Erg4A and Erg4B are required for conidiation and azole ... · Though the ergosterol biosynthesis pathway in Saccharomyces cerevisiae. 75 . has been characterized (12 ), little is

Erg4A and Erg4B are required for conidiation and azole 1

resistance via regulation of ergosterol biosynthesis in 2

Aspergillus fumigatus 3

Nanbiao Longa, Xiaoling Xua, Qiuqiong Zengb, Hong Sangb, Ling Lua# 4

5

aJiangsu Key laboratory for Microbes and Functional Genomics, Jiangsu Engineering 6

and Technology Research Center for Microbiology, College of Life Sciences, Nanjing 7

Normal University, Nanjing, 210023, China; 8

bDepartment of Dermatology, Jinling Hospital, School of Medicine, Nanjing 9

University, Nanjing, 210002, China; 10

#Corresponding author: Ling Lu, E-mail: [email protected], 11

Phone/Fax: +86-025-85891791 12

13

Running title: Erg4A and Erg4B of Aspergillus fumigatus 14

15

16

ABSTRACT 17

Ergosterol, a fungal specific sterol enriched in cell plasma membranes, is 18

an effective antifungal drug target. However, current knowledge of the 19

ergosterol biosynthesis process in the saprophytic human fungal pathogen 20

Aspergillus fumigatus remains limited. In this study, we identified that 21

two endoplasmic reticulum-localized sterol C-24 reductases encoded by 22

AEM Accepted Manuscript Posted Online 16 December 2016Appl. Environ. Microbiol. doi:10.1128/AEM.02924-16Copyright © 2016, American Society for Microbiology. All Rights Reserved.

on January 7, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

both erg4A and erg4B homologs are required to catalyze the reaction 23

during the final step of ergosterol biosynthesis. Loss of one homolog of 24

Erg4 induces the over-expression of the other one, accompanied with 25

almost normal ergosterol synthesis and the wild-type colony growth. 26

However, double deletions of erg4A and erg4B completely block the last 27

step of ergosterol synthesis, resulting in the accumulation of 28

ergosta-5,7,22,24(28)-tetraenol, a precursor compound of ergosterol. 29

Further studies indicate that erg4A and erg4B are required for conidiation 30

but not for hyphal growth. Importantly, Δerg4AΔerg4B still remains the 31

wild-type virulence in a compromised mouse model but displays 32

remarkable increased susceptibility to antifungal azoles. Our data suggest 33

that inhibitors of Erg4A and Erg4B may serve as effective candidates for 34

the adjunct antifungal agent with azoles. 35

Keywords: ergosterol biosynthesis, Aspergillus fumigatus, sterol C-24 36

reductase, azoles 37

38

IMPORTANCE 39

The knowledge for the ergosterol biosynthesis pathway in the human 40

opportunistic pathogen A. fumigatus is useful for designing and finding 41

new antifungal drugs. In this study, we demonstrated that endoplasmic 42

reticulum-localized sterol C-24 reductases Erg4A and Erg4B are required 43


.asm.org/

Dow

nloaded from

http://aem.asm.org/

for conidiation via regulation of ergosterol biosynthesis. Moreover, 44

inactivation of both Erg4A and Erg4B results in hypersensitivity to the 45

clinically guideline-recommended antifungal drugs itraconazole and 46

voriconazole. Therefore, our finding indicates that inhibiting Erg4A and 47

Erg4B could be an effective approach to alleviate A. fumigatus infection. 48

INTRODUCTION 49

Aspergillus fumigatus is a saprophytic fungus with a large number of 50

small airborne spores that can survive under various environmental 51

conditions. Due to the strong adaptability to environment, A. fumigatus 52

has become the most prevalent opportunistic pathogen which could cause 53

Invasive Aspergillosis (IA) (1). Unfortunately, in recent years, with 54

increased immunosuppressed populations, the incidence of IA has risen 55

simultaneously (2). Though the utilization of antifungal drugs clearly 56

improves the health condition of patients with IA, the continued use of 57

antifungal drugs has also increased the number of drug-resistant strains 58

over the years (3, 4). To date, the most widely used antifungal drugs are 59

azoles, which mainly target ergosterol synthesis since ergosterol is a 60

fungal specific sterol and is primarily distributed in plasma membranes. 61

Moreover, many previous studies have identified that ergosterol is also 62

involved in many biological processes including membrane fluidity, 63

permeability, signal transduction, and others (5-8). For example, in 64


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Aspergillus nidulans, it has been reported that ergosterol-enriched SRDs 65

