37
EuMicroSat EuMicroSat db db (Eukaryotic Microsatellite Database) (Eukaryotic Microsatellite Database) How to use EuMicroSat How to use EuMicroSat db db Guru Gobind Singh Indraprastha Guru Gobind Singh Indraprastha University, Delhi University, Delhi http://ipu.ac.in/usbt/EuMicroSat db .htm Cite as : Cite as : Aishwarya V., Grover A. and Sharma P.C. (2007) Aishwarya V., Grover A. and Sharma P.C. (2007) EuMicroSatdb : A database for EuMicroSatdb : A database for microsatellites in the sequenced genomes of eukaryotes. microsatellites in the sequenced genomes of eukaryotes. BMC Genomics BMC Genomics 8(1): 8(1):225 225 Published on (10 July 2007) Published on (10 July 2007)

EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Embed Size (px)

Citation preview

Page 1: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

EuMicroSatEuMicroSatdbdb(Eukaryotic Microsatellite Database)(Eukaryotic Microsatellite Database)

How to use EuMicroSatHow to use EuMicroSatdbdb

Guru Gobind Singh Indraprastha University, DelhiGuru Gobind Singh Indraprastha University, Delhi

http://ipu.ac.in/usbt/EuMicroSatdb.htm

Cite as : Cite as :

Aishwarya V., Grover A. and Sharma P.C. (2007) Aishwarya V., Grover A. and Sharma P.C. (2007) EuMicroSatdb : A database for EuMicroSatdb : A database for microsatellites in the sequenced genomes of eukaryotes.microsatellites in the sequenced genomes of eukaryotes. BMC GenomicsBMC Genomics  8(1):8(1):225225

Published on (10 July 2007)Published on (10 July 2007)

Page 2: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

EuMicroSatEuMicroSatdb db can be used to search for microsatellites from the any of can be used to search for microsatellites from the any of the available genome sequences. the available genome sequences.

Search can be made using various important parameters.Search can be made using various important parameters.

At present EuMicroSatAt present EuMicroSatdb db has microsatellite data of the following specieshas microsatellite data of the following species

Page 3: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

EuMicroSatEuMicroSatdb db can search for both perfect and compound can search for both perfect and compound (perfect) microsatellites and microsatellite clusters(perfect) microsatellites and microsatellite clusters

Simple Microsatellite likeSimple Microsatellite like (ATT)21(ATT)21 (TTC)32(TTC)32 (AACAT)11 (AACAT)11

Compound Microsatellites like Compound Microsatellites like (AAGA)15(GAAA)14(GGAG)6 (AAGA)15(GAAA)14(GGAG)6 (TCTT)18(TCCT)7(TCTT)7(TCTT)18(TCCT)7(TCTT)7

Microsatellite ClustersMicrosatellite Clusters (AT)21(AT)21ATAAATAA(GCC)6(GCC)6TGAGCTAGGCGATAGCTATGAGCTAGGCGATAGCTA(GCG)12(GCG)12

Page 4: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

TIP : The most important thing while using the database is to TIP : The most important thing while using the database is to mark the correct checkbox. This is important as results may mark the correct checkbox. This is important as results may

differ if illogical checks and entries are made.differ if illogical checks and entries are made.

This Demo will help to efficiently use EuMicroSatThis Demo will help to efficiently use EuMicroSatdb.db.Few case studies are given to demonstrate the Few case studies are given to demonstrate the

working of the databaseworking of the database

Page 5: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Searching ParametersSearching Parameters

Repeat Unit Length (mono-, di-, tri-, tetra-, penta-, Repeat Unit Length (mono-, di-, tri-, tetra-, penta-, hexa-)hexa-)

Repeat SequenceRepeat Sequence The sequence of the microsatellite e.g. GCCThe sequence of the microsatellite e.g. GCC Repeat No. Repeat No. (AT)(AT)10 10 has a repeat number 10has a repeat number 10 Microsatellite Length Microsatellite Length (ATT)20 has a motif length 60(ATT)20 has a motif length 60 Position Position Where the microsatellite is located on the chromosome)Where the microsatellite is located on the chromosome) Interruption Size (Microsatellite Cluster)Interruption Size (Microsatellite Cluster) (Difference between two adjacent microsatellites)(Difference between two adjacent microsatellites)

Page 6: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

All the Case Studies pertain to All the Case Studies pertain to chromosome 1 of chromosome 1 of Homo sapiens Homo sapiens but but same pattern may be followed for rest of same pattern may be followed for rest of databasedatabase

Page 7: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Perfect microsatellite Perfect microsatellite SearchingSearching

You can search a microsatellite for any You can search a microsatellite for any desired sequence desired sequence

Page 8: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Case Study 1 Case Study 1 (Perfect microsatellite)(Perfect microsatellite)

If you want to search for a simple pentanucleotide If you want to search for a simple pentanucleotide repeat microsatellite with tandem repeat GGTTT, repeat microsatellite with tandem repeat GGTTT, microsatellite length greater than 210 microsatellite length greater than 210

To search for such microsatellite, use the following To search for such microsatellite, use the following vaules.vaules.

