. This pattern may be an
artifact of under-sampling in New Guinea, but Gehyra from the two regions show
49
divergent trends in morphology. Melanesian species are generally large in size (and
include all of the largest species), characteristically have very loose skin with baggy skin
folds in the legs and flanks. Their skin is easily mechanically damaged and shed in pieces
if the lizard struggles against restraint. Australian species are medium to small in size,
with less of the fragile loose skin, and include many species that have adapted
successfully to the arid zone. Furthermore the two Australian Gehyra clades display
distinctively different evolutionary patterns. Members of the G. australis species complex
(King 1983b) which generally lay two- egg clutches are associated with Australia’s
tropical regions while the taxa representing the G. variegata species complex (King
1979), which generally lay single-egg clutches, are associated primarily with the
Australian arid zone.
Despite allowing some insight into the evolutionary history of Gehyra within
southern Australia, it is worth noting that this analysis is based on a single mitochondrial
locus. A forthcoming multilocus nuclear and mitochondrial gene based phylogenetic
analysis will allow a more thorough and robust examination of the evolutionary history of
the genus in Australia.
The current morphological set of taxonomic characters that are used to define the
species of Gehyra is difficult to apply in practice. Several characters used in the
taxonomy of Gehyra are more variable and are more difficult to interpret than would
appear to be the case according to the original species descriptions. The shape of the
rostral is one such character, whether rising to a median angular apex (‘gabled’) or with
its dorsal margin horizontal. Most Australian Gehyra have a rostral that is best described
as ‘moderately gabled’, seldom appearing horizontal as described for, e.g. G.
50
purpurascens, and often not especially sharply gabled as described for e.g. G. variegata.
The chin shields are usually expressed as simply two pairs or three pairs, but the number
difference is less important than the arrangement of these scales relative to the
infralabials, especially their contacts with the second and third infralabials and whether
the second or third infralabial is notched for the start of the sublabial scale row. Colour
pattern is useful, especially in live animals, but it is often difficult to determine in
preserved specimens, as these geckos frequently fade a short time after preservation,
especially specimens preserved under field conditions where heat and light accelerate
fading.
All of the above difficulties have clearly had an adverse effect on the ability of
workers to identify species confidently in the field and in preserved collections using
either existing species descriptions or keys derived from them. We became acutely aware
of this problem during the course of the current study as the observed position in the
mitochondrial DNA tree of a high proportion of specimens did not match their position
expected from their initial identification. Our subsequent morphological analyses,
however, were consistent with the molecular placements.
Four species of Gehyra can be recognized now in the south-eastern interior of
Australia, but there are taxonomic issues remaining to be clarified. First, the type
population of Gehyra montium has yet to be karyotyped, leaving the precise identity of
the species uncertain as two karyotypic groups of small rock- dwelling Gehyra are known
from the central ranges of northwestern SA, southwestern NT and eastern WA (2n=42a
and 42b; Moritz 1986). Second, while we continue to use G. variegata for both the
eastern 2n=40a and western 2n=40b populations, it is still uncertain whether these
51
karytotypic groups are indeed conspecific. Thus there is a need for further combined
karyotypic, molecular and morphological analyses incorporating typotypic material.
Acknowledgments
We thank Craig Moritz (University of California, Berkeley) for specimens and data
on karyotypes, Paul Horner (Northern Territory Museum) and Pat Couper (Queensland
Museum) for the loan of specimens. Dr Franz Tiedemann of the
Naturhistorischesmuseum Wien and Hal Cogger provided photographs, information and
observations on the type of G. grayi. The study was funded in part by Australian
Biological Resources Study grant 207-43 to MNH and SCD.
52
Delimiting species in recent radiations with low levels of
morphological divergence: a case study in Australian Gehyra
geckos
Mark Sistrom1,2,3
, Steve Donnellan2,3
& Mark Hutchinson2,3
.
1 - School of Earth and Environmental Sciences, University of Adelaide, Adelaide,
Australia, 5005.
2 - South Australian Museum, North Terrace, Adelaide, Australia 5000.
3 - Australian Centre for Evolutionary Biology and Biodversity, University of Adelaide,
Adelaide, Australia, 5005.
Corresponding author: [email protected]
This chapter is formatted in a style appropriate for submission to the Proceedings of the
Royal Society Series B: Biological Sciences with the exception of the in text references
which are maintained in a “Chicago manual of style” format for consistency within the
thesis.
53
Statement of Authorship
Mark J. Sistrom (candidate)
Corresponding author: Responsible for molecular data collection, analysis and
interpretation, conducted morphological analysis, drafted manuscript, produced all
figures, oversaw manuscript revision.
Signed…………………………………………………………..Date……………
Mark N. Hutchinson
Sought and won funding, co-supervised direction of study, responsible for morphological
data collection, provided morphological data collection methods section.
I give consent for M.J. Sistrom to include this paper for examination towards the degree
of Doctor of Philosophy.
Signed: Date: 16/09/2011
Stephen C. Donnellan
Sought and won funding, co-supervised direction of project, provided assistance in
analysis selection and manuscript revision.
I give consent for M.J. Sistrom to include this paper for examination towards the degree
of Doctor of Philosophy.
54
Signed: Date: 16/09/2011
55
Abstract
Recent conceptual and methodological advances have led to an increased ability to apply
a multifaceted approach to delimiting species, which is particularly useful in delimiting
recently diversified species where a single lines of evidence lead to incorrect species
delimitation or assignment of individuals to species (e.g. cryptic, morphological species
and paraphyletic, hybridizing species). The species of the Australian Gehyra gecko
radiation have historically proven difficult to delimit due to the uniform, almost continent
wide distribution of the group and conservative morphology that contrasts with high
levels of chromosomal and genetic diversity within the group Using an integrated
approach to species delimitation and taking advantage of morphological, geographic
distributional and multi-locus genetic data, we investigated the diversity within three
taxonomically challenging Gehyra species from the G. variegatata group from the
Australian arid zone. We found that these three species represent up to eight distinct
phylogenetic lineages, which display different patterns of morphological distinction and
reproductive isolation. Using a recently developed Bayesian species delimitation method,
we also find different levels of support for putative species dependent on the priors on
population size and timing of diversification assumed. Our results show that the current
taxonomy does not adequately account for the diversity of the group and we describe an
additional three Gehyra species. The discrepancies between the different lines of
evidence considered indicate that the diversification in the examined species is recent and
ongoing thus posing challenges for both species concepts and the delimitation of species.
Keywords: species delimitation, speciation, gecko, Australia, arid zone.
56
Introduction
Accurate delimitation of species is of fundamental importance for the majority
ecological, evolutionary and conservation studies. In light of current threats to global
biodiversity, expeditious species delimitation is additionally of increasing importance for
a large portion of earth’s biota, as the need to identify species before they become extinct
is recognized (Koh et al. 2004) However, it is often difficult to delimit recently evolved
species as fixed differences in characters allowing for consistent diagnosis may not have
accumulated, and potential admixture between species can produce individuals with
phenotypically and genetically intermediate states which generate conflict between
different data types (Shaffer & Thompson 2007). As such, species can lack the traits
typically used for delimitation and variation between species can be masked by similar
levels of variation within species.
Whilst species concepts are numerous (De Queiroz 1998; 2007) there has been
some consensus that the general aim of species delimitation is to identify separately
evolving lineages and describe them (De Queiroz 2007). This general lineage concept of
species defines species as “separately evolving metapopulation lineages” and defines the
properties of those metapopulations; such as reciprocal monophyly, reproductive
isolation, fixed morphological differences, differentiated ecological niches, etc as
“operational criteria” that allow for the identification of species though a variety of
methods (De Queiroz 2007). Resultantly, this conceptual approach overcomes some of
the challenges faced when singular lines of evidence provide incomplete delimitation of
species and allow for the resolution of problematic species groups using a multifaceted
approach.
57
Methods of delimiting species have increasingly employed molecular data.
Despite contention regarding the role of molecular data in the detection and description
of species (DeSalle et al. 2005; Leaché & Fujita 2010; Bauer et al. 2011; Fujita & Leaché
2011) molecular genetic data can provide information on recent and ancient gene flow,
the level of hybridization and the phylogenetic relationships between potential species
(Neilsen & Wakeley 2001; Hey & Neilsen 2007; Hey 2010). Rapid advances in the
collection and associated analysis of molecular genetic data has meant that collecting and
analyzing large numbers of loci from large numbers of individuals is increasingly
achievable and fast, new methods for conducting species delimitation using molecular
genetic data are emerging (O’Meara 2010; Yang & Rannala 2010).
King (1983) recognized two major lineages in the Australian gecko genus Gehyra,
the G. australis species complex, associated with the higher rainfall subtropical far north
and the G. variegata species complex (King 1979), associated with the Australian arid
zone. These two lineages show some morphological and developmental differentiation
(King 1979; 1983; Moritz 1992). However, within each of these groups, the distinction
between species is confounded by complex and confusing geographic and morphological
patterns – likely due a recent history of diversification from a conservative morphological
“template” (Shaffer & Thompson 2007). Members of the G. variegata complex (King
1979) are the most abundant climbing geckos in the Australian arid biome, occupying all
climbing habitats throughout it and extending into adjacent dry temperate and seasonally
arid tropical habitats. Morphological variation across arid zone Gehyra taxa is limited
and some characters used to differentiate currently recognized species, such as back
pattern, are continuously variable between species (King 1979). Some G. variegata
58
complex species show habitat specialization in that they are predominately found on
rocky outcrops, while others are restricted to trees (Mitchell 1965; Bustard 1968; King
1979). However, most ecological data for these species are anecdotal or local, in addition
to which ecological requirements are difficult to determine in the face of the genus's
incomplete taxonomy.
Several efforts have been made in the past to clarify the taxonomy and investigate
the recent history of Gehyra (King 1979; 1982a; 1982b; 1983; Moritz 1986; Horner
2005; Sistrom et al. 2009). Of note is the high level of chromosomal variation within arid
zone Gehyra - with up to nine chromosome races found within the G. variegata species
complex (King 1979; Moritz 1986) and a high level of allozyme variation within rock
dwelling populations (Moritz 1992). However due to the remote locations of many
populations, sampling density was low and the ability to investigate gene flow between
nominal species using chromosomal data is limited (Sites & Moritz 1987; Moritz 1992)
and thus despite revealing potential taxonomic difficulties among arid zone Gehyra, such
studies only led to partial taxonomic resolution of the complex.
We have chosen to examine three nominal species of Gehyra variegata complex
geckos – G. minuta, G. montium and G. variegata (King 1979; Mortiz 1992; Sistrom et
al. 2009). These species are known to display a complex arrangement of chromosome
races with equally complex geographic distributions (King 1979; Moritz 1986; 1992). In
addition, these species display conserved, overlapping morphologies that do not allow for
clear classification of specimens into species (Moritz 1986; 1992). Due to the complexity
of these arrangements of various lines of evidence for species boundaries, we intend to
use an integrated approach, taking advantage of existing karyotypic data in addition to a
59
phylogenetic approach, assessments of gene flow between putative species, geographic
distributions, morphology and a recently developed species tree approach to delimiting
species (Yang & Rannala 2010). By utilizing an integrated approach and using multiple
analyses to inform one another we intend to delimit potential species within this complex
under the general lineage concept.
Methods
Sampling and laboratory methods
DNA was extracted from frozen and alcohol preserved liver tissue stored in the
Australian Biological Tissue Collection (ABTC) at the South Australian Museum
(SAMA) using a Puregene™ DNA Isolation Tissue Kit D-7000a (Gentra Systems)
following the manufacturer's guidelines. Sequence data from was collected for 220
individuals representing all currently recognized species of Gehyra from Australia, four
species from Oceania and Melanesia and three outgroups from Cyrtodactylus,
Hemiphyllodactylus and Lepidodactylus [Aaron Bauer pers. comm.]. This sampling also
comprehensively covers the ranges of all arid zone Gehyra taxa and samples consistent
with current taxonomic descriptions were included from corresponding type localities of
all arid zone taxa. Due to the relatively high rates of misidentification of Gehyra
specimens in all Australian collections (Sistrom et al. 2009) only tissues with
corresponding voucher specimens available for verification of identification were used.
Histone cluster 3 gene along with the contained exon region (H3) (517 bp) were
amplified using primers developed by aligning Gekko japonicus cDNA sequence
available on GenBank to the Anolis genome in order to identify exon-primed, intron-
60
crossing (EPIC) primer sites using the tool BLAT (Kent 2002). Primers developed using
this method were G1600F (5’ - TGGAGCAGGAAARACAACYAT – 3’) and G1601R
(5’ – RAGCTCAGACTTYGAAATKCC – 3’). Prolactin receptor (PRL-R) (544 bp) was
amplified using primers PRLR_f1 (5′ - GACARYGARGACCAGCAACTRATGCC - 3′)
and PRLR_r3 (5′ - GACYTTGTGRACTTCYACRTAATCCAT - 3′) (Townsend et al.
2008). NADH dehydrogenase subunit 2 (ND2) and partial flanking tRNA's (1136 bp)
were amplified using the primers M112F (5'- AAGCTTTCGGGGCCCATACC- 3') and
M1123R (5'- GCTTAATTAAAGTGTYTGAGTTGC - 3') (Sistrom et al. 2009).
Amplifications were carried out in 25µL volumes using standard buffer and MgCl2
concentrations, 0.1 mM each dNTP, 0.2 µM each primer, 0.75 U AmpliTaq Gold® DNA
Polymerase (Applied Biosystems) and approximately 100ng of genomic DNA.
Thermocycler profiles were: 9 min at 94oC, then 45 cycles of: 45 s at 94
oC, 45 s at 55
oC
and 1 min at 72oC for nuclear genes and 40 cycles of: 45 s at 94
oC, 45 s at 60
oC and 1
min at 72oC with a final extension step of 6 min at 72
oC. The PCR product was purified
using a Millipore Montage® PCR384 Cleanup Kit (Millipore Corporation) following the
manufacturer's guidelines. One microlitre of purified product was used as template for a
BigDye Terminator sequencing reaction, which was carried out in 20µL reactions,
consisting of 1µL of BigDye (Applied Biosystems), 7µL of 2.5x buffer and 1µL of
5pmol/µL primer. Sequenced products were separated on an Applied Biosystems 3730xl
capillary sequencer.
Alignment and Phylogenetic analysis
The MUSCLE alignment algorithm (Edgar 2004) was used to align sequences via
a plugin in Geneious v. 4.8.5 (Drummond et al. 2010) which were refined by eye. The
61
protein-coding region of ND2 was translated into amino acid sequences using the
vertebrate mitochondrial genetic code and was compared to Gekko gecko (GenBank
accession EU054288) translations to check for stop codons and frame shifts. The
heterozygote plugin in Geneious was used to identify heterozygous sites in sequences of
PRL-R and H3, in addition to visual inspection. For the purposes of phylogenetic
reconstruction, these base pairs were coded using IUPAC ambiguity codes. Due to the
low relative diversity and large number of indels in the H3 data, indels were coded as
presence – absence data.
MacClade v. 4.08 (Maddison & Maddison 2005) was used to identify redundant
sequences, which were removed from the dataset for phylogenetic analyses and the
determination of gametic phase. We conducted Bayesian and Maximum Likelihood (ML)
analyses on each locus independently and on a concatenated dataset of all three loci.
jModeltest v. 0.1.1 (Posada 2008) was used to evaluate models of evolution for all loci.
The tRNA sequences were removed from ND2 before partitioning it according to codon
position (1st, 2
nd,3
rd and 1
st and 2
nd combined). As RaxML is unable to accommodate
presence-absence data, the H3 gap partition was not used in the ML analysis. ML
analysis with 1000 bootstrap replicates was carried out using the RAxML BlackBox web
server (Stamakis et al. 2008). Bayesian analysis was conducted for 5 million step MCMC
chains were run, sampling every 1000 generations, with the first 500 samples discarded
as burn-in, leaving 4500 trees for construction of a majority rule consensus using
MrBayes v. 3.1 (Ronquist & Huelsenbeck 2003). TRACER v. 1.4.1 (Rambaut &
Drummond 2010) was used to confirm acceptable mixing, likelihood stationarity of the
MCMC chain and adequate effective sample sizes for each parameter (~200).
62
Morphological Analysis
In order to assess phenotypic differences between putative species, a number of
morphological characters were taken from specimens with associated tissue samples.
This analysis excluded Clade 3, Clade 4 and G. minuta due to low sample sizes (n<3).
Measurements were carried out using digital calipers to the nearest 0.01mm and counts
carried out by eye. Characters evaluated were: number of preanal pores in males (PP),
clutch size in females (CL), tail length (TL), head length (HL), head width (HW), eye to
naris distance (EN), snout height (SH), femur length (FEM), height of the rostral groove
(RG), number of internasal scales (IN), ratio upper to lower postnasal scale (PN), number
of supralabial scales (SL), number of infralabial scales (IL) number of chin shield scales
(CS), number of infralabials contacted by the first chin shield scale (CS1), interorbital
distance (IL) and the number of subdigital lamellae on the fourth toe of the right rear foot
(SDL). A small number of measurements which could not be collected due to specimen
damage (2 individuals) were imputed using the within species mean.
All subsequent analyses of morphological data were conducted using the R
statistical package (R Core Development Team, 2011). Each character was tested for
sexual dimorphism by regressing values for male and female specimens by SVL as a
proxy for body size (except for SVL which was regressed by EN) using the lm
function of the base R package. The slopes of male and female regression lines were
compared for significant differences using an F test implemented with the var.test
function of the base R package. When slopes were found to not be significantly
different an Analysis of Covariance (ANCOVA) was carried out on male and female
63
regression lines using the lm function of the base R package to determine if sexual
dimorphism was present.
Data found to be free of sexual dimorphism were log transformed and corrected
for body size using the methods described by Lleonardt (2000) using SVL as a measure
for body size (except in the case of SVL where EN was used). Principle components
analysis was then carried out on the corrected data using the dudi.pca function of the
vegan package (Oksanen et al. 2011). Multivariate analysis of variance (MANOVA) was
used to test whether PC axes showed significant differences between species and axes
that displayed which showed significant differences were further evaluated using an
analysis of variance (ANOVA) in conjunction with Tukey’s honestly significant
difference (HSD) tests (Yandell 1997) to evaluate the significant differences observed
between specific putative species. A visualization of the mean PC scores of putative
species along axes which showed significant differences between groups is shown in Fig.
3 and the results of Tukey’s HSD tests is shown in Table 1.
Inference of Gene flow
For both nuclear loci, heterozygous individuals needed to be resolved for the
purpose of analysing gene flow. For individuals with only a single heterozygous base pair
this was done manually. For individuals with multiple heterozygous sites we used the
program PHASE v. 2.10 (Stephens et al. 2001; Stephens & Scheet 2005) and retained the
most probable alleles with support values >90%. In order to test reproductive isolation
between existing and putative novel species with overlapping geographic ranges and
where no fixed morphological differentiation could be found, rates of migration between
them were estimated using the program Ima2 (Hey 2010). Despite IMa2 having the
64
capability to test multiple populations, the amount of data required and computational
expense increases dramatically with the addition of each population (Hey 2010) so tests
of gene flow between proposed species were carried out in a pairwise fashion. Data was
divided into non-recombining blocks using the algorithm of Hudson and Kaplan (1985)
implemented in DNAsp v. 5 (Librado & Rozas 2009) and the infinite sites model used for
IMa2 analyses. The burn in was conducted using a geometric heating model with 40
independent chains and parameters optimized to maximize mixing between chains
throughout the run. Burn in was run until trendplots had stabilized and ESS values for all
parameters had reached >50. After burn in, each run was conducted under default settings
for 30 million generations. The estimated number of migrants per mutation (m) in both
directions was plotted against its respective p value for migration in both directions (Fig.
4). In cases where the most probable number of migrants in at least one direction was
zero, we were able to support restricted gene flow between putative species and therefore
support that putative species as a distinct evolutionary lineage.
Bayesian Estimation of Species Delimitation
We tested validity of putative and existing species using reverse-jump MCMC
methods implemented in the program BPP v. 2.0 (Yang & Rannala 2010). Due to
possible bias in the phylogenetic analysis used to identify putative species induced by
high relative signal in the ND2 dataset compared to the nuclear loci, the analysis was
conducted both with this data included and excluded. In addition, as prior values for
ancestral population size (θ) and branch lengths (T0) can have a significantly misleading
effect if they are incorrect and too strict, we implemented a range of 5 diffuse priors
ranging from m=0.1 to m=1x10-4
for θ and T0 in order to assess the impact of these priors
65
on support for species hypotheses presented by the guide tree. We also included a model
with m=0.1 for θ and m=1x10-4
for T0, as this model assumes relatively large ancestral
population sizes and short branch lengths, which represents a conservative scenario
favoring fewer speciation events. The rjMCMC analysis was run for 500 000 generations,
sampled every 5 and with a burn in period of 10 000 generations. We used algorithm 0
with a fine-tuning parameter of Ɛ = 5.0. Each speciation event was given equal prior
probability.
Results
Phylogenetic analysis
For the ND2 alignment, the model GTR+I+Γ was selected for all codon partitions.
For the H3 dataset, HKY+Γ was selected for the sequence data and MrBayes uses an F-
81 model for binary coded gap data. For the PRL-R dataset, the model GTR+I+Γ was
selected. Phylogenetic analysis using Bayesian and Maximum Likelihood methodologies
resulted in identical tree topology. The results of the ML phylogenetic analysis are
presented in Fig. 1. Phylogenetic analysis confirmed the genetic distinction of all known
species and revealed an additional 5 monophyletic clades that represent putative species
not currently recognized by the taxonomy. The validity of existing species and these
putative novel taxa was tested in subsequent analyses.
66
Figure 1: Maximum likelihood tree of the concatenated ND2, H3 and PRLR data for all
samples. Asterisks denote nodes with >95 Bayesian posterior probability and >70 ML
bootstrapping score. Existing names are used for clades which contain samples of
67
specimens from the type locality of the relevant description and numbers after lineages
denotes karyotype where known.
Figure 2: Map of Australia showing the sampling localities of putative species evaluated.
Grey lines represent 50m elevation contour lines.
Morphological Differentiation of Clades
Sexual dimorphism was detected in Clade 1 individuals for RG and in Clade 5
individuals for HL and HW. As such, these characters were removed from further
analyses. Significant differences between putative species was detected in PC axes 1, 2
and 3, which cumulatively explained >95% of the variation in the data. Using Tukey’s
HSD to evaluate the significant differences between putative species pairs, the only
68
putative species pair that is shown to be morphologically indistinct is G. variegata and
Clade 5 (see Table 1).
Table 1: Results of Tukey’s HSD test showing significant morphological differences
between putative species. D represents the differences in mean PC values between each
species along each PC axis and P represents the corresponding P value. * significant to
95%, ** significant to 99%.
PC Axis 1 PC Axis 2 PC Axis 3
Comparison D P D P D P
Clade 1 - Clade 2 0.392 0.76 -2.146 0.00** -0.182 1
Clade 1 - Clade 5 -2.481 0.00** -0.239 0.91 0.759 0.05*
Clade 1 - G. montium 1.349 0.00** -0.023 1 1.567 0.00**
Clade 1 - G. variegata -1.711 0.00** -0.212 0.96 1.059 0.01*
Clade 2 - Clade 5 -2.873 0.00** 1.907 0.00** 0.778 0.1
Clade 2 - G. montium 0.956 0.05 2.122 0.00** 1.585 0.00**
Clade 2 - G. variegata -2.104 0.00** 1.934 0.00** 1.077 0.02*
Clade 5 - G. montium 3.829 0.00** 0.215 0.95 0.808 0.05*
Clade 5 - G. variegata 0.769 0.12 0.027 1 0.299 0.86
G. montium - G. variegata -3.06 0.00** -0.189 0.98 -0.508 0.53
69
Figure 3: A graphical depiction of mean morphological distance between putative
species. Points represent mean PC scores for each of the tested putative species, error
bars represent 95% confidence intervals.
70
Inference of Gene flow
The potential for gene flow between putative species identified using phylogenetic
analysis was evaluated using the program IMa2 (Hey 2010). Using phased nuclear data,
migrations per substitution (m) were estimated in both directions between putative and
known species where either geographic ranges or morphological characters were
overlapping. To evaluate the likelihood of gene flow between putative species we plotted
values of m against their respective p values (Fig. 4). In cases where the most probable
value of m was zero in at least one direction between two putative species, we concluded
that restricted gene flow between them was supported.
Using this approach, we are able to support restricted gene flow between Clade 1
and 2, Clade 1 and 5, Clade 1 and G. minuta, Clade 2 and G. minuta, Clade 3 and 4,
Clade 3 and 5, Clade 4 and 5, Clade 4 and G. minuta and between G. minuta and G.
montium. Gene flow was predicted between Clade 1 and G. montium, Clade 2 and G.
montium, Clade 3 and G. variegata, Clade 4 and G. variegata, Clade 5 and G. minuta,
Clade 5 and G. montium and between G. montium and G. variegata. Inference between
Clade and G. montium, Clade 3 and G. variegata and between Clade 4 and G. montium
were inconclusive. It is important to note that as a rate of mutation was not inferred, gene
flow was not quantified and its presence does not necessarily call for rejection of a
putative species.
71
72
Figure 4: Results of Ima2 analyses. M – the number of migrants is plotted on the x axis and its corresponding P value is plotted on the y axis. For
each analysis carried out, M is recorded for migration in both directions and reported as separate distributions, which are plotted as the two lines in
each graph. A hypothesis of restricted gene flow was considered supported if the highest value for P was at m=o in at least one direction.
73
Bayesian Species Delimitation
Results for Bayesian species delimitation is shown in Fig. 5. All species in the
guide tree are well supported when a prior distribution of m=0.1 for θ and T0, however
support for the most derived species splits (namely between G. minuta, Clade 4 and
Clade 5) becomes very low as values for m decrease and even more so when a prior
distribution of m=0.1 for θ and m=1x10-4
for T0. When the mtDNA is included (Fig. 5b)
this pattern is still observed though nodal support is higher overall. Low support for the
G. purpurascens/G. punctata and G. nana/G. occidentalis splits indicates that the low
representative sample size for these species is having an effect on the support they are
given in the analysis.
74
Figure 5: Bayesian species delimitation results with a) mtDNA excluded and b) mtDNA included. Each node of the tree is labeled
with posterior probabilities of the species split under different combinations of prior distributions of θ and T0 in the order 1: means =
0.1, 2: means = 0.01, 3: means = 0.005, 4 means = 1 x 10-4
and 5: mean θ =0.1 and mean T0= 1 x 10-4
.
75
Discussion
Integrative species delimitation
Species delimitation is a decision making process and the general lineage concept
allows for making these decisions based on a number of different approaches and data
types (Schlick-Steiner et al. 2010; Yeates et al. 2010). Integrative approaches are more
thorough and likely to yield robust results than delimiting species with a singular line of
evidence (Schlick-Steiner et al. 2010). However, integrative species delimitation is made
difficult when different lines of evidence yield conflicting results, as is likely with
recently radiated groups (Shaffer & Thompson 2007) and is apparent in the arid zone
Gehyra geckos evaluated in this study.
The use of phylogenetic analysis, particularly with mitochondrial DNA, is
widespread as a preliminary investigation of the evolutionary diversity of organismal
groups that have proven taxonomically challenging using traditional taxonomic methods
(Moritz 1994). While it is possible for species to go undetected using such an approach
when processes such as incomplete lineage sorting or horizontal gene transfer obscure
genetic differentiation between species (Knowles & Carstens 2007), it is a demonstrably
effective approach in discovering difficult to distinguish and cryptic species (Bickford et
al. 2006; Dasmahapatra et al. 2010). Phylogenetic analysis of the arid zone Gehyra
confirmed the genetic distinctiveness of all currently described species and identified a
further five previously undiscovered putative species, despite considerable past efforts in
delimiting species in the group using morphological and chromosomal techniques. The
phylogenetic clusters detected using this approach represent the most divergent
delimitation model possible for the group based on current knowledge.
76
Reinvestigating the chromosomal evidence in light of the phylogeny shows that
all putative species with the exception of Clade 5 represent a single karyotpyic
arrangement. This has three implications: 1) Fixed differences in chromosomal
arrangements between putative species, where evident add additional support to the
separation of these species. 2) The fact that several putative and currently described
species share the same karyotype highlights that in some cases, this marker is
uninformative in the identification of species and emphatically shows the difficulties
faced by previous researchers. 3) The multiple chromosome races found in Clade 5 may
indicate that a speciation event not detected by phylogenetic analysis may have occurred.
This potentially warrants further investigation that is beyond the scope of the current
study. While karyotype is an informative character in detecting and identifying Gehyra
species, when used in isolation it only yields to partial resolution of the group.
Despite the complex nature of the geographic distribution of Gehyra lineages, the
geographic distribution of some putative species provides information relevant to their
status as species. Many putative species have geographic ranges that are either
completely or partially sympatric (see Fig. 2 and Table 2) indicating that the evolutionary
distinction observed in other lines of evidence persists despite the potential for
contemporary gene flow (Petit & Excoffier 2009). In other cases, geographic
distributions of species are coherent with known biogeographic regions within the
Australian arid zone (Byrne et al. 2008, Fujita et al. 2010), suggesting that speciation in
these populations has been affected by the same historical processes that have acted on
other elements of the biota of these regions - e.g. Clade 1 is restricted to the MacDonnell
Ranges – a region noted for high endemism in plants (Woinarski et al 1996) and
77
invertebrates (Morton et al. 1995) and Clade 2 is restricted to the Central Ranges – a
distribution shared with the agamid Ctenophorus rufescens and skink Lerista speciosa
(Wilson & Swan 2008) (see Fig. 2). A significant finding of our study is that G.
montium has a much wider westerly distribution than previously thought (Storr 1982),
extending throughout the Pilbara and central Western Australia. Without doubt, this is
due to the morphological similarity among these geckos, such that southern Pilbara
specimens of G. montium were assigned to either G. variegata or G. punctata, depending
on the degree to which the colour pattern was reticulate or spotted (respectively). The G.
variegata clade has a widespread western distribution, while the distribution of Clade 5 is
split into eastern and central sections . Contact between the variegata clade and Clade 5
must occur in the eastern Nullarbor Plain region. The exact nature of this contact remains
unknown but would be informative in relation to their evolutionary isolation. It is worth
noting that sampling in remote regions of Australia such as the Tanami Desert and large
portions of northern Australia is grossly inadequate and apparent gaps in distribution of
several species, or lack of geographic overlap between species in some areas, may merely
represent gaps in sampling.
Despite extreme difficulty in identifying and characterizing morphological
differences between Gehyra species without prior genetic groupings and using traditional
qualitative taxonomic methods (King 1979; 1983; Moritz 1986), almost all of the putative
species identified by the phylogenetic analysis show significant differences in
morphology using multivariate methods, with the exception of Clade 5 and G. variegata.