(sterol-rich membrane domains), which distributed at plasma membranes 66

in hyphal tips, play important roles during the process of polarized 67

growth (9). In addition, oxysterol-binding protein homologs OshA-E, 68

which are involved in the non-vesicular sterol transport for dispatching 69

ergosterol to the distinct site, have also been implicated to regulate the 70

fungal cell growth (10). 71

In the fungal kingdom, the biosynthesis pathway of ergosterol is 72

highly conserved, and approximately 20 enzymes are involved (11). 73

Though the ergosterol biosynthesis pathway in Saccharomyces cerevisiae 74

has been characterized (12), little is known about this pathway in A. 75

fumigatus. To date, components in the ergosterol synthesis pathway in A. 76

fumigatus are known for Erg11, Erg25, and Erg3 (13, 14). Erg11 contains 77

two homologs, Erg11A (Cyp51A) and Erg11B (Cyp51B), which encode 78

two distinct 14-α sterol demethylases. Deletion of erg11A displays no 79

effect on ergosterol levels, whereas the erg11B deletion mutant has a 80

prominent decrease of ergosterol when compared to that of the parental 81

wild-type strain (13). However, double deletions of erg11A and erg11B 82

are lethal in A. fumigatus (15). Likewise, Erg25, an ergosterol synthesis 83

enzyme that is downstream of Erg11, also contains two homologs 84

referred to as Erg25A and Erg25B. Single deletion of erg25A or erg25B 85

leads to no significant differences in production of ergosterol compared to 86


.asm.org/

Dow

nloaded from

http://aem.asm.org/

that of the parental wild-type strain, while double deletions of erg25A and 87

erg25B are lethal (16). Another verified component of the ergosterol 88

synthesis enzyme in A. fumigatus is Erg3, which contains 3 copies termed 89

Erg3A, Erg3B, and Erg3C (17). Notably, single deletion of erg3A or 90

erg3C does not show obvious difference in total ergosterol production 91

compared to that of the parental wild-type strain. Nevertheless, deletion 92

of erg3B results in dramatically decreased ergosterol production (13, 17). 93

Comparatively, cholesterol present in the mammalian cell membranes 94

serves a similar role to ergosterol of fungi. Cholesterol is known as an 95

essential component of plasma membranes functioning in membrane 96

permeability, fluidity and so on (18, 19). However, most enzyme 97

homologs in early steps of ergosterol and cholesterol biosynthesis 98

pathways share common functions, which limits the possibility for the 99

design of antifungal drugs. Interestingly, Erg4, Erg5, and Erg6 are 100

specific components in the ergosterol synthetic pathway, suggesting that 101

these enzymes could be used as promising targets for antifungal drugs 102

(12). It has been reported that the enzyme involved in the last step 103

catalyzing ergosta-5,7,22,24(28)-tetraenol to ergosterol is encoded by 104

erg4 in S. cerevisiae (20). The Scerg4 deletion mutant fails to 105

biosynthesize ergosterol and significantly increases susceptibilities to 106

divalent cations and to several antifungal drugs miconazole, fluconazole 107

and other azoles (20). Similarly, in the plant pathogen Fusarium 108


.asm.org/

Dow

nloaded from

http://aem.asm.org/

graminearum, deletion of Fgerg4 causes the absolute deficiency of 109

ergosterol and increases sensitivities to metal cations and osmotic and 110

oxidative stresses (21). Importantly, the Fgerg4-null mutant showed 111

abnormal vegetative differentiation and attenuated virulence in the plant 112

host (21). 113

Given the difference between the biosynthesis process of ergosterol 114

and cholesterol, the present study examines whether blocking the final 115

step of ergosterol biosynthesis would affect hyphal growth, drug 116

resistance and virulence in A. fumigatus. We identified two predicted 117

homologs of Erg4 in A. fumigatus, here referred to as Erg4A and Erg4B, 118

and indicated that these homologs are required to catalyze the reaction in 119

the final step of ergosterol biosynthesis. Deletion of one homolog induces 120

the overexpression of the other such that either deletion of erg4A or 121

erg4B has almost no effect on ergosterol biosynthesis or conidiation. 122

However, double deletions of erg4A and erg4B completely block the 123

conversion of ergosta-5,7,22,24(28)-tetraenol, a precursor compound of 124

ergosterol, to ergosterol. Further, concurrent inactivation of erg4A and 125

erg4B results in a severe defect for conidiation rather than for hyphal 126

growth. Accordingly, Δerg4AΔerg4B displayed the wild-type virulence in 127

A. fumigatus. Importantly, Δerg4AΔerg4B showed hyper-sensitivities to 128

azole drugs itraconazole and voriconazole, suggesting that inhibitors 129


.asm.org/

Dow

nloaded from

http://aem.asm.org/

of Erg4A and Erg4B may serve as effective candidates for the adjunct 130

antifungal agent with azoles. 131

132

133

MATERIALS AND METHODS 134

Strains, media, and culture conditions. All strains of A. fumigatus 135

used in this study were given in Table 1. Generally, A. fumigatus strains 136

were grown on YAG or YUU (YAG supplemented with 5 mM uridine and 137

10 mM uracil) rich media, according to Jiang et al., containing 2% 138

glucose, 0.5% yeast extract, and 1 ml/L 1000× trace elements (22). To 139

test the sensitivity of A. fumigatus to stresses, NaCl, D-sorbitol, H2O2, 140

menadione, congo red, calcofluor white, itraconazole, voriconazole, 141

terbinafine, amphotericin B, and caspofungin were supplemented in the 142

YAG or YUU medium. For the plate-point assay, 2-μl slurry of the 143

indicated spores from the stock suspensions (107, 106, 105/ml) was 144

spotted onto YAG or YUU. All plates were incubated at 37°C for 1.5-2 145

days. For screen media of transformants, generally, 0.1 μg/ml 146

pyrithiamine (Sigma) or 200 μg/ml hygromycin B (Sangon) was added to 147

the related medium, respectively (23). 148

Deletion and complementation of erg4A and/or erg4B. All primers 149

used in this study were shown in Table 2. For the construction of erg4A 150

deletion cassette, the fusion PCR was used as previously described (24). 151


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Briefly, approximately 1 kb of the upstream and downstream flanking 152

sequences of the erg4A gene were amplified using primers erg4A P1/P3 153

and erg4A P4/P6, respectively. The selection marker hph (approximately 154

4 kb in length) from the plasmid pAN7-1 was amplified with primers hph 155

F/R. Next, the three aforementioned PCR products were combined and 156

used as the template to generate the erg4A deletion cassette using primers 157

erg4A P2/P5, and then transformed into A1160, which belonged to a 158

ku80 null mutant. For the construction of erg4B-null mutant, a similar 159

strategy was used in that the selection marker used in erg4B was pyr4, 160

which was amplified from the plasmid pAL5. For double deletions of 161

erg4A and erg4B, we deleted erg4B in the background of the erg4A-null 162

mutant using the same method. For complementation of Δerg4AΔerg4B 163

receipt strain with wild-type erg4A and/or erg4B gene, the follow strategy 164

was used. First, the basic plasmid pEASY-ptrA was generated. Briefly, 165

the fragment of pyrithiamine resistance cassette (ptrA) that amplified with 166

primers ptrA F/R was subcloned into pEASY-Blunt zero (TransGen 167

Biotech) according to the manufacturer’s directions. Then, the 168

Δerg4AΔerg4B receipt strain was co-transformed with pEASY-ptrA and 169

erg4A and/or erg4B gene, which was amplified with primers erg4A F/R 170

and erg4B F/R respectively. Similar strategy was used to complement 171

ku80 cassette, which was under the control of AngpdA. All transformation 172

procedure in A. fumigatus was performed as described previously (24). 173


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Construction of Erg4A and Erg4B GFP-tagging strains. For 174