TIP : The most important thing while using the database is to TIP : The most important thing while using the database is to mark the correct checkbox. This is important as results may mark the correct checkbox. This is important as results may

differ if ill logical checks and entries are made.differ if ill logical checks and entries are made.

Page 9: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Input Input

Page 10: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Output Output

Page 11: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Flanking SequencesFlanking Sequences

EuMicroSatEuMicroSatdb db also provides 200bp upstream also provides 200bp upstream and downstream flanking sequences of the and downstream flanking sequences of the extracted microsatellite to design primersextracted microsatellite to design primers

The output of which is as followsThe output of which is as follows

Page 12: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Case Study 2Case Study 2(Perfect microsatellite)(Perfect microsatellite)

If you want to search for all the simple If you want to search for all the simple trinucleotide microsatellites in a trinucleotide microsatellites in a particular region of the chromosome… particular region of the chromosome…

Page 13: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

InputInput

Page 14: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Output Output

Page 15: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Case Study 3Case Study 3(undefined perfect microsatellite)(undefined perfect microsatellite)

If you want to search for the a particular If you want to search for the a particular trinucleotide repeat e.g. TTC whose trinucleotide repeat e.g. TTC whose repeat number is greater than 50repeat number is greater than 50

Page 16: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Input Input

Page 17: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Output Output

Page 18: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

If you want to search for all the If you want to search for all the microsatellites present on the microsatellites present on the chromosome in one go, use these valueschromosome in one go, use these values

Page 19: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Input Input

Page 20: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Output Output

Page 21: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

For searching compound For searching compound microsatellites, search parameters microsatellites, search parameters

are as followsare as follows

Page 22: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Case Study 5Case Study 5(compound microsatellite)(compound microsatellite)

If you want to search for the compoud If you want to search for the compoud microsatellite with a Tetra-Tetra-Tetra microsatellite with a Tetra-Tetra-Tetra combination, with the microsatellite combination, with the microsatellite length greater than 100 bplength greater than 100 bp

Page 23: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Input Input

Page 24: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Output Output

Page 25: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Case Study 6Case Study 6(compound microsatellite)(compound microsatellite)

If you want to search for the a compoud If you want to search for the a compoud microsatellite with a GTGC-CTTC-microsatellite with a GTGC-CTTC-CCTC combination, with microsatellite CCTC combination, with microsatellite between 100 and 150between 100 and 150

Page 26: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Input Input

Page 27: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Output Output

Page 28: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Case Study 7Case Study 7(compound microsatellite)(compound microsatellite)

If you want to search for the a compoud If you want to search for the a compoud microsatellite with a combination TTTC-microsatellite with a combination TTTC-TCTT-TC, with the fourth association TCTT-TC, with the fourth association being a tetra- and fifth being a di- being a tetra- and fifth being a di- repeat (sequence unspecified) and repeat (sequence unspecified) and microsatellite length greater than 100.microsatellite length greater than 100.

Page 29: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

InputInput

Page 30: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

* indicates that (CT)12 can also be read as a (TC)12* indicates that (CT)12 can also be read as a (TC)12

Output Output

Page 31: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Case Study 8Case Study 8(compound microsatellite)(compound microsatellite)

If you want to search for a If you want to search for a microsatellite with a tri combination, microsatellite with a tri combination, GAA-AAG-AAC, with repeat number GAA-AAG-AAC, with repeat number more than 5 for GAA and more than 5 more than 5 for GAA and more than 5 for AAC (suppose you do not know the for AAC (suppose you do not know the repeat number for AAG)repeat number for AAG)

Page 32: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

InputInput

Page 33: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Output Output

Page 34: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Case Study 9Case Study 9(Imperfect microsatellite)(Imperfect microsatellite)

To search for imperfect microsatellites you To search for imperfect microsatellites you have to input the interruption value i.e. have to input the interruption value i.e. the desired number of basepair difference the desired number of basepair difference between any two microsatellitesbetween any two microsatellites

Page 35: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

InputInput

Page 36: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

OutputOutput(The output represents two clusters (imperfect microsatellites) (The output represents two clusters (imperfect microsatellites) one from 4-1-1-1 to 4-1-1-5 and the second from 4-1-1-8 to 4-one from 4-1-1-1 to 4-1-1-5 and the second from 4-1-1-8 to 4-

1-1-10)1-1-10)

Page 37: EuMicroSat db (Eukaryotic Microsatellite Database) How to use EuMicroSat db Guru Gobind Singh Indraprastha University, Delhi

Thank you for taking the Thank you for taking the DemoDemo

EuMicroSatEuMicroSatdb db team hopes that this demo will help you team hopes that this demo will help you to efficiently use this database.to efficiently use this database.

If any query still persists please write to usIf any query still persists please write to us http://ipu.ac.in/usbt/EuMicroSatdb.htm