Unfortunately, low sample size prevents a morphological assessment of Clade 3, 4 and a
reassessment of G. minuta. Cursory examination of Clade 3 and Clade 4 specimens
78
suggests morphological crypsis with respective sympatric lineages G. variegata and
Clade 5 indicating that determining the phenotypic distinction of these putative species
requires further investigation once adequate information is available on live colour
patterns and more sampling of populations in the overlap zones between these clades and
their nearest relatives. The status of G. minuta as a distinct species is not in question at
this point, but species assignments for the poorly studied populations of small, spotted
rock-dwelling geckos from the northern half of the arid zone are doubtful, and we defer
further consideration of this species and its geographic and morphological limits to a
future time when better sampling of this region has been undertaken. Tests for gene flow
(summarized in Fig. 4) between putative species provided support for some otherwise
difficult to distinguish putative species showing limited morphological divergence or
undetermined/identical chromosomal states. For example, restricted gene flow between
Clade 4 and 5 was detected despite preliminary examination of specimens showing
limited morphological divergence, entirely sympatric distribution and the undetermined
chromosomal state of Clade 4 meaning that support for the separation was otherwise low.
Coalescent estimates of gene flow were useful in supporting some putative species splits,
however in some cases restricted gene flow between putative species supported by other
lines of evidence was not supported – e.g. restricted gene flow between G. montium and
G. variegata. It is important to note a number of conditions when interpreting the results
of coalescent migration analyses used in this manner. As the mutation rate of the loci
used for the analyses was not estimated due to the associated error in estimating mutation
rates potentially leading to type 1 error in species delimitation (Kuhner 2009; Strasburg
& Reiseberg 2010), the magnitude of gene flow between putative species when predicted
79
also cannot be estimated. This renders the test highly conservative in cases where low
levels of gene flow between true species may be present. In addition, the use of
coalescent estimation of migration for this purpose does violate an assumption of the test
by comparing putative species which may not be sister species. While multiple
population models can be carried out using IMa2, the required genomic coverage to yield
robust results increases in a non-linear fashion and simulation studies show that gene
flow estimates are unlikely to be significantly affected by low to moderate gene flow with
an unsampled intermediate population (Strasberg & Reiseberg 2010).
Bayesian Species delimitation using BPP (Yang & Rannala 2010) provided
conflicting results when different prior distributions of θ and T0 were assumed despite
these distributions being set deliberately diffuse in that splits between the most derived
putative species – G. minuta, G. montium, Clade 3, Clade 4 and Clade 5 show decreasing
levels of support for decreasing prior means of θ and T0 with the lowest support seen
when the prior distribution of θ is assumed to be high relative to the prior distribution of
T0. Support for the more derived species splits in arid zone Gehyra are supported under
some evolutionary scenarios but not others, highlighting that prior knowledge of likely
evolutionary scenarios may be important for accurate delimitation using this method. In
addition, support for the species G. punctata and G. purpurascens is low and highly
variable, despite the relative placement of these species being uncontroversial (King
1979; Storr 1982; Sistrom et al. 2009). As they are only represented in the analysis by
small, representative sampling it may suggest that small, disproportionate samples can
lead to low support values for otherwise distinct species. Given the small relative samples
sizes of Clade 4 and G. minuta this may be playing a role in the low support values for
80
these terminal species. Finally, posterior support values were higher with the inclusion of
mtDNA, however patterns of support were similar to those observed when only nuclear
loci were analysed, suggesting that mtDNA is not providing contradictory signal which
would lead to an erroneous result in the combined analysis.
Status of putative species.
Our results show significant support for all currently described central Australian
Gehyra species and indentify five additional putative species, with varying levels of
support for each under the general lineage concept using an integrative approach. Clade 1
and Clade 2 prove to be genetically and morphologically distinct, with discrete
geographic ranges indicating that traditional taxonomic description of these species to be
relatively straightforward and appropriate. Clade 3 and Clade 4 are shown to be
genetically distinct and may warrant description as new species, pending additional
samples being either detected by targeted genetic screening of museum held samples or
further specimens collected in the now known distributions of these clades to characterize
the morphology of these putative species. The phylogenetic and chromosomal distinction
of Clade 5 from G. variegata, in concert with the parapatric distribution initially suggests
that these two clades represent distinct species however their morphologically cryptic
nature and the gene flow between them indicate that the scenario may be more complex.
Additional sampling in the zone of contact in western South Australia, in concert with
analysis using appropriate markers to detect and assign potential hybrids such as
microsatellites (Barton & Gale 1993) would provide a clearer understanding of the
interactions between these two putative species.
variegata montium minuta Clade 1 Clade 2 Clade 3 Clade 4
81
montium B M C S
minuta B C B M I S
Clade 1 B M C B M C S B C I S
Clade 2 B M C B M C S B C I S B M C I
Clade 3 B S B I B C I B B
Clade 4 B I B S I B B B I
Clade 5 B C B M C S C S B M C I S B M C S B I I S
Table 2: Summary of evidence for species delimitation of phylogenetic clades. B –
Bayesian species delimitation supports the split under multiple scenarios.
M – Significant morphological differences detected.
C – Fixed chromosomal difference detected.
I – Restricted gene flow detected
S – The geographic ranges of species overlap.
Conclusions
Our study clearly shows that the current taxonomy of central Australian Gehyra
under-represents the number of species within the group, and identifies a number of novel
species worthy of description or further investigation. While the general lineage concept
of species allows the reconciliation of multiple lines of evidence when evaluating the
potential of these putative species, this approach offers a considerably more powerful and
universal method of identifying and defining species than traditional methods, however
many data types – such as genetic data and categorical morphological data are difficult to
evaluate using similar analytical frameworks. As such, when datasets are in conflict, as is
the case in the Gehyra group analyzed and typical of many recently evolved groups,
decisions regarding species delimitation become qualitative judgments. While
frameworks for making these decisions have been posed (Schlick-Steiner et al. 2010;
Yeates et al. 2010 the development of a statistical approach for evaluating multiple lines
of evidence for species delimitation would be considerably more desirable. Despite this,
the fact that speciation is a continuous biological process (De Queiroz 2007; Shaffer &
82
Thompson 2007) delimitation of species in groups like the Central Ranges Gehyra is
likely to always be difficult.
Species Descriptions
Our OTU designations are formalized here, with restriction and redefinition of
two of the three nominal species, and descriptions of three new species. All descriptions
are based solely on specimens that have been typed using DNA sequences. Two of our
OTUs, Clade 3 and Clade 4 are not formally described as they lack karyotypic data and
information on life colour pattern variation, and for both sampling is currently inadequate
to assess the degree to which they are consistent across their range. Further collections
and analyses will be necessary to fill these gaps in knowledge.
83
Gehyra variegata (Duméril & Bibron, 1836)
Figure 6: Gehyra variegata. A) SAMA R63256, Eyre Highwy at Fraser Range, WA. B)
SAMA R63283, 57 km ENE Balladonia Rock, WA. C) SAM R65162, Maralinga, SA.
D) SAM R65161, Maralinga, SA.
84
Hemidactylus variegatus Duméril & Bibron, 1836: p. 353 Syntypes: MNHP 254 (3
specimens), from “Tasmania” (in error), and MNHP 2295 from Shark Bay, W.A.
Specimens examined: See supplementary material.
Diagnosis. Distinguished from other Australian Gehyra by a combination of 8
divided scansors under the expanded portion of the fourth toe, moderate size, generally
two pairs of enlarged chin shields, second infralabial notched and a dorsal pattern in
which dark lines and white markings coordinate to produce a pattern of dark lines and
bars with white trailing edges. Not distinguishable by external morphology from G.
versicolor sp. nov. (see below), but distinguished karyotypically by the unique 2n=40b
arrangement (King 1979).
Description. Snout-vent length 41-49 mm (mean = 47.5 mm, n = 19). Length of tail
43 mm (105% SVL, n = 1).
Nostril surrounded by rostral, first supralabial, supranasal and two subequal post
nasals. Generally a single moderate internasal separates the supranasals above the rostrol,
but supranasls In medial contact in a minority of specimens. Supralabials 9 or 10 (mode
9). Infralabials 7-10 (mode 9). Usually 2 pairs chin shields, anterior pair in contact with
only the first infralabial. Chin shields separated from the third and succeeding
infralabials by the interpolation of a series of enlarged scales (parinfralabials) that margin
the ventral edge of the infralabials. Usually second infralabial notched where this
parinfralabial scale row starts. Scansors under pad of fourth toe divided, 6-8 (mode 8).
Preanal pores in males 11-14 (mean 12.3, n=8).
85
The karyotype is 2n=40b, (King 1979, Moritz 1984).
In life, dorsally light to medium grey or brown, generally with a complex
reticulation of white-edged black lines. These usually include several temporal streaks
and often form continuous paravertebral and transverse dorsal irregular lines, forming a
vaguely ladder-like pattern. Some specimens, especially from rock-dwelling populations
have the dark markings more discontinuous, but dark markings continue to appear as
white-edged lines and bars rather than separate black markings and white circular spots
as in other rock-dwelling species of Gehyra. Colour pattern is variable both within and
between populations. In preservative, the colour pattern is often greatly reduced in
contrast and can be hard to discern.
Distribution. Widespread through the southern half of Western Australia, from the
Carnarvon basin east to the Central Ranges and southeast to the western interior of South
Australia (Maralinga).
Comments. The combination Gehyra variegata has long been applied Australia-wide to
populations of morphologcally similar Gehyra species with similarly generalist habits.
Our study makes it clear that the well-established karyotypic differences between western
and eastern populations are evidence that the two are not part of the same gene pools.
Indeed, the two are not even sister lineages.
The type localities associated with the syntypes of Hemidactylus variegatus in the
MNHP collection are Shark Bay, WA (one specimen) and Tasmania (four specimens).
86
No Gehyra occur in Tasmania (Wilson and Swan 2011), and the Baudin expedition on
which these types were collected did not make collections from any localities where the
eastern populations (2n=40a karyotype) occur. However they did make extensive
collections from many areas of the west coast in WA, including Shark Bay, where the
western karyotypic group (2n=40b) occurs. Thus the Shark Bay specimen likely
represents a real collecting locality for the type series and specimen MNHP 2295 is the
logical candidate for lectotype. This leads us to conclude that the name variegata
properly applies to the western populations.
As our study shows, morphology alone cannot distinguish between the two
karyotypic groups and In addition, the lectotype cannot now be found (I. Ineich, pers.
com.), while the 'Tasmanian' paralectotypes are all completely faded (pers.obs.). All are
small Australian type Gehyra geckos, but little further can be said about them.
One aspect of our study conflicts with published Information. King (1979)
mapped Gehyra in the Maralinga area of western South Australia as belonging to his
2n=40a karyotype group (fusion products are chromosome pairs 5 and 7). However, in a
sample of seven specimens karyotyped from three locations in the Maralinga area and on
the northern Nullarbor Plain, all were 2n=40b (fusion products pairs 3 and 6; our Clade
5). We are unable to account for this discrepancy. However, our karyotypic data are
confirmed by DNA sequence data from the same specimens that indicate membership of
the variegata clade. King's data would predict the presence of Clade 5 in this area, but all
of our samples from the far west of South Australia belong to the variegata clade, our
only recovery of a Clade 5 animal in the western half of South Australia being in the
87
north-western ranges. We note that the size distinctions between chromosome of these
two variants are small and might readily be confused in the absence of close scrutiny.
Gehyra montium Storr, 1982
Figure 7: Gehyra montium. SAMA R61924, Morgan Range, WA.
Gehyra montium Storr, 1982: p. 56. Holotype: WAM R31732, from Mt Lindsay
[Watarru], Birksgate Range, north-western South Australia, 27º 02’ S, 129º 53’ E.
Specimens examined: See supplementary material.
Diagnosis: Distinguished from other Australian Gehyra by a combination of modally 7
divided subdigital lamellae, small to moderate size generally two pairs of enlarged chin
shields, second infralabial notched, a dorsal colour pattern combining grey-brown to
rufous colouring (in life) patterned by small pale spots interspersed in a continuous
network of irregular, dark lines, and a karyotype of 2n=42a (Moritz 1986).
Diagnosis: Distinguished from other Australian Gehyra by a combination of
88
modally 7 divided scansors under the expanded portion of the fourth toe, small to
moderate size generally two pairs of enlarged chin shields, second infralabial notched, a
dorsal colour pattern combining grey-brown to rufous colouring (in life) patterned by
small pale spots interspersed in a continuous network of irregular, dark lines, and a
karyotype of 2n=42a (Moritz 1986).
Description. Adult snout-vent length 36-49 mm (mean = 40.3 mm, n=21 ). Length
of tail 41-48 mm ( mean = 110% SVL, n=4,).
Nostril surrounded by rostral, first supralabial, supranasal and two post nasals, the
upper usually markedly larger than the lower (as noted by Storr 1982). 1-3 (modally 1)
moderate internasal scales separate the supranasals above the rostral. Supralabials 8-11,
mode 8. Infralabials 7-9, mode 8. Consistently 2 pairs chin shields, anterior pair in
contact with only the first infralabial. Chin shields separated from the third and
succeeding infralabials by the interpolation of a series of enlarged scales (parinfralabials)
that margin the ventral edge of the infralabials. Second infralabial notched where this
parinfralabial scale row starts. Scansors under pad of fourth toe divided, 7-8 (mode 7).
Preanal pores in males 10-13, mean 11.1 (n=12).
The karyotype is 2n=42a (King 1979). This karyotype is shared with a number of
Gehyra species, including G. minuta and populations currently assigned to G. punctata in
Western Australia
In life, dorsally light grey-brown to to reddish brown to pinkish, the entire dorsal
surface patterned by a reticulum of blackish grey. Scattered over the dorsal surface are
small circular pale spots, often only contrasting weakly with the dorsal background
89
colour. In preservative any rusty colour tones and pale spots tend to disappear leaving
the specimens greyish with a dark reticulum.
Distribution. Rocky mountain ranges of north-western South Australia extending to
adjacent areas of the south-western Northern Territory and west into central Western
Australia, as far northwest as the southern Pilbara.
Comments. Throughout arid areas of central and northern Australia, rock outcrops may
harbour relatively small Gehyra species, typically with rufous colouring and a pattern
including pale spots. The name G. montium has often been applied to many such
populations, but our study reveals that this species only just extends east of the Western
Australian border, to the Tomkinson Ranges and Birksgate Ranges in South Australia.
Our current knowledge suggest that G. montium does not occur in the Northern Territory
nor in most of north-western South Australia. The fact that the species was not
recognised hitherto as extending westward as far as the Pilbara possibly reflects a tacit
assumption that G. montium was a central Australian species, as well as the superficial
similarity of pattern in preserved G. montium and G. variegata.
In the adjacent rocky ranges of north-western South Australia and the south-
eastern Northern Territory, G. montium is shown by our study to be replaced by geckos
of Clades 2 and 1, respectively, and these are described below as new species.
When describing this species Storr (1982) suggested it might represent the 2n=38
karyotypic group of King (1979). However, our and Moritz’s karyotype data show that
90
all populations conspecific with the type population of montium have the 2n=40a
karyotype.
Gehyra minuta King, 1982
See King.
Comments. King described his new species from a small number of localities and more
recent knowledge has not suggested any broader distribution for this species. We did not
have significant sampling of this species and so suggest that until further data prove the
contrary, it should be regarded as an endemic inhabitant of the scattered rocky ranges
centred around Tennant Creek, Northern Territory, and characterised by very small size,
speckled colour pattern, 2n=42a karyotype and restriction to rocky microhabitats.
91
Gehyra moritzi sp. nov
Figure 8: Gehyra moritzi. A) SAMA R65937, Emily Gap, NT. B) SAMA R65935,
Rainbow Valley, NT. C) SAMA R65945 20 km S of Barrow Creek, NT. D) SAMA
R65943, 2 km S of Devils Marbles, NT.
92
Gehyra 2n=44 "nana-montium" Moritz, 1986: p. 48.
Holotype: SAMA R65941, from Emily Gap, East MacDonnell Ranges, Northern
Territory, 23° 44' 23.0" S, 133° 57' 02.5" E, collected by M. Hutchinson, P. Oliver, G.
Armstrong & S. South on 9 January 2011.
Paratypes: 18 specimens in the collections of the South Australian Museum, Adelaide
and the Northern Territory Museum and Art Gallery, Darwin (see supplementary
material).
Diagnosis: Distinguished from other Australian Gehyra by a combination of either
7 or 8 divided scansors under the expanded portion of the fourth toe, small to moderate
size generally two pairs of enlarged chin shields, second or third infralabial notched,
dorsal colour pattern combining pinkish grey to rufous colouring (in life) patterned by
entirely by black and whitish spots, and a karyotype of 2n=44 (Moritz 1986).
Description. Adult snout-vent length 36-49 mm (mean = 42.0 mm, n=19). Length
of tail 38-51 mm (mean = 106% SVL, n=5).
Nostril surrounded by rostral, first supralabial, supranasal and two subequal
postnasals. Either a single internasal scale separates the supranasals above the rostral (9
specimens) or supranasals in median contact (9 specimens). Supralabials 8-10, mode 9.
Infralabials 7-9, mode 8. 2, less frequently 3, pairs chin shields, anterior pair in contact
93
with only the first infralabial. Chin shields separated from the fourth, or third, and
succeeding infralabials by the interpolation of a series of enlarged scales (parinfralabials)
that margin the ventral edge of the infralabials. Third, less frequently second, infralabial
notched where this parinfralabial scale row starts. Scansors under pad of fourth toe
divided, 7-8 (mode 8). Preanal pores in males 11-16 (mean 14.4, n=11).
The karyotype is 2n=44, (pers. obs and Moritz 1986).
In life, dorsally light pinkish grey to reddish brown, the entire dorsal surface
patterned by spots. Dark spots are larger and more irregular, pale spots tend to be more
precisely circular in shape.
Distribution. Rocky mountain ranges of the south-central Northern Territory, centred on
the MacDonnell Ranges and south to the James Range, west to the Kings Canyon area
and north to the Devils Marbles.
Comments. The above description refers to specimens from the central and southern
parts of the species' range. The northernmost sample, from rocky hills south of the
Devils Marbles, is distinctly different in morphology but is not distinguishable by either
DNA sequence data or karyotype. This series of eight specimens is consistently smaller
(largest specimens only 40 mm SVL), males have fewer preanal pores (range 8-11) and
the spotted colour pattern consists of relatively very small spots each covering only a few
dorsal scales. All have seven rather enlarged scansors rather than the 8 usual for the
other populations. For the present we refer this sample to G. moritzi but exclude it from
the paratype series. Further genetic studies of gecko populations along the middle
94
sections of the Stuart Highway would be useful to clarify the genetic relationships among
G. moritzi populations.
The specific name recognises the contribution of Craig Moritz (University of
California, Berkeley) in revealing the high level of karyotypic diversity among central
Australian populations of Gehyra.
Gehyra pulingka sp. nov
Figure 9: Gehyra pulingka. A) SAMA R65248, Umuwa, SA. B) SAMA R61926,
Kurtjuntari Rockhole, WA.
Gehyra 2n=42b "nana-montium" Moritz, 1986: p. 48.
95
Holotype: SAMA R652481, from Umuwa, Musgrave Ranges, South Australia, 23° 44'
23.0" S, 133° 57' 02.5" E, collected by M. Hutchinson, on 25 May 2010.
Paratypes: 16 specimens in the collections of the South Australian Museum, Adelaide
(see supplementary material).
Diagnosis: Distinguished from other Australian Gehyra by a combination of
modally 7 or 8 divided scansors, small to moderate size, generally three pairs of enlarged
chin shields, third infralabial notched, dorsal colour pattern a light to medium brown
dorsum (in life) patterned by a pattern of irregular thin black lines and circular pale spots,
and a karyotype of 2n=42b (Moritz 1986).
Description. Adult snout-vent length 38-49 mm (mean = 43.3 mm, n=14). Length
of tail 43-56 mm (mean = 117% SVL, n=6,).
Nostril surrounded by rostral, first supralabial, supranasal and two subequal
postnasals. Usually a single internasal scale (occasionally 2 or none) separates the
supranasals above the rostral. Supralabials 7-10, mode 8. Infralabials 7-9, mode 8. Three
pairs chin shields, outer (third) pair small or absent in a three specimens, anterior pair in
contact with only the first infralabial. Chin shields separated from the fourth and
succeeding infralabials by the interpolation of a series of enlarged scales that margin the
ventral edge of the infralabials. Third infralabial notched where this parinfralabial scale
row starts. Scansors under pad of fourth toe divided, 7-8 (mode 8). Preanal pores in males
12-16 (mean 13.9, n=7).
96
The karyotype is 2n=42b is unique for this species, differing from the 2n=42a
karyotype via a secondary constriction on pair 11 (Moritz 1986 and pers. obs.).
In life, dorsally light pinkish grey to reddish brown, the entire dorsal surface
patterned by spots. Dark spots are larger and more irregular, pale spots tend to be more
precisely circular in shape.
Distribution. Rocky mountain ranges of the south-central Northern Territory,
centred on the MacDonnell Ranges and south to the James Range, west to the Kings
Canyon area and north to the Devils Marbles.
Comments. Long included in G. montium, G. pulingka is consistently
distinguishable in morphology, karyotype and DNA sequence data. In the field, the
colour pattern of blackish squiggles and prominent spots can be used to distinguish this
species from true G. montium, which has a more continuous black dorsal network and
small, weakly contrasting spots. Additional distinctions in chin shields (3 versus 2) and
higher male preanal pore counts will provide extra support if genetic data are lacking.
The specific name is from the Pitjantjatjara language (Goddard 1996) from the
roots puli, rock, or rocky hill, and the suffix -ngka meaning pertaining to, alluding to the
habits of the species and its distribution confined to the desert areas occupied by the
speakers of Pitjantjatjara and related dialects. Specific name would not change with
gender of the genus.
97
Gehyra versicolor sp. nov
Figure 10: Gehyra versicolor. A) SAMA R-----, New Years Gift Bore, Borefield Road,
SA. B) SAMA R-----, Gregory Creek crossing, Borefield Road, SA. C) SAMA R-----,
New Years Gift Bore, Borefield Road, SA D) SAMA R-----, New Years Gift Bore,
Borefield Road, SA.
Gehyra 2n=40a "variegata", 38b "variegata-montium", Moritz, 1986: p. 48.
98
Holotype: SAMA R51968.
Paratypes: 29 specimens in the collection of the South Australian Museum, Adelaide (see
supplementary material).
Diagnosis: See G. variegata, above, from which G. versicolor is indistinguishable
in external morphology, but is distinguishable by karyotype (2n=40a or 2n=38).
Description. Adult snout-vent length 37-54 mm (mean = 46.7 mm, n=30). Length
of tail 40-58 mm (mean = 110% SVL, n=6,).
Nostril surrounded by rostral, first supralabial, supranasal and two subequal
postnasals. Usually a single internasal scale (occasionally 2 or none) separates the
supranasals above the rostral. Supralabials 8-11, mode 9. Infralabials 7-10, mode 9.
Usually two pairs chin shields, sometimes a small outer (third) pair, anterior pair in
contact with only the first infralabial. Chin shields separated from the third and
succeeding infralabials by the interpolation of a series of enlarged scales (parinfralabials)
that margin the ventral edge of the infralabials. Second infralabial notched where this
parinfralabial scale row starts. Scansors under pad of fourth toe divided, 7-8 (mode 8).
Preanal pores in males 10-14 (mean 11.9, n=15).
Most populations have the 2n=40a karyotype first reported by King (1979), but
our samples from the Macdonnell Rangesd and adjacent southern interior of the Northern
Territory have 2n=38 karyotypes. These specimens branch in at least two distinct areas
of the tree, interspersed with animals from 2n=40a populations, and thus behave as if they
are not genetically different from them.In case further cryptic species are demonstrated
99
among these populations, we have confined our type series for G. versicolor to animals
from 2n=40a populations only.
Distribution. Widespread from the Murray Valley of northern Victoria north and east
through New South Wales west of the Great Dividing Range and similar areas of
Queensland north to about the level of the latitude of Hughenden. Extends west into
most of South Australia, with the exception of the southern and western Eyre Peninsula
and the Great Victoria Desert, and north west into southern and central Northern
Territory. Not currently known to occur in Western Australia. Found in both rocky and
arboreal situations, as well as on human dwellings and other buildings.
Comments. This species is the only one where we find two karyotypic groups appearing
to belong to a single taxon. Moritz reported both 2n=40a and 2n=38 (a and b) from the
MacDonnell Ranges and adjacent central Northern Territory, and at present our data
suggests all belong to a single lineage, our clade 5. As with the variable populations of
G. moritzi, further detailed study combining the same multiple approaches used here are
desirable to clarify the gene flow among these chromosomally different populations.
Similar detailed studies are needed in central and western Queensland to better
understand the distribution and variation of G. versicolor and Clade 4 where they co-
occur, and the potential contact or overlap between G. variegata and G. versicolor in
central western South Australia. However, it is clear that over the great majority of its
distribution this is a single species, consistently different from other Gehyra. Virtually
all of the extensive literature pertaining to “Gehyra variegata” actually applies to this
species.
100
Given the very wide distribution of the species, it is somewhat surprising that no
name appears to be available for it in the synonymy of G. variegata. Cogger et al. (1983)
listed several synonyms of Gehyra variegata. Subsequently, these have proven to be
based on specimens attributable to other Australian Gehyra species groups, especially
eastern species related to G. australis (Bauer and Henle 1994). Other possible synonyms
were discussed by Sistrom et al. (2009) in reference to G. lazelli; none apply to our Clade
5. The specific name chosen here is from Latin root meaning ‘variable in colour’,
appropriate for a species that shows considerable individual and geographic variation.
Acknowledgements
This work was funded by ABRS grant 207-43 awarded to M. Hutchinson and S.
Donnellan. We thank R. Hutchinson, Department of Cytogenetics and Molecular
Genetics, Women’s and Children’s Hospital, North Adelaide, South Australia, for
confirmation of the karyotypes of several populations sampled for DNA comparison. We
also thank P. Doughty and B. Maryan (W. A. Museum, Perth), P. Horner and G. Dally
(N. T Museum and Art Gallery, Darwin) and I. Ineich (Museum Nationale d’Histoire
Naturelle, Paris) for the loan of type specimens and other reference material. We thank P.
Doughty at the Western Australian Museum for providing tissue samples.
101
Estimating species trees and testing evolutionary hypotheses
despite high levels of gene tree discordance in Australian
Gehyra (Reptilia: Gekkonidae).
Mark Sistrom1,2,3
, Mark Hutchinson 2, 3
Terry Bertozzi2 and Steve Donnellan
2,3
1 School of Earth and Environmental Sciences, The University of Adelaide, Adelaide,
Australia 5005.
2 South Australian Museum, North Terrace, Adelaide, Australia 5000.
3 Australian Centre for Evolutionary Biology and Biodiversity, The University of
Adelaide, Australia 5005.
Corresponding author: [email protected]
102
Mark J. Sistrom (candidate)
Corresponding author: Responsible for data collection, analysis and interpretation,
drafted manuscript, produced all figures, oversaw manuscript revision.
Signed…………………………………………………………..Date……………
Mark N. Hutchinson
Sought and won funding, co-supervised direction of study and assisted in selection of
fossil calibrations and assisted in manuscript revision.
I give consent for M.J. Sistrom to include this paper for examination towards the degree
of Doctor of Philosophy.
Signed: Date: 16/09/2011
Terry Bertozzi
Assisted in marker design and assisted in manuscript revision.
I give consent for M.J. Sistrom to include this paper for examination towards the degree
of Doctor of Philosophy.
Signed: Date: 14/09/2011
103
Stephen C. Donnellan
Sought and won funding, co-supervised direction of project, provided assistance in
analysis selection and manuscript revision.
I give consent for M.J. Sistrom to include this paper for examination towards the degree
of Doctor of Philosophy.
Signed: Date: 16/09/2011
104
Abstract
The advent of recent developments in methods of reconstructing species trees are
addressing previous impediments to the estimation of species relationships and timing of
diversification in rapid radiations with high levels of gene tree discordance. Using a
multi-locus dataset, comprising one mitochondrial and six nuclear loci, and undertaking
calibrated species tree estimation, we are able to estimate the species relationships among
Australian Gehyra and test previous hypotheses regarding the evolutionary history of the
group. We find support for previous hypotheses suggesting a recent Asian origin for the
group and the division of it into a large bodied and tropically adapted G. australis species
complex and a small bodied and arid adapted G. variegata species complex, We are
unable to support a previously suggested model for allopatric speciation driven by
chromosomal rearrangement in the group. A Bayesian concordance analysis revealed
high levels of gene tree discordance at various levels within the diverse and recently
radiated Australian Gehyra lineage. Our analysis of the effects of gene tree discordance
and incomplete taxon sampling revealed that gene tree discordance was high whether
terminal taxon or gene sampling was maximized – indicating that high levels of
discordance due to biological processes characterize the group, as is expected in recently
diversified groups of organisms.
105
Introduction
Recent advances in both molecular genetic data acquisition and phylogenetic
analysis have led to an ability to generate significantly more sophisticated phylogenetic
reconstructions than in the past, such as species trees inferred from multiple gene trees
(Heled & Drummond 2010; Kubatko et al. 2009; Liu & Pearl 2007) and time calibrated
phylogenies (Drummond & Rambaut 2007). These new methodological approaches aim
to overcome some of the limitations of traditional phylogenetic reconstruction by better
accounting for discordance between gene trees (Degnan & Rosenberg 2009) and allow
for hypotheses regarding the evolutionary history, timing of speciation and relationships
between organisms to be tested in a rigorous framework.
One of the difficulties in the inference of species trees from multiple gene trees is
overcoming situations in which individual gene trees differ from one another, a situation
that poses significant challenges for traditional methods of combing information from
multiple loci via concatenation (Huang et al. 2010; Kubatko & Degnan 2007).
Discordance between gene trees can be caused by both stochastic (e.g..incorrect gene tree
estimation) and technical (e.g., paralogous sequences) errors (Chung & Ané 2011). A
number of biological processes, such as incomplete lineage sorting (ILS) and horizontal
gene transfer (HGT) are known to create further discordance between gene trees
(Maddison 1997) and with the underlying species tree. Species tree methods represent a
conceptual shift in phylogenetics in that gene tree and species tree estimation are
considered separately. These methods aim to account for discordance between gene trees
in the estimation of species trees but make varying inferences regarding the source of the
discordance (Chung & Ané 2011). In addition to accounting for gene tree discordance,
106
the advent of fossil calibrated phylogenies utilizing multiple genes and individuals for
each species can significantly increase support when linking biogeographic events to the
diversification of species (Drummond & Rambaut 2007; McCormack et al. 2010)
although discordance between gene trees can have an adverse effect on the ability to
estimate rates of divergence and thus, divergence dates (Burbrink & Pyron 2011). It is
because of this ability to deal with certain levels of gene tree discordance, that species
tree methods are also particularly useful for reconstructing the evolutionary history of
recent and rapid radiations which have historically been problematic to reconstruct using
more traditional phylogenetic methods (McCormack et al. 2010; Rowe et al. 2010).