generating the Erg4B-GFP strain, approximately 1.5 kb upstream 175

sequence (except the termination codon) and downstream sequence 176

(including the termination codon) of erg4B were amplified using 177

erg4B-gfp P1/P3 and erg4B-gfp P4/P6, respectively. The fragment that 178

containing 5×GA linker, eGFP, and the selection marker AfpyrG was 179

amplified from the plasmid pFNO3 using primers gfp-pyrG F/R. Next, 180

the above three fragments were combined and used as the template to 181

generate the erg4B-gfp cassette using primers erg4B-gfp P2/P5. 182

For generating the GFP-Erg4A strain, we labeled Erg4A with GFP in 183

the N terminal under the control of AngpdA promoter. Briefly, we first 184

amplified gfp (without termination codon) and erg4A using primers 185

gfp-erg4A P1/P2 and gfp-erg4A P3/P4, respectively. After purification, 186

two fragments were used as a template to generate gfp-erg4A cassette 187

using primers gfp-erg4A P1 and gfp-erg4A P4 and then subcloned into 188

the ClaI site of pBARGPE-1 (25) to construct the GFP-Erg4A vector. To 189

label Erg11A with RFP in the GFP-tagged Erg4A and Erg4B strains, an 190

erg11A-rfp (C-tag) cassette under the control of an AngpdA promoter was 191

introduced into the GFP-tagged Erg4A and Erg4B strains respectively as 192

described previously (25). 193

Microscopic observation. To visualize the subcellular localization of 194

GFP-Erg4A and Erg4B-GFP, the indicated strains were incubated in 3 ml 195


.asm.org/

Dow

nloaded from

http://aem.asm.org/

liquid YUU media on coverslips for 18 hours. For nucleus staining, 4, 196

6-diamidino-2-phenylindole (DAPI) (Sigma) that dissolved in phosphate 197

buffer saline (PBS) was used at a final concentration of 0.8 μg/ml and 198

incubated for 5 min at the room temperature after fixing with 4% 199

paraformaldehyde (Polyscience, Warrington, PA). For chitin and 200

sterol-rich membrane domains staining, calcofluor white (Sigma) and 201

filipin (Sigma) were used at a final concentration of 2 μg/ml. For 202

observation of conidiophore structure, coverslips were stuck into the plate 203

in which each strain was spread and incubated at 37°C for 1.5-2 days. 204

Images were captured using a Zeiss Axio imager A1 microscope (Zeiss, 205

Jena, Germany), and the photos were managed with Adobe Photoshop. 206

RNA extraction for qRT-PCR. Total RNA of the indicated strains 207

was isolated from the fresh mycelia using TRIzol (Roche) as described by 208

manufacturer’s instructions. For qRT-PCR, methods were used as 209

previously described (26). 210

Ergosterol extraction and analysis. The extraction and analysis of 211

ergosterol were performed as described previously (13, 27). Briefly, 212

108 spores of each strain were incubated in 100 ml YG or YUU media at 213

the speed of 220 rpm at 37°C for 24 h. Mycelia were obtained via 214

filtration with gauze, washed 3 times with distilled water, and lyophilized. 215

Approximately 100～200 mg dry mycelia were treated with 3 ml of 25% 216

alcoholic potassium hydroxide (3:2, methanol to ethanol) incubated at 217


.asm.org/

Dow

nloaded from

http://aem.asm.org/

85 °C for 1 h. Thereafter, 1 ml of distilled water and 3 ml of pentane were 218

added and vortex for 3 min. It was then set-aside for ten minutes, and the 219

upper layer was transferred to a clear tube and evaporated in a fume hood 220

at room temperature. Before analysis, all samples were dissolved in 1 ml 221

of methanol and filtered with a pore-size 0.2-μm filter. Total ergosterol 222

was analyzed using high-performance liquid chromatograph (HPLC) 223

(Agilent Technologies) and detected at 282 nm on an AQ-C18 column 224

(250 mm by 4.6 mm, 5 μm) with a flow rate of 1 ml/min. 225

Virulence assay. Virulence assays used in this study were performed 226

according to the method developed by Li and Zhang (28, 29). Briefly, 6-8 227

weeks old male mice (ICR) were immunosuppressed on day -3 and -1 228

with cyclophosphamide (150 mg/kg) and on day -1 with hydrocortisone 229

acetate (40 mg/kg). On day 0, after anesthetization with pentobarbital 230

sodium, mice were infected intratracheally with 50-μl slurry that contains 231

106 conidia or 50-μl PBS as the control. After infection, 232

cyclophosphamide (75 mg/kg) was injected every three days to maintain 233

immunosuppression. For mortality statistics, mice were monitored for 14 234

days after inoculation. For histopathological analysis, lungs were isolated 235

from the sacrificed mice and fixed in 4% formaldehyde (v/v) before 236

periodic acid-schiff staining. All animal experiments in this study were 237

performed according to the Guide for the Care and Use of Laboratory 238

Animals of the U.S. National Institutes of Health. The animal 239


.asm.org/

Dow

nloaded from

http://aem.asm.org/

experimental protocol was approved by the Animal Care and Use 240

Committee of Nanjing Normal University, China (permit no. 2090658) 241

according to the governmental guidelines for animal care. 242

243

RESULTS 244

A. fumigatus includes two homologs of S. cerevisiae Erg4. To 245

identify homologs of Erg4 of S. cerevisiae in A. fumigatus, the amino acid 246

sequence of ScErg4 was used as query to perform BLASTP analysis in 247

the genome database of A. fumigatus. The result showed that 248

AFUB_062080 (EDP52170.1, identity 53%, E-value 7e-166) and 249

AFUB_007490 (EDP56047.1, identity 50%, E-value 1e-152) were 250

possible homologs of ScErg4 in A. fumigatus. Subsequent BLASTP 251

analysis using AFUB_062080 and AFUB_007490 as queries were 252

performed in S. cerevisiae database, and results showed that ScErg4 was 253

the best match, suggesting that AFUB_062080 and AFUB_007490, here 254

referred to as Erg4A and Erg4B, might be potential homologs of ScErg4 255

in A. fumigatus. Based on the fact that A. fumigatus contains two 256

predicted Erg4 homologs while S. cerevisiae has only one, we were 257

interested in exploring whether other fungi also contain two Erg4 258

homologs. To this end, Erg4 family members of more than ten fungi were 259

identified from the NCBI GenBank using the BLAST algorithm with a 260

cut-off value of e-55. Interestingly, in the selected yeast-form fungi, 261


.asm.org/

Dow

nloaded from

http://aem.asm.org/

including S. cerevisiae, Candida albicans, Schizosaccharomyces pombe 262

and Cryptococcus gattii, there only has a single homolog of Erg4, 263

whereas many selected filamentous fungi contain two Erg4 homologs, 264

suggesting that the ergosterol biosynthesis pathway in filamentous fungi 265

may be more complicated than that in single-cell yeasts (Fig. 1A). 266

The deduced DNA sequence of erg4A is 1510 bp in length and 267

encodes 471 amino acids, while erg4B has a 2066-bp genomic DNA in 268

length and encodes 568 amino acids. Sequence analysis showed that 269

Erg4A and Erg4B share 62% identity with each other. Intriguingly, 270

compared to Erg4A or ScErg4, Erg4B displays an extended N-terminus 271

with approximately 95 amino acids. The transmembrane domain analysis 272

predicted by the TMHMM v2.0 program 273

(http://www.cbs.dtu.dk/services/TMHMM-2.0) or SMART protein search 274

(http://smart.embl-heidelberg.de/) revealed that both Erg4A and Erg4B 275

contain nine transmembrane structures. In comparison, ScErg4 only 276

contains seven predicted transmembrane structures. This suggests that the 277

function of ScErg4 may be different from that of Erg4A and Erg4B in A. 278

fumigatus (Fig. 1B). 279

Double deletions of erg4A and erg4B result in fluffy colonies with 280

severely impaired conidiation. To investigate the function of Erg4A and 281

Erg4B, we constructed erg4A, erg4B, erg4A and erg4B-null mutants in 282

the background strain A1160 (Δku80, pyrG). Diagnostic PCR showed 283


.asm.org/

Dow

nloaded from

http://aem.asm.org/

that the selection marker hph or pyr4 completely replaced the open 284

reading frame (ORF) of erg4A or erg4B, respectively, suggesting that the 285

ORF of erg4A or erg4B was fully deleted (Fig. S1). As shown in Fig. 2A, 286

the erg4B single deletion mutant showed a similar phenotype to that of its 287

parental wild type with normal colony growth and conidiation in YUU 288

media (Fig. S2A and B). In contrast, the erg4A single deletion mutant 289

displayed a slightly attenuated colony diameter at approximately 20% to 290

that of its parental wild type while conidia numbers per unit area in the 291

Δerg4A mutant was not affected compared to that of its parental wild type 292

(Fig. 2A, S2A and B). However, the Δerg4AΔerg4B double mutant 293

exhibited a nearly white and fluffy colony plus a decreased colony 294

diameter at approximately 26% to that of its parental wild type. The 295

severely impaired conidiation phenomenon suggests that Erg4A and 296

Erg4B are essential for conidiation of A. fumigatus (Fig. 2A, S2A and B). 297

To elucidate how the defect of conidiation occurred in the 298

aforementioned double deletion mutant, we compared the conidiophores 299

of Δerg4A, Δerg4B, Δerg4AΔerg4B, and its parental wild type. As shown 300

in Fig. 2A, for Δerg4A and Δerg4B single mutants, the conidiophore 301

structure was normal and similar to that of its parental wild type with 302

numerous conidia in it, whereas in Δerg4AΔerg4B there were no 303

detectable conidiophore structures. Instead, there were several abnormal 304

septa at the stalk of the foot cell in Δerg4AΔerg4B, while Δerg4A, Δerg4B 305


.asm.org/

Dow

nloaded from

http://aem.asm.org/

single mutants or the parental wild-type strain did not show any 306

detectable septa at the same site (Fig. 2A). To address whether the 307

impaired conidiation of Δerg4AΔerg4B was due to the 308

absence of ergosterol, we tested its colony morphology and conidiation 309

structure with the extra ergosterol addition in solid media. As expected, in 310

the presence of ergosterol, the formation of conidia and conidiophores of 311

Δerg4AΔerg4B was recovered significantly (Fig. 2B), which suggests that 312

the defect in conidiation may be partially caused by ergosterol deficiency. 313

To further identify whether the defected phenotype in Δerg4AΔerg4B was 314

really due to deletions of these two genes, we carried out the 315

complementation experiment. The result in Fig. 2C clearly showed that 316

introducing either erg4A or erg4B gene or both into the Δerg4AΔerg4B 317

receipt strain was able to completely rescue mutant defects in conidiation. 318

Further, to exclude the side effect of ku80 for defect phenotypes, the 319

wild-type ku80 cassette was also introduced into the Δerg4AΔerg4B 320

mutant under the control of AngpdA. Semi-quantitative RT-PCR analysis 321

showed that ku80 was expressed successfully in the tested transformants 322

(Fig. S2C). Phenotypic analysis indicates that wild-type ku80 323

transformants displayed similar phenotypes to Δerg4AΔerg4B with the 324

colony-size reduction as well as the impaired conidial formation (Fig. 2C). 325

It demonstrates that the defect phenotype of Δerg4AΔerg4B was 326

specifically caused by deletions of erg4A and erg4B rather than the result 327


.asm.org/

Dow

nloaded from

http://aem.asm.org/

from any second mutations. Next, we asked if deletion of erg4A and/or 328

erg4B would affect the hyphal growth. We compared the hyphal 329

morphology feature of Δerg4A, Δerg4B, Δerg4AΔerg4B and its parental 330

wild type under the liquid culture condition. First, through the 331

microscopy study for examining the hyphal tips of erg4A and/or 332

erg4B-null mutants, we found that all tested mutants had similar hyphal 333

phenotypes compared to that of its parental wild type, suggesting that 334

deletions of erg4A and/or erg4B have no detectable effect on polarized 335

growth under liquid conditions (Fig. 2D). Due to the abnormal septa 336

displayed in the conidiophore structure of Δerg4AΔerg4B, we then 337

stained the hyphal septa with the chitin dye-calcofluor white. The result 338

showed that no significant difference exists in the septum formation 339

between mutants and the parental wild-type strain (Fig. 2D). As the 340

ergosterol-enriched SRDs are mainly located in hyphal tip membrane, we 341

then stained the SRDs of the indicated strains with the sterol dye-filipin to 342

visualize the sterol distribution. As shown in Fig. 2D, there was no 343

detectable difference between mutants and the parental wild-type strain, 344

which suggests that deletion of erg4A and/or erg4B has no significant 345

effect on the SRDs formation and sterol distribution. Taken together, 346

these data demonstrate that erg4A and erg4B are required for conidiation 347

but not for hyphal growth in A. fumigatus. 348

The Δerg4AΔerg4B mutant demonstrates the wild-type virulence. 349


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Because Δerg4AΔerg4B displayed impaired colony growth and blocked 350

conidiation, we compared its virulence with that of the parental wild-type 351

strain in an immunosuppressed mouse model of invasive aspergillosis. 352

Mice infected with the parental wild-type strain or Δerg4AΔerg4B began 353

to die at day 2 or 3, respectively. Survival of mice was monitored during 354

14 days after infection. As shown in survival curves of Fig. 3A, both 355

parental wild type and the Δerg4AΔerg4B strain caused similar 356

mortalities (about 87%) with no significant difference by the log-rank 357

analysis (p = 0.874) (Fig. 3A). To address whether the death of mice was 358

caused by the infected A. fumigatus strain, we then cultured the lung 359

tissue isolated from the infected dead mice on YAG media. The results in 360

Fig. 3B showed that each tested plate inoculated by lung tissue isolated 361

from relative infection mice displayed the respectively infected live 362

colonies of A. fumigatus. Next, histopathological examinations of lung 363

sections were performed with the periodic acid-schiff staining. As shown 364

in Fig. 3C, a large amount of growing hyphae appeared around the lung 365

airway which were infected by both the parental wild-type and the 366

Δerg4AΔerg4B strains. Therefore, data in the survival curve combined 367

with the histopathological analysis strongly suggest that despite having 368

defects in colony size and conidiation, the Δerg4AΔerg4B mutant exhibits 369

similar virulence to the parental wild-type strain. 370

Erg4A and Erg4B are required for the biosynthesis of ergosterol. 371


.asm.org/

Dow

nloaded from

http://aem.asm.org/

In S. cerevisiae, it has been demonstrated that ScErg4 is the enzyme 372

which catalyzes the final step of ergosterol biosynthesis and the absolute 373

deficiency of ergosterol can be observed without this enzyme (20). To 374

investigate whether A. fumigatus Erg4A and Erg4B are involved in the 375

last step of ergosterol biosynthesis (Fig. 4A), we analyzed the content of 376

ergosterol extracted from Δerg4A, Δerg4B, Δerg4AΔerg4B mutants and 377

its parental wild type by high-performance liquid chromatography 378

(HPLC). In this assay, a commercial purified ergosterol was used as a 379

standard to determine the retention time of ergosterol. As shown in Fig. 380

4B, there has a single absorption peak, which suggests that the specific 381

absorption peak of ergosterol was at the retention time of ~10.6 min (Fig. 382

4B). Next, a similar approach was used to detect the content of ergosterol 383

in extracts from the above-mentioned strains. Intriguingly, both Δerg4A 384

and Δerg4B mutants showed no detectable differences to that of its 385

parental wild type in HPLC profile for the ergosterol synthesis analysis 386

(Fig. 4B and 4C). However, different from the single mutant, 387

Δerg4AΔerg4B had no ergosterol-specific absorption peak at the time of 388

~10.6 min. Instead, at the retention time of ~8.7 min, an absorption peak 389

was detected that probably belonged to the sterol intermediate (Fig. 4B). 390

To determine whether this sterol intermediate was the precursor of 391

ergosterol, we then authenticated it by LC-MS. As expected, this sterol 392

intermediate was identified as ergosta-5,7,22,24(28)-tetraenol (Fig. S3). 393


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Taken together, our data suggest that Erg4A and Erg4B in combination, 394

but neither one individually, are required for the biosynthesis of 395

ergosterol in A. fumigatus. 396

Loss of ER-localized Erg4A induces the over-expression of Erg4B 397

and vice versa. To further explore the function of Erg4A and Erg4B in A. 398

fumigatus, we studied the subcellular localization of them. Through 399

homologous recombination, we labeled Erg4B with GFP in the C 400

terminus under the control of its native promoter successfully. 401

Unfortunately, using this strategy, we were unable to obtain the 402

functional Erg4A-GFP strain. Instead, we labeled Erg4A in the N 403

terminus under the control of AngpdA promoter. As shown in Fig. 5A and 404

5B, both GFP-Erg4A and Erg4B-GFP fusion proteins had the ER-like 405

localization pattern, with a network of strands around the nucleus, which 406

were predicted and consistent with most of the proteins involved in the 407

ergosterol biosynthesis (25). Further, to investigate whether tagging 408

Erg4A or Erg4B would affect its function, we transformed the Δerg4A 409

and Δerg4B mutants with gfp-erg4A and erg4B-gfp cassettes respectively. 410

As result shown in Fig. S4, the localization and colony characteristics of 411

the Erg4A and Erg4B GFP-tagged strains are both similar to that of the 412

parental wild type, which suggest that the GFP-tagged Erg4A and Erg4B 413

proteins are functional. To directly demonstrate whether Erg4A and 414


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Erg4B are localized in ER, we performed an experiment labeling the ER 415

marker-Erg11A with RFP in its C terminus in the background strains of 416

GFP-Erg4A and Erg4B-GFP. Microscopic observations showed that both 417

GFP-Erg4A and Erg4B-GFP were co-localized with Erg11A-RFP, which 418

directly demonstrate that both Erg4A and Erg4B proteins have the 419

ER-localization (Fig. 5A and 5B). 420

As aforementioned, in Δerg4A or Δerg4B single mutants, the 421

ergosterol content was similar to that of the parental wild type while in 422

Δerg4AΔerg4B, ergosterol content was nearly undetectable. Therefore, 423

we hypothesized that Erg4A and Erg4B may have redundant functions 424

during ergosterol biosynthesis. To verify this hypothesis, we first detected 425

the mRNA level of erg4A and erg4B, respectively in the parental 426

wild-type strain. As shown in Fig. 5C, relative to the transcription of tubA, 427