Gehyra, a large genus of geckos from the family Gekkonidae (Han et al. 2004;
Russell & Bauer 2002), currently comprises 36 species, which occupy a wide range of
habitats from Indochina throughout most of Oceania and Melanesia and Australia (King
1979; Russell & Bauer 2002). The Australian Gehyra radiation makes up the bulk of the
group’s diversity with 19 largely endemic species (Horner 2005; Sistrom et al. 2009).
The Australian Gehyra radiation has proven to be taxonomically troublesome in the past,
as considerable karyotypic and allozyme variation does not manifest in easily
recognizable morphological variation. Thus, many species comprise multiple
morphological isolates, distinct chromosome races, allozyme OTU’s and mitochondrial
clades (King 1979; 1982; 1983; 1984; Moritz 1984; 1986; 1992, Sistrom et al. 2009;
Sites & Moritz 1987).
Despite the lack of complete taxonomic resolution of the genus, several
characteristics of the evolutionary patterns and history of Gehyra have been inferred by
past researchers, often with limited levels of empirical justification. King (1979; 1983;
107
1984) summarized many of these assumptions in his work, asserting a recent Asian origin
for Gehyra (King 1984) and supporting the hypothesis put forward by Mitchell (1965)
that the Australian Gehyra form two major species complexes – the Gehyra variegata
complex characterized by small bodied, species associated with the arid regions of the
continent (King 1979) and the Gehyra australis species complex characterized by larger
bodied animals associated with the tropical, subtropical and monsoonal regions of the
continent (King 1983). King (1984) also proposed that radiation within these two
complexes was due to allopatric divergence and chromosomal rearrangement with a
radiation of allopatrically derived 2n=44 chromosome species, followed by a similar
radiation of 2n=42 chromosome species, then by 2n=40 and 2n=38 chromosome species
simultaneously. However, King’s proposal was criticized as somewhat premature given
the incomplete taxonomy of the genus and lack of data relevant to reproductive isolation
of allopatric chromosome races (Moritz 1992; Sites & Moritz 1987).
Using a multi-locus species tree approach we sought to evaluate hypotheses
regarding the evolutionary patterns and history of the Australian Gehyra radiation.
Through the reconstruction of species relationships, we sought to test the hypotheses that
Australian Gehyra originated from Melanesian Gehyra and diversified into two species
groups – the G. variegata and the G. australis species groups (Mitchell 1965; King 1979;
King 1982). The King and Mitchell hypotheses were not enunciated in modern
phylogenetic terms so we restate them as three discrete hypotheses; 1) The Australian
Gehyra result from a single, recent colonization event from a Melanesian ancestor. In this
case, the Australian radiation will form a monophyletic clade, nested within a broader
Melanesian Gehyra species assemblage. 2) The Australian radiation consists of a large-
108
bodied, tropically adapted australis group and small-bodied, arid-adapted variegata
species group, in which case we would expect to find two reciprocally monophyletic
clades corresponding to Mitchell and King’s proposed species complexes. 3) The
diversification of the Australian Gehyra was driven by chromosomal rearrangement in
allopatric populations. If King’s proposal regarding chromosomal speciation is correct,
2n=44 chromosome species would be expected to be oldest, with the origin of 2n=42
chromosome animals being temporally intermediate and 2n=38 and 2n=40 chromosome
lineages being the most recently derived species. We sought to evaluate these three
hypotheses using a combination of species tree reconstruction and molecular dating
methods.
Methods
Sampling
All tissue samples were obtained from Australian museum collections (Australian
Biological Tissue Collection [ABTC] at the South Australian Museum [SAMAR],
Western Australian Museum [WAM]) or sequences were available on GenBank
(Appendix 1 – GenBank accession numbers will be added upon acceptance). DNA
was extracted using a Puregene™ DNA Isolation Tissue Kit D-7000a (Gentra
Systems USA) following the manufacturer's guidelines. Standard PCR methods were
used to amplify the coding region of the mitochondrial gene NADH dehydrogenase
subunit 2 (ND2), portions of the nuclear coding genes recombination-activating gene
1 (RAG1), prolactin receptor (PRL-R), melanocortin 1 receptor (MC1R), the first and
second intron of the histone cluster 3 gene along with the contained exon region (H3)
109
and two anonymous nuclear loci (A1 and A2). Anonymous loci were developed from
the analysis of DNA fragments generated from a partial shotgun library using GS-
FLX 454 sequencing (Roche USA), isolated using the methods described in Bertozzi
et al. (in prep) (A1 and A2). A summary of primers used is provided in Table 1. PCR
products were sequenced using the ABI PRISM BigDye Terminator Cycle
Sequencing Ready Reaction Kit and an ABI 3730 automated sequencer. Sequences
were edited by eye and aligned at first using the Muscle plug-in in Geneious v5.3.1
(Biomatters, New Zealand) (Drummond et al. 2010; Edgar 2004) then refined by eye.
Unalignable regions were determined by eye and excluded from further analysis and
heterozygous sites were coded using IUPAC ambiguity codes.
110
Table 1: Summary of loci used for species tree analysis. Summary statistics were calculated using DNAsp v5.0 (Rozas 2009) Primers
are listed from 5’ end to 3’ end, BP – base pair length of alignment, /site – nucleotide diversity per site, /sequence – Watterson’s
theta be sequence, * after Tajima’s D statistic indicates significance of the statistic to p < 0.05, model refers to the model of nucleotide
substitution chosen for the locus using AIC.
Locus Primer Sequence BP Samples
No
species
No
Haplotypes
GC
content e
Tajima's
D Model Reference
ND2 F:AAGCTTTCGGGGCCCATACC 1049 123 32 110 0.453 0.22 0.14 -0.77 GTR + I + Γ Sistrom et al 2009
R:GCTTAATTAAAGTGTYTGAGTTGC
H3 F:TGGAGCAGGAAARACAACYAT 442 100 32 30 0.453 0.04 0.09 -2.20* TrN + Γ This paper
R:RAGCTCAGACTTYGAAATKCC
PRLR F:GACARYGARGACCAGCAACTRATGCC 526 103 32 20 0.46 0.03 0.08 -2.17* GTR + Γ Townsend
R:GACYTTGTGRACTTCYACRTAATCCAT
MC1R F:GGCNGCCATYGTCAAGAACCGGAACC 608 34 23 19 0.56 0.04 0.05 -0.37 HKY + I Pinho et al 2009
R:CTCCGRAAGGCRTAAATGATGGGGTCCAC
RAG1 F:CTAAGACTGATAAAGAGAAAG 756 24 24 22 0.432 0.01 0.03 -1.82* GTR + I + Γ Sanders & Oliver 2009
R:CTTCACATCTCCACCTTCTTC
A1 F:CCGCTTGAACCGATGGTGCTCT 658 42 20 34 0.432 0.06 0.13 -1.9* GTR + Γ This paper
R:ACGTAACACAGCATGAGTTTTGGAGTG
A2 F:ACGAGCCAGTAACCACTGATCAGGAA 529 42 25 13 0.497 0.03 0.06 -1.90* GTR + Γ This paper
R:CCGTCGTTTGGCCGTCAGAAAT
111
from further analysis and heterozygous sites were coded using IUPAC ambiguity
codes.
Estimation of Rates of Evolution within Gehyra
Divergence times between representatives of major Gehyra lineages were
estimated from the RAG1 data (see Appendix 1) using Bayesian inference implemented
in BEAST v1.6.1 (Drummond & Rambaut 2010). Monophyly of the Gekkotans in
relation to other squamates is well established (e.g. Gamble et al 2010, Oliver & Sanders
2008) and was thus assumed assumed a priori. Model selection was determined using the
Akaike Information Criterion (AIC) carried out using jModeltest v0.1.1 (Posada 2008). A
Yule branching process with a uniform prior was adopted. A relaxed clock was used and
rate variation across adjacent branches was assumed to be uncorrelated. Model parameter
values were unlinked and the analysis run for 50 million generations, with the first 15
million discarded as burn in and every 1000th
tree sampled thereafter. Output was
evaluated using TRACER v1.4.1 (Drummond & Rambaut 2010) to confirm acceptable
mixing, stationarity of the MCMC parameter sampling, and adequate effective sample
sizes (>200). Due to the lack of Gekkotan fossils which can be placed with enough
phylogenetic precision to act as molecular clock calibrations (Gamble et al. 2010; Oliver
& Sanders 2009; Sanders et al. 2007), a number of robust external fossil calibrations were
used. Our chosen calibrations are similar to those of Sanders et al. (2007) and are
summarized in Table 2. All calibrations were treated as being uncertain and given
lognormal distribution, in order to reflect known bias in the fossil record (Sanders & Lee
2007). A liberal, uniform prior of 160 – 250 ma was placed on the base of the tree to
prevent the analysis becoming stuck in an unrealistic parameter space (Drummond et al.
112
2006). The posterior set of trees was summarized using TreeAnnotator (Drummond &
Rambaut 2010) before being visualized using FigTree v1.4.0 (Rambaut 2009).
Table 2: Summary of calibrations used for the dating analysis. A fuller justification for
the use of these calibrations is available in Sanders & Lee (2007). Apart from the basal
split between Gekkotans and the rest of the squamates, all calibrations were given a
lognormal distribution, which has a hard minimum bound slightly younger than the
minimum age of the oldest known fossil, peak probability at the estimated age of the
oldest known fossil and a long tail of possible older dates to reflect known bias in the
fossil record. Dates presented represent the median date and upper and lower 95%
confidence intervals.
Node
Lognormal Prior
Distribution References
Scolecophidians and alethinophidians 97 (92-120) Sanders & Lee 2007
Shinisaurus and Varanus 83 (77-105) Sanders & Lee 2007
Henophidians and caenophidians 93.5 (85-116) Molnar 2000
Iguanians and anguimorphs 168 (155-190) Wiens et al. 2006
Scincomorphs and lacertoids + Toxicoferans 168 (155-190) Sanders & Lee 2007
Gekkotans and other squamates 165 -251 [flat prior] Sanders & Lee 2007
Species Tree Reconstruction and Divergence Estimation within Australian Gehyra
Sampling for the reconstruction of species relationships was based on a total of
123 individuals and the seven genes listed above. Taxon sampling included five
individuals from all recently discovered species (using mtDNA screening, morphological
analysis and species boundary assessment – Sistrom et al. in prep.), all described Gehyra
species, and selected representatives of Melanesian Gehyra (G. baliola, G. barea, G.
membranacruralis, G mutilata and G. oceanica) to determine the phylogenetic placement
of the Australian Gehyra in relation to Melanesian taxaWe undertook locus sampling in a
113
hierarchical manner using faster evolving loci for more detailed individual sampling
compared to markers traditionally used to resolve deeper phylogenetic relationships (see
Appendix 1 for details on the scheme for locus sampling for each individual). Attempts
were made to sequence at least one individual per species for each locus, however where
this was not achieved, data were coded as missing in the input file. Although this
approach considerably increases the MCMC sampling required to reach convergence in
Bayesian analysis and thus computational expense, it allows a sequence to be placed
anywhere in the tree and thus is the most conservative approach to dealing with missing
information from a species. Collecting sequence data in this manner is expected to have a
minimal impact on analytical power (Wiens & Morrill 2011) whilst reducing sequencing
cost. We used a conservative approach in estimating the rate of sequence evolution by
placing a normally distributed prior on the substitution rate of the RAG1 dataset (see
above), taken from the 95% C.I. for rate estimation along each branch among the Gehyra
in the dating analysis.
Bayesian estimation of the species level phylogeny was undertaken using
*BEAST (Heled & Drummond 2010). * BEAST utilizes a single step approach to
simultaneously estimate gene trees from individual sequence alignments and the overall
species tree simultaneously. Substitution models for individual genes were determined
using the AIC carried out using jModeltest v0.1.1 (Posada 2008) (see Table 1) and all
related parameters were estimated in *BEAST. A Yule branching process with a uniform
prior was adopted and a relaxed clock was used and rate variation across adjacent
branches was assumed to be uncorrelated for all gene trees. The mutation rate for the
RAG1 gene tree was given a lognormal prior distribution with upper and lower rates
114
representing the fastest and slowest rates observed in the broader dating analysis as
represented by the 95% confidence intervals of all branches within Gehyra in that
analysis and the mean representing the average of all observed rates within Gehyra.
Model parameter values were unlinked and the analysis run for 100 million generations,
with the first 25 million discarded as burn in and every 10 000th
tree sampled thereafter.
Output was evaluated using TRACER v1.4.1 (Drummond & Rambaut 2010) as for the
higher level analysis. To ensure adequate searching of the parameter space, the analysis
was repeated five times. A maximum clade credibility species tree was produced by
combining the trees remaining after burn in from all runs using LogCombiner
(Drummond & Rambaut 2010) and summarized using TreeAnnotator (Drummond &
Rambaut 2010) before being visualized using FigTree v1.4.0 (Rambaut 2009).
Gene Tree Discordance Analysis
As gene trees inferred from different loci are often incongruent (Chung & Ané
2011; Cranston 2010; Degnan & Rosenberg 2009), it is important to investigate the level
of potential discordance between gene trees. As an initial examination of discordance,
individual gene trees from each of the five *BEAST runs were combined with
LogCombiner (Drummond & Rambaut 2010) and summarized using TreeAnnotator
(Drummond & Rambaut 2010), once 25% of the trees had been removed as burn in. Tree
files were visualized using FigTree v1.4.0 (Rambaut 2009) (Appendix 2).
Like other species tree approaches (e.g., STEM, BEST, MDC), *BEAST accounts
for potential discordance between trees by attributing the discordance between trees to
incomplete lineage sorting (ILS) (Larget et al. 2010). Consequently, if discordance is a
result of horizontal gene transfer (HGT), the method may incorrectly produce a smaller
115
distance between lineages than expected under the coalescent model (Liu & Yu 2011).
This is of particular concern in Gehyra where admixture between species cannot be ruled
out. In order to investigate the role of potential sources of gene tree incongruence, a
Bayesian concordance analysis (BCA) was used to estimate gene tree discordance
(Larget et al. 2010) without making assumptions with regard to the source of that
discordance. Methods for measuring gene tree discordance are still in development and
require congruent sampling of individuals and species across loci (Cranston 2010). In
order to meet this requirement, we used a hierarchical approach to testing our data. As the
RAG1 gene tree has the most minimal sampling, all other gene trees were trimmed to
match RAG1 taxon sampling (n=30). At the next level, A7, A8 and MC1R had similar
sampling, so all gene trees excluding RAG1 were trimmed to have identical sampling
(n=44). Finally, as ND2, H3 and PRL-R all had near complete individual sampling, as a
final step in our hierarchical approach, these were trimmed to have identical sampling
(n=76). Models were determined using the AIC implemented in jModeltest v0.1.1
(Posada 2008) and all model parameters were unlinked. For each tier, individual gene
trees were estimated using MrBayes v3.1 (Ronquist & Huelsenbeck 2003). Each analysis
was run for 15 million generations sampled every 1000 generations. Using the program
mbsum (Larget et al. 2010), tree files from the two chains for each Bayesian analysis
were combined once the first 10% of trees had been discarded as burn in. Once complied,
BUCKy v1.4.0 (Larget et al. 2010) was used to conduct BCA analysis. Each BCA
analysis comprised two independent runs with four chains each for two million
generations sampled every 100 generations. The primary concordance tree for each BCA
analysis was visualized using FigTree v1.4.0 (Rambaut 2009), with the concordance
116
factor (CF) for each node displayed on the tree. If discordance is the result of sampling
method, it would be expected that maximizing either taxon or gene sampling would
increase CFs.
Results
Estimation of Rates of Evolution in Gehyra
The results of the analysis of rate estimation using the RAG1 dataset and a
Bayesian uncorrelated relaxed clock with five external fossil calibrations (Table 2) are
presented in Figure 1. Divergence dates across squamates and geckos were largely
concordant with previous studies (Gamble 2008; 2010; Sanders et al. 2007). This
indicates that date estimates for splits within Gehyra are likely to be reasonable given the
available calibrations. Divergence of G. oceanica from G. australis and G. variegata had
a point estimate of 29.74 ma (95% C.I. 45. 05 – 17.22 ma), and divergence between G.
variegata and G. australis had a point estimate of 11.24 ma (95% C.I. 21.32 – 3.95 ma).
From this analysis we used the average branch rate of evolution of 0.0007 mutations per
year (95% C.I. 0.0002 – 0.0019) for further species tree analyses.
117
Figure 1: Dating analysis using fossil calibrations from Table 2. Node bars represent the
95% confidence interval of divergence dates in years and node labels represent posterior
probabilities. Calibrated node bars are shown in black. Gehyra are shown to be a
monophyletic member of the subfamily Gekkoninae, the split between Australian Gehyra
118
and G. oceanica is shown to have occurred approximately 29.74 ma. (95% C.I. 45. 05 –
17.22 ma.).
Species Tree Reconstruction and Divergence Estimation within Australian Gehyra
The results of Bayesian species tree analysis across Australian and some
Melanesian Gehyra are presented in Figure 2. Overall, posterior probabilities across the
species tree appear relatively low and BCA results confirm a high degree of discordance
in the data. This could indicate uncertainty in the observed species tree and suggests that
interpretations be undertaken with caution. However as our analyses considers a more
extensive parameter space considered by species tree analysis than traditional
phylogenetic analyses (i.e. concatenated Bayesian analysis) and thus the support values
are not directly comparable to those obtained by such methods and “no rule of thumb”
regarding acceptable support values is established. We consider our tree to represent the
best estimate of topology given the data at hand. The species tree analyses (i.e. *BEAST
and BCA) find a basal split of Australian Gehyra into two clades, but the content of the
two groups differs from those proposed by King. Two species, G. occidentalis and G.
xenopus, that were regarded as members of the australis group by King fall in with
members of his variegata group. In addition, one Melanesian species, G.
membranacruralis, branches at the base of our australis group rather than with the other
Melanesian species (G. oceanica, G. baliola and G. barea).
A comparison of the divergence estimates for the basal splits within our revised
G. variegata and G. australis clades revealed near identical estimates: G. variegata – 6.8
ma (95% C.I. 17.8 – 1.9 ma) and G. australis –7.0 ma (95% C.I. 18.0 – 1.9 ma) with
broad overlap of the estimates of splits within each clade (see Fig. 2).
119
Figure 2: Species tree estimation based on one mitochondrial and six nuclear genes
across Gehyra. Terminal labels are Gehrya species names and the numbers in grey
following them represent the chromosome race of species where known. Node bars
120
represent the 95% confidence interval of divergence dates in years and node labels
represent posterior probabilities.
Gene Tree Discordance Analysis
A visual inspection of individual gene trees from the *BEAST analysis reveals
considerable discordance between genes (Appendix 3). Analysis of hierarchically
trimmed gene trees showed CFs (a measure the percentage of gene trees which support a
particular node) were low overall, indicating a high level of gene tree discordance (see
Fig. 3). The deeper relationships between taxa in the BCA analysis at different sampling
levels are considerably variable – further supporting high levels of gene tree discordance.
However, the topology of the species tree attained using BCA and containing all genes
shows a high degree of similarity with the *BEAST species tree reconstruction. The
topologies of these trees support the basal position of the Melanesian species relative to
the Australian species groups and the New Guinean G. membranacruralis, reciprocal
monophyly of the G. australis and G. variegata clades and species membership of each.
121
Figure 3: Results of BUCKy species tree estimation and BCA. a- sampling of 30 individuals and seven genes b – sampling of 44
individuals and six genes c- sampling of 76 individuals and 3 genes. Terminal labels represent Gehyra species and node labels
122
represent concordance factors – a measure of the number of gene trees across the sample
that support a node. CFs were generally low regardless of whether gene or taxon
sampling were maximized.
Discussion
Our results clarify the taxonomic placement of the Australian Gehyra, provide
confirmation of the phylogenetic relationships and the timing of speciation within
Australian Gehyra and quantify the high levels of gene tree discordance observed
within this recent and rapid radiation. The time calibrated RAG1 phylogeny places
Gehyra as a monophyletic group within the subfamily Gekkoninae, consistent with the
current taxonomic nomenclature. The time calibrated RAG1 phylogeny and species tree
analysis show that the Australian Gehyra species are largely monophyletic and nested
with a broadly distributed assemblage of Melanesian Gehyra species.
The exception to this is G. membranacruralis, a Melanesian species from
southern New Guinea, which is nested within the Australian Gehyra clade in the most
probable tree topology. However this relationship is weakly supported (pp=0.45 on the
branch linking it to the australis group, See fig. 2). One possibility is back migration of
an australis group member, but on the face of it this would indicate a species with the
relatively conservative Australian style external morphology re-adopting an extreme
version of the Melanesian Gehyra. morphology (fragile skin, extensive folds of skin on
body and limbs, extremely large size). An alternative could be that G.
membranacruralis is close to the common ancestor of the Australian radiation, such
that the molecular signal on the ordering of the splits between Melanesian and
Australian lineages is relatively weak and noisy.
123
Regardless of the precise branching position of G. membranbacruralis, the basal
split separating the Australian clade from the other Melanesian assemblage occurred
between the mid-Eocene and the early Miocene. Our divergence estimate for the split
between the G. australis and G. variegata clades dates between the early Miocene and
the mid Pliocene. Finally, BCA investigation of gene tree discordance reveals high levels
of discordance between gene trees across the dataset indicating that discordance is due to
biological processes rather than sampling artifacts, but that the general tree shape is
congruent with our other analyses.
Hypothesis 1 - Recent Asian Origin of the Australian Gehyra
Our analyses support previous evidence (Sistrom et al. 2009; Oliver et al. 2010)
that the Australian Gehyra radiation is monophyletic and derived in relation to
Melanesian Gehyra, with the exception of the southern New Guinean species – G.
membranacruralis. As species tree methods differ from traditional phylogenetic
approaches in that they do not employ tree rooting with outgroups (Knowles & Carstens
2007), temporal hypotheses regarding divergence between reciprocally monophyletic
basal groups are not possible to test. However as the Australian Gehyra clade is nested
within a broader, paraphyletic Melanesian assemblage, it is possible to infer,that the
Australian clade is derived relative to other Melanesian taxa. The estimated time of
divergence of the Australian clade from the rest of the Melanesian assemblage covers a
very wide interval, from the mid-Eocene to the early Miocene. This makes attributing a
particular biogeographic event to the introduction of Gehyra to Australia difficult,
however the timing of the split of the Australian clade from the Melanesian assemblage
overlaps with the collision of the Australian tectonic plate with the Ontong Java plateau
124
23-26 ma (Knesel et al. 2008) at a period when Australia was likely to be warm and
humid (Byrne et al. 2008, Martin 2006). Therefore the invasion of a tropically adapted,
ancestral Gehyra from the Asian/Melanesian region at this time is plausible. The
placement of G. membranacruralis within the G. australis clade indicates a link between
Australian and New Guinea that is not unexpected given the long term periodical
connection of the two landmasses throughout the Plio-Pleistocene (Voris 2000). In
contrast with the other Australian Gekkotan lineages which have a Gondwanan origin,
the divergence between Australian and Melanesian Gehyra is more recent (Gamble et al.
2008b; Oliver & Sanders 2009) as is consequently the diversification within Australian
Gehyra.
Hypothesis 2 – Tropically Adapted and Arid Adapted Species Complexes
All of our analyses find two clades within the Australian radiation, as do previous
molecular studies (Sistrom et al. 2009, Oliver et al. 2010). The content of our two groups
mostly matches the subdivision proposed by Mitchell and King. However, it is important
to note that two of King’s australis group species, G. occidentalis and G. xenopus fall
into our variegata clade. Species contained within the initial concepts of the G. australis
clade (Fig. 2) were on average larger bodied taxa (Horner 2005; King 1983) associated
with the tropical, subtropical and monsoonal tropics of Australia and southern New
Guinea, while the G. variegata clade comprised smaller bodied species associated with
the arid and semi-arid zones (King 1979; Moritz 1986). Both G. occidentalis and G.
xenopus are relatively large bodied (maximum SVL greater than 65 mm), both are
confined to the monsoonal Kimberley region of Western Australia, and both branch near
the base of the G. variagata clade. While it is true that many of the members of the G.
125
variegata clade are smaller-bodied than those in the G. australis clade, body size appears
to be somewhat labile in this group with larger species branching close to smaller species.
The one consistent aspect of body size appears to be that the smallest species (max SVL
< 45 mm) are confined to the variegata group, but no general conclusion applies to
medium and larger body sizes. Similarly, the tropical-arid dichotomy is weakened by the
likely plesiomorphic nature of tropical adaptations and the fact that the G. variegata clade
includes tropical species.
Hypothesis 3 – Evaluation of Chromosomal Speciation Patterns
King hypothesized that the diversification of the Australian Gehyra was driven by
chromosomal speciation and proposed a detailed evolutionary scenario by which this may
have occurred (King 1984). However, this scenario came under considerable scrutiny
(Sites & Moritz 1987) due to the inconclusive nature of assumptions regarding the
allopatric distribution of chromosome races and reproductive isolation between them.
Our framework provides a time calibrated, multi-locus framework with which to re-
evaluate this scenario that is considerably more robust than the information that was
available to King (1984). A prediction of King’s (1984) proposed evolutionary scenario,
is that reproductively isolated chromosome races should be arranged phylogenetically in
a linear fashion reflecting their historical divergence. It is clear from the distribution of
chromosome races in our analysis that this is not the case. Furthermore, the placement of
G. occidentalis in the G. variegata clade means that the assumption that the 2n=44
chromosome karyotype is the ancestral state of the Australian Gehyra is questionable.
Given our phylogeny, either the independent evolution of karyotypes (such as 2n=42a) or
reversal (to 2n=44) are necessary to explain the observed karyotypes, but neither
126
phenomenon was countenanced in King’s model. King’s work undoubtedly revealed the
fact of large-scale cryptic speciation in Gehyra, but the mechanism he proposed has not
proven to be a sufficient explanation.
Evolutionary History of the Australian Gehyra Radiation
Based on our analyses, we are able to pose a new scenario for the diversification
of the Australian Gehyra. The paraphyletic relationship with and timing of the Australian
Gehyra clade in relation to Melanesian Gehyra assemblage makes an introduction of the
group to Australia during the collision of the Australian tectonic plate with the Ontong
Java plateau and subsequent close proximity to Melanesia approximately 23-26 ma
plausible. At this time, Australia’s climate was warm, wet and stable (Byrne et al. 2008;
Martin 2006), which would have been ideal conditions for a tropically adapted gecko to
capitalize on newly available habitat. Estimation of the divergence of the G. variegata
and G. australis clades is imprecise, making the inference of a particular biogeographic
event causing the divergence to be difficult. However, the confidence intervals of
divergence estimates between species within each clade show that diversification of both
clades occurred simultaneously over a period ranging from the Late Miocene to the
present, in which the Australian continent has undergone a significant contraction of
mesic habitat and simultaneous expansion of the arid biome (Byrne et al. 2008). As such,
series of complex vicariant and adaptive events are likely to be associated with the
diversification of both groups.
Complex patterns of morphology, chromosomal diversity, evidence of incomplete
lineage sorting and reproductive isolation (Sistrom et al. in prep) indicate that expansion
127
and diversification of Australian Gehyra, particularly in the G. variegata clade is
ongoing. Finally, G. xenopus and G. occidentalis, which are found in the Kimberley
region of northwest Australia, display morphological properties akin to the G. australis
clade, but are phylogenetically members of the G. variegata clade, indicating that this
region could have played a key role in the initial diversification of the two groups.
The Impact of Gene Tree Discordance
Gene tree discordance is problematic for the inference of species relationships
using a concatenation approach (Huang et al. 2010; Cranston 2010; Kubatko & Degnan
2007). Species tree approaches more accurately model uncertainty in the data and thus
are less prone to type 1 error than concatenation approaches, thus making them more
suitable for the estimation of species relationships when gene tree discordance is high
(Chung & Ané 2011; Huang et al. 2010; Kubatko & Degnan 2007). Despite the large
number of samples that we used for species tree estimation, posterior probabilities of tree
nodes are low overall. As such, it is likely that discordance between gene trees accounts
for the low support, consistent with our BCA results (Fig. 3). While increasing both taxon
and gene sampling undoubtedly would improve the power of the analysis, the
hierarchical approach to BCA we have undertaken shows that CFs remain low regardless
of whether taxon or gene sampling is maximized, indicating that in this case, increasing
the density of individual sampling is unlikely to improve analytical power, at least over
the range of sample sizes that we investigated. As *BEAST assumes all discordance
arises from ILS, and HGT is a potential cause of discordance, it is possible that the
distance between species are incorrectly assumed to be shorter than they truly are. For
this reason, our substitution rates are deliberately conservative and thus the error bars
128
surrounding nodes in the species tree are more likely to encompass the true divergence
times of species than a more restrictive prior. Distinguishing between ILS and HGT is a
significant hurdle in the estimation of species trees and the determination of evolutionary
relationship between species and development of methods to distinguish between these
two processes is ongoing (Chung & Ane 2011).
Acknowledgements
This work was funded by ABRS grant 207-43 awarded to M. Hutchinson and S.
Donnellan The authors would like to thank K Sanders and M.S.Y. Lee for advice on
suitable calibrations for divergence estimation, S. Edwards for advice on sampling
design, H. Lainer and D. Edwards for reviewing and improving the manuscript.
129
Morphological differentiation correlates with ecological but
not genetic divergence in a Gehyra gecko.
Mark Sistrom1, 2, 4
, Danielle Edwards3, Steve Donnellan
1, 4 and Mark Hutchinson
2.
1 Ecology and Evolutionary Biology Department, School of Earth and Environmental
Sciences, The University of Adelaide, Adelaide, Australia.
2 Department of Herpetology, South Australian Museum, Australia.
3 Department of Ecology and Evolutionary Biology, University of Michigan, Ann
Arbor, MI, USA.
4 Evolutionary Biology Unit, South Australian Museum, Adelaide, Australia.
Corresponding author: [email protected]
Journal of Evolutionary Biology (in review)
130
Mark J. Sistrom (candidate)
Corresponding author: Conducted field collection, responsible for molecular and genetic
data collection, analysis and interpretation, drafted manuscript, produced all figures,
oversaw manuscript revision.
Signed…………………………………………………………..Date……………
Dan Edwards
Developed and assisted in environmental analytical approach, provided methods for
environmental data collection and analysis and assisted in manuscript revision.
I give consent for M.J. Sistrom to include this paper for examination towards the degree
of Doctor of Philosophy.
Signed: Date:13/09/2011
Stephen C. Donnellan
Sought and won funding, co-supervised direction of project, provided assistance in
analysis selection and manuscript revision.
I give consent for M.J. Sistrom to include this paper for examination towards the degree
of Doctor of Philosophy.
131
Signed: Date: 16/09/2011
Mark N. Hutchinson
Sought and won funding, co-supervised direction of study, assisted in field collection and
assisted in manuscript revision.
I give consent for M.J. Sistrom to include this paper for examination towards the degree
of Doctor of Philosophy.