the mRNA level of erg4B was approximately 2.5 times higher than that 428

of erg4A in the parental wild-type strain. Next, we examined the mRNA 429

level of erg4A in the Δerg4B mutant and erg4B in the Δerg4A mutant 430

compared to its parental wild type. Remarkably, the mRNA level of 431

erg4A in the absence of erg4B was increased to 3.4 times of its parental 432

wild type (Fig. 5D). Similarly, under the condition of erg4A deficiency, 433

the mRNA level of erg4B was increased up to 1.6 times compared to that 434

of its parental wild type (Fig. 5D). Therefore, our data verified that 435


.asm.org/

Dow

nloaded from

http://aem.asm.org/

ER-located Erg4A and Erg4B have redundant functions during ergosterol 436

biosynthesis and loss of one paralog would induce the 437

increased-expression of the other one. 438

Sensitivities of the erg4 mutant to osmotic and oxidative stresses, 439

and cell wall-perturbing agents. Ergosterol is an important sterol 440

constituent in cellular plasma membranes and it involves in cell 441

membrane integrity, fluidity and permeability of fungal cells (5, 30, 31). 442

Given the predominant function of ergosterol, we speculated that 443

deficiency of ergosterol might change the susceptibility of A. fumigatus to 444

some plasma stresses or cell wall-perturbing agents. To test this 445

hypothesis, we analyzed phenotypes of Δerg4A, Δerg4B, Δerg4AΔerg4B 446

and its parental wild type in the YUU solid medium supplemented by 447

different reagents. Interestingly, under the osmotic stress condition 448

generated by D-sorbitol, all tested mutants showed a similar colony 449

growth to that of its parental wild type while under the stress condition 450

induced by NaCl, Δerg4A and Δerg4AΔerg4B showed a slight sensitivity 451

compared to the reference strain (Fig. 6A and 6B). In a similar manner, 452

we tested and compared the phenotypes of those mutants to the parental 453

wild-type strain in oxidative stresses induced by H2O2 and menadione. 454

Under the condition of H2O2, both Δerg4A and Δerg4AΔerg4B mutants 455

exhibited the increased susceptibility. However, compared to the parental 456

wild-type strain, Δerg4AΔerg4B displayed a slight resistance in the 457


.asm.org/

Dow

nloaded from

http://aem.asm.org/

presence of menadione, whereas Δerg4A showed an increased sensitivity 458

under the same condition (Fig. 6A and 6B). Erg4 is involved in cell wall 459

assembly in S. cerevisiae (32). Thus, we examined a potential role for 460

Erg4A and Erg4B in cell wall integrity. To this end, we tested the 461

sensitivity of erg4A and/or erg4B deletions to cell wall-perturbing agents 462

such as congo red, calcofluor white. Notably, in the presence of congo 463

red, compared to the parental wild-type strain, both the Δerg4A single 464

mutant and the Δerg4AΔerg4B double mutant showed 465

hyper-susceptibility while Δerg4B displayed a similar phenotype to that 466

of its parental wild type. Likewise, similar results were obtained to congo 467

red under the treatment of calcofluor white, which suggests that erg4A 468

may play more important roles than that of erg4B in the cell wall integrity 469

in A. fumigatus (Fig. 6A and 6B). Collectively, the above data 470

demonstrate that Erg4A and/or Erg4B are critical to protect fungal cells 471

against the plasma and cell wall stresses. 472

Susceptibilities of the erg4 mutant to antifungal drugs. Because 473

the widely used anti-fungal azole drugs mainly inhibit the biosynthesis of 474

ergosterol, we then tested the sensitivity of those mutants to some azole 475

drugs. As depicted in Fig. 7A, under the treatment of itraconazole or 476

voriconazole, which inhibit the lanosterol 14-alpha-demethylase enzyme, 477

Δerg4AΔerg4B showed increased susceptibility to the tested azoles 478

compared to single mutants, erg4A and/or erg4B complemented strain or 479


.asm.org/

Dow

nloaded from

http://aem.asm.org/

the parental wild-type strain. Because Δerg4AΔerg4B showed 480

hypersensitivity to itraconazole and voriconazole, we subsequently tested 481

its minimum inhibitory concentrations (MICs) using commercial E-test 482

strips. As shown in Fig. 7B, the MIC value of itraconazole for the 483

Δerg4AΔerg4B mutant (1.2 µg/ml) was significantly lower than that of 484

the parental wild-type strain (3 µg/ml) under the same condition. 485

Similarly, as observed with the voriconazole E-test strip, the MIC value 486

of Δerg4AΔerg4B (0.032 µg/ml) was dramatically lower than that of the 487

parental wild-type strain (0.125 µg/ml). This MIC test further 488

demonstrates that Δerg4AΔerg4B is much more sensitive to antifungal 489

azoles than the parental wild-type strain. Interestingly, all mutants 490

showed slight resistance to terbinafine, which interferes with the 491

biosynthesis of ergosterol by inhibition of squalene epoxidase (Fig. 7C). 492

Moreover, because the polyene drug amphotericin B was known to kill 493

fungal cells by binding ergosterol to form a pore to disrupt the integrity of 494

membranes, we then tested the drug susceptibility for the indicated strains. 495

As shown in Fig. 7C, we found that compared to the parental wild-type 496

strain, Δerg4AΔerg4B showed the significant resistance to amphotericin 497

B. As the aforementioned fact that Δerg4A and Δerg4AΔerg4B mutants 498

displayed increased susceptibility to cell wall perturbing agents, such as 499

congo red and calcofluor white, we then examined the sensitivity of 500

erg4A and/or erg4B mutants to caspofungin, an echinocandin drug which 501


.asm.org/

Dow

nloaded from

http://aem.asm.org/

inhibits β-1,3 glucan synthase. Unexpectedly, the susceptibility of both 502

single and double mutants of erg4A and erg4B did not show any 503

difference to that of its parental wild type (Fig. 7C). 504

Given the aforementioned fact that addition of ergosterol can partly 505

rescue the conidiation defect of Δerg4AΔerg4B, we carried out another 506

experiment to test whether ergosterol supplementation could affect the 507

drug susceptibility in mutants. Unexpectedly, adding ergosterol did not 508

significantly change the susceptibility of erg4A and/or erg4B mutants as 509

shown in Fig. S5. Collective data suggest that inactivation of erg4A 510

and/or erg4B obviously alter the susceptibility of A. fumigatus to 511

itraconazole, voriconazole, terbinafine and amphotericin B but not to 512

caspofungin. 513

514

DISCUSSION 515

The knowledge of the ergosterol biosynthesis pathway in human 516

opportunistic pathogen A. fumigatus is useful for novel antifungal drug 517

design. In this study, through bioinformatics analysis, we characterized 518

two homologs of yeast Erg4 in A. fumigatus. In the absence of one 519

homolog of A. fumigatus Erg4, its function could be complemented by 520

the increasing expression of the other one. Thus, neither deletion of erg4A 521

nor erg4B would affect the biosynthesis of ergosterol. However, 522

concurrent deletions of erg4A and erg4B completely block the 523


.asm.org/

Dow

nloaded from

http://aem.asm.org/

biosynthesis of ergosterol and result in severely impaired conidiation. 524

Moreover, hypersensitivity to clinically first-line antifungal azoles in 525

Δerg4AΔerg4B suggests that Erg4A and Erg4B could be used as 526

promising targets for antifungal drugs. 527

Erg4A and Erg4B are required for conidiation but not for hyphal 528

growth. As shown in Fig. 2A, when losing the function of ergosterol 529

biosynthesis, Δerg4AΔerg4B was still viable, which demonstrates that 530

ergosterol is not necessary for fungal survival. It also indicates that other 531