Signed: Date: 16/09/2011
132
Abstract
Body size affects life history, the ecological niche of an organism and its interactions
with other organisms. Resultantly, marked differences in body size between related
organisms are often an indication of a species boundary. This is particularly evident in
the Gehyra variegata species complex of geckos, which displays differential body sizes
between genetically divergent species, but high levels of intra-specific morphological
conservatism. We report on a Gehyra population that displays extraordinary body size
differentiation in comparison with other G. variegata species. We used morphological
and environmental data to show this population is phenotypically and ecologically
distinct from its parapatric congener G. lazelli and that morphology and ecology are
significantly correlated. Contrastingly, mtDNA analysis indicates paraphyly between the
two groups and allele frequencies at six microsatellite loci show no population structure
concordant with morpho/eco-type. These results suggest either ecological speciation or
environmentally induced phenotypic polymorphism, in an otherwise morphologically
conservative group.
133
Introduction
Body size is one of the most important ecological and evolutionary attributes of
an organism. The size of an organism influences its energetic requirements (Nagy, 2005),
ability to exploit resources (Schluter, 2000) as well as influencing the interactions it will
have with other organisms (Schluter, 2010). Resultantly, differences in body size are the
predominant way in which related organisms can avoid direct resource competition thus
allowing for assemblages of related organisms to occupy an environment (Dayan &
Simberloff, 2005), similarly size selective predation can be a primary organizing force in
a community assembly (Palkovacs & Post, 2009). Body size places important constraints
on how an organism interacts with its environment and the magnitude, manner and
symmetry of its interactions with other species (Schluter, 2000). While, the ecological
impacts of shifts in body size have implications for macro- and micro ecological
interactions, evolutionary changes in body size can also be an important component of
speciation processes.
Differential body size can arise through differential environmental selection,
interspecific interactions or intraspecific phenotypic plasticity (Schluter, 1994).
Differential body sizes between species are hypothesized to have arisen through two
distinct processes (Losos, 1990). The first is character displacement, which is an
evolutionary response to divergent selection pressure (Nagel & Schluter, 1998; Pfennig &
Pfennig, 2010). The second is through pre-mating selection either through divergent mate
selection or reduced hybrid fitness (Rundle & Schluter, 1997, Nagel & Schluter, 1998).
As such, divergent body size can lead to the development and subsequent reinforcement
134
of species boundaries following secondary contact of divergent populations that have
arisen either in sympatry or allopatry.
Studies of model organisms such as Anolis lizards have shown that rapid
morphological change can occur in a very small number of generations when divergent
selection pressure is high (Losos et al., 1997) although the role of phenotypic plasticity in
such adaptation is thought to be significant (Losos et al., 2000). In addition, stickleback
fishes show both ecologically divergent selection and assortative mating in relation to
body size providing evidence for an adaptive shift in body size being fundamental in
recent speciation (Nagel & Schluter, 1998). In species pairs that have undergone recent
and rapid divergence, genome wide divergence would be expected to accumulate at a
slower rate, under the “genomic islands of speciation” model, demonstrated in several
recent studies (e.g., Anopheles - Turner et al., 2005, Mus – Harr, 2006, Drosophila - Ting
et al., 1998). As such, rapid, recent speciation associated with strong diversifying
selection can produce phenotypically distinct species that are not necessarily
differentiated when examined using neutrally evolving genetic markers. As a result of the
important role that body size can play in the development and maintenance of species
boundaries, when a marked difference in body size between populations is observed it is
often a robust indicator of the presence of multiple species, particularly when population
distributions are adjacent or overlapping (e.g. Sota et al., 2000). While some taxa do
display significant intra-specific plasticity in body size within population, this is typically
partitioned by sex as a result of selection on mating systems (e.g., male size
differentiation in frogs - Smith & Roberts, 2003, lizards – Stuart-Smith et al 2007, and
fishes – Gross, 1984; Gross, 1985).
135
Geckos of the Gehyra variegata species complex (King, 1979; King, 1983;
Sistrom et al., 2009) display a number of interspecific body size shifts. Body size (snout-
vent length - SVL) of species within the complex ranges from an average of 45mm in G.
minuta to 79mm in G. xenopus (see Fig. 1). Pairs of sister species can differ by as much
as 17% (G. purpurascens and G. nana) despite displaying size variation between species,
members of the Gehyra variegata complex show a narrow range of variation of body size
within species and no member of the genus is known to include obvious multiple size
classes (King, 1979). In addition to intra-specific conservatism of body size, members of
the G. variegata complex historically have proven taxonomically challenging due to
conservatism in other morphological characters, particularly body shape and scalation
(King, 1979; King, 1983; Moritz, 1986), despite significant genetic and karyotypic
divergence (King, 1979; King, 1983; Moritz, 1986; Sistrom et al., 2009). As such, body
size differences among populations of Gehyra are generally a good indicator of species
boundaries, especially when populations are sympatric.
136
Figure 1: Phylogenetic tree adapted from Sistrom et al. (2009) of the Gehyra variegata
complex showing body size transitions. Body size measurements represent average SVL
of each species (Wilson and Swan 2008) and silhouettes are to scale.
As part of a systematic revision of southern Australian Gehyra, we discovered
a population of exceptionally large and robust Gehyra in the far northern Flinders
Ranges of southern Australia, where two smaller species Gehyra lazelli and G.
variegata also occur (Fig. 2). As substantial body size differences typically indicate
137
different species in Gehyra, we carried out an investigation of the status of this large-
bodied population (henceforth referred to as LP) using both morphological and
genetic data to address the patterns of morphological change.
Figure 2: Representative preserved vouchers of A) G. lazelli [R64427 and R64944], B)
LP [R58254 and R56408] and C) G. variegata [R59379 and R58593] from the Flinders
Ranges, southern Australia showing the variation in body size and robustness.
Through extensive field surveys we sought to determine if LP and G. lazelli occur
sympatrically or allopatrically across a broad distributional area centred on known
locations where LP occurred. At an early stage we became aware of substantial
discordance between morphological data, which tended to confirm the distinctiveness of
LP, and the mitochondrial phylogeny, that indicated no differentiation and in fact seemed
to suggest polyphyly of LP compared to G. lazelli. In this paper, we explore possible
scenarios underlying the discordance between genetic and morphological patterns of
138
variation by assessing morphological, genetic and environmental evidence. Specifically,
we assess if morphological divergence is associated with genetic divergence by testing
for genetic differentiation between the morphotypes using six microsatellite markers,
extended mtDNA screening and karyotype analysis. Further, we determine if the
morphological divergence between the morphotypes is associated with environmental
distinction by testing the levels to which morphological variation could be explained by
variation in climate, elevation, rock-type and vegetation-type. We also examine the
relative merit of alternative hypotheses for the evolution of this pattern, including
allopatric speciation, ecological speciation and phenotypic plasticity.
Materials and Methods
Sample selection and field collections
Field surveys of the Terrapinna Springs and surrounding areas were undertaken in
the Northern Flinders ranges for a total of 3 weeks over the summer of 2008/2009 and
2009/2010, which resulted in the collection of 22 specimens characteristic of LP
morphotype – adults of this form were noticeably larger than surrounding populations of
G. lazelli and G. variegata (Fig. 2), departing from the morphological conservatism
typical of the genus (King, 1979; Moritz, 1986; Sistrom 2009)and was only found granite
gorge and rock outcrop habitats. Frozen and alcohol preserved tissue samples were
deposited in the Australian Biological Tissue Collection (ABTC) and whole specimens
were deposited at SAMA (See Appendix 1 for specimen collection details and museum
numbers – Genbank Accession number and Dryad DOI’s will be added to Appendix 1
following acceptance). Populations of G. lazelli were at most within 5km of LP
139
specimens but were never syntopic. We expanded our G. lazelli sampling to include
specimens collected in the vicinity of the contact with LP, and a representative sampling
across the known distribution of G. lazelli in order to make a comparison with the intra-
specific diversity of G. lazelli.
Figure 3: Collection locations of specimens used for morphological and molecular
140
genetic analyses. Grey circles are collection sites for G. lazelli specimens, black stars are
collection sites for LP specimens. Numbers refer to locality data in Figure 4, summarized
in Appendix 1, site without numbers represent samples for which only microsatellite and
morphological data was collected. Grey contours are at 50m elevation intervals.
Karyotyping
Two individuals collected from Terrapinna Springs (R64103 (female) and
R64104 (male)), both with the LP morphotype, were karyotyped using standard methods
as described in Sistrom et al. (2009) in order to determine the chromosome complement
of the LP individuals.
mtDNA molecular protocols
Genomic DNA was extracted using a Puregene™ DNA Isolation Tissue Kit D-
7000a (Gentra Systems) following the manufacturer's guidelines. The mitochondrial gene
NADH dehydrogenase subunit 2 (ND2) and partial flanking tRNA's (1136 bp) were used
for initial screening to determine the placement of the LP individuals within the broader
Gehyra phylogeny. Mitochondrial ND2 fragments were amplified using the primers
M112F (5'- AAGCTTTCGGGGCCCATACC- 3') and M1123R (5'-
GCTTAATTAAAGTGTYTGAGTTGC - 3'). Amplifications were carried out in 25ML
volumes using standard buffer and MgCl2 concentrations, 0.4 mM dNTPs, 0.2 MM each
primer, 0.75 U AmpliTaq Gold® DNA Polymerase (Applied Biosystems) and
approximately 100ng of genomic DNA. Thermocycler profiles were: 9 min at 94oC, then
45 x: 45 s at 94oC, 45 s at 55oC and 1 min at 72o C with a final extension step of 6 min at
141
72o C. The PCR product was purified using a Millipore Montage® PCR384 Cleanup Kit
(Millipore Corporation) following the manufacturer's guidelines. Standard cycle
sequencing was carried out according to the standard BigDye Terminator (Applied
Biosystems) requirements and cleaned products were read on an Applied Biosystems
3730xl capillary sequencer.
Phylogenetic analyses
Bayesian and Maximum Likelihood (ML) phylogenetic analyses of the ND2 data
were undertaken to ascertain the phylogenetic placement of the LP specimens. The
program jModeltest v0.01 (Posada, 2008) was used to evaluate different models of
nucleotide substitution. The ND2 data were partitioned according to codon position and
corrected-AIC criterion selected the GTR + I + Γ model for all codon positions. ML
analyses were carried out using the RAxML BlackBox web server (Stamatakis et al.,
2008) and branch support was assessed with 1000 bootstrap replicates. Bayesian analyses
were undertaken using MrBayes v3.1 (Ronquist & Huelsenbeck, 2003). For Bayesian
analyses the data were partitioned for each codon position, as described above, with
parameters for each partition unlinked. Four-incrementally heated MCMC chains were
run for five million generations, sampling every 1000 generations, with the first 10%
samples discarded as burn-in. Convergence of posterior probabilities and stationarity of
likelihood scores were confirmed through examination of the trace and effective sample
sizes (ESS) of parameters using Tracer v1.4 (Rambaut & 156 Drummond, 2007).
142
Microsatellite locus development and genotyping
Given the lack of monophyly for mtDNA, the level of genetic distinctiveness of
the LP specimens was examined using microsatellite loci. Microsatellite markers were
developed using a next generation sequencing approach. Total genomic DNA was
extracted from a tissue sample from a single G. lazelli individual (R52962) using the
methods described above. Shotgun sequencing was performed at the Australian Genomic
Research Facility in Brisbane, Australia where samples were prepared according to
standard GS-FLX Titanium Library procedure, with the exception that species-specific
oligonucleotide adapters (IDT, Iowa, USA) were ligated to the sheared DNA, as multiple
species were included in the 454 run. The G. lazelli sample occupied 12% of the plate,
which resulted in 87,899 individual reads of which 2.18% contained microsatellites.
The program MSATCOMMANDER v0.81 (Faircloth, 2008) was used to search
raw sequences for microsatellites with at least eight repeat units and design appropriate
primers. The program MicroFamily (Meglécz, 2007) was used to screen the flanking
regions of the reads selected by MSATCOMMANDER for similarities that would
prevent successful PCR amplification of the fragments in question. Twenty-four primer
pairs were selected for screening across a representative sample of six individuals.
Forward and reverse Multiplex-Ready Technology (MRT) tags were added to the locus
specific primers and loci were amplified using PCR protocols as specified in Hayden et.
al. (2008). PCR reactions were carried out in 12μL volumes, containing of 10ng genomic
DNA and 20nM of forward and reverse locus specific primers.
A total of eight primer pairs amplified successfully and were polymorphic in the
representative sample and these loci were used for full screening across 95 individuals
143
(63 G. lazelli, 22 LP specimens). Gehyra lazelli samples were taken from specimens
collected in the area immediately surrounding Terrapinna Springs and extending across
the distribution of this species. Electrophoresis of amplified products was carried out
using an ABI Prism 3730 Genetic Analyzer (Applied Biosystems) and scored with
GENEMAPPER v3.7 (Applied Biosystems). Two loci proved unscoreable due to a high
level of non-amplification. The primers for the remaining six loci used for further
analysis are documented (Table 1). The six loci used for analysis were checked for null
alleles, large allele dropout and stuttering using MICRO-CHECKER (Oosterhout et al.,
2004). Deviations from Hardy-Weinberg Equilibrium (HWE) and linkage disequilibrium
were investigated using Genepop 4.0 (Rousset, 2008).
144
Table 1: Summary of microsatellite marker properties and variation. The first set of summary statistics is for the dataset as whole and
the second represents the dataset split into the LP specimen cluster (bottom figures) observed for the corrected data and the G. lazelli
(top figures). N is the number of individuals scored for each locus, Ho is the observed level of heterozygosity, He is the expected
heterozygosity under HWE, Fis is the F statistic with the corresponding P value resulting from Fisher’s exact test implemented in
Genepop 4.0 (Rouseet 2008).
Locus Direction/Sequence Length Repeat
unit
N Ho He Fis P Ho He Fis P
Geh1 F-ACCTTGAGGGTCCAGTTGTC 178 – 302 (GT)14 70 0.8 0.93 0.1412 0.007* 0.78 0.91 0.163 0.000*
R-TCAGGTGGAGATGCCAAGG 0.81 0.96 0.088 0.235
Geh2 F-ACCATTAGCTGTTTGTGGATTGC 156 - 348 (AC)15 45 0.89 0.96 0.0795 0.571 0.76 0.92 0.167 0.001*
R-CACAGGCTGGTCCCACAG 0.75 0.93 -0.089 1
Geh3 F-ATGTATCCTTGGTGTCTCCGC 221 – 345 (GT)25 42 0.76 0.96 0.2065 0.004* 0.88 0.94 0.208 0.000*
R-GTGTCTGCCGCTCTTAACC 0.8 0.95 0.195 0.002*
Geh4 F-AAAAAGGGGCAGAGCTCAAG 180 – 338 (ATCT)13 76 0.8 0.93 0.1381 0.000* 0.83 0.91 0.202 0.000*
R-AATGATCCCCTCCTGCCTC 1 0.92 0.017 0.11
Geh5 F-AGCTGTTCAAGGAACGAATGC 160 – 356 (CTTT)14 78 0.86 0.94 0.0862 0.040* 0.76 0.94 0.064 0.001*
R-TGCAGAGGTGGGTAATGGC 0.92 0.94 0.153 0.006*
Geh6 F-ATGACTGGGAGAAAGACAAAGC 195 – 263 (ATCT)15 65 0.78 0.96 0.1718 0.000* 0.81 0.95 0.166 0.000*
R-GCAGGATGATCAGTGCAAGC 0.75 0.9 0.087 0.082
145
Genetic Clustering Methods
An individual-based clustering approach, implemented in STRUCTURE v2.3.3
(Pritchard et al., 2000) was used to determine how individuals grouped into genetic
clusters. This dataset was run with the inclusion and exclusion of loci for which there was
a high degree of missing data. Each STRUCTURE analysis was run for 10 million
generations, with the first one million discarded as burn-in at k ranging from 1-10 with 20
replicates for each value of k. The program HARVESTER (Earl 2011) was employed to
calculate Δk using the approach of Evanno et al. (2005). In this way, we determine the
number of clusters most likely and generated input files for CLUMPP (Jakobsson &
Rosenberg, 2007) so that results from the 20 runs could be combined for visualization
using the program DISTRUCT (Rosenberg, 2004).
Morphology and Ecology
A total of 83 adult specimens were selected for morphological analysis (see list -
Appendix 1), with 19 morphometric and 5 meristic characters measured. Morphometric
data comprised measurements for head length (HL), head width (HW), head depth (HD),
inter-nasal width (IN), inter-orbital width (IO), eye to ear distance (EE), ear to snout
distance (ES), forebody length (FBL), axilla-groin length (AGL), humerus length (HU),
forelimb length (FL), femur length (FEL), hindlimb length (HIL), snout-vent length
(SVL), tail length (TL), mental scale length (ML), mental scale width (MW), rostral scale
height (RH) and rostral scale width (RW). Morphometric measurements were measured
to the nearest 0.5mm using digital calipers. Meristic characters measured included
characters traditionally used to assess species boundaries in geckos, including pre-anal
146
pore counts (PP), and scale counts for supralabial scales (UL), sublabial scales (SL)
lamellae on 4th rear toe pad (LL) and chin shield scales (CS).
All subsequent analyses of morphological and environmental data were conducted
using the R statistical package (R Development Core Team, 2011). Each character was
tested for sexual dimorphism by regressing values for male and female specimens by
SVL (except for SVL which was regressed by HL) using the lm function of the base R
package (R Development Core Team, 2011). The slopes of male and female regression
lines were compared for significant differences using an F test implemented with the
var.test function of the base R package (R Development Core Team, 2011). When slopes
were found to not be significantly different an Analysis of Covariance (ANCOVA) was
carried out on male and female regression lines using the lm function of the base R
package (R Development Core Team, 2011) to determine if sexual dimorphism was
present.
Characters that did not show sexual dimorphism were used to conduct a principal
component analysis (PCA) using the prcomp function of the base R package (R
Development Core Team, 2011). Prior to PCA analyses data were log transformed and
PCA was undertaken with data both uncorrected and with non-meristic traits corrected
for body size (Lleonardt 2000), taking the first principal component (PC) of the
uncorrected analysis as a measure for body size (Marroig and Cheverud 2009).
Using significant PC axes from both PCA analyses, we undertook both model
based and hierarchical clustering on each of the two datasets (i.e., corrected or
uncorrected for body size). This was due to model based clustering providing an estimate
of the most likely number of clusters, and hierarchical clustering being able to provide
147
support values via bootstrapping. For Gaussian model-based clustering we used the
mclust function in R package Mclust (Fraley & Rafterty, 2006). Mclust implements a
Poisson process to handle noisy data, for which an initial noise estimate was obtained
using a nearest-neighbor method implemented by the nnclean function in the R package
prabclus (Hennig & Hausdorf, 2010). For hierarchical clustering we used the pvclust
function in the R package pvclust (Suzuki & Shimodaira 2006) using Euclidean distance
and the Ward clustering method (Ward 1963) with 100 000 bootstrap replicates. To
determine which morphological characters were most important in the clustering
analysis, a discriminant function analysis (DFA) and an ANCOVA were carried out using
the clustering of individuals as the independent variable and the morphological
measurements as the dependent variables using the R package MASS (Venables &
Ripley, 2002). For the ANCOVA, SVL was used as the covariate, except in the case of
SVL for which HL was used. In addition, we constructed classification trees to determine
the most influential parameters in individual assignment to clusters for both corrected and
uncorrected datasets using the cltree function in the R package tree (Ripley, 2010).
Homogeneity was measured using the generalised Gini index (Therneau & Atkinson,
2002 – equation 3) to ensure that the precautionary principle applied and that the
omission errors are fewer than the commission errors where possible. The recursive
partitioning model was run with cross-validation to provide for better accuracy
assessments and therefore better final model fit.
To gain some insight into whether the observed morphological differentiation has
an ecological basis, an analysis of environmental variables for all of the animals used in
the morphological and microsatellite analyses (Appendix 1) was undertaken. ArcGIS v10
148
was used to extract values from the 19 climatic variables available through Worldclim
(http://www.worldclim.org/), a 90m Digital Elevation Model available through Diva-GIS
(http://srtm.csi.cgiar.org/), categorical surface geology and categorical vegetation type
(Geoscience Australia) for each specimen using the Multiple Values to Points tool.
Bioclimatic variables and elevation were standardized (by subtracting the mean and
dividing by the standard deviation) and reduced to PC scores using the methods described
above. The first two principal components were taken as a measure of climatic conditions
in order to avoid autocorrelation between individual climatic variables. As environmental
variables included categorical variables, pvclust cannot be applied due to permutations
being conducted by re-estimation of the distance matrix. As an alternative method, the
daisy function of the R package cluster (Machler et al., 2005) was used to produce a
dissimilarity matrix of environmental data using Gower’s coefficient (Gower, 1971).
Hierarchical clustering of the environmental dissimilarity matrix was implemented using
the Ward method using the hclust function of the R package cluster (Machler et al., 2005)
– as this is the method implemented by pvclust – meaning the methods are comparable
aside from the use of bootstrapping. Classification tree construction was carried out using
the methods described above.
To evaluate the relationship between morphological and environmental variables
full and partial distance-based redundancy analyses (dbRDA) were undertaken. Distance-
based redundancy analysis is a multivariate method that allows testing of the influence of
environmental factors on values in a linearly dependent dissimilarity matrix (in this case,
morphological distance) via permutation testing (Legendre & Anderson, 1999; McArdle
& Anderson, 2001). Partial dbRDA allows for the fitting of covariates to take into
149
account the potential confounding effects of these values. In this case, both genetic
distance and geographical co-ordinates have been fitted in order to account for the
influence of genetic structure and isolation by distance on the relationship between
environment and morphology in partial dbRDA analyses. Geographic distance matrices
were calculated from individual latitude and longitude data using the earth.dist function
of the Fossil package (Vavrek, 2010). Values were standardized using logarithmic
transformation and converted to a continuous rectangular dataset using principal
coordinates analysis via the npcm function of the Vegan package (Oksanen et al., 2010)
for further analyses. A genetic distance matrix of Fst scores was calculated from the 6
microsatellite loci using Genepop 4.0 (Rousset, 2008) Missing values were imputed using
the mean Fst value. The influence of each environmental variable (climate PC1, climate
PC2, elevation, rock type, vegetation type) on the morphological distance matrix was also
tested. All dbRDA analyses were conducted using the ‘capscale’ function of the R
package vegan (Oksanen et al., 2011). The significance of dbRDA analyses was assessed
using multivariate F statistics with 9999 permutations in the ANOVA function of the
base package included in the R statistical Package (R core development team, 2011).
Results
Karyotyping
The diploid number of the two LP specimens karyotyped was 2n=44 and
chromosome morphology was indistinguishable from that of G. lazelli (Sistrom et al.,
2009). As such, LP is not chromosomally differentiated from G. lazelli.
150
Mitochondrial phylogenetic analyses
Results from both Bayesian and ML phylogenetic methods of the ND2 sequences
were congruent. Figure 4 shows the ML phylogram, with asterisks marking nodes with
high support from both phylogenetic methods (ML bootstrap values >70 and Bayesian
posterior probability >0.95). The analysis confirmed that LP specimens are polyphyletic
within two major G. lazelli clades (D and E in Fig 4). These two clades are distributed
broadly throughout the Flinders Ranges and east into western NSW. The southern and
western extent of the G. lazelli distribution falls into 3 other distinct clades (A, B and C),
which are basal relative to clade D and E. Clades D and E are well supported as distinct
however the branching order of these clades is poorly resolved by phylogenetic analysis
of the mtDNA.
151
Figure 4: Phylogenetic ML of preliminary mtDNA screen of LP specimens Stars
represent nodes highly supported by both ML bootstrap support (>70) and Bayesian
posterior probability (>95%). Numbers refer to collection locations (Fig. 2, Appendix 1)
and letters designate major clades referred to in the text. Samples labeled ‘LP” refer to LP
specimens.
152
Morphological Analyses
A basic overview of morphology is displayed in Figure 3. LP specimens show a
significantly larger and more robust body size in comparison with G. lazelli and
sympatric G. variegata, which are similar in body shape and size in comparison. All three
species show considerable intraspecific variation in back pattern, however fixed
differences in color pattern and meristic measurements between G. variegata and G.
lazelli are documented in Sistrom et al. (2009). The average SVL of pre-designated LP
specimens based on geographic location and general body size and shape was 62.7mm
4.83mm. In comparison, the average SVL of G. lazelli samples used in this study was
47.8mm 5.53mm (Fig. 2). Less than half of the specimens had intact original tails and
as such, TL was excluded from further analysis. Sexual dimorphism was detected in HW
and FEL measurements, as a result these were also removed from further analyses.
For the PCA analyses on data not corrected for body size, the first and second
Principal Components (PC) accounted for 69% and 10.0% of the variance respectively,
while each of the remaining components explained less than 5% of the variance.
Hierarchical and model-based clustering both yielded identical individual assignments.
As hierarchical clustering provides approximate unbiased bootstrap values as a measure
of statistical support for clusters, the results of this analysis is presented (Fig. 5). Model-
based clustering yielded two well-supported clusters, with cluster one comprising solely
LP individuals and cluster two comprising a mixture of LP (18% of individuals) and G.
lazelli. Both DFA and ANCOVA indicated a high level of influence due to HL, ES and
SVL, which are measurements that would logically be associated with body size (Table
2). Results of the classification tree analysis showed the most accurate number of groups
153
to be two and SVL to be the most important clustering element, with the misclassification
error at 0.01 (Fig. 5). These results suggest that two size classes of individuals occur in
the data set corresponding to distinct, but not mutually exclusive groups associated with
LP and G. lazelli.
When PCA was carried out on morphological data corrected for body size, the
first four PCs accounted for 32.2%, 18.1%, 14.4% and 5.5% of the variance respectively
(Fig. 5). Hierarchical and model-based clustering both produced comparable results.
Model-based clustering of the size corrected data yielded four well-supported clusters,
one of which contained all of the LP individuals. In the hierarchical clustering R20377, a
sample collected in 1979, was an outlier to allmajor clusters. In addition, two G. lazelli
specimens, R52982 and R51801, fell into the LP cluster. Results of the standardized
corrected cluster DFA and ANCOVA (Table 2) indicated a high level of influence due to
five measurements associated with head shape (mental and rostral scale shape, IO,IN,
EE). Results of the classification tree analysis suggest that the most accurate number of
groups is four, and that SVL and CS are the most important clustering elements, with a
misclassification error of 0.08 (Fig. 5). As all of these metrics are associated with
variation in head shape, these analyses indicate head shape significantly differentiates the
LP cluster.
154
Table 2: Summary of morphological analysis. The first set of data represent the analysis
of data uncorrected for body size and the second set represent results from the analysis of
data corrected for size using equation 13 from Lleonardt (2000), taking the first PC1 of
PCA analysis on uncorrected data as a measurement of body size. Numbered roots are
standardized coefficients of significant canonical roots resulting from DFA. F and P
values are taken from ANCOVA analysis of variables using SVL as the covariant, except
in the case of SVL itself for which HL was used as the covariant.
Uncorrected Corrected
Root 1 ANCOVA Root 1 Root 2 Root 3 ANCOVA
F P F P
Wilk's λ 0.000 0.000 0.000 0.004
Proportion of
Trace 100 0.6263 0.2458 0.1279
DF 79 79 79 79
HL -2.923 28.176 0.000 * 1.333 2.117 -1.991 3.122 0.081
HD 0.356 1.364 0.247 -1.113 -0.412 0.031 0.929 0.338
IO -0.186 1.585 0.212 0.547 -1.036 0.565 14.546 0.000 *
IN 1.237 0.677 0.413 -0.206 -1.235 1.830 17.832 0.000 *
EE 0.260 4.628 0.035 * -0.036 0.651 0.287 5.580 0.021 *
ED -0.086 3.237 0.076 -0.357 -0.554 0.111 2.882 0.093
ES -1.877 23.213 0.000 * 0.746 -0.323 -2.072 3.268 0.075
FBL 0.726 3.856 0.053 -0.699 0.045 -0.043 0.397 0.531
AGL 0.817 1.340 0.251 -0.630 -1.740 0.271 2.468 0.120
SVL 2.045 8.204 0.005 * -3.043 0.062 1.956 12.702 0.001 *
HU -0.501 0.563 0.456 0.359 -0.057 -1.218 0.004 0.950
FL -0.427 13.938 0.000 * 0.198 -1.184 0.201 0.778 0.381
HI 0.013 2.308 0.133 -0.804 0.410 -0.470 0.484 0.489
ML 0.341 1.056 0.307 -0.329 -0.224 0.444 6.310 0.014 *
MW 0.261 0.020 0.889 0.019 -0.883 0.901 26.057 0.000 *
RW 0.137 1.959 0.166 0.794 -0.130 0.529 13.796 0.000 *
RH -0.224 2.976 0.089 1.536 0.253 -0.254 13.837 0.000 *
SL 0.083 0.733 0.394 -0.508 1.154 -0.651 0.264 0.609
UL -0.035 0.052 0.820 0.901 -0.927 -0.485 1.479 0.228
CS -0.226 7.493 0.008 * 0.669 1.824 0.429 2.047 0.157
LL 0.206 0.847 0.360 0.621 0.973 -0.370 0.360 0.550
155
Figure 5: Dendrograms produced by hierarchical clustering of Euclidean distances from
PCA scores of the morphometric data on specimens A) not corrected for size, and B)
corrected for body size. Asterisks indicate nodes with high approximate unbiased
bootstrap support (>70). Grey highlighting designates LP specimens, with G. lazelli
individuals un-highlighted. The height scale represents within-dataset Euclidean distance.
Notations are the results of classification tree analysis which looks for the parameter in
156
the dataset which groups individuals into the designated clusters most accurately, SVL –
snout-vent length, CS – chin shield scale count, measurements are based on corrected and
scaled values.
Genetic clustering
Microsatellite loci were free of deviation from HWE due to stuttering, null alleles
and large allele dropout, however a heterozygote deficiency was detected in all loci when
G. lazelli and LP specimens were combined (see Table 1). When samples were separated
into two groups based on morphological assignment to group (uncorrected analysis), four
of the six loci in the LP group conformed with HWE, but all loci in G. lazelli group
significantly departed from HWE. This result could be caused by several genetic
populations represented within G. lazelli (i.e., a Wahlund effect) however genetic
structure within LP and G. lazelli warrants further investigation. The STRUCTURE
analysis indicated that a single cluster (Δk=1) had the highest likelihood. In order to show
the lack of genetic structure corresponding to morphology, STRUCTURE results from
the K=2 analysis are visualized in Figure 6.
Figure 6: Structure output when results for K=2 are visualized. Numbers represent
specimens of G. lazelli characteristic morphology (1) and LP (2). No structure
157
corresponding with morphology is evident from the analysis.
The relationship between ecology and morphology
In the PCA analysis of the environmental data, the first two PC scores accounted
for 53.4% and 32.0% of the variance respectively. Clustering of individuals based on
ecological data (Fig. 7) yielded four major clusters. LP specimens fell into two of the four
clusters, with 17 individuals from nine locations in one cluster (along with four G. lazelli
individuals from 3 locations) and five from two locations in a second cluster (along with
14 G. lazelli individuals from 4 locations). Results of DFA and ANCOVA carried out
using environmental data (Table 3) show a high level of influence due to climate PC1,
elevation and geology. The classification tree analysis showed the most accurate number
of groups to be four with geology, elevation and vegetation type to be the most important
clustering elements, and a misclassification error of 0.05 (Fig. 7). In contrast,
classification tree analysis using assignment to cluster, based on corrected morphological
data as the response variable and environmental dissimilarity as the predictor, found that
vegetation type and geology were the most important clustering elements. This
contradicted an anecdotal field observation that rock type might be an important factor,
however the misclassification rate was relatively high (0.28). The results of dbRDA
analysis showed a significant correlation between morphological distance and climate
PC1 – dominated by a mix of precipitation and temperature variables (results not shown),
elevation, rock type and vegetation type, which remained significant when genetic and
geographic distance were used as covariates (Table 4). This result strongly supports a
correlation between morphological distance and environmental variables.
158
Table 3: Summary of the environmental analysis. The numbered roots are standardized
coefficients of significant canonical roots resulting from DFA. F and P values are taken
from ANCOVA analysis of variables using climate PC2 as the covariate, except in the
case of climate PC2 itself for which climate PC1 was used as the covariate.
Root 1 Root 2 Root 3 ANCOVA
Proportion of Trace 0.7363 0.1659 0.0978 F P
P 0.000* 0.001* 0.02*
DF 79 79 79
Climate PC1 -0.888983321 -1.254541176 0.203014541 19.97 0.000*
Climate PC2 -0.26919125 0.848787353 0.463819838 0.92 0.34
Elevation 0.066624143 1.182484706 -1.761558243 8.23 0.006*
Geology 1.673184893 -0.303018824 0.41957223 490.22 0.000*
Vegetation -0.54852125 -0.428909118 0.647961419 0.89 0.35
Table 4: Summary of dbRDA analysis, testing for correlation between environmental
measurements and morphological distance. F and corresponding P values are presented
for each environmental variable when no covariate is used, when a genetic distance
matrix based on Fst is used and when a geographic distance matrix based on longitudinal
and latitudinal co-ordinates is used. 19 bioclim variables were used but condensed to two
principle components to avoid autocorrelation. A significant correlation between
morphology and Climate PC1, elevation, rock type and vegetation type was found, which
was not affected by correction for genetic or geographic distance.
No co-variate Genetic distance Geographic distance
F P F P F P
Climate PC1 18.92 >0.0001** 19.22 >0.0001** 16.52 >0.0001**
Climate PC2 1.35 0.24 1.22 0.279 0.14 0.852
Elevation 8.91 0.001** 8.68 0.002** 4.28 0.031*
Rock type 4.71 >0.0001** 4.63 >0.0001** 3.74 >0.0001**
Vegetation type 2.96 0.004** 3.05 0.003** 3.69 0.001**
159
Figure 7: Dendrogram produced by hierarchical clustering of Euclidean distances from
PCA scores of the environmental data. Grey highlighting designates LP specimens, with
un-highlighted samples being G. lazelli samples. The height scale represents within-
dataset Euclidean distance. Notations are the results of classification tree analysis which
looks for the parameter in the dataset which groups individuals into the designated
clusters most accurately, elev – elevation, lith – rock type (a – igneous felsic intrusive, f –
feldspar, g – argillaceous detrital sediment, j – sedimentary carbonate, k – sedimentary
siliciclastic, m – metamorphic, x - regolith), veg – vegetation type (a - Casurina, b –
Eucalyptus, c – Chenopodiaceae, d – Melaleuca, f – Acacia and x – other).
Discussion
Gehyra lazelli and the LP are significantly morphologically divergent with both
body size and head shape being important distinguishing characteristics. The two
morphotypes also utilize different environments, with climate, elevation, vegetation and
geology all playing a role in distinguishing their habitats irrespective of geographic or
160
genetic distance. Under the assumption that the morphological variation has a genetic
basis, the morphological features together with the evidence that a new distinct habitat
has been selected collectively would have uncontroversially resulted in the description of
LP as a separate species. In stark contrast, the mitochondrial and nuclear markers did not
show any evidence of population divergence. This result is complemented by the lack of
chromosomal differentiation between the two groups. In particular, the polyphyly of LP
and G. lazelli mtDNA sequences is striking as LP sequences are distributed broadly
within the two major clades (D and E) that are found only in the arid zone. This finding
implies that the relationship between the two morphotypes is characterized by either
widespread admixture, the retention of ancestral polymorphism over a considerable
period of time, or a very recent adaptive shift in body size associated with the occupation
of differential habitats.
Morphological and ecological, but not genetic disjunction between LP and G. lazelli
The presence of the distinct LP morphotype provides prima facie evidence for the
presence of evolutionarily distinct lineages potentially representing two distinct species,
as variation in phenotypes can often represent the first step in adaptive speciation (Herrel
et al., 2001). Morphological evidence supports the differentiation of the two groups based
on phenotype, as does evidence provided by an analysis of the broad environmental
conditions occupied by the morphotypes. A strong, positive correlation between
morphotype and climate, elevation, vegetation and rock type is indicative of an adaptive
basis to the differentiation and is a good indicator that the two morphotypes represent
distinct species, as is the case for many examples of adaptive divergence in lizards
(Herrel et al., 2008), fishes (Nagel & Schluter, 1998; Langerhans et al., 2003) and birds
161
(McCormack & Smith, 2008). However, the conflicting evidence provided by mtDNA,
microsatellite and chromosomal data indicates that this explanation is not as
straightforward as might be expected. Differential morphotypes within a species are
common, however, this is not a condition known from Gehyra, which is a genus
characterized by low morphological variation within and between species, particularly in
body shape and size (King, 1984).
Mechanisms resulting in differential body size
Both body size (Camargo et al., 2010; Higham & Russell, 2010; Hibbitts et al.,
2005) and head shape (Thorpe and Baez 1987, Vanhoonydonck and van Damme 1999,
Daza et al. 2009), which are the main phenotypic traits that differentiate LP from G.
lazelli, have been characterized as adaptive morphological traits in lizards, including
geckos. This suggests that the divergence between the LP and G. lazelli is adaptive in
nature, which is supported by the significant differences in the habitats utilized by each
morphotype (Fig. 6). Theory suggests that adaptively divergent populations would be
able to exploit differentiated ecological niches and thus exist in sympatry (Schluter,
2000). Such fine scale partitioning based on body size and locomotive performance has
been observed in Anolis lizards (Carlsbeek & Smith, 2006), benthic and limnetic
partitioning of large and small stickleback fish species (Nagel & Schluter, 1998) and
divergence of body size generated due to the availability of cover from predators in
cichlid fishes (Takahashi e.t al, 2009).The parapatric distribution of the two groups
indicates that if adaptation is the cause of the morphological divergence, the ecological
niches are geographically disjunct. Even though lithology is not identified as a major
factor separating LP from G. lazelli in the classification tree analysis, it is notable that LP
162
specimens obligatorily occur on the Terrapinna granite unit, unique to the upper region of
the Flinders Ranges (Neuman, 2001) and no G. lazelli samples have been found on this
granite unit. Field observation suggests that this rock unit is characterized by very large,
continuous rock faces with sparse, but deep fissures which act as refuges for the geckos.
This contrasts with the surrounding rocks, which are far more fissile and provide a habitat
with far more refugia and fewer open faces where extensive searching failed to yield LP
specimens. This distinct geology has implications for many ecological parameters such as
thermoregulatory parameters, surrounding soil type, prey availability and predation
pressure and may have resulted in divergent selection for body size. Also, examination of
rates of tail loss in LP specimens (70% of observed specimens) and G. lazelli (40.4% of
observed specimens) provides a preliminary indication that predation or aggressive
within species interactions may be higher in LP specimens, however a more thorough
investigation beyond the scope of the current study would be required to make more than
a speculative suggestion regarding predation rates.
Evolutionary explanations for the maintenance of body size differentiation
The lack of correspondence between morphotype and genetic structure suggests a
scenario in which divergent phenotypes representing allopatric divergence and secondary
introgression is unlikely. Under an allopatric scenario, divergence in microsatellite loci
would be expected, and given the prevalence of differentiating chromosomal states in
closely related Gehyra species (King, 1979; 1983; Moritz, 1986; 1987) a difference in
karyotype might additionally be expected. The fact that morphotypes are distributed in
adjacent but differentiated environmental conditions provides strong evidence that the
163
nature of morphological divergence is adaptive. Further, considering the lack of support
for an allopatric model of divergence, divergence has likely been ecologically driven in
sympatry. While the loci used in this study have the ability to detect recent divergence in
most scenarios, in some cases of very recent divergence they have not (e.g. Elmer et al.,
2010) and would not be expected to under a “genomic islands of speciation” model of
divergence where differentiation only occurs in genes undergoing selection (Turner et al.,
2008). Lack of differentiation in the genetic data means it is not possible to distinguish
between incipient speciation with recent adaptive divergence and phenotypic plasticity
within a single species. Some species do show sympatric, intra-specific dimorphism of
body size in relation to predation (Takahashi et al., 2009) and sexual strategy (Smith &
Roberts, 2003; Stuart-Smith et al., 2007), however in most cases of size dimorphism
related to sexual strategy there is a sexual bias to size classes which is not present in this
case.
While it is unclear from our data whether or not introgression has occurred
between the two groups due to the fact no population differentiation was discerned, the
potential for hybridization between them exists. The maintenance of differential
morphotypes through reduced hybrid fitness (Rice & Pfennig, 2010) could act to
reinforce an already established morphological divergence. Conversely, introgression has
the potential to be facilitating the reproductive absorption of the LP morphotype and thus
it may disappear through the process of hybridization (Rhymer & Simberloff, 1996). As
the role of interbreeding between the two morphotypes could be having significant
opposite effects on the process of continued differentiation, this is an interesting and
significant facet of this system to be further explored.
164
Acknowledgements
This work was funded by ABRS grant 207-43 awarded to M. Hutchinson and S.
Donnellan. The authors thank the Sheehan and Sprigg families for access to private
property for the collection of material and Hailey Lainer, Kate Sanders and Paul Oliver
for reviewing and greatly improving the manuscript. Specimens collected in the field
were collected under South Australian Dept. of Environment and Natural Resources
Permit #C25661-1 and ethics permit #41-2008.
165
General Discussion
As this thesis is presented as a series of papers, each with its own discussion of
specific findings, the general discussion addresses the broader impacts of my work
with respect to the overall aims of my thesis, and highlight the likely directions of
future evolutionary and systematic studies on Australian Gehyra.
Summary of Aims
My thesis aimed to examine species diversity and patterns of speciation in Australian
Gehyra. In particular it aimed to: 1) Explore the adequacy of current taxonomy in
accounting for species diversity in the group and improve it where necessary. 2)
Evaluate previously proposed evolutionary scenarios for the diversification of
Australian Gehyra and propose a comprehensive evolutionary history of the group. 3)
Examine possible processes of speciation in Australian Gehyra.
The taxonomic status of Australian Gehyra and species delimitation.
Chapters 1 and 2 confirm the findings of past researchers (King 1979; 1982a; 1984;
Moritz 1984; 1986) in that the underlying genetic diversity of the Australian Gehyra
radiation is not accounted for by the current taxonomy and as such the current
taxonomy of the group does not adequately characterize the diversity of the group.
My research has begun to address this by formally describing the long known to be
distinct 2n=44 chromosomal race of G variegata (Chapter 1) and the re-description of
G. barea (Appendix 2). In addition I have undertaken a thorough, integrative analysis
of the genetic, geographic and morphological diversity of central Australian Gehyra
166
(Chapter 2). My study revealed that patterns of morphological, genetic and
geographic distribution are complex and in many cases, conflicting - presenting
significant and ongoing challenges to delimiting and describing species. Despite these
challenges, my study presents information allowing for a considerably better
understanding of the morphological variation and geographical distribution of
currently recognized species and identifies five additional putative species and
presents evidence for the distinction of their respective evolutionary histories under
the general lineage concept (De Quieroz 2007).
As such, my thesis has considerably increased the taxonomic understanding of
southern Australian Gehyra, both by increasing the taxonomic resolution of the group
and by highlighting the significant and ongoing challenges in describing the group
given the conflicting nature of delimiting characters in the group.
Species Relationships within Australian Gehyra
The relationships among Australian Gehyra species have been inferred by past
researchers (King 1979; 1984) despite significant data and methodological restrictions
(Mortiz 1992, Sites & Moritz 1987). Significant advances in data acquisition and
methodology allowed me to revisit the evolutionary history of Gehyra both to test
existing hypotheses and with a much larger level of confidence, infer the evolutionary
history and species relationships within Australian Gehyra. In chapter 3 I conducted a
multi-locus species tree estimation using external fossil calibrations in order to both
test previous theories regarding the species relationships and evolutionary history of
167
the group and in light of the newly available evidence, suggest likely scenarios for the
diversification of the group.
As such, we were able to confirm a relatively recent Asian origin for the group,
coinciding with the collision of the Australian and Java-Ontong tectonic plates and
monophyly of Australian Gehyra in relation to Asian and Melanesian species
indicates a single colonization event. Reciprocal monophyly of the previously
identified G. australis (Mitchell 1965, King 1979) and G. variegata (Mitchell 1965,
King 1982) groups indicates that these represent morphologically and ecologically
distinct species complexes are distinct evolutionary lineages rather than the product of
adaptive convergent evolution, and diversification of both complexes has been
ongoing since their divergence occurred in the late Miocene.
Further to this, by applying karyotypic data to the phylogenetic framework I have
developed, I am unable to support previously suggested scenarios of speciation driven
by chromosomal rearrangement in allopatry (King 1979, King 1984) and suggest that
while in some cases chromosomal rearrangement may be a factor in the maintenance
of species boundaries once acquired, they represent secondary characters of
divergence.
Modes of Speciation in Australian Gehyra
Further to the rejection of models of chromosomal speciation driving diversification
of the group, the complex geographic patterns of variously overlapping and allopatric
168
genetic and morphological diversity revealed in chapter 2 indicate that equally
complex and diverse modes of diversification are involved in the speciation of
Australian Gehyra. In particular, this is the case for G. variegata complex in the
Central Ranges region.
The complex and contrasting patterns of morphological divergence and crypsis in
both sympatric and allopatric lineages suggest that both ecologically driven adaptive
speciation and allopatric speciation due to vicariance are likely to play roles in the
diversification of the group.
In chapter 4, I investigated a particular case study of morphological and ecological
divergence between adjacent populations of Gehyra in the northern Flinders Ranges,
which contrasts with an observed lack of genetic divergence. We characterized the
morphological and ecological divergence between G. lazelli and a large bodied
population only found at the northernmost extremity of its range – which displayed a
morphology similar to the tropically adapted G. australis species complex. A lack of
any detectable genetic differentiation between G. lazelli and the large bodied
population in mtDNA and microsatellite markers indicates that the large bodied
population represents either environmentally driven morphological plasticity in G.
lazelli or an extremely recently evolved species – characterizing potential importance
of ecologically driven adaptive speciation in the diversification of the Australian
Gehyra.
As such, the modes of speciation that have resulted in the diversification of Gehyra in
Australia are likely to be complex and challenging to elucidate, but the complexity,
169
apparent diversity and recentness of speciation events evident in the group indicate
that such studies could be exceptionally useful in furthering broader studies of the
process of speciation.
Limitations
Unexpected levels of complexity
Whilst it was expected and indeed one of the premises for undertaking the study, the
level of diversity and complexity uncovered by initial phylogenetic screening was
considerably higher than expected. Screening of the areas such as the Central Ranges
and Kimberley Plateau revealed that the current taxonomy accounted for less than half
of the potential species diversity of these regions. In concert with the unexpectedly
high diversity, an assessment of museum samples revealed extremely high rates of
misidentification – up to 50% of specimens were discovered not to be representative
of the species assigned to them in some cases; a situation was ubiquitous across
institutions and collectors. This issue had a number of effects on the study that were
not foreseen until it had begun, the first of which was that the identity of tissue
samples without corresponding voucher specimens were of limited value due to the
low reliability of their identifications. The second was the realized importance of
having typotypic material to assess the status of currently named species, which
involved additional field collection and sequencing effort. Finally, the level of
sampling to establish a basic understanding of the diversity of the group was more
extensive than expected.
As such, it became apparent that the scope of the project in terms of budget and time
170
was not sufficient to comprehensively evaluate the diversity of the entire complex, as
such my delimitation studies were scaled back to only evaluate the Central Ranges
and south-eastern Australia. I have identified the Kimberley and the Pilbara regions as
areas in which diversity is in need of further evaluation.
Sampling
Despite extensive sampling of Gehyra across Australia, sampling in the remote
northern regions of the continent – notably mainland areas of the Kimberley, northern
deserts, Arnhem Land and Cape York is too poor for any reliable assessment of
Gehyra diversity in these regions, especially in light of the unexpected diversity of the
group and broader patterns of increased biodiversity in these regions (Moritz et al.
unpublished data). Clearly, extensive collection of vouchers and matching tissue
samples is required across much of northern Australia for an adequate continent-wide
assessment of Gehyra diversity.
Marker Acquisition
The acquisition of nuclear markers is a long-standing difficulty in undertaking multi-
locus studies of non-model organisms (Thomson et al. 2010). However emergent next
generation sequencing technologies are providing the technological basis for
financially and temporally feasible acquisition of larger numbers of nuclear markers
than ever before (Thomson et al. 2010). I undertook two novel methods of nuclear
marker development. In the first, I aligned cDNAs from Gekko japonicus available on
Genbank with orthologues from the Anolis genome in an attempt to identify exon
171
bound introns with which to develop exon primed, intron crossing (EPIC) loci.
Unfortunately the evolutionary distance between the marker source (Gekko japonicus)
the reference (Anolis) and the target (Gehyra) was great enough that this method only
developed a small number of loci and despite significant effort, only one of these – a
H3 Histone intron reliably amplified across Gehyra. For the second method, I used
GS-FLX 454 genomic shotgun sequences, BLASTed against themselves and
GenBank nucleotide sequences to identify putative non-coding markers. This
generated over 5500 potential loci, but due to financial and time constraints I only
tested 11 primer pairs, which yielded two reliably amplifying, highly variable loci.
If I had of undertaken the second method of marker discovery in place of the first, it
would have been likely that my suite of useful nuclear loci would have been
considerably larger and obtained in a more cost effective manner. As the availability
of next generation sequencing with increasing depth and coverage increases and the
cost decreases, similar methods are likely to become more effective in the future.
Broader impacts of study
Biodiversity
My work includes the description of four novel species, three potential species worthy
of further investigation and considerably clarifies the diversity represented by existing
species names. As a result, this work adds significantly to the knowledge of Australian
biodiversity, particularly in south eastern Australia and the central arid zone.
Knowledge of basic biodiversity is a fundamental and key to a large variety of
downstream scientific studies, general knowledge and conservation policy formation
172
and thus has wide ranging impacts. The identification of new species and areas
worthy of further investigation in Gehyra assist in the identification of both
biogeographic regions and taxonomic groups for which this basic data is lacking and
thus allows for more informed decisions on where to direct future efforts for
understanding Australian biodiversity. Finally, my work highlights the need for
considerable additional sampling across northern Australia. The high level of
misidentification I discovered during my studies shows that our basic knowledge of
this group is not at a level where definitive field identification is possible and thus
resolving taxonomic and biodiversity issues will require additional specimen
collection.
Contrast to other Australian radiations
Many well-known and well-studied Australian organismal groups have Gondwanan
origins and as such, are relatively ancient, e.g marsupials (Beck 2008), diplodactyline
geckos (Oliver & Sanders 2008), crayfish (Toon et al. 2010), casuarinas (Crisp et al.
2004), which contrast with more recently arrived lineages originating in Asia, e.g.
agamids (Hugall & Lee 2004), skinks (Skinner et al. 2011), rodents (Rowe et al.
2008), chenopod shrubs (Crisp et al. 2004). My studies show that Gehyra represent an
ideal comparative group for evolutionary and biogeographic studies. Chapter 4
represents a comprehensive species tree reconstruction characterizing the evolutionary
history of the Australian Gehyra providing enough information for the group to
significantly add to comparative studies of biogeography which contrasts Gondwanan
radiations such as the diplodactyline geckos (Oliver & Sanders 2008) and can be
compared with other recent Asian colonizers such as the agamids (Hugall & Lee
173
2004) and skinks (Skinner et. al. 2011) in terms of speciation rates, modes and causes.
In addition, my studies show Gehyra to be a promising group for speciation studies,
particularly in relation to arid zone radiations, with the likelihood that a variety of
speciation drivers have influenced the diversification of the group as evidenced by the
role of ecological divergence shown in Chapter 5.
Conservation
My studies have a number of implications regarding conservation research and policy.
The first and most significant is the confirmation or discovery of a number of species
displaying restricted ranges. The first is G. minuta, which the comprehensive
screening in Chapter 3 confirms as restricted to rocky ranges near Tennant Creek. The
newly discovered G. moritzi and G. pulingka represent species restricted to the
MacDonnell Ranges and the Central Ranges respectively and thus previously
unknown units of diversity to consider in future conservation assessments. The most
startling discovery in terms of short-range endemics within Gehyra is the large-bodied
population in the Northern Flinders characterized in Chapter 5. This potential species
appears to be restricted to a region of 80km x 20km which is currently being
considered for rezoning with respect to mining activity (PIRSA 2009). As a result, this
potential species represents an important conservation concern. Finally, G. variegata,
previously considered to be a single species with a continent wide distribution has
been shown to be two species – G. variegata and the newly discovered G. versicolor
with large but much smaller than previously thought ranges, and thus represent
distinct entities regarding conservation.
174
Future directions
Taxonomic Resolution
My work has provided a comprehensive framework by which the geographic
distribution and genetic and geographic diversity of all currently described species is
characterized and thus it allows for the rapid identification and characterization of
putative new taxa. Preliminary genetic screening has shown the Gehyra of the
Kimberley region of northwestern Australia to be complex – with several (10-15)
putative undescribed species. In addition past allozyme screening (Adams –
unpublished data) and mtDNA phylogeographic studies (Pepper – pers. comm.) have
identified significant levels of undescribed diversity in the Pilbara region of Western
Australia complimented by high levels of morphological diversity currently
recognized as the G. punctata complex (Doughty – pers. comm.). It seems likely that
future taxonomic work should focus on these under-investigated centers of Gehyra
diversity. It is of important note however that many regions of northern Australia such
as the Arnhem Plateau, Cape York and the northern deserts suffer severely from
under-collection of both voucher specimens and tissues critical to the evaluation of
taxonomic diversity.
Integrative Species Delimitation
Recent conceptual and methodological developments (De Quieroz 2007, Yang and
Rannala 2010, O’Meara 2010) have allowed for integrative detection of species under
the general lineage concept using a diverse array of evidence for the independent
175
evolutionary history of lineages. However, a current gap in methodology exists in that
a truly integrative framework for delimiting species is not yet available. Analytical
development in species delimitation, particularly for difficult groups like the
Australian Gehyra radiation is needed to step beyond a priori methods of identifying
putative species and the assignment of individuals to them in situations where patterns
of diversity are conflicting and complex, as trying to interpret these patterns
individually will inevitably lead to scientists making errors in both species detection
and the assignment of individuals to species. The use of comparative distance
matrices in an integrative framework has the potential to do this when used in
conjunction with validation methods such as BPP (Yang & Rannala 2010). Complex
systems where species are inherently difficult to delimit – such as the Australian
Gehyra radiation present both the motivation to develop these methods and ideal
models to test their efficacy.
Speciation Studies
As our ability to recover genetic information rapidly increases in concert with the
sophistication of associated analyses, it is becoming more and more feasible to
analytically investigate the causes, patterns and processes involved in speciation –
which could only previously be speculated about. Approaches such as functional
genomic (Butlin 2010; Louis 2011) simulation studies (Barbuti et al. 2009: Thibert-
Plante & Hendry 2008) and ecological speciation studies (Berner et al. 2009; Harmon
et al. 2008) are allowing researchers to directly investigate speciation as it happens.
However a second key requirement for studies of speciation are systems in which
176
speciation is currently ongoing. The Gehyra radiation in Australia – in particular the
G. variegata species complex has many elements which make it a useful system in
which to study the process of speciation. Characters which make it an appropriate
model system include many recent diversification events, which include varying
levels of genetic, morphological and geographic differentiation allowing for
comprehensive, comparative studies, a large body of museum collection and a very
high abundance leading to ease of field collection and observation and a lack of
conservation concerns which would limit collection and experimentation. However,
the slow rate to sexual maturity and low fecundity (1-2 eggs per clutch (Bustard
1968)) relative to other model systems for speciation studies, e.g. Anolis (Gavrilets &
Losos 2009), sticklebacks (Schluter 2010), make the group unsuitable for laboratory
based experimental study in addition to impediments associated with the ongoing
taxonomic uncertainty in the group. As such, the Australian Gehyra radiation is
unlikely to become a classic model system for the study of speciation, but may be an
exceptional system for in situ study of the process of speciation in Australia in
response to the onset of aridity and fragmentation of mesic habitats (Byrne et. al.
2008) and future development of the system as an Australian model for speciation
processes would compliment and assist in taxonomically resolving the group.
Concluding Remarks
In many aspects this work follows in the footsteps of past researchers – in that it
makes significant steps to resolving known issues but in the process creates a
substantial body of new questions, however much of the most compelling scientific
177
research generates more questions than answers. While my research highlights the
unexpectedly high complexity and diversity of the Australian Gehyra and the
significant challenges in delimiting and describing species, we also produce a
comprehensive genetic framework that will greatly assist in the rapid identification
and characterization of new species in the future. My research has also evaluated
species relationships and the evolutionary history of Australian Gehyra, confirming
some of the assumptions made by previous researchers but rejecting diversity in the
group being driven by chromosomal rearrangement. Speciation in the group has been
shown to be complex and multifaceted, worthy of further study. I have evaluated one
case of complex divergence in Gehyra, finding that ecological parameters are likely to
be involved in phenotypic divergence and highlighting the potential role of
ecologically driven speciation in the group. While the Australian Gehyra radiation
sorely needs more basic diversity work to be carried out, the rewards from
understanding the processes that make elucidating this diversity so challenging offer
large advances in our understanding of how the diversification of arid species
complexes occurs.
178
References
1. Adler G.H., Levins R. 1994. The island syndrome in rodent populations. Q.
Rev. Biol. 69:473-490.
2. Avise J.C. & Wollenberg K. 1997. Phylogenetics and the origin of species. Proc.
Natl. Acad Sci. U.S.A. 94:7748-7755.
3. Barbuti, R. Maggiolo-Schettini, A. & Milazzo, P. 2009. A methodology for
stochastic modeling and simulation of sympatric speciation by sexual selection. J.
Biol. Syst. 17:349-376.
4. Barton, N. H. & Gale, K. S. 1993. Genetic analysis of hybrid zones In Hybrid
zones and the evolutionary process (ed. Harrison, R. G.), U.S.A.: Oxford
University Press.
5. Bauer A.M., Henle K. 1994. Gekkonidae (Reptila, Sauria). Part I. Australia and
Oceania. Das Tierreich 109:1–222.
6. Bauer A.M., Parham J.F., Brown R.M., Stuart B.L., Grismer L. Papenfuss T.J.,
Böhme W., Savage J.M., Carranza S., Grismer J.L., Wagner P., Schmitz A.,
Ananjeva N.B., Inger R.F. 2011. Availability of new Bayesian-delimited gecko
names and the importance of character-based species descriptions. Proc. R. Soc.
Biol. Sci. Ser. B. 278:490-492.
7. Beck, R. M. 2008. A dated phylogent of marsupials using a molecular
supermatrix and multiple fossil constraints. J. Mamm. 89:175-189.
8. Beerli P., Felsenstein J. 2001. Maximum likelihood estimation of a migration
matrix and effective population sizes in n subpopulations using a coalescent
approach, Proc. Natl. Acad. Sci. USA 98:4563–4568.
179
9. Berner, D., Grandchamp, A. & Hendry, A.P., 2009. Variable progress toward
ecological speciation in parapatry: stickleback across eight lake-stream
transitions. Evolution 63:1740-1753.
10. Bickford, D., Lohman, D. J., Sodhi, N. S., Ng, P. K. L., Meier, R., Winker K.,
Ingram, K. K. & Das, I. 2006. Cryptic species as a window on diversity and
conservation. Trends. Ecol. Evol. 22:148-155.
11. Burbrink F.T., Pyron A.R. 2011. The impact of gene-tree/species tree discordance
on diversification rate estimation Evolution 65:1851-1861.
12. Bustard, H.R. 1968. The ecology of the Australian gecko, Gehyra variegata, in
northern New South Wales. J. Zool. (Lond.) 154:113–138.
13. Butlin, R.K. 2010. Population genomics and speciation. Genetica 138:409-418.
14. Byrne M., Yeates D.K., Joseph L., Kearney M., Bowler J., Williams M.A.J.,
Cooper S., Donnellan S.C., Keogh J.S., Leys R., Melville J., Murphy D.J., Porch
N., Wyrwoll K-H. 2008. Birth of a biome: insights into the assembly and
maintenance of Australian arid zone biota. Mol. Ecol. 20:4398-4417.
15. Camargo A., Sinervo B., Sites J.W. 2010. Lizards as model organisms for
linking phylogeographic and speciation studies. Mol. Ecol. 19:3250-3270.
16. Cardoso A., Serrano A., Vogler, A.P. 2009. Morphological and molecular
variation in tiger beetles of the Cicindela hybrida complex: is an ‘integrative
taxonomy’ possible? Mol. Ecol. 18:648–664.
17. Carlsbeek R., Smith T.J. 2006. Probing the adaptive landscape using
experimental islands: density-dependent natural selection on lizard body size.
Evolution 61:1052-1061.
180
18. Carstens B.C., Dewey T. 2010 Species delimitation using a combined coalescent
and information-theoretic approach: an example from North American Myotis
bats. Syst. Biol. 59:400-414.
19. Chung Y., Ané C. 2011. Comparing two Bayesian methods for gene tree/species
tree reconstruction: Simulations with incomplete lineage sorting and horizontal
gene transfer. Syst. Biol. 60:261-275.
20. Cogger, H.G. 2000. Reptiles and amphibians of Australia. 6th ed. Reed New
Holland, Sydney, Australia
21. Cogger H.G., Cameron E.E., Cogger H.M. 1983. Zoological catalogue of Australia.
Vol 1. Amphibia and Reptilia. Bureau of fauna and flora, Canberra. 313.
22. Cogger H.G., Heatwole, H. 1981. The Australian reptiles: origins biogeography,
distribution patterns and island evolution. In Keast, A. (ed.), Ecological
Biogeography of Australia. W Junk, The Hague, Vol. 3:1333–1373.
23. Covacevich J., Couper, P. 1991. The reptile records. In Raven R. J., Ingram G. J.
(eds) An atlas of Queensland's frogs, reptiles birds and mammals. Queensland
Museum, Brisbane. 45–140.
24. Cranston K.A. 2010. Summarizing gene tree incongruence at multiple
phylogenetic depths. In Knowles L.L., Kubatko L.S (eds) Estimating species
trees: practical and theoretical aspects. Wiley-Blackwell, N.Y. U.S.A. 129-142.