intermediate products of the ergosterol biosynthesis pathway may play a 532

substitute role for the function of ergosterol. Moreover, it is possible that 533

the filipin staining could not distinguish between ergosterol and 534

ergosta-5,7,22,24(28)-tetraenol so that wild type and the double mutant 535

which lacks ergosterol but profoundly accumulates the intermediate 536

precursor of ergosterol, showed no detectable difference (Fig. 2D). In 537

contrast, previous studies have reported that genes involved in early steps 538

in ergosterol biosynthesis, such as erg11 (cyp51A and cyp51B) and erg25 539

(erg25A and erg25B), are essential. These data suggest enzymes which 540

involved in different steps of biosynthesis pathway of ergosterol have 541

unique functions for fungal survival. 542

Interestingly, our findings indicate that inactivation of both erg4A and 543

erg4B exhibits a severe conidiation defect with a white and fluffy colony 544

(Fig. 2A and S2), demonstrating that ergosterol is required for conidiation. 545


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Indeed, in the presence of extra ergosterol addition in culture media, the 546

conidiation of Δerg4AΔerg4B was partially rescued (Fig. 2B). However, 547

there have not been reported yet until now regarding how ergosterol 548

could affect conidiation. In yeasts, previous studies have verified that 549

ergosterol was able to interact with the long acyl chain of sphingolipids to 550

form microdomains within membranes to participate in pheromone 551

signaling and plasma membranes fusion (7, 8). In Aspergillus, many lines 552

of evidence have identified that the signal to control asexual development 553

or vegetative growth is tightly regulated in a sequence (33). To date, a 554

large number of proteins related to asexual development regulation have 555

been reported, such as FluG, BrlA, and FlbB (34). Interestingly, the 556

conidiation-defected phenotype in Δerg4AΔerg4B was similar to that of 557

ΔfluG, ΔbrlA, and ΔflbB with a fluffy appearance, which implies that loss 558

of both erg4A and erg4B may cause dysfunction of asexual 559

development-related proteins (33). In addition, trimeric G-protein 560

signaling has been reported to be involved in the regulation of vegetative 561

growth and asexual development (35-37). Therefore, we speculate that 562

ergosterol-enriched in plasma membranes may be necessary for the 563

transduction of the extracelluar signal into cells. Given that it is true, 564

under the condition of ergosterol deficiency, trimeric G-protein or other 565

relevant molecules might be unable to be localized to the appropriate 566

functioning sites so that the signaling of asexual development is blocked. 567


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Of course, the assumption that there may also exist other mechanisms 568