25. Crisp, M., Cook, L., Steane D. 2004. Radiation of the Australian flora: what can
comparisons of molecular phylogenies across multiple taxa tell us about the
evolution of diversity in present-day communities? Philos. Trans. R. Soc. Lond. B
Biol. Sci. 359:1551-1571.
181
26. Dasmahapatra, K. K., Elias, M., Hill, R. I., Hoffman, J. I. & Mallet, J. 2010.
Mitochondrial DNA barcoding detects some species that are real, and some
that are not. Mol. Ecol. 10:264-273.
27. Dayan T., Simberloff D. 2005. Ecological and community-wide character
displacement: the next generation. Ecol. Lett. 8:875-894.
28. Daza J.D., Herrera A., Thomas R., Claudio H.J. 2009. Are you what you eat?
A geometric morphometric analysis of gekkotan skull shape. Biol. J. Linn.
Soc. 97:677-707.
29. Degnan J.H., Rosenberg N.A. 2009. Gene tree discordance, phylogenetic
inference and the multispecies coalescent. Trends Ecol. Evol. 24:332-340.
30. De Queiroz, K. 1998. The general lineage concept of species, species criteria and
the process of speciation. In Endless forms: species and speciation (eds. Howard,
D. J. & Berlocher, S. H.) pp. 57-65. London: Oxford University Press.
31. De Queiroz K. 2005. Ernst Mayr and the modern concept of species. Proc. Natl.
Acad. Sci. U.S.A. 102:6600–6607
32. De Queiroz K. 2007. Species concepts and species delimitation. Syst Biol. 56:879-
86.
33. DeSalle, R., Egan M. G. & Siddall M. 2005. The unholy trinity: taxonomy,
species delimitation and DNA barcoding. Proc. Roy. Soc. Sci. Ser. B. 360:1905-
1916.
34. Drummond A.J., Rambaut A. 2010. BEAST v1.6. Available from
http://beast.bio.ed.ac.uk/ Last accessed 26 April 2011.
182
35. Drummond A.J., Ashton B., Buxton S., Cheung M., Cooper A., Duran C., Field
M., Heled J., Kearse M., Markowitz S., Moir R., Stones-Havas S., Sturrock S.,
Thierer T., Wilson A. 2010. Geneious v5.3. Available from www.geneious.com.
Last accessed 15 July 2011.
36. Drummond A.J., Rambaut A. 2007. BEAST: Bayesian evolutionary analysis by
sampling trees. BMC Evol. Biol. 7:214.
37. Earl D.A. 2011. Structure Harvester v0.6, Available at
http://users.soe.ucsc.edu/~dearl/software/struct_harvest/. Last accessed
December 12, 2010.
38. Edgar R.C. 2004. MUSCLE: Multiple sequence alignment with high accuracy and
high throughput. Nucliec Acid Res. 32:1792-1797.
39. Ellegren H. 2008. Comparative genomics and the study of evolution by natural
selection. Mol. Ecol. 17:4586–4596.
40. Elmer K.R., Lehtonen T.K., Kautt A.F., Harrod C., Meyer, A. 2010. Rapid
sympatric ecological differentiation of crater lake cichlid fishes within historic
times. BMC Biol. 8:60.
41. Evanno G., Regnaut S., Goudet J. 2005. Detecting the number of clusters of
individuals using the software STRUCTURE: a simulation study. Mol. Ecol.
14:2611–2620.
42. Everitt B.S., Dunn G. 1991. Applied Multivariate Data Analysis 2nd ed. John
Wiley and Sons, London, U.K.
43. Faircloth B.C. 2000. MSATCOMMANDER: detection of microsatellite repeat
arrays and automated, locus-specific primer design. Mol. Ecol. Res. 8:92–94.
183
44. Fraley C., Raftery A.E. 2006. MCLUST version 3 for R: Normal mixture
modeling and model-based clustering, Technical Report No. 504, Dept.
Statistics, Univ. Washington, Seattle, U.S.A.
45. Freshney R.I. 2000. Culture of Animal Cells (4th edn). Wiley-Liss Inc, New York.
577.
46. Fujita,M.K., McGuire, J.A., Donnellan, S.C., Moritz, C. 2007. Diversification and
persistence at the arid–monsoonal interface: Australia-wide biogeography of
Bynoe's gecko (Heteronotia binoei: Gekkonidae). Evolution 64:2293–2314.
47. Fujita M.K., Leaché A.D. 2011. A coalescent perspective on delimiting and
naming species: a reply to Bauer et al. Proc. R. Soc. Biol. Sci. Ser. B. 278:493-
495.
48. Gamble T.P., Bauer A.M., Greenbaum E., Jackman T.R. 2008a. Out of the blue: a
novel trans-Atlantic clade of geckos (Gekkota, Squamata). Zool. Scr. 37:355-366.
49. Gamble T.P., Bauer A.M., Greenbaum E., Jackman T.R. 2008b. Evidence for
Gondwanan vicariance in an ancient clade of gecko lizards. J. Biogeog. 35:88-
104.
50. Gamble T.P., Bauer A.M., Colli G.R., Greenbaum E., Jackman T.R., Vitt L.J.,
Simons A.M. 2010. Coming to America: multiple origins of New World geckos.
J. Evol. Biol. 24:231-244.
51. Gavrilets, S. & Losos, J.B. 2009 Adaptive radiation: contrasting theory with data.
Science 323:732-737.
52. Goddard, C. 1996. Pitjantjara / Yunkunytjatjara to English Dictionary. IAD
Press, Alice Springs, 306 pp.
184
53. Gower, J.C. 1971. A general coefficient of similarity and some of its
properties. Biometrics 27:857–874.
54. Gray J.E. 1834. A new genus of Geckotidae. Proc. Zool. Soc. Lond. 2:99-101.
55. Gross M.R. 1984. Sunfish, salmon and the evolution of alternative
reproductive strategies and tactics in fishes. In Wootton, R. and Potts G (eds)
Fish Reproduction: Strategies and Tactics. Academic Press, London, U.K. 55–
75.
56. Gross M.R. 1985. Disruptive selection for alternative life histories in salmon.
Nature 313:47–48.
57. Gross M.R. 1996. Alternative reproductive strategies and tactics: diversity
within sexes. Trends Ecol. Evol. 11:92-98.
58. Han D., Zhou K., Bauer A.M. 2004 Phylogenetic relationships among gekkotan
lizards inferred from C-mos nuclear DNA sequences and a new classification of
the Gekkota. Biol. J. Linn. Soc. 83:353-368.
59. Harmon, L.J., Melville, J., Larson, A. & Losos J.B. 2008. The role of geography
and ecological opportunity in the diversification of day geckos (Phelsuma). Syst.
Biol. 57:562-573.
60. Harr B. 2006. Genomic islands of differentiation between house mouse
subspecies. Genome Res. 16:730-737.
61. Hayden M.J., Nguyen T.M., Waterman A., Chalmers K.J. 2008. Multiplex-
Ready PCR: A new method for multiplexed SSR and SNP genotyping. BMC
Genomics 9:80.
185
62. Heled J., Drummond A.J. 2010. Bayesian inference of species trees from
multilocus data. Mol. Biol. Evol. 27:570-580.
63. Henle K. 1990. Population ecology and life history of the arboreal gecko
Gehyra variegata in arid Australia. Herpetol. Monogr. 4:30–60.
64. Hennig C., Hausdorf B. 2010. Prabclus: Functions for clustering of presence-
absence, abundance and multilocus genetic data. R package version 2.2-2
http://CRAN.R-project.org/package=prabclus. Last accessed December 10,
2010.
65. Hey J. 2001. The mind of the species problem. Trends Ecol. Evol. 16:326-329.
66. Hey, J. & Neilsen, R. 2007. Integration within the Felsenstein equation for
improved Markov chain Monte Carlo methods in population genetics. Proc. Natl.
Acad. Sci. U.S.A. 104:2785-2790.
67. Hey J. 2010 Isolation with migration models for more than two populations. Mol.
Biol. Evol. 27:905-920.
68. Horner P.P. 2005. Gehyra koira sp. nov. (Reptilia: Gekkonidae), a new species of
lizard with two allopatric subspecies from the Ord-Victoria region of north-
western Australia and a key to the Gehyra australis species complex. Beagle
21:165-174.
69. Herczeg G., Gonda A., Merila J. 2009. Evolution of gigantism in nine-spined
sticklebacks. Evolution 63:3190-3200.
70. Herrel A., Meyers J.J., Vanhooydonck B. 2001. Correlations between habitat
use and body shape in a phrynosomatid lizard (Urosaurus ornatus): a
population-level analysis. Biol. J. Linn. Soc. 74:305–314.
186
71. Herrel A., Huyghe K., Vanhooydonck B., Backeljau T., Breugelmans K.,
Grbac I., Van Damme R., Irschick D.J. 2008. Rapid large-scale evolutionary
divergence in morphology and performance associated with exploitation of a
different dietary resource. Proc. Nat. Acad. Sci. U.S.A. 105:4792–4795.
72. Hibbits T.J., Pianka E.R., Huey R.B., Whiting M.J. 2005. Ecology of the
common barking gecko (Ptenopus garrulus) in Southern Africa. J. Herpetol.
39:509-515.
73. Higham T.E., Russell A.P. 2010. Divergence in locomotor performance,
ecology, and morphology between two sympatric sister species of desert-
dwelling gecko. Biol. J. Linn. Soc. 101:860-869.
74. Horner, P. 2005. Gehyra koira sp. nov. (Reptilia: Gekkonidae), a new species of
lizard with two allopatric subspecies from the Ord-Victoria region of north-
western Australia and a key to the Gehyra australis complex. The Beagle 21:165-
174.
75. Huang H., He Q., Kubatko L.S., Knowles L.L. 2010. Sources of error inherent in
species-tree estimation: Impact of mutational and coalescent effects on accuracy
and implications for choosing among different methods. Syst. Biol. 59:573-583.
76. Hudson M.E. 2008. Sequencing breakthroughs for genomic ecology and
evolutionary biology. Mol. Ecol. Resour. 8:3–17.
77. Hudson, R. R. & Kaplan, N. L. 1985. Statistical properties of the number of
recombination events in the history of a sample of DNA sequences. Genetics
111:147-164.
187
78. Hugall, A.F. & Lee, M.S.Y. 2004. Molecular claims of Gondwanan age for
Australian agamid lizards are untenable. Mol. Biol. Evol. 21:2102-2110.
79. Jakobsson M., Rosenberg N.A. 2007. CLUMPP: a cluster matching and
permutation program for dealing with label switching and multimodality in
analysis of population structure. Bioinformatics (Oxf.) 23:1801-1806.
80. Kent, J. W. 2002. BLAT – The BLAST-like alignment tool. Genome Res.
12:656-664.
81. Keogh S.J., Scott I.A., Hayes C. 2005. Rapid and repeated origin of insular
gigantism and dwarfism in Australian tiger snakes. Evolution 59:226-233.
82. King M. 1979. Karyotypic evolution in Gehyra (Gekkonidae: Reptilia) I. The
Gehyra variegata-punctata complex. Aust. J. Zool. 27:373-393.
83. King M. 1982a. Karyotypic evolution in Gehyra (Gekkonidae: Reptilia). II. A
new species from the Alligator Rivers region in northern Australia. Aust. J. Zool.
30:93–101.
84. King M. 1982b. A new species of Gehyra (Reptilia: Gekkonidae) from central
Australia. Trans. R. Soc. S. Aust. 106:155–158.
85. King M. 1983a. Karyotypic evolution in Gehyra (Gekkonidae: Reptilia) III. The
Gehyra australis complex. Aust. J. Zool. 31:723–741.
86. King M. 1983b. The Gehyra australis species complex (Sauria: Gekkonidae).
Amphib-Reptilia 4:147–169.
87. King M. 1984. Karyotypic evolution in Gehyra Gekkonidae Reptilia IV:
chromosome change and speciation. Genetica (Dordr.) 64:101-114.
88. Kloser R.J., Ryan T., Sakov P., Williams A., Koslow J.A. 2002. Species
188
identification in deep water using multiple acoustic frequencies. Can. J. Fish.
Aquat. Sci. 59:1065-107.
89. Kluge A.G. 1987. Cladistic relationships in the Gekkonoidea (Squamata, Sauria).
University of Michigan Museum of Zoology, Miscellaneous Publications. 173:1–
54.
90. Knesel K.M., Cohen B.E., Vasconcelos P.M., Thiede D.S. 2008. Rapid change in
drift of the Australian plate records collision with Ontong Java plateau. Nature
454:754-758.
91. Knowles L.L., Carstens B.C. 2007. Delimiting species without monophyletic gene
trees. Syst. Biol. 56:400-411.
92. Koh, L. P., Dunn, R. R., Sodhi, N. S., Colwell, R. K., Proctor H. C. & Smith, V.
S. 2004. Species coextinctions and the biodiversity crisis. Science 305:1632-1634.
93. Kubatko L.S., Degnan J.H. 2007. Inconsistency of phylogenetic estimates from
concatenated data under coalesence. Syst. Biol. 56:17-24.
94. Kubatko L.S., Carstens B.C., Knowles, L.L. 2009. STEM: Species tree estimation
using maximum likelihood for gene trees under coalescence. Bioinformatics
(Oxf.) 25:971-973.
95. Kuhner, M. K. 2009. Coalescent genealogy samplers: windows into population
history. Trends Ecol. Evol. 24:86-93.
96. Langerhans B.R., Layman C.R., Langerhans A.K, Dewitt T.J. 2003. Habitat-
associated morphological divergence in two Neotropical fish species, Biol. J.
Linn. Soc. 80:689–698.
189
97. Larget B.R., Kotha S.K., Dewey C.N., Ané C. 2010 BUCKy: Gene tree/species
tree reconciliation with Bayesian concordance analysis. Bioinformatics 26:2910-
2911.
98. Leaché, A. D. & Fujita, M. K. 2010. Bayesian species delimtation in west
African forest geckos (Hemidactylus fasciatus). Proc. Roy. Soc. Sci. Ser. B.
277:3071-3077.
99. Legendre A., Anderson M.J. 1999. Distance-based redundancy analysis:
testing multispecies responses in multifactorial ecological experiments. Ecol.
Monogr. 69:1-24.
100. Librado, P. & Rozas, J. 2009. DnaSP v5: A software for comprehensive analysis
of DNA polymorphism data. Bioinformatics 25:1451-1452.
101. Liu L., Pearl D.K. 2007. Species trees from gene trees: Reconstructing Bayesian
posterior distributions of a species phylogeny using estimated gene tree
distributions, Syst. Biol. 56:504-514.
102. Liu L., Yu L. 2011. Estimating species trees from unrooted gene trees. Syst. Biol.
(in press) DOI: 10.1093/sysbio/syr027
103. Lleonart J., Salat J., Torres G.J. 2000. Removing allometric effects of body
size in morphological analysis. J. Theor. Biol. 205:85-93.
104. Losos J.B. 1990. Ecomorphology, performance capability and scaling of West
Indian Anolis lizards: an evolutionary analysis. Ecol. Monogr. 60:369–388.
105. Losos J.B., Warheitt K.I., Schoener T.W. 1997. Adaptive differentiation
following experimental island colonization in Anolis lizards. Nature 387:70-
73.
190
106. Losos J.B., Creer D.A., Glossip D., Goellner R., Hampton, A., Roberts G.,
Haskell, N., Taylor P. & Ettling J. 2000. Evolutionary implications of phenotypic
plasticity in the hindlimb of the lizard Anolis segrei Evolution 54:301-305.
107. Louis, E.J. 2011. Population genomics and speciation in yeasts. Fungal Biol. Rev.
In press doi:10.1016/j.fbr.2011.06.001
108. Maddison W.P. 1997. Gene trees in species trees. Syst Biol. 46:523-536.
109. Maddison, D. R. & Maddison, W. P. 2005. MacClade 4: Analysis of phylogeny
and character evolution. Version 4.08a. Available from http://macclade.org.
110. Maechler M., Rousseeuw P., Struyf A., Hubert M. 2005. Cluster analysis
basics and extensions, http://cran.r-project.org/web/packages/cluster/ Last
accessed 10 December 2010.
111. Martin H.A. 2006. Cenozoic climatic changes and the development of the arid
vegetation of Australia. J. Arid Environ. 66:533–563.
112. Marroig G., Cheverud J.M. 2009. Size and shape in callimico and marmoset
skulls: allometry and heterochrony in the morphological evolution of small
Anthropoids In Ford, S.M., Davis, L.C. and Porter, L.M. (eds) The Smallest
Anthropoids: The Marmoset/Callimico Radiation. Springer N.Y. U.S.A. 331-
353.
113. Mayden R.L. 1997. A hierarchy of species concepts: The denouement in the saga
of the species problem. In: Claridge M.F., Dawah H.A., Wilson M.R. (eds)
Species: The units of biodiversity. London: Chapman and Hall. 381-424.
114. Mayr E. 1942. Systematics and the origin of species, Columbia University Press
Sussex, U.K.
191
115. McArdle B., Anderson M.J. 2001. Fitting multivariate models to community
data: a comment on distance based redundancy analysis. Ecology 82:290-297.
116. McCormack J.E., Heled J., Delaney K.S., Peterson A.T., Knowles, L.L. 2010.
Calibrating divergence times on species trees versus gene trees: implications for
speciation history of Aphelocoma jays. Evolution 65:184-202.
117. McCormack J.E., Smith T.B. 2008. Niche expansion leads to small-scale adaptive
divergence along an elevation gradient in a medium-sized passerine bird, Proc. R.
Soc. B. 275:2155-2164.
118. Meglécz E. 2007. MicroFamily: A computer program for detecting flanking
region similarities among different microsatellite loci. Mol. Ecol. Notes 7:18-
20.
119. Michel A.P., Sim S., Powell T.H.Q., Taylor M.S., Nosil P., Feder J.L. 2010.
Widespread genomic divergence during sympatric speciation. Proc. Natl.
Acad. of Sci. U.S.A. 107:9724-9729.
120. Mitchell F.J. 1965. Australian geckos assigned to the genus Gehyra GRAY.
(Reptilia, Gekkonidae). Senck. Biol. 46:287-319.
121. Moritz C.M. 1984. The evolution of a highly variable sex chromosome in Gehyra
purpurascens (Gekkonidae). Chromosoma 90:111-119.
122. Moritz C.M. 1986. The population biology of Gehyra (Gekkonidae):
Chromosome change and speciation. Syst. Biol. 35:46-67.
123. Moritz C.M. 1992. The population biology of Gehyra (Gekkonidae) III. Patterns
of microgeographic variation. J. Evol. Biol. 5:661-676.
124. Mortiz, C M. 1994. Defining “evolutionarily significant units” for conservation.
192
Trends Ecol. Evol. 9:373-375.
125. Morton, S.R., Short, J, and Barker, R.D. 1995. Refugia for biological diversity in
arid and semi-arid Australia. Biodiversity Series Paper No 4. Biodiversity Unit.
Department of Environment, Sports and Territories. Australian Federal
Government.
126. Murphy R.W., Sites J.W., Buth D.G., Haufler, C.H. 1996. Proteins I: Isozyme
electrophoresis. In: Hillis, D. M., Moritz C. & Mable B. (eds). Molecular
Systematics. Sinauer Associates, Sunderland, 51–120.
127. Nagel L., Schluter D. 1998. Body size, natural selection and speciation in
sticklebacks. Evolution 52:209-218.
128. Nagy K.A. 2005. Field metabolic rate and body size. J. Exp. Biol. 208:1621-
1625.
129. Neumann N.L., 2001. Geochemical and isotopic characteristics of South
Australian Proterozoic granites: implications for the origin and evolution of
high heat-producing terrains. Ph.D. thesis (unpublished). Univ. Adelaide,
Australia.
130. Nei M. 1987. Molecular Evolutionary Genetics. Columbia University Press, New
York, 375.
131. Neilsen, R. & Wakeley, J. 2001. Distinguishing migration from isolation: a
Markov chain Monte Carlo approach. Genetics 158:885-896.
132. Nosil P., Crespi B.J. 2006. Experimental evidence that predation promotes
divergence in adaptive radiation, Proc. Natl. Acad. Sci. U.S.A. 103:9090 –
9095.
193
133. Oksanen J., Blanchet, G.F., Kindt R., Legendre P., O’Hara R.B., Simpson
G.L., Solymos P., Stevens H.H., Wagner H. 2011. Vegan: Community ecology
package, R package version 1.17-7 http://CRAN.R–
project.org/package=vegan. Last accessed 5 January 2011.
134. Oliver P.M., Sanders K.L. 2009. Molecular evidence for Gondwanan origins of
multiple lineages within a diverse Australasian gecko radiation. J. Biogeogr.
36:2044-2055.
135. Oliver P.M., Sistrom M.J., Tjaturadi B., Keliopas K. 2010. On the status and
relationships of the Gecko species Gehyra barea (Kopstein 1926), with
description of new specimens and a range extension. Zootaxa 2354:45-55.
136. O’Meara, B. C. 2010. New heuristic methods for joint species delimitation and
species tree inference, Syst. Biol. 59:59-73.
137. Oosterhout C.V., Hutchinson D., Wills P.M., Shipley P. 2004. MICRO-
CHECKER: software for identifying and correcting genotyping errors in
microsatellite data. Mol. Ecol. Notes 4:535-538.
138. O'Meara B.C. 2010. New heuristics methods for joint species tree inference and
species delimitation. Syst. Biol. 59:59-73.
139. Palkovacs E.P., Post D.M. 2009. Experimental evidence that phenotypic
divergence in predators drives community divergence in prey. Ecology
90:300-305.
140. Petit, R. J. & Excoffier, L. 2009. Gene flow and species delimitation. Trends
Ecol. Evol. 24:386-393.
194
141. Pfennig D.W., Pfennig K.S. 2010. Character displacement and the origins of
diversity. Am. Nat. 176:26-44.
142. Posada, D., Crandall, K.A. 1998. Modeltest: testing the model of DNA
substitution. Bioinformatics 14:817–818.
143. Posada D. 2008. jModelTest: Phylogenetic Model Averaging. Mol. Biol. Evol.
25:1253-1256.
144. Primary Industries and Resources South Australia (PIRSA) 2009. Seeking a
balance: Conservation and resource use in the Northern Flinders Ranges,
Adelaide: Government of South Australia
145. Pritchard J.K., Stephens M., Donnelly P. 2000. Inference of population
structure using multilocus genotype data. Genetics 155:945–959.
146. Prosperi M.C., Prosperi L., Bruselles A., Abbate I., Rozera G., Vincenti D.,
Solmone M.C., Capobianchi M.R., Ulivi G. 2011. Combinatorial analysis and
algorithms for quasispecies reconstruction using next-generation sequencing.
BMC Bioinformatics 12:5.
147. Rambaut A. 2009. Figtree v1.4. Available from http://tree.bio.ed.ac.uk/ Last
accessed 28 May 2011.
148. Rambaut, A., Drummond, A.J. 2007. Tracer v1.4.
http://beast.bio.ed.ac.uk/Tracer. Last accessed 30 November 2010.
149. Ray, J. 1686. Historia Plantarum. In Lankester (ed). The correspondence of John
Ray, 1842. The Ray Society, London.
150. R Core Development Team. 2011. R: A Language and Environment for
Statistical Computing, R Foundation for Statistical Computing, Vienna,
195
Austria. http://www.R-project.org Last accessed 7 September 2011.
151. Reisberg L.H. 2001. Chromosomal rearrangements and speciation, Trends
Ecol. Evol. 16:351:358.
152. Rhymer J.M., Simberloff D. 1996. Extinction by hybridization and
introgression. Annu. Rev. Ecol. Syst. 27:83-109.
153. Rice A.M., Pfennig D.W. 2010. Does character displacement initiate
speciation? Evidence of reduced gene flow between populations experiencing
divergent selection. J. Evol. Biol. 23:854-865.
154. Richardson B., Baverstock P., Adams M. 1986. Allozyme Electrophoresis.
Academic Press, Sydney, 410.
155. Rissler L.J., Apodaca J.J. 2007. Adding more ecology into species delimitation:
Ecological niche models and phylogeography help define cryptic species in the
black salamander (Aneides flavipunctatus). Syst. Biol. 56:924-42.
156. Ronquist F., Huelsenbeck J.P. 2003. MRBAYES 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics 19:1572-1574.
157. Rosenberg N.A. 2004. DISTRUCT: a program for the graphical display of
population structure. Mol. Ecol. Notes 4:137–138.
158. Rousset F. 2008. Genepop'007: a complete reimplementation of the Genepop
software for Windows and Linux. Mol. Ecol. Res. 8:103-106.
159. Rowe K.C., Aplin K.P., Baverstock P.R., Moritz C. 2010. Recent and rapid
speciation with limited morphological diversity in the genus Rattus. Syst. Biol.
60:188-203.
196
160. Rundle H.D., Schluter D. 1997. Reinforcement of stickleback mate
preferences: sympatry breeds contempt. Evolution 52:200-208.
161. Rowe, K.C., Reno, M.L., Richmond, D.M., Adkins, R.M. & Steppan S.J. 2008.
Pliocene colonization and adaptive radiations in Australia and New Guinea
(Sahul): multilocus systematics of the old endemic rodents (Muroidea: Murinae).
Mol. Phylogenet. Evol. 47:84-101.
162. Rozas J. 2009. DNA Sequence Polymorphism Analysis using DnaSP. In Posada
D. (ed) Bioinformatics for DNA Sequence Analysis; Methods. In Molecular
Biology Series Vol. 537. Humana Press, NJ, USA. 337-350.
163. Rozas J., Sánchez-DelBarrio J.C., Messeguer X., Rozas R. 2003. DnaSP, DNA
polymorphism analyses by the coalescent and other methods. Bioinformatics
19:2496–2497.
164. Russell A.P., Bauer, A.M. 2002. Underwood’s classification of the geckos: A 21st
century appreciation. Bull. Br. Mus. (Nat. Hist.) Zool. 68:113-121.
165. Sanders K.L., Lee M.S.Y., Leys R., Foster R., Keogh S.J. 2008. Molecular
phylogeny and divergence dates for Australasian elapids and sea snakes
(Hydrophiinae): evidence from seven genes for rapid evolutionary radiations. J.
Evol. Biol. 21:682-695.
166. Schlick-Steiner, B. C., Steiner, F. M., Seifert, B., Stauffer, C. Christian, E. &
Crozier, R. H. 2010. Integrative taxonomy; a multidisciplinary approach to
exploring biodiversity. Annu. Rev. Entomol. 55:421-438.
167. Schluter D. 1994. Experimental evidence that competition promotes adaptive
divergence, Science 266:798–801.
197
168. Schluter D. 2000. The ecology of adaptive radiation. Oxford Uni. Press, New
York, U.S.A.
169. Schluter D. 2010. Resource competition and coevolution in sticklebacks. Evo.
Edu. Outreach 3:54-61.
170. Shaffer H.B., Thomson R.C. 2007. Delimiting species in recent radiations. Syst.
Biol. 56:896-906.
171. Simpson G.G. 1951. The species concept. Evolution. 5:285-298.
172. Sistrom M., Hutchinson M., Hutchinson R., Donnellan S. 2009. Molecular
phylogeny of Australian Gehyra (Squamata: Gekkonidae) and taxonomic
revision of Gehyra variegata in south-eastern Australia. Zootaxa 2277:14-32.
173. Sites J.R., Moritz C.M. 1987. Chromosomal evolution and speciation revisited.
Syst. Biol. 36:153-174.
174. Skinner, A., Hugall, A.F. & Hutchinson, M.N. 2011. Lygosomine phylogeny and
the origins of Australian scincid lizards. J. Biogeogr. 38:1044-1058.
175. Smith M.J., Roberts J.D. 2003. No sexual size dimorphism in the frog Crinia
georgiana (Anura: Myobatrachidae): An examination of pre- and
postmaturational growth. J. Herpetol. 37:132-137.
176. Smouse P.E., Long J.C., Sokal R.R. 1986. Multiple regression and correlation
extensions of the Mantel test of matrix correspondence. Syst. Zool. 35:627–
632.
198
177. Sota T., Takami Y., Kubota K., Ujiie M., Ishikawa R. 2000. Interspecific body
size differentiation in species assemblages of the carabid subgenus
Ohomopterus in Japan. Popul. Ecol. 42:279-291.
178. Stamatakis A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic
analyses with thousands of taxa and mixed models. Bioinformatics. 22:2688–
2690.
179. Stamatakis A., Hoover P., Rougemont J. 2008. A rapid bootstrap algorithm for the
RAxML web-servers. Syst. Biol. 75:758–771.
180. Steindachner F. 1867. Part 3. Reptiles, in Wüllerstorf-Urbair, B. von (ed.) Reise
der Österreichischen Fregatte Novara um die Erde in den Jahren 1857, 1858,
1859. Zoologischer Teil. I. Wirbelthiere. State Printer, Vienna.
181. Stephens, M., Smith, N. & Donnelly, P. 2001. A new statistical method for
haplotype reconstruction from population data. Am. J. Hum. Genet. 68:978-989.
182. Stephens, M. & Scheet, P. 2005. Accounting for decay of linkage disequilibrium
in haplotye inference and missing-data imputation. Am. J. Hum. Genet. 76:449-
462.
183. Storr G.M. 1982. Two new Gehyra (Lacertilia: Gekkonidae) from Australia. Rec.
West. Aust. Mus. 10:53–59.
184. Strasburg, J. L. & Reiseberg, L. H. 2010. How robust are “isolation with
migration” analyses to violations of the IM model? A simulation study. Mol.
Biol. Evol. 27:297-310.
185. Stuart-Smith J., Swain R., Wapstra E. 2007. The role of body size in
competition and mate choice in an agamid with female-biased dimorphism,
199
Behaviour 144:1087-1102.
186. Suzuki R., Shimodaira H. 2006. Pvclust: An R package for hierarchical
clustering with p-values via multiscale bootstrap resampling, R package
version 1.2-1. http://www.is.titech.ac.jp/~shimo/prog/pvclust/ Last accessed
25 November 2010.
187. Takahashi T., Watanabe K., Munehara H., Ruber L., Hori, M. 2009. Evidence for
divergent natural selection of a Lake Tanganyika cichlid inferred from repeated
radiations in body size. Mol. Ecol. 18:3110-3119.
188. Taylor E.H. 1963. The lizards of Thailand. Univ. Kans. Sci. Bull. 44:687–1076.
189. Tiedemann F., Hãupl M. 1980. Typenkatalog der herpetologischen Sammlung.
Teil 11. Reptilia. Kat. Wiss. Samml. Nathist. Mus. Wien, Vertebrata, 4:1–80.
190. Tiedemann F., Häupl M., Grillitsch H. 1994. Katalog der Typen der
herpetologischen Sammlung nach dem Stand vom 1. Jänner 1994. Kat. Wiss.
Samml. Nathist. Mus. Wien. 10:1–110.
191. Therneau T., Atkinson B. 2002. rpart ver. 3. Mayo Foundation for Medical
Education and Research.
http://www.mayoresearch.mayo.edu/mayo/research/biostat/splusfunctions.cfm
Last accessed 28 November 2010.
192. Thibert-Plante, X. & Hendry, A.P. 2008. Five questions on ecological speciation
addressed with individual-based simulations. J. Evol. Biol. 22:109-123.
193. Thomson, R.C., Wang, I.J. & Johnson, J.R. 2010. Genome-enabled development
of DNA markers for ecology, evolution and conservation. Mol. Ecol. 19:2184-
2195.
200
194. Thorpe R.S., Baez M. 1987. Geographic Variation within an island: univariate
and multivariate contouring of scalation, size, and shape of the lizard Gallotia
galloti. Evolution. 41:256-268.
195. Ting C.T., Tsaur S.C., Wu M.L., Wu C.I. 1998. A rapidly evolving homeobox
at the site of a hybrid sterility gene. Science 282:1501-1504.
196. Toon, A., Perez-Losada, M., Schweitzer, C.E., Feldmann, R.M., Carlson, M.
& Crandall, K.A., 2010. Gondwanan radiation of the Southern Hemisphere
crayfishes (Decapoda: Parastacidae): edvidence from fossils and molecules. J.
Biogeogr. 37:2275-2290.
197. Townsend, T. M., Alegre, E. R., Kelley S. T., Weins, J. J. & Reeder, T. W.
2008. Rapid development of multiple nuclear loci for phylogenetic analysis
using genomic resources: an example from squamate reptiles. Mol.
Phylogenet. Evol. 47:129-142.
198. Turner T.L., Hahn M.W., Nuzhdin S.V. 2005. Genomic islands of speciation
in Anopheles gambiae. PloS Biol. 3:1572-1578.
199. Underwood G. 1954. On the classification and evolution of geckos. Proc. Zool.
Soc. Lond. 124:469-492.
200. Vanhooydonck B., Van Damme R. 1999. Evolutionary relationships between
body shape and habitat use in lacertid lizards. Evol. Ecol. Res. 1:785-805.
201. Vavrek M. 2010. fossil: Palaeoecological and palaeogeographical analysis
tools. R package version 0.3.3 http://CRAN.R –project.org/package=fossil.
Last accessed 12 December 2010.
202. Venables W.N., Ripley B.D. 2002. Modern applied statistics with S. 4th
201
Edition, Springer, N. Y. U.S.A.
203. Voris H.K. 2000. Maps of Pleistocene seas levels in Southeast Asia: shorelines,
river systems and time durations. J. Biogeog. 27:1153-1167.
204. Ward J.H. 1963. Hierarchical grouping to optimize an objective function. J.
Amer. Stat. Assoc. 58:236−244.
205. Wells R., Wellington C.R. 1985. A classification of the Amphibia and Reptilia of
Australia. Aust. J. Herp. Supplementary Series 1-61.
206. Wiens J.J., Morrill M.C. 2011. Missing data in phylogenetic analysis: reconciling
results from simulations and empirical data. Syst. Biol. (in press)
DOI:10.1093/sysbio/syr025
207. Wilson S., Swan G. 2010. A complete guide to reptiles of Australia, 3rd
edition,
New Holland, Australia.
208. Woinarski, J.C.Z., Connors, G., Oliver, B. (1996b) The reservation status of plant
species and vegetation types in the Northern Territory. Aust. J. Bot. 44:673–689.
209. Wu C.I. 2001. The genic view of the process of speciation. J. Evol. Biol. 14:851-
865.
210. Yandell, B. S. 1997. Practical data analysis for designed experiments. London:
Chapman & Hall
211. Yang Z., Rannala B. 2010. Bayesian species delimitation using multilocus
sequence data. Proc. Natl. Acad. Sci. U.S.A. 107:9264-9269.
212. Yeates, D. K., Seago, A., Nelson, L. Cameron, S. L., Joeseph, L. & Truman, J. W.
H. 2011. Integrative taxonomy or iterative taxonomy? Syst. Entomol. 36:209-217.
202
Appendix 1. Details of the specimens and samples used for Chapter 2.
Genus species Map
code
mtDNA karyotype Allozyme
OTU
ABTC No. Voucher No. Locality Country State declat declong
Cyrtodactylus marmoratus ABTC48075 AMSR126126 Cibodas, Java Indonesia
Gehyra australis Y ABTC28970 NTMR21022 Black Point Australia NT -11.15 132.15
Gehyra baliola Y ABTC44765 AMSR122405 Waro PNG SHP
Gehyra borroloola Y ABTC11883 SAMAR34183 McArthur River
Station
Australia NT -16.66 135.85
Gehyra catenata Y ABTC77213 SAMAR55893 30k N Tambo Australia Qld -24.65 146.385
Gehyra dubia Y ABTC76885 SAMAR55583 20k NNE Biloela Australia Qld -24.223 150.64472
Gehyra ipsa Y ABTC28493 Bungle Bungles Australia WA -17.3748 128.3913
Gehyra koira Y ABTC30614 NTMR23804 Wickham River, Australia NT -16.842 130.2361
Gehyra lazelli L1 9 SAMAR38950–58 Tungkillo Australia SA -34.82 139.06
Gehyra lazelli L2 2n=44* 8 ABTC03668-
70
SAMAR33529,
R38943–44
Lancoona Station Australia NSW -33.36 145.883
Gehyra lazelli L3 Y 10 ABTC18031-
2
SAMAR38984–6 Middleback Range Australia SA -33.183 137.1
Gehyra lazelli L4 Y ABTC22091 SAMAR28977 Gawler Ranges Australia SA -32.616 136.35
Gehyra lazelli L5 Y ABTC52434 SAMAR28515 120k NE Minnipa Australia SA -32.33 136.283
Gehyra lazelli L6 Y ABTC88098 SAMAR60608 Bimbowrie Station Australia SA -32.07472 140.3283
Gehyra lazelli L7 Y ABTC88097 SAMAR60620 Bimbowrie Station Australia SA -32.06722 140.3333
Gehyra lazelli L8 Y ABTC88094 SAMAR60602 Bimbowrie Station Australia SA -
31.9741666
7
140.3161
Gehyra lazelli L9 Y ABTC89675 SAMAR61563 11.3k NNW
Penong
Australia SA -31.9144 132.892
Gehyra lazelli L10 Y ABTC39325 SAMAR52366 4.7k W Parachilna
Hill
Australia SA -31.1327 138.54916
Gehyra lazelli L11 Y 2n=44 ABTC38861 SAMAR51801 9k SSE
Mudlapena Spring
Australia SA -30.68972 138.81583
Gehyra lazelli L12 Y 2n=44 ABTC39130 SAMAR52012 4.7k NNE Warden
Hill
Australia SA -30.4038 139.2352778
Gehyra lazelli L13 Y ABTC74062 SAMAR52962 Arkaroola Australia SA -30.11861 139.4483
Gehyra membranacruralis Y ABTC50301 AMSR135529 near Sibilanga
Mission
PNG SP
Gehyra minuta 2n=42a* 1 ABTC31246,
103196,
103199,
103213-4
CM1235, 1257, 1280,
1383, 1391
The Granites Australia NT -20.5722 130.3501
Gehyra minuta Y ABTC61706 NTMR13647 80k S Renner
Springs
Australia NT -18.9469 134.1227
Gehyra montium M1 Y 2n=42a ABTC41961-
2, 4
SAMAR48732-3, 5;
SAMAR51537,
Mt Lindsay Australia SA -27.025 129.875
203
R51540, R51565,
R51574
Gehyra montium M2 Y 2 ABTC103204 CM1321 Cavenagh Range Australia WA -26.1705 127.9697
Gehyra montium M3 2n=42a* 3 CM1260, 1319 1342
1357
Warburton Australia WA -26.1505 126.5474
Gehyra montium M4 2n=42a* CM1264 Winburn Rocks Australia WA -26.05 127.51
Gehyra montium M5 2n=42a* 2 CM1339 1348 Blackstone Range Australia WA -26.0156 128.2728
Gehyra montium M6 2n=42a* 4 CM1322 1345 1340 Mt Samuel Australia WA -25.76 125.93
Gehyra montium M7 2n=42a* 4 CM1337 1343 1349 Notabilis Hill Australia WA -25.65 125.55
Gehyra montium M8 2n=42a* 2 CM1298 Mt Fagan Australia NT -25.0904 129.5677
Gehyra montium M9 2n=42a* 4 CM1299 1303 1380
1377
Giles Australia WA -25.03 128.3
Gehyra montium M10 2n=42a* 2 CM1261 CM1338 Rawlinson Ranges Australia WA -24.8077 127.7846
Gehyra mutilata Y ABTC32321 Dumaguete,
Negros Island
Philippines
Gehyra mutilata Y ABTC13940 Krakatau Indonesia
Gehyra nana Y ABTC29669 NTMR21783 Litchfield NP Australia NT -13.1317 130.8052
Gehyra occidentalis Y ABTC13488 SAMAR51105 El Questro Station Australia WA -15.966 127.93
Gehyra oceanica Y ABTC49805 AMSR129847 Normanby Island PNG MBP
Gehyra oceanica Y ABTC32281 UMMZ182803 Tanna Island Vanuatu
Gehyra pamela Y ABTC72525 NTMR26111 Arnhemland
Plateau
Australia NT -13.383 133.383
Gehyra pilbara Y ABTC11726 SAMAR34053 40k E Mt Newman Australia WA -23.183 119.98
Gehyra pilbara WAM131748 Hamersley Station Australia WA -22.33 117.86
Gehyra punctata WAM164116 250k NNW
Newman
Australia WA -
22.2230555
6
118.9552778
Gehyra purpurascens P1 ABTC52233 SAMAR31984 Yumbarra CP Australia SA -
31.7719444
4
133.4719444
Gehyra purpurascens P2 Y ABTC38217 SAMAR50278 7k SSE Mt
Deception
Australia SA -
30.7602777
8
138.286944
Gehyra purpurascens Y ABTC38215 SAMAR50277 7k SSE Mt
Deception
Australia SA -
30.7602777
8
138.2869444
Gehyra purpurascens P3 ABTC58138 SAMAR45300 Olympic Dam Australia SA -30.383 136.85
Gehyra purpurascens P4 Y ABTC00579 SAMAR36374 23k NE Etadunna Australia SA -28.583 138.816
Gehyra purpurascens P5 Y ABTC41803 SAMAR46147 25k NW
Kunytjanu
Australia SA -26.4877 129.1736111
Gehyra purpurascens P6 Y ABTC42153 SAMAR50164 14.4k S Sentinel
Hill
Australia SA -26.21083 132.4427778
Gehyra purpurascens P7 N 7 CM1254 Old Andado Australia NT -25.384 135.4413
Gehyra purpurascens P8 N 7 CM1372 Giles Australia WA -25.03 128.3
Gehyra purpurascens P9 Y 7 ABTC31290 CM1293, 1305 Ti Tree Australia NT -22.1325 133.4205
204
Gehyra purpurascens N 2n=?? SAMAR51606 ENE Mimili,
Everard Ranges
Australia SA
Gehyra robusta Y ABTC11946 SAMAR34227 7k E Mount Isa Australia Qld -20.716 139.55
Gehyra variegata V1 Y 2n=40a* 5 ABTC03666-
7/71
SAMAR38941–2/45 Lancoona Station Australia NSW -32.366 145.883
Gehyra variegata V2 Y ABTC89242 SAMAR61010 Bimbowrie Station Australia SA -32.09805 140.281111
Gehyra variegata V3 Y ABTC06813 No voucher 1.5k W Blinman Australia SA -31.1152 138.6779
Gehyra variegata V4 Y ABTC06817 No voucher Chambers Gorge Australia SA -30.95 139.24
Gehyra variegata V5 Y 2n=40a ABTC38899 SAMAR51832 5.8k SE
Mudlapena Spring
Australia SA -30.64694 138.8480556
Gehyra variegata V6 6 ABTC14117-
24
SAMAR38934–40 Italowie Gap Australia SA -30.56 139.16
Gehyra variegata V7 6 ABTC14112 SAMAR38933 Loch Ness Well Australia SA -30.4597 139.1784
Gehyra variegata V8 Y 2n=40a ABTC38986 SAMAR51912 0.5k NW
Nudlamutana Well
Australia SA -
30.3741666
7
139.3505556
Gehyra variegata V9 Y ABTC74186 SAMAR53006 Arkaroola Australia SA -30.333 139.36
Gehyra variegata V10 Y 2n=40a ABTC39071 SAMAR51962 2.8k W Moosha
Bore
Australia SA -30.3211 138.78611
Gehyra variegata V11 Y 2n=40a ABTC39077 SAMAR51968 1.9k SW Reedy
Hole Springs
Camp
Australia SA -30.26527 138.825
Gehyra variegata V12 Y 2n=40a ABTC39173 SAMAR51781-2 10.4k SW
Yudnamutana
Bore
Australia SA -30.225 139.19194
Gehyra variegata V13 Y 2n=40a ABTC39184 SAMAR51790 2.5k WSW
Yudnamutana
Bore
Australia SA -30.174166 139.251
Gehyra variegata V14 Y 2n=40a ABTC39181 SAMAR51760 1.75k W
Yudnamutana
Bore
Australia SA -30.17083 139.257
Gehyra variegata V15 Y 6 ABTC14870-
1/5
SAMAR38929–31 Yudnamatana Australia SA -30.166 139.283
Gehyra variegata V16 Y ABTC74203 SAMAR52943 Arkaroola Australia SA -30.1205 139.39861
Gehyra variegata V17 Y ABTC52478 SAMAR28201 1k S Mt Dutton Australia SA -27.816 135.716
Gehyra variegata V18 ABTC58533 SAMAR48599 12.3k NNW Mt
Cheesman
Australia SA -27.3142 130.265
Gehyra variegata V19 Y ABTC79922 SAMAR56497 5.6k W Mount
Hoare
Australia SA -27.0575 129.6438
Gehyra variegata V20 Y 2n=40a ABTC42460 SAMAR51607, 9 26.3k ENE Mimili Australia SA -26.91305 132.95083
Gehyra variegata V21 Y 2n=40a ABTC42449 SAMAR51637 30.3k WNW
Indulkana
Australia SA -26.86916 133.0225
Gehyra variegata 2n=40a SAMAR51842, 51881 Mt Fitton Australia SA
Gehyra xenopus Y ABTC13017 SAMAR53962 10k S Cape
Voltaire
Australia WA -14.35 125.583
205
Hemiphylloda
ctylus
typhus ABTC32736 No voucher Suva Fiji
Hemiphylloda
ctylus
typhus ABTC49760 BPBM12995 No location
Lepidodactylu
s
lugubris ABTC32735 No voucher Suva Fiji
Lepidodactylu
s
lugubris ABTC50488 AMSR136386 Honiara,
Guadalcanal
Solomon
Islands
206
Appendix 2: Details of samples and specimens used in Chapter 3.
ABTC
Number
Registration
Number Genus Species Location State Lat Long mtDNA PRLR H3 Morph
ABTC48075 AMSR126126 Cyrtodactylus marmoratus Cibodas forest Indonesia Y Y
ABTC28970 NTMR21022 Gehyra australis Black Point NT -11.15 132.15 Y Y Y
ABTC44765 AMSR122405 Gehyra baliola Waro PNG Y Y Y
ABTC11883 SAMAR34183 Gehyra borroloola McArthur River Station NT -16.67 135.85 Y Y Y
ABTC77213 SAMAR55893 Gehyra catenata 30k N Tambo on Alpha-Tambo Road Qld -24.65 146.39 Y Y Y
ABTC09994 NMVD67708 Gehyra Clade 1 3.6k W Serpentine Gorge turnoff NT -23.77 132.94 Y Y Y
ABTC24050 Gehyra Clade 1 MacDonnell Ranges NT -23.72 132.81 Y Y Y
ABTC24069 NTMR15358 Gehyra Clade 1 Lawrence Gorge NT -24.01 133.41 Y Y Y Y
ABTC24129 Gehyra Clade 1 MacDonnell Ranges NT -23.72 132.81 Y Y Y
ABTC24131 NTMR14356 Gehyra Clade 1 6k SSW Claraville HS NT -23.42 134.73 Y Y Y Y
ABTC24132 NTMR15356 Gehyra Clade 1 6k SSW Claraville HS NT -23.42 134.73 Y Y Y Y
ABTC29428 NTMR20664 Gehyra Clade 1 Finke Gorge NP NT -24.14 132.81 Y Y Y Y
ABTC30293 NTMR18310 Gehyra Clade 1 Palm Valley Gas Well, Finke Gorge NP NT -24.01 132.62 Y Y Y
ABTC33882 SAMAR41876 Gehyra Clade 2 15k W Mimili SA -27.02 132.57 Y Y Y Y
ABTC33938 SAMAR42069 Gehyra Clade 2 29k SW Illintjitja SA -26.34 130.16 Y Y Y Y
ABTC41664 SAMAR44892 Gehyra Clade 2 8k SE Mitchell Knob SA -26.19 131.88 Y Y Y
ABTC42130 SAMAR50119 Gehyra Clade 2 0.9k SE Sentinel Hill SA -26.09 132.46 Y Y
ABTC42343 SAMAR51536 Gehyra Clade 2 35k ESE Amata SA -26.25 131.48 Y Y Y Y
ABTC42344 SAMAR51537 Gehyra Clade 2 35k ESE Amata SA -26.25 131.48 Y Y Y
ABTC42363 SAMAR51574 Gehyra Clade 2 36.5k ESE Amata SA -26.26 131.49 Y Y Y Y
ABTC42403 SAMAR51540 Gehyra Clade 2 35k ESE Amata SA -26.25 131.48 Y Y Y Y
ABTC52483 SAMAR28265 Gehyra Clade 2 Kulgera NT -25.83 133.30 Y Y Y Y
ABTC58313 SAMAR46009 Gehyra Clade 2 Hunt Peninsula Lake Eyre North SA -28.94 137.40 Y
ABTC73410 SAMAR54751 Gehyra Clade 2 Mt Howe SA -26.26 133.44 Y Y Y Y
ABTC91737 WAMR166311 Gehyra Clade 2 Morgan Range WA -25.94 128.39 Y Y
ABTC105541 WAMR108849 Gehyra Clade 3 Cherralta Homestead WA -21.03 116.82 Y Y Y
ABTC105565 WAMR117060 Gehyra Clade 3 Ashburton Valley WA -23.50 117.50 Y Y Y
ABTC105571 WAMR119017 Gehyra Clade 3 Sandstone WA -28.00 120.50 Y Y Y
ABTC105572 WAMR119018 Gehyra Clade 3 Yuinmery WA -28.52 119.02 Y Y
ABTC105580 WAMR126067 Gehyra Clade 3 Mount Magnet WA -28.00 117.83 Y Y Y
ABTC105583 WAMR127613 Gehyra Clade 3 Laverton WA -28.63 122.32 Y Y Y
ABTC105647 WAMR165853 Gehyra Clade 3 Newman WA -23.29 119.30 Y Y
ABTC105651 WAMR170800 Gehyra Clade 3 Mount Elvire WA -21.71 116.77 Y Y Y
ABTC59760 AMSR123089 Gehyra Clade 3 Yalgoo tip WA -28.34 116.68 Y
ABTC59761 AMSR123090 Gehyra Clade 3 Yalgoo tip WA -28.34 116.68 Y Y Y
ABTC09031 SAMAR42789 Gehyra Clade 4 Diamantina Station dump Qld -23.75 141.13 Y
207
ABTC09066 SAMAR42821 Gehyra Clade 4 30k SE Springvale Station Qld -23.68 140.90 Y Y Y
ABTC11968 SAMAR34248 Gehyra Clade 4 7k E Mount Isa Qld -20.72 139.72 Y Y Y
ABTC29508 NTMR21325 Gehyra Clade 4 Musselbrook Reservoir Qld -18.29 138.48 Y Y
ABTC77005 SAMAR55694 Gehyra Clade 4
13.4k NNE Hughenden on Kennedy
Developmental Road Qld -20.79 144.31 Y Y Y
ABTC77065 SAMAR55751 Gehyra Clade 4
35k S Julia Creek on Julia Creek-Kynuna
Road Qld -20.96 141.83 Y Y
ABTC77066 SAMAR55752 Gehyra Clade 4
35k S Julia Creek on Julia Creek-Kynuna
Road Qld -20.96 141.83 Y Y
ABTC77068 SAMAR55749 Gehyra Clade 4 37k SSE Julia Creek Qld -20.98 141.89 Y Y
ABTC03666 SAMAR38941 Gehyra Clade 5 Lancoona HS NSW -32.37 145.88 Y Y
ABTC03667 SAMAR38942 Gehyra Clade 5 Lancoona HS NSW -32.37 145.88 Y Y
ABTC03669 SAMAR33529 Gehyra Clade 5 Lancoona HS NSW -33.37 145.88 Y
ABTC03671 SAMAR38945 Gehyra Clade 5 Lancoona HS NSW -32.37 145.88 Y Y Y
ABTC03711 SAMAR38946 Gehyra Clade 5 5k E Tooraweenah NSW -31.43 148.92 Y Y
ABTC06813 Gehyra Clade 5 1.5k W Blinman SA -31.12 138.71 Y
ABTC06816 Gehyra Clade 5 1.5k W Blinman SA -31.12 138.71 Y Y
ABTC06817 Gehyra Clade 5 Chambers Gorge SA -30.97 139.22 Y Y Y
ABTC06818 Gehyra Clade 5 Chambers Gorge SA -30.97 139.22 Y Y
ABTC08930 SAMAR42678 Gehyra Clade 5 138k N Boulia Qld -21.73 139.55 Y Y Y
ABTC08954 SAMAR42707 Gehyra Clade 5 Mica Creek, near Mount Isa Qld -20.77 139.48 Y
ABTC09204 SAMAR42957 Gehyra Clade 5 Betoota Qld -25.68 140.73 Y
ABTC09960 NMVD67573 Gehyra Clade 5 Alice Springs NT -23.69 133.88 Y Y Y
ABTC11969 SAMAR34249 Gehyra Clade 5 7k E Mount Isa Qld -20.72 139.72 Y Y Y Y
ABTC12603 Gehyra Clade 5 Petermann Creek, George Gill Ranges NT -24.39 131.93 Y Y Y
ABTC13998 AMS Gehyra Clade 5 Mootwingee NP NSW -31.24 142.29 Y Y
ABTC14006 AMS Gehyra Clade 5 Mootwingee NP NSW -31.24 142.29 Y
ABTC14871 SAMAR38930 Gehyra Clade 5 Yudnamatana SA -30.17 139.28 Y Y
ABTC14875 SAMAR38931 Gehyra Clade 5 Yudnamatana SA -30.17 139.28 Y Y
ABTC15185 SAMAR38954 Gehyra Clade 5 3k E Tungkillo SA -34.82 139.10 Y Y Y
ABTC16330 QMJ48538 Gehyra Clade 5 Naccowlah, 36k WNW Jackson Qld -26.49 149.29 Y Y
ABTC16331 QMJ48539 Gehyra Clade 5 Naccowlah, 36k WNW Jackson Qld -26.49 149.29 Y Y
ABTC22104 SAMAR28954 Gehyra Clade 5 Gawler Ranges SA -32.62 136.22 Y Y
ABTC31290 Gehyra Clade 5 Ti Tree NT -22.13 133.42 Y
ABTC38215 SAMAR50277 Gehyra Clade 5 7k SSE Mt Deception, Beltana Station SA -30.76 138.29 Y Y Y Y
ABTC38217 SAMAR50278 Gehyra Clade 5 7k SSE Mt Deception, Beltana Station SA -30.76 138.29 Y Y Y
ABTC38899 SAMAR51832 Gehyra Clade 5 5.8k SE Mudlapena Spring SA -30.65 138.85 Y
ABTC38986 SAMAR51912 Gehyra Clade 5 0.5k NW Nudlamutana Well SA -30.37 139.35 Y Y Y
ABTC39071 SAMAR51962 Gehyra Clade 5 2.8k W Moosha Bore SA -30.32 138.79 Y Y Y
ABTC39077 SAMAR51968 Gehyra Clade 5 1.9k SW Reedy Hole Springs Camp SA -30.27 138.83 Y Y Y
ABTC39173 SAMAR51782 Gehyra Clade 5 10.4k SW Yudnamutana Bore SA -30.23 139.19 Y Y Y Y
208
ABTC39181 SAMAR51760 Gehyra Clade 5 1.75k W Yudnamutana Bore SA -30.17 139.26 Y Y Y
ABTC39184 SAMAR51790 Gehyra Clade 5 2.5k WSW Yudnamutana Bore SA -30.17 139.25 Y Y Y
ABTC39325 SAMAR52366 Gehyra Clade 5 4.7k W Parachilna Hill SA -31.13 138.55 Y Y Y
ABTC42449 SAMAR51637 Gehyra Clade 5 30.3k WNW Indulkana SA -26.87 133.02 Y Y Y
ABTC51406 AMR129375 Gehyra Clade 5 7k E Mount Isa Qld -20.72 139.55 Y Y Y
ABTC52396 SAMAR26185 Gehyra Clade 5 Birdsville Qld -25.90 139.35 Y Y Y Y
ABTC52478 SAMAR28201 Gehyra Clade 5 1k S Mt Dutton SA -27.82 135.72 Y
ABTC57602 SAMAR42028 Gehyra Clade 5 Lambina Station, E Stuart Highway SA -26.96 130.70 Y Y
ABTC59707 AMSR118623 Gehyra Clade 5 Coonbah NSW -32.98 141.62 Y Y Y
ABTC59708 AMSR118622 Gehyra Clade 5 Coonbah NSW -32.98 141.62 Y Y
ABTC72952 SAMAR54530 Gehyra Clade 5
4.5k N Station Creek crossing, Prarie-
Muttaburra Road Qld -22.04 144.62 Y Y Y
ABTC72961 SAMAR54546 Gehyra Clade 5
14k NW Longreach on Landsborough
Highway Qld -23.35 143.20 Y Y Y Y
ABTC72962 SAMAR54547 Gehyra Clade 5
14k NW Longreach on Landsborough
Highway Qld -23.35 143.20 Y Y Y
ABTC74186 SAMAR53006 Gehyra Clade 5 Arkaroola SA -30.33 139.37 Y
ABTC74203 SAMAR52943 Gehyra Clade 5 Arkaroola SA -30.12 139.40 Y
ABTC77006 SAMAR55695 Gehyra Clade 5
13.4k NNE Hughenden on Kennedy
Developmental Road Qld -20.79 144.31 Y Y
ABTC77007 SAMAR55696 Gehyra Clade 5
13.4k NNE Hughenden on Kennedy
Developmental Road Qld -20.79 144.31 Y Y Y
ABTC79486 SAMAR55905 Gehyra Clade 5
9k N New South Wales/Queensland border
on Mitchell Highway Qld -28.96 145.73 Y Y Y
ABTC82407 SAMAR55297 Gehyra Clade 5 Phosphate Hill, Mulga Site Qld -21.80 139.91 Y Y
ABTC82419 SAMAR55268 Gehyra Clade 5 Phosphate Hill, Snappy Site Qld -21.89 139.99 Y Y Y
ABTC76885 SAMAR55583 Gehyra dubia 20k NNE Biloela Qld -24.22 150.64 Y Y Y
ABTC28493 Gehyra ipsa Bungle Bungles WA -17.38 128.39 Y Y Y
ABTC30614 NTMR23804 Gehyra koira Wickham River, Gregory NP NT -16.84 130.24 Y Y
ABTC22091 SAMAR28977 Gehyra lazelli Gawler Ranges SA -32.62 136.35 Y Y Y
ABTC52233 SAMAR31984 Gehyra lazelli Yumbarra CP SA -31.77 133.47 Y Y Y
ABTC74062 SAMAR52962 Gehyra lazelli Arkaroola SA -30.12 139.45 Y Y Y
ABTC50301 AMSR135529 Gehyra membranacruralis near Sibilanga Mission SP Y Y Y
ABTC12100 SAMAR38830 Gehyra minuta Hatches Creek Mine NT -20.95 135.22 Y Y Y
ABTC61704 NTMR13645 Gehyra minuta 80k S Renner Springs NT -18.95 134.13 Y Y Y
ABTC61706 NTMR13647 Gehyra minuta 80k S Renner Springs NT -18.95 134.13 Y Y Y
ABTC61707 NTMR13648 Gehyra minuta 80k S Renner Springs NT -18.95 134.13 Y Y
ABTC103197 Gehyra montium Brown Range, Warburton WA -26.13 126.57 Y Y Y
ABTC103204 Gehyra montium Cavanagh Range WA -26.1705 127.9697 Y Y
ABTC103208 Gehyra montium Blackstone Range WA -26.0002 128.1476 Y Y
ABTC105323 WAMR131737 Gehyra montium Clutterbuck Hills WA -24.6158 126.2231 Y Y Y
209
ABTC105324 WAMR164289 Gehyra montium Clutterbuck Hills WA -24.5669 126.2544 Y Y Y
ABTC105382 WAMR108744 Gehyra montium Gordon Downs Homestead WA -18.6833 128.5833 Y Y
ABTC105384 WAMR108948 Gehyra montium Telfer WA -21.8833 122.3667 Y
ABTC105545 WAMR111852 Gehyra montium Red Hill WA -23.4908 120.3172 Y Y
ABTC105557 WAMR114924 Gehyra montium Nullagine WA -21.6500 120.0833 Y Y Y
ABTC105560 WAMR115627 Gehyra montium Cliff Head WA -29.5333 114.9833 Y Y Y
ABTC105566 WAMR117145 Gehyra montium Yamarna Station WA -27.9666 123.7667 Y Y
ABTC105585 WAMR129901 Gehyra montium West Angelas WA -23.2500 118.6667 Y Y
ABTC105591 WAMR131746 Gehyra montium Hamersley Station WA -22.3647 117.8633 Y Y Y
ABTC105593 WAMR132551 Gehyra montium Degrey River Station WA -20.2263 119.1794 Y Y Y
ABTC105599 WAMR135118 Gehyra montium Bullabulling WA -30.8625 120.9067 Y Y Y
ABTC105610 WAMR139610 Gehyra montium Mount Hodgson WA -22.4408 121.128 Y Y
ABTC105624 WAMR156600 Gehyra montium Woodie Woodie WA -21.6200 121.2139 Y Y
ABTC105626 WAMR156679 Gehyra montium Yarrie Minesite WA -20.6491 114.3031 Y Y
ABTC105634 WAMR161141 Gehyra montium Bonney Downs Homestead WA -22.182 119.933 Y Y Y
ABTC105649 WAMR170390 Gehyra montium Balfour Downs Homestead WA -22.6111 120.729 Y Y
ABTC105652 WAMR170890 Gehyra montium Marble Bar WA -21.4381 119.541 Y Y Y
ABTC105653 WAMR77994 Gehyra montium Warburton WA -26.0000 126.7500 Y
ABTC13409 SAMAR51087 Gehyra montium Tennant Creek dump NT -19.65 134.18 Y Y Y