such that Erg4A and Erg4B could interact with some unknown proteins, 569

which are required for conidiation, is also possible. 570

Previous study has indicated that ScErg4 is able to interact with Ste20 571

(the p21-activated kinase) to regulate cell polarity and without which the 572

apical growth is significantly affected (32). Different from the yeast 573

Scerg4 mutant, our data indicate that Δerg4AΔerg4B showed a similar 574

morphology to that of the parental wild-type strain in hyphal polarized 575

growth (Fig. 2D), which demonstrates that Erg4A and Erg4B are not 576

essential for hyphal growth. Possibly, this may also explain why 577

Δerg4AΔerg4B still has the wild-type virulence in a compromised mouse 578

model (Fig. 3). Compared to Erg4 in F. graminearum, erg4A and erg4B 579

of A. fumigatus also encode sterol C-24 reductase so they may share 580

functions during the fungal development (21). However, Fgerg4 is 581

required for full virulence of F. graminearum whereas Erg4A and Erg4B 582

are not essential for virulence of A. fumigatus, suggesting they may have 583

different functions in vivo (21). 584

Erg4A and Erg4B mediate susceptibility to azole drugs. In fungi, 585

the widely used azoles, such as itraconazole and voriconazole, mainly 586

target lanosterol 14-α-demethylase, which is encoded by Erg11. The 587

inhibition of lanosterol 14-α-demethylase caused by azoles results in 588

accumulation of toxic sterol and thus lead to cell death (38). In our study, 589


.asm.org/

Dow

nloaded from

http://aem.asm.org/

we found that inactivation of erg4A and erg4B resulted in hypersensitivity 590

to itraconazole and voriconazole (Fig. 7A and 7B), suggesting that Erg4A 591

and Erg4B are required for drug resistance. To explain the reason for the 592

increased sensitivity of Δerg4AΔerg4B to itraconazole and voriconazole, 593

we first may exclude the mechanism mediated by ergosterol deficiency 594

since a previous study in erg3 mutants with a decreased ergosterol 595

content has demonstrated that there was no significant difference in the 596

voriconazole susceptibility (17). Second, the possibility due to that 597

induced by ergosta-5,7,22,24(28)-tetraenol accumulation might also be 598

excluded as the Δerg5 mutant with a blocked production of 599

ergosta-5,7,22,24(28)-tetraenol in N. crassa or Fusarium verticillioides, 600

exhibited increased susceptibility to azole as well (39). Therefore, it 601

suggests that reason for the increased susceptibility is probably due to the 602

changed fluidity of membranes or the varied activities of 603

membrane-located azole pumps, which may be affected in the absence of 604

Erg4A and Erg4B. Under this defect condition, azoles might be easy to be 605

up-taken or difficult to be drained off, causing hypersensitivity to azoles. 606

Moreover, it has been reported that ketoconazole can directly bind Erg5 607

with a similar affinity as with Erg11 in S. cerevisiae (40). Thus, we 608

hypothesize that itraconazole and voriconazole may also have the binding 609

ability with Erg4. If this case is true, the absence of Erg4 would increase 610

the targeting probability of drugs to Erg11, resulted in the increasing 611


.asm.org/

Dow

nloaded from

http://aem.asm.org/

sensitivity to these antifungals. Another possible reason of the increased 612

susceptibility of Δerg4AΔerg4B to itraconazole and voriconazole might 613

be due to the altered cell wall integrity compared to the parental wild-type 614

strain (41). Additionally, previous studies in fungi have demonstrated that 615

when azoles were used, the drug target-lanosterol 14-demethylase 616

enzyme activity encoded by erg11 was inhibited, resulting in an abnormal 617

accumulation of a toxic sterol 618

(14α-methylergosta-8,24(28)-dien-3β,6α-diol). It suggests that a toxic 619

sterol accumulation could be a reason for arresting the fungal cell growth 620

(38, 42). In yeasts, inactivation of Δ5,6 desaturase encoded by erg3 was 621

able to suppress the growth defect under the treatment of azoles and 622

losing Δ5,6desaturase could decrease accumulation of a toxic sterol 623

(14α-methylergosta-8,24(28)-dien-3β,6α-diol) (43, 44). Based on this 624

information, we hypothesize that hypersensitivity to azoles in 625

Δerg4AΔerg4B may be due to accumulation of the toxic sterols induced 626

by azoles. However, evidences for verifying the above hypothesis need 627

further investigation. 628

629

ACKNOWLEDGMENTS 630

We thank Dr Shizhu Zhang for helpful comments for this study and 631

thanks for Dr. Hechun Jiang for the A. fumigatus strain A1160C (Nanjing 632

Normal University). A. fumigatus strain A1160 was obtained from FGSC 633


.asm.org/

Dow

nloaded from

http://aem.asm.org/

(http://www.fgsc.net). 634

635

FUNDING INFORMATION 636

This work was financially supported by the National Natural Science 637

Foundation of China (NSFC)(Grant No. 81330035 to L. Lu) and the 638

Special Fund for the Doctoral Program of Higher Education of China (No. 639

20123207110012) to L. Lu; the Priority Academic Program Development 640

(PAPD) of Jiangsu Higher Education Institutions; the Postgraduate 641

Research and Innovation Plan Project of Jiangsu Province (No. 642

KYLX16_1283) to N. Long. 643

644

REFERENCES 645

1. Latge JP. 1999. Aspergillus fumigatus and aspergillosis. Clin Microbiol 646

Rev 12:310-350. 647

2. Chamilos G, Luna M, Lewis RE, Bodey GP, Chemaly R, Tarrand JJ, 648

Safdar A, Raad, II, Kontoyiannis DP. 2006. Invasive fungal infections in 649

patients with hematologic malignancies in a tertiary care cancer center: an 650

autopsy study over a 15-year period (1989-2003). Haematologica 651

91:986-989. 652

3. van der Linden JW, Snelders E, Kampinga GA, Rijnders BJ, Mattsson 653

E, Debets-Ossenkopp YJ, Kuijper EJ, Van Tiel FH, Melchers WJ, 654

Verweij PE. 2011. Clinical implications of azole resistance in Aspergillus 655

fumigatus, The Netherlands, 2007-2009. Emerg Infect Dis 17:1846-1854. 656

4. Howard SJ, Arendrup MC. 2011. Acquired antifungal drug resistance in 657

Aspergillus fumigatus: epidemiology and detection. Med Mycol 49 Suppl 658

1:S90-95. 659


.asm.org/

Dow

nloaded from

http://aem.asm.org/

5. Kodedova M, Sychrova H. 2015. Changes in the Sterol Composition of the 660

Plasma Membrane Affect Membrane Potential, Salt Tolerance and the 661

Activity of Multidrug Resistance Pumps in Saccharomyces cerevisiae. 662

PLoS One 10:e0139306. 663

6. Bard M, Lees ND, Turi T, Craft D, Cofrin L, Barbuch R, Koegel C, 664

Loper JC. 1993. Sterol synthesis and viability of erg11 (cytochrome P450 665

lanosterol demethylase) mutations in Saccharomyces cerevisiae and 666

Candida albicans. Lipids 28:963-967. 667

7. Jin H, McCaffery JM, Grote E. 2008. Ergosterol promotes pheromone 668

signaling and plasma membrane fusion in mating yeast. J Cell Biol 669

180:813-826. 670

8. Morioka S, Shigemori T, Hara K, Morisaka H, Kuroda K, Ueda M. 671

2013. Effect of sterol composition on the activity of the yeast 672

G-protein-coupled receptor Ste2. Appl Microbiol Biotechnol 97:4013-4020. 673

9. Takeshita N, Higashitsuji Y, Konzack S, Fischer R. 2008. Apical 674

sterol-rich membranes are essential for localizing cell end markers that 675

determine growth directionality in the filamentous fungus Aspergillus 676

nidulans. Mol Biol Cell 19:339-351. 677

10. Buhler N, Hagiwara D, Takeshita N. 2015. Functional Analysis of Sterol 678

Transporter Orthologues in the Filamentous Fungus Aspergillus nidulans. 679

Eukaryot Cell 14:908-921. 680

11. Ferreira ME, Colombo AL, Paulsen I, Ren Q, Wortman J, Huang J, 681

Goldman MH, Goldman GH. 2005. The ergosterol biosynthesis pathway, 682

transporter genes, and azole resistance in Aspergillus fumigatus. Med Mycol 683

43 Suppl 1:S313-319. 684

12. Espenshade PJ, Hughes AL. 2007. Regulation of sterol synthesis in 685

eukaryotes. Annu Rev Genet 41:401-427. 686

13. Alcazar-Fuoli L, Mellado E, Garcia-Effron G, Lopez JF, Grimalt JO, 687

Cuenca-Estrella JM, Rodriguez-Tudela JL. 2008. Ergosterol biosynthesis 688

pathway in Aspergillus fumigatus. Steroids 73:339-347. 689


.asm.org/

Dow

nloaded from

http://aem.asm.org/

14. Alcazar-Fuoli L, Mellado E. 2012. Ergosterol biosynthesis in Aspergillus 690

fumigatus: its relevance as an antifungal target and role in antifungal drug 691

resistance. Front Microbiol 3:439. 692

15. Hu W, Sillaots S, Lemieux S, Davison J, Kauffman S, Breton A, Linteau 693

A, Xin C, Bowman J, Becker J, Jiang B, Roemer T. 2007. Essential gene 694

identification and drug target prioritization in Aspergillus fumigatus. PLoS 695

Pathog 3:e24. 696

16. Blosser SJ, Merriman B, Grahl N, Chung D, Cramer RA. 2014. Two 697

C4-sterol methyl oxidases (Erg25) catalyse ergosterol intermediate 698

demethylation and impact environmental stress adaptation in Aspergillus 699

fumigatus. Microbiology 160:2492-2506. 700

17. Alcazar-Fuoli L, Mellado E, Garcia-Effron G, Buitrago MJ, Lopez JF, 701

Grimalt JO, Cuenca-Estrella JM, Rodriguez-Tudela JL. 2006. 702

Aspergillus fumigatus C-5 sterol desaturases Erg3A and Erg3B: role in 703

sterol biosynthesis and antifungal drug susceptibility. Antimicrob Agents 704

Chemother 50:453-460. 705

18. Barenholz Y. 2002. Cholesterol and other membrane active sterols: from 706

membrane evolution to "rafts". Prog Lipid Res 41:1-5. 707

19. Rog T, Vattulainen I. 2014. Cholesterol, sphingolipids, and glycolipids: 708

what do we know about their role in raft-like membranes? Chem Phys 709

Lipids 184:82-104. 710

20. Zweytick D, Hrastnik C, Kohlwein SD, Daum G. 2000. Biochemical 711

characterization and subcellular localization of the sterol C-24(28) reductase, 712

erg4p, from the yeast Saccharomyces cerevisiae. FEBS Lett 470:83-87. 713

21. Liu X, Jiang J, Yin Y, Ma Z. 2013. Involvement of FgERG4 in ergosterol 714

biosynthesis, vegetative differentiation and virulence in Fusarium 715

graminearum. Mol Plant Pathol 14:71-83. 716

22. Jiang H, Shen Y, Liu W, Lu L. 2014. Deletion of the putative 717

stretch-activated ion channel Mid1 is hypervirulent in Aspergillus fumigatus. 718

Fungal Genet Biol 62:62-70. 719


.asm.org/

Dow

nloaded from

http://aem.asm.org/

23. Zhang C, Meng X, Wei X, Lu L. 2016. Highly efficient CRISPR 720

mutagenesis by microhomology-mediated end joining in Aspergillus 721

fumigatus. Fungal Genet Biol 86:47-57. 722

24. Szewczyk E, Nayak T, Oakley CE, Edgerton H, Xiong Y, Taheri-Talesh 723

N, Osmani SA, Oakley BR. 2006. Fusion PCR and gene targeting in 724

Aspergillus nidulans. Nat Protoc 1:3111-3120. 725

25. Song J, Zhai P, Zhang Y, Zhang C, Sang H, Han G, Keller NP, Lu L. 726

2016. The Aspergillus fumigatus Damage Resistance Protein Family 727

Coordinately Regulates Ergosterol Biosynthesis and Azole Susceptibility. 728

MBio 7:e01919-01915. 729

26. Long N, Xu X, Qian H, Zhang S, Lu L. 2016. A Putative Mitochondrial 730

Iron Transporter MrsA in Aspergillus fumigatus Plays Important Roles in 731

Azole-, Oxidative Stress Responses and Virulence. Front Microbiol 7:716. 732

27. Yasmin S, Alcazar-Fuoli L, Grundlinger M, Puempel T, Cairns T, 733

Blatzer M, Lopez JF, Grimalt JO, Bignell E, Haas H. 2012. Mevalonate 734

governs interdependency of ergosterol and siderophore biosyntheses in the 735

fungal pathogen Aspergillus fumigatus. Proc Natl Acad Sci U S A 736

109:E497-504. 737

28. Li P, Xu X, Cao E, Yu B, Li W, Fan M, Huang M, Shi L, Zeng R, Su X, 738

Shi Y. 2014. Vitamin D deficiency causes defective resistance to Aspergillus 739

fumigatus in mice via aggravated and sustained inflammation. PLoS One 740

9:e99805. 741

29. Zhang C, Kong Q, Cai Z, Liu F, Chen P, Song J, Lu L, Sang H. 2015. 742

The newly nonsporulated characterization of an Aspergillus fumigatus 743

isolate from an immunocompetent patient and its clinic indication. Fungal 744

Genet Biol 81:250-260. 745

30. Parks LW, Smith SJ, Crowley JH. 1995. Biochemical and physiological 746

effects of sterol alterations in yeast--a review. Lipids 30:227-230. 747

31. Mollinedo F. 2012. Lipid raft involvement in yeast cell growth and death. 748

Front Oncol 2:140. 749


.asm.org/

Dow

nloaded from

http://aem.asm.org/

32. Tiedje C, Holland DG, Just U, Hofken T. 2007. Proteins involved in 750

sterol synthesis interact with Ste20 and regulate cell polarity. J Cell Sci 751

120:3613-3624. 752

33. Krijgsheld P, Bleichrodt R, van Veluw GJ, Wang F, Muller WH, 753

Dijksterhuis J, Wosten HA. 2013. Development in Aspergillus. Stud 754

Mycol 74:1-29. 755

34. Park HS, Yu JH. 2012. Genetic control of asexual sporulation in 756

filamentous fungi. Curr Opin Microbiol 15:669-677. 757

35. Affeldt KJ, Carrig J, Amare M, Keller NP. 2014. Global survey of 758

canonical Aspergillus flavus G protein-coupled receptors. MBio 759

5:e01501-01514. 760

36. Grice CM, Bertuzzi M, Bignell EM. 2013. Receptor-mediated signaling in 761

Aspergillus fumigatus. Front Microbiol 4:26. 762

37. Cai ZD, Chai YF, Zhang CY, Qiao WR, Sang H, Lu L. 2015. The 763

Gbeta-like protein CpcB is required for hyphal growth, conidiophore 764

morphology and pathogenicity in Aspergillus fumigatus. Fungal Genet Biol 765

81:120-131. 766

38. Ghannoum MA, Rice LB. 1999. Antifungal agents: mode of action, 767

mechanisms of resistance, and correlation of these mechanisms with 768

bacterial resistance. Clin Microbiol Rev 12:501-517. 769

39. Sun X, Wang W, Wang K, Yu X, Liu J, Zhou F, Xie B, Li S. 2013. Sterol 770

C-22 Desaturase ERG5 Mediates the Sensitivity to Antifungal Azoles in 771

Neurospora crassa and Fusarium verticillioides. Front Microbiol 4:127. 772

40. Kelly SL, Lamb DC, Baldwin BC, Corran AJ, Kelly DE. 1997. 773

Characterization of Saccharomyces cerevisiae CYP61, sterol 774

delta22-desaturase, and inhibition by azole antifungal agents. J Biol Chem 775

272:9986-9988. 776

41. Chung D, Thammahong A, Shepardson KM, Blosser SJ, Cramer RA. 777

2014. Endoplasmic reticulum localized PerA is required for cell wall 778

integrity, azole drug resistance, and virulence in Aspergillus fumigatus. Mol 779


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Microbiol 92:1279-1298. 780

42. Munayyer HK, Mann PA, Chau AS, Yarosh-Tomaine T, Greene JR, 781

Hare RS, Heimark L, Palermo RE, Loebenberg D, McNicholas PM. 782

2004. Posaconazole is a potent inhibitor of sterol 14 alpha-demethylation in 783

yeasts and molds. Antimicrob Agents Chemother 48:3690-3696. 784

43. Kelly SL, Lamb DC, Corran AJ, Baldwin BC, Kelly DE. 1995. Mode of 785

action and resistance to azole antifungals associated with the formation of 786

14 alpha-methylergosta-8,24(28)-dien-3 beta,6 alpha-diol. Biochem 787

Biophys Res Commun 207:910-915. 788

44. Watson PF, Rose ME, Ellis SW, England H, Kelly SL. 1989. Defective 789

sterol C5-6 desaturation and azole resistance: a new hypothesis for the 790

mode of action of azole antifungals. Biochem Biophys Res Commun 791

164:1170-1175. 792

793

794

FIGURE LEGENDS 795

FIG 1 Bioinformatics analysis of Erg4. (A) Phylogenetic analysis of Erg4 796

homologs from selected fungi, including A. fumigatus, S. cerevisiae, 797

Ustilago maydis, F. graminearum, Candida albicans, Cryptococcus gattii, 798

Neurospora crassa, Talaromyces marneffei, Schizosaccharomyces pombe, 799

A. nidulans, Trichoderma reesei, Rhizoctonia solani, Coccidioides 800

immitis, Histoplasma capsulatum. The phylogenetic tree 801

(Neighbor-Joining tree) were created using MEGA 5 software. (B) 802

Putative protein domains in A. fumigatus Erg4A and Erg4B and S. 803


.asm.org/

Dow

nloaded from

http://aem.asm.org/

cerevisiae Erg4. To find the putative protein domains, TMHMM Server v. 804

2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0) was utilized. 805

FIG 2 Phenotypic characterization of the erg4A and/or erg4B-null 806

mutants. (A) Colony and conidiophore morphology of the parental 807

wild-type strain, and the Δerg4A, Δerg4B, and Δerg4AΔerg4B mutants. 808

(B) Colony and conidiophore morphology of the Δerg4AΔerg4B mutant 809

under the condition with or without extra ergosterol addition (40 µM). (C) 810

Colony and conidiophore morphology of the Δerg4AΔerg4B derived 811

strains that complemented with ku80, erg4A and/or erg4B genes. (D) 812

Hyphal morphology of the parental wild-type, Δerg4A, Δerg4B, and 813

Δerg4AΔerg4B strains stained with calcofluor white (CFW) or filipin. 814

Scale bar = 5 μm. 815

FIG 3 Virulence test of Δerg4AΔerg4B in a murine model of invasive 816

pulmonary aspergillosis. (A) Survival curve of mice infected with wild 817

type, Δerg4AΔerg4B, and the control PBS. (B) Plate cultured A. 818

fumigatus isolated from the relative lung tissue of post-infected mice . (C) 819

Histopathological sections of lung tissue of the sacrificed mice infected 820

with each strain. Periodic acid-schiff (PAS) stains were utilized to 821

visualize fungal growth. 822

FIG 4 Erg4A and Erg4B are required for the biosynthesis of ergosterol. 823

(A) Schematic line of ergosterol biosynthetic pathway. (B) and (C) The 824

ergosterol production of the parental wild-type, Δerg4A, Δerg4B, and 825


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Δerg4AΔerg4B strains analyzed by HPLC assays. NS represents no 826

significant difference. ***P< 0.001 compared with the parental wild-type 827

strain. P-values were determined using analysis of variance. 828

FIG 5 Loss of ER-localized Erg4A induces the over-expression of Erg4B 829

and vice versa.. (A) and (B) GFP-tagged Erg4