ABTC31296 Gehyra montium Petermann Range WA -25.01 128.93 Y Y Y
ABTC31336 Gehyra montium Giles WA -25.03 128.30 Y
ABTC41477 SAMAR44368 Gehyra montium 14k ENE Mt Cooparinna SA -26.34 130.10 Y Y Y
ABTC41478 SAMAR44369 Gehyra montium 14k ENE Mt Cooparinna SA -26.34 130.10 Y Y Y
ABTC41480 SAMAR44370 Gehyra montium 14k ENE Mt Cooparinna SA -26.34 130.10 Y Y
ABTC41553 SAMAR44407 Gehyra montium 8.4k NW Mt Kintore SA -26.50 130.44 Y Y Y Y
ABTC41770 SAMAR46107 Gehyra montium 21k ENE Pipalyatjara SA -26.12 129.37 Y Y Y Y
ABTC41777 SAMAR46134 Gehyra montium 16k E Pipalyatjara SA -26.16 129.33 Y Y Y Y
ABTC41778 SAMAR46135 Gehyra montium 16k E Pipalyatjara SA -26.16 129.33 Y Y Y Y
ABTC41794 SAMAR46139 Gehyra montium 40k NE Pipalyatjara NT -25.98 129.48 Y Y Y
ABTC41961 SAMAR48732 Gehyra montium Mt Lindsay SA -27.03 129.88 Y Y
ABTC41962 SAMAR48733 Gehyra montium Mt Lindsay SA -27.03 129.88 Y Y Y Y
ABTC41964 SAMAR48735 Gehyra montium Mt Lindsay SA -27.03 129.88 Y Y
ABTC41972 SAMAR48708 Gehyra montium 4k W Mt Lindsay SA -27.03 129.84 Y Y
ABTC41982 SAMAR48718 Gehyra montium 4k W Mt Lindsay SA -27.03 129.84 Y Y Y Y
ABTC79922 SAMAR56497 Gehyra montium 5.6k W Mount Hoare SA -27.06 129.64 Y Y Y
ABTC91567 WAMR166310 Gehyra montium 4.2k SSE Pungkulpirri Waterhole WA -24.6964 128.7628 Y Y
ABTC91633 WAMR166321 Gehyra montium 3.4k NE Mt Fanny WA -25.7583 128.5983 Y Y Y Y
ABTC91637 WAMR166314 Gehyra montium Kutjuntari Rockhole WA -24.8914 128.7692 Y Y
ABTC91656 WAMR166317 Gehyra montium Morgan Range WA -259386 128.3897 Y Y
ABTC91658 WAMR166318 Gehyra montium Morgan Range WA -259386 128.3897 Y Y Y
ABTC91760 WAMR166312 Gehyra montium Morgan Range WA -259386 128.3897 Y
210
ABTC13940 Gehyra mutilata Krakatau Y Y
ABTC32321 Gehyra mutilata Dumaguete, Negros Island Y Y Y
2058 BP02058 Gehyra nana King Edward River Crossing WA -14.45 126.66 Y Y Y
ABTC32281 UMMZ182803 Gehyra oceanica Tanna Island Y Y Y
ABTC49805 AMSR129847 Gehyra oceanica Guleguleu Normanby Island MBP Y
ABTC72525 NTMR26111 Gehyra pamela ~15k S Camp Arnhemland Plateau NT -13.38 133.38 Y Y Y
ABTC11726 SAMAR34053 Gehyra pilbara 40k E Mt Newman WA -23.18 119.98 Y Y
ABTC31246 Gehyra pilbara The Granites NT -28.04 117.83 Y Y
ABTC105474 WAMR165102 Gehyra punctata Millstream Homestead WA -21.518 117.043 Y Y
ABTC105480 WAMR170815 Gehyra punctata Old Pilga Homestead WA -21.480 119.414 Y Y
ABTC59765 AMSR123098 Gehyra punctata Kalli HS WA 117.12 -26.89 Y Y
ABTC59773 AMSR123115 Gehyra punctata Pells Creek crossing WA -25.24 115.53 Y Y Y
ABTC62348 WAMR106088 Gehyra punctata Woodstock Station WA -21.61 118.95 Y Y Y
ABTC105487 WAMR108683 Gehyra purpurascens Banjawarn Homestead WA -27.72 121.8167 Y Y Y
ABTC42153 SAMAR50164 Gehyra purpurascens 14.4k S Sentinel Hill SA -26.21 132.44 Y Y Y
ABTC58138 SAMAR45300 Gehyra purpurascens Olympic Dam SA -30.38 136.85 Y Y Y
ABTC58533 SAMAR48599 Gehyra purpurascens 12.3k NNW Mt Cheesman SA -27.31 130.27 Y Y Y
ABTC11939 SAMAR34220 Gehyra robusta 7k E Mount Isa Qld -20.72 139.55 Y Y
ABTC105535 WAMR104995 Gehyra variegata Old Rainy Rocks WA -29.7327 119.6169 Y Y Y
ABTC105539 WAMR108602 Gehyra variegata Pannawonica WA -21.7833 116.2500 Y Y Y
ABTC105542 WAMR110308 Gehyra variegata Mile Camp WA -22.7073 119.709 Y Y Y
ABTC105544 WAMR111848 Gehyra variegata Wheelarra Hill WA -23.3725 120.458 Y Y Y
ABTC105547 WAMR113685 Gehyra variegata Dalwallinu WA -30.2833 116.7167 Y
ABTC105549 WAMR114039 Gehyra variegata Peron Hs WA -25.8333 113.5500 Y Y
ABTC105554 WAMR114499 Gehyra variegata Waggrakine WA -28.7000 114.6667 Y Y Y
ABTC105555 WAMR114501 Gehyra variegata Wicherina Dam WA -28.7333 115.0000 Y Y Y
ABTC105556 WAMR114915 Gehyra variegata Capricorn Roadhouse WA -23.7166 119.7167 Y Y
ABTC105558 WAMR115241 Gehyra variegata Eurardy Station WA -27.5666 114.6667 Y Y Y
ABTC105563 WAMR117022 Gehyra variegata Babbage Island WA -24.8666 113.6333 Y Y Y
ABTC105564 WAMR117025 Gehyra variegata Bush Bay WA -25.1500 113.7833 Y Y Y
ABTC105567 WAMR117153 Gehyra variegata Dead Horse Rocks WA -29.3666 121.2833 Y Y Y
ABTC105568 WAMR117168 Gehyra variegata Zanthus WA -31.0666 123.5833 Y Y Y
ABTC105573 WAMR119033 Gehyra variegata Wuraga WA -28.4166 116.2833 Y
ABTC105581 WAMR126810 Gehyra variegata WA -24.5113 114.6367 Y Y Y
ABTC105597 WAMR132901 Gehyra variegata Jilakin Rock WA -32.6666 118.3333 Y Y Y
ABTC105604 WAMR136313 Gehyra variegata Muggon WA -26.5269 115.5250 Y Y Y
ABTC105605 WAMR136645 Gehyra variegata Lake Mason WA -27.7127 119.4006 Y Y Y
ABTC105609 WAMR139014 Gehyra variegata Mandora WA -19.8083 121.4639 Y
ABTC105611 WAMR140926 Gehyra variegata Peak Eleanora WA -33.1666 121.2667 Y Y Y
ABTC105613 WAMR141662 Gehyra variegata Cape Rose WA -25.7500 113.6583 Y Y Y
ABTC105614 WAMR141670 Gehyra variegata Baudin Island WA -26.5166 113.6500 Y
211
ABTC105615 WAMR144114 Gehyra variegata Ora Banda WA -30.3688 121.0675 Y Y
ABTC105616 WAMR144777 Gehyra variegata Bungalbin Hill WA -30.4666 119.6000 Y Y
ABTC105619 WAMR146951 Gehyra variegata Mount Gibson WA -29.5886 117.4128 Y Y
ABTC105623 WAMR156487 Gehyra variegata Goodiadarrie Hills WA -22.6725 118.9367 Y Y Y
ABTC105625 WAMR156674 Gehyra variegata North West Coastal Hwy WA -26.8169 114.6153 Y Y Y
ABTC105629 WAMR157811 Gehyra variegata Karara Station WA -29.1891 116.7119 Y Y Y
ABTC105638 WAMR162450 Gehyra variegata Meekatharra WA -26.591 118.497 Y Y
ABTC105641 WAMR163321 Gehyra variegata Neale Junction WA -28.6883 125.8483 Y Y Y
ABTC105645 WAMR165160 Gehyra variegata Yanyare River Mouth WA -20.8429 116.367 Y Y Y
ABTC105648 WAMR167541 Gehyra variegata Gascoyne Junction WA -25.4936 114.8650 Y Y Y
ABTC105681 WAMR168151 Gehyra variegata Camp Creek WA -15.5944 125.1872 Y Y Y
ABTC52237 SAMAR31997 Gehyra variegata Mitcherie RH SA -31.49 132.84 Y Y
ABTC52238 SAMAR31998 Gehyra variegata Mitcherie RH SA -31.49 132.84 Y Y
ABTC64320 SAMAR32281 Gehyra variegata 42.5k N Muckera RH SA -29.70 130.12 Y Y
ABTC72576 WAMR141460 Gehyra variegata Faure Island WA -25.90 113.91 Y Y Y Y
ABTC72583 WAMR141467 Gehyra variegata Faure Island WA -25.88 113.89 Y Y Y
ABTC82613 SAMAR59074 Gehyra variegata Mt Gibson Station - camp WA -29.61 117.41 Y Y
ABTC95388 SAMAR57176 Gehyra variegata 48.7k S Vokes Hill Corner SA -28.85 130.48 Y Y
BS9064 Gehyra variegata Eyre Hwy, Nullabor Plain SA -32.40 124.46 Y
BS9065 Gehyra variegata Eyre Hwy, Nullabor Plain SA -32.40 124.46 Y
R64106 SAMAR64106 Gehyra lazelli Terrapinna Springs SA -29.92 139.67 Y Y Y
2072 BP02072 Gehyra occidentalis Manning Gorge WA -16.64 125.91 Y Y Y
2061 BP02061 Gehyra xenpous King Edward River Crossing WA -14.45 126.66 Y Y
2065 Gehyra xenpous King Edward River Crossing WA -14.45 126.66 Y Y Y
ABTC32736 Hemiphyllodactylus typhus Suva Y Y Y
ABTC50488 AMSR136386 Lepidodactylus lugubris Honiara, Guadalcanal Y Y Y
212
Appendix 3: Samples used for dating analysis in Chapter 4.
Genus Species Acession No.
Aristelliger georgeensis HQ426261
Calotes calotes AY662584
Chondrodactylus angulfier DQ275447
Christinus marmoratus FJ855440
Coleodactylus septentrionalis EU435212
Cordylus polyzonus EU366444
Ctenotus robustus AY662630
Cyrtodactylus loriae EU268289
Cyrtopodion scabrum HQ426275
Dixonius siamensis EU054283
Ebenavia inunguis EF536143
Eremias sp. AY662615
Eublepharis turcmenicus AY662622
Euleptes europea EF534806
Euprepis auratus AY662629
Gehyra australis ABTC28970
Gehyra oceanica ABTC32281
Gehyra variegata ABTC105487
Gekko gecko AY662625
Gloydius halys AY662614
Gymodactylus amarali HQ426288
Haemodracon riebeckii HM212506
Hemidactylus frenatus EU108534
Homonota fasciata EU293629
Homopholis fasciata EU054226
Lepidoblepharis xanthostigma EU435217
Naja naja EU366432
Osteolaemus tetrasips FJ390081
Ramphotyphlops braminus AY444062
Shinisaurus crocodilurus AY662610
Sphenodon punctatus AY487362
Varanus griseus AY662608
Xenopeltis unicolor DQ465564
Xenosaurus grandis AY662607
213
Appendix 4: Details of samples used for species tree analysis in Chapter 4
ABTC
Number Species ND2 PRLR H3 MCR A1 A2 Rag
ABTC11826 australis Yes Yes Yes
ABTC28970 australis Yes Yes Yes Yes Yes
ABTC28544 australis Yes Yes Yes
ABTC11877 australis Yes Yes Yes
ABTC29516 australis Yes Yes Yes Yes Yes
ABTC44765 baliola Yes Yes Yes Yes Yes Yes
ABTC44485 baliola Yes Yes Yes Yes Yes Yes
ABTC90224 barea Yes Yes
ABTC90183 barea Yes Yes
ABTC11903 borroloola Yes Yes Yes Yes Yes
ABTC11809 borroloola Yes Yes
ABTC11888 borroloola Yes Yes
ABTC29880 borroloola Yes Yes Yes
ABTC11887 borroloola Yes Yes
ABTC11923 borroloola Yes Yes Yes Yes Yes Yes
ABTC29579 borroloola Yes Yes
ABTC29556 borroloola Yes Yes Yes Yes
ABTC77213 catenata Yes Yes Yes
ABTC32130 catenata Yes Yes Yes
ABTC32121 catenata Yes Yes Yes
ABTC09994 CladeI Yes Yes
ABTC30293 CladeI Yes Yes Yes Yes Yes
ABTC24050 CladeI Yes Yes Yes
ABTC24132 CladeI Yes Yes Yes Yes
ABTC91637 CladeII Yes Yes Yes Yes Yes
ABTC33882 CladeII Yes Yes
ABTC42363 CladeII Yes Yes
ABTC73410 CladeII Yes Yes Yes Yes Yes Yes
ABTC42130 CladeII Yes
ABTC105580 CladeIII Yes Yes Yes Yes Yes Yes
ABTC105541 CladeIII Yes Yes
ABTC105565 CladeIII Yes Yes
ABTC105583 CladeIII Yes Yes
ABTC59760 CladeIII Yes Yes Yes Yes Yes Yes
ABTC09031 CladeIV Yes Yes Yes
ABTC77068 CladeIV Yes Yes Yes
ABTC11968 CladeIV Yes Yes Yes
ABTC09066 CladeIV Yes Yes
ABTC13398 CladeIV Yes Yes Yes Yes Yes Yes
ABTC29239 CladeV Yes Yes
ABTC23879 CladeV Yes Yes
ABTC77006 CladeV Yes Yes Yes Yes Yes Yes
ABTC06816 CladeV Yes Yes
ABTC03711 CladeV Yes Yes
ABTC15185 CladeV Yes Yes Yes Yes Yes
ABTC29571 dubia Yes Yes Yes
ABTC70702 dubia Yes Yes Yes
ABTC77212 dubia Yes Yes Yes
ABTC77195 dubia Yes Yes Yes Yes
ABTC15115 dubia Yes Yes Yes Yes Yes Yes
ABTC16191 dubia Yes Yes Yes Yes
ABTC28493 ipsa Yes Yes Yes
214
ABTC28547 ipsa Yes Yes Yes Yes Yes
ABTC28490 ipsa Yes Yes Yes
ABTC105310 koira Yes Yes Yes Yes Yes
ABTC105321 koira Yes Yes Yes
ABTC30613 koira Yes Yes Yes
ABTC30614 koira Yes Yes Yes Yes Yes
ABTC30107 koira Yes Yes
ABTC52233 lazelli Yes Yes Yes Yes Yes Yes Yes
ABTC74065 lazelli Yes Yes Yes
ABTC74197 lazelli Yes Yes Yes Yes Yes
ABTC50301 membranacruralis Yes Yes Yes Yes Yes
ABTC12100 minuta Yes Yes Yes Yes Yes
ABTC61706 minuta Yes Yes
ABTC61704 minuta Yes Yes Yes
ABTC61707 minuta Yes Yes Yes Yes Yes Yes Yes
ABTC105323 montium Yes Yes
ABTC41961 montium Yes Yes Yes
ABTC105585 montium Yes Yes Yes
ABTC105557 montium Yes Yes Yes
ABTC41553 montium Yes Yes Yes Yes Yes Yes
ABTC32321 mutilata Yes Yes Yes Yes Yes
ABTC13940 mutilata Yes Yes Yes Yes Yes
ABTC105329 nana Yes Yes Yes Yes Yes
2058 nana Yes Yes Yes
2059 nana Yes Yes Yes Yes Yes
ABTC105326 nana Yes Yes Yes
ABTC105372 occidentalis Yes Yes Yes Yes
ABTC105373 occidentalis Yes Yes Yes
2072 occidentalis Yes Yes Yes Yes Yes
ABTC105379 occidentalis Yes Yes
ABTC105352 occidentalis Yes Yes
ABTC32281 oceanica Yes Yes Yes Yes
ABTC49805 oceanica Yes
R64106 ornata Yes Yes Yes
R64430 ornata Yes
ABTC27725 pamela Yes Yes Yes
ABTC11872 pamela Yes Yes Yes
ABTC72525 pamela Yes Yes Yes
ABTC29167 pamela Yes Yes Yes
ABTC105408 pilbara Yes Yes Yes
ABTC105466 pilbara Yes Yes Yes Yes Yes Yes
ABTC105402 pilbara Yes Yes Yes
ABTC105403 pilbara Yes Yes Yes Yes
ABTC105474 punctata Yes Yes Yes
ABTC59773 punctata Yes Yes Yes Yes Yes
ABTC59765 punctata Yes Yes Yes
ABTC62348 punctata Yes Yes Yes Yes Yes Yes
ABTC105480 punctata Yes Yes
ABTC42153 purpurascens Yes Yes Yes
ABTC58553 purpurascens Yes Yes Yes
ABTC105487 purpurascens Yes Yes Yes
ABTC58138 purpurascens Yes Yes Yes Yes
ABTC00580 purpurascens Yes Yes Yes Yes
ABTC08949 robusta Yes Yes
ABTC11946 robusta Yes Yes Yes
ABTC11939 robusta Yes Yes Yes Yes Yes Yes
215
ABTC72858 robusta Yes Yes
ABTC11941 robusta Yes
ABTC105539 variegata Yes Yes Yes
ABTC105615 variegata Yes Yes Yes
ABTC82613 variegata Yes Yes Yes
ABTC105547 variegata Yes Yes Yes
ABTC105645 variegata Yes Yes Yes Yes Yes
2061 xenopus Yes Yes Yes Yes Yes Yes Yes
ABTC105662 xenopus Yes Yes
ABTC105659 xenopus Yes Yes Yes
ABTC13017 xenopus Yes Yes Yes Yes Yes
ABTC105679 xenopus Yes Yes
216
Appendix 5: Individual gene trees extracted from *Beast Species tree analysis.
217
218
219
220
221
222
Appendix 6: Details of the specimens and samples used for Chapter 5.
ABTC Regno mtDNA microsatellites morphology species Locality Longitude Latitude
Map
No.
ABTC40737 SAMAR26491 yes yes lazelli near Yalata Roadhouse 131.27 -31.4
ABTC89675 SAMAR61563 yes lazelli 11.3k NNW Penong 132.8905 -31.8739 4
ABTC17956 SAMAR38988 yes yes lazelli 15k N Witchellina Station 133.58 -32.28
ABTC52233 SAMAR31984 yes lazelli Yumbarra CP 133.67 -31.67 5
ABTC89462 SAMAR61313 yes yes lazelli 8.2k NNW Oak Hill 134.29 -32.15
ABTC95855 SAMAR56567 yes lazelli 5.8k NE Kalbrae 134.92 -33.53
ABTC95873 SAMAR56576 yes yes lazelli 26.5k WSW Minnipa 135.37 -33.01
ABTC52383 SAMAR25435 yes yes lazelli Mt Ive HS 136.07 -32.4
ABTC52434 SAMAR28515 yes lazelli 120k NE Minnipa 136.2833333 -32.3333333 23
ABTC22091 SAMAR28977 yes lazelli Gawler Ranges 136.35 -32.6166667 7
ABTC15382 SAMAR38973 yes lazelli 3k W Cowell 136.85 -33.68
ABTC18031 SAMAR38986 yes lazelli Middleback Range 137.1 -33.1833333 9
ABTC18032 SAMAR38985 yes lazelli Middleback Range 137.1 -33.1833333 9
ABTC57241 SAMAR38570 yes lazelli Middleback Ranges 137.1333333 -33.1666667 8
ABTC33226 SAMAR46283 yes yes lazelli 4.5k NE Mt Brown 138.02 -32.47
ABTC52394 SAMAR25874 yes yes lazelli Witchelina Station 138.05 -30.02
ABTC15326 SAMAR38967 yes yes lazelli Warren Gorge 138.08 -32.07
ABTC70444 SAMAR53259 yes lazelli 4.5k ENE Telowie 138.12 -33.04
ABTC95467 SAMAR56397 yes lazelli 1.1k WNW White Cliff Hill 138.3 -30.14
ABTC70511 SAMAR53080 yes yes lazelli 5k E Mt Elm 138.36 -31.91
ABTC70527 SAMAR53088 yes yes lazelli 5k E Mt Elm 138.36 -31.91
ABTC70422 SAMAR53226 yes yes lazelli 5k W Wilpena Chalet 138.55 -31.53
ABTC39325 SAMAR52366 yes yes lazelli 4.7k W Parachilna Hill 138.55 -31.13
ABTC70412 SAMAR53239 yes yes lazelli 4.3k WSW Wilpena Chalet 138.56 -31.54
ABTC70415 SAMAR53211 yes yes lazelli 1.2k SW Wilpena Chalet 138.59 -31.54
ABTC70423 SAMAR53213 yes yes lazelli 1.2k SW Wilpena Chalet 138.59 -31.54
ABTC74017 SAMAR52674 yes yes lazelli 2k SSE Warraweena HS 138.64 -30.79
ABTC39291 SAMAR52214 yes lazelli
2.2k ESE Horn Camp Ruin, Alpana
Station 138.6438889 -31.1158333 18
223
ABTC70425 SAMAR53245 yes yes lazelli Appealinna Ruins 138.7 -31.44
ABTC58818 SAMAR51289 yes yes lazelli Finke Creek 138.72 -30.52
ABTC58819 SAMAR51290 yes yes lazelli Finke Creek 138.72 -30.52
ABTC39251 SAMAR52198 yes yes lazelli Patawarta Bore Narrina Station 138.73 -30.94
ABTC39257 SAMAR52189 yes yes lazelli 0.8k S Patawarta Bore Narrina Station 138.73 -30.94
ABTC39258 SAMAR52190 yes yes lazelli 0.8k S Patawarta Bore Narrina Station 138.73 -30.94
ABTC39239 SAMAR52181 yes yes yes lazelli 2.1k SW Malkegna Bore Narrina Station 138.75 -30.96 17
ABTC39250 SAMAR52184 yes yes lazelli 2.1k SW Malkegna Bore Narrina Station 138.75 -30.96
ABTC38861 SAMAR51801 yes lazelli 9k SSE Mudlapena Spring 138.8158 -30.6897 12
ABTC39217 SAMAR51800 yes yes lazelli 9k SSE Mudlapena Spring 138.82 -30.69
ABTC39223 SAMAR52177 yes yes lazelli 9k SSE Mudlapena Spring 138.82 -30.69
ABTC39237 SAMAR51801 yes yes yes lazelli 9k SSE Mudlapena Spring 138.82 -30.69
ABTC58817 SAMAR51288 yes yes lazelli Mt Serle Station 138.88 -30.53
ABTC70047 SAMAR53786 yes yes lazelli 7.5k NNE Strathalbyn 138.92 -35.19
ABTC74104 SAMAR52896 yes yes yes lazelli Gammon Ranges NP 139.04 -30.47 22
ABTC15181 SAMAR38950 yes yes yes lazelli Tungkillo 139.1 -34.8166667 1
ABTC15183 SAMAR38952 yes yes yes lazelli 3k E Tungkillo 139.1 -34.82 2
ABTC15184 SAMAR38953 yes lazelli 3k E Tungkillo 139.1 -34.82 2
ABTC15196 SAMAR38955 yes lazelli Tungkillo 139.1 -34.8166667 1
ABTC74158 SAMAR52911 yes yes yes lazelli Gammon Ranges NP 139.15 -30.43 28
ABTC74160 SAMAR52912 yes yes yes lazelli Gammon Ranges NP 139.15 -30.43 20
ABTC74161 SAMAR52913 yes yes lazelli Gammon Ranges NP 139.15 -30.43
ABTC74072 SAMAR52907 yes yes lazelli Gammon Ranges NP 139.17 -30.42
ABTC74154 SAMAR52900 yes yes yes lazelli Gammon Ranges NP 139.17 -30.42 29
ABTC39130 SAMAR52012 yes yes yes lazelli 4.7k NNE Warden Hill 139.24 -30.4 19
ABTC18043 SAMAR32860 yes yes lazelli 12k N Sedan 139.3 -34.47
ABTC74057 SAMAR52973 yes yes yes lazelli Mt Freeling 139.42 -30.11 26
ABTC74058 SAMAR52974 yes yes lazelli Mt Freeling 139.42 -30.11
ABTC74059 SAMAR52975 yes lazelli Mt Freeling 139.42 -30.11
ABTC74063 SAMAR52988 yes yes yes lazelli Arkaroola 139.42 -30.11 27
ABTC74065 SAMAR52977 yes yes yes lazelli Mt Freeling 139.42 -30.11 26
224
ABTC74186 SAMAR53006 yes yes variegata Arkaroola 139.42 -30.11
R64445 yes variegata 17km E Mt Fitton HS 139.420833 -29.904167
R64446 yes variegata 17km E Mt Fitton HS 139.420833 -29.904167
ABTC74062 SAMAR52962 yes yes yes lazelli Arkaroola 139.45 -30.12 6
ABTC74066 SAMAR52963 yes yes yes lazelli Arkaroola 139.45 -30.12 6
ABTC74197 SAMAR52958 yes yes yes lazelli Arkaroola 139.45 -30.12 6
ABTC74199 SAMAR52960 yes yes yes lazelli Arkaroola 139.45 -30.12 6
ABTC74200 SAMAR52961 yes yes yes lazelli Arkaroola 139.45 -30.12 6
ABTC74198 SAMAR52959 yes lazelli Arkaroola 139.45 -30
ABTC108002 R64937 yes yes variegata Hidden Valley, Arkaroola 139.505565 -30.114661
ABTC108001 R64936 yes yes variegata Hidden Valley, Arkaroola 139.506723 -30.114268
ABTC108007 R64942 yes yes ornata Hidden Valley, Arkaroola 139.5211367 -30.08302185 24
ABTC108015 No voucher yes variegata Hidden Valley, Arkaroola 139.52116 -30.08525
ABTC108004 R64939 yes yes ornata Hidden Valley, Arkaroola 139.5219403 -30.08479939 24
ABTC108005 R64940 yes yes ornata Hidden Valley, Arkaroola 139.5219403 -30.08479939 24
ABTC108006 R64941 yes yes ornata Hidden Valley, Arkaroola 139.5219403 -30.08479939 24
ABTC108024 No voucher yes variegata 2k W Waterlina Bore, Moolawatana 139.54413 -29.8399
ABTC108025 R64950 yes yes ornata 2k W Waterlina Bore, Moolawatana 139.54553 -29.84042 14
ABTC108023 No voucher yes variegata 2k W Waterlina Bore, Moolawatana 139.54585 -29.8405
ABTC108022 R64945 yes yes ornata 2k W Waterlina Bore, Moolawatana 139.54694 -29.84011 14
ABTC108027 R64953 yes yes ornata 2k W Waterlina Bore, Moolawatana 139.54884 -29.84442 14
ABTC108021 R64943 yes yes ornata 2k W Waterlina Bore, Moolawatana 139.54886 -29.83592 14
R64442 yes variegata Mt Fitton HS 139.553611 -29.987222
R64443 yes variegata Mt Fitton HS 139.553611 -29.987222
ABTC108039 R64955 yes yes ornata
Pepegoona Gorge, Northen Flinders
Ranges 139.60188 -30.08139 10
ABTC108040 R64956 yes yes ornata
Pepegoona Gorge, Northen Flinders
Ranges 139.60188 -30.08139 10
ABTC108037 R64954 yes yes ornata
Pepegoona Gorge, Northen Flinders
Ranges 139.60251 -30.08078 10
ABTC108033 R64944 yes yes ornata
Pepegoona Gorge, Northen Flinders
Ranges 139.60442 -30.08026 10
ABTC108035 No voucher yes variegata
Pepegoona Gorge, Northen Flinders
Ranges 139.60442 -30.08026
225
R64439 yes variegata 3Km E Mt Fitton HS 139.613611 -29.950278
R64440 yes variegata 3Km E Mt Fitton HS 139.613611 -29.950278
R64441 yes variegata 3Km E Mt Fitton HS 139.613611 -29.950278
R64103 yes yes yes ornata Terrapinna Springs 139.6664 -29.9153 31
R64104 yes yes yes ornata Terrapinna Springs 139.6664 -29.9153 31
R64105 yes yes yes ornata Terrapinna Springs 139.6664 -29.9153 31
R64106 yes yes yes ornata Terrapinna Springs 139.6664 -29.9153 31
R64427 yes yes yes ornata Terrapinna Springs 139.6664 -29.9153 31
R64428 yes yes yes ornata Terrapinna Springs 139.6664 -29.9153 31
SAMAR20377 yes ornata Terrapinna Springs 139.6664 -29.9153
R64097 yes variegata Terrapinna Springs 139.7186 -29.9042
R64098 yes yes yes variegata Terrapinna Springs 139.7186 -29.9042
R64099 yes yes variegata Terrapinna Springs 139.7186 -29.9042
R64429 yes yes yes ornata 5km W Moolawatana HS 139.7186 -29.9042 11
R64430 yes yes yes ornata 5km W Moolawatana HS 139.7186 -29.9042
R64431 yes yes yes ornata 5km W Moolawatana HS 139.7186 -29.9042 11
R64432 yes yes yes ornata 5km W Moolawatana HS 139.7186 -29.9042
ABTC68799 SAMAR52596 yes yes lazelli Tombstone Hill 6k N Plumbago HS 139.91 -32.01
ABTC68800 SAMAR52597 yes yes lazelli Tombstone Hill 6k N Plumbago HS 139.91 -32.01 21
ABTC74093 SAMAR52936 yes yes yes lazelli Gammon Ranges NP 139.97 -30.52 13
ABTC74094 SAMAR52937 yes yes yes lazelli Gammon Ranges NP 139.97 -30.52 13
ABTC74095 SAMAR52938 yes yes lazelli Gammon Ranges NP 139.97 -30.52
ABTC74096 SAMAR52939 yes yes lazelli Gammon Ranges NP 139.97 -30.52 13
ABTC40166 SAMAR41450 yes yes lazelli Saltwell 140.12 -32.6
ABTC89242 SAMAR61010 yes lazelli Old Boolcoomata, Bimbowrie Station 140.28 -32.1 3
ABTC88094 SAMAR60602 yes lazelli 2k SE Calico Bore, Bimbowrie Station 140.3161111 -31.9741667 15
ABTC88098 SAMAR60608 yes lazelli 2k WNW Blue Dam, Bimbowrie Station 140.3283333 -32.0747222 30
ABTC88097 SAMAR60620 yes lazelli 2.5k WSW Blue Dam, Bimbowrie Station 140.3333333 -32.0672222 16
ABTC96429 SAMAR58721 yes yes lazelli 5.9k NNW Nelwood HS 140.92 -33.91
ABTC03671 SAMAR38945 yes yes lazelli Lancoona HS 145.883333 -32.366667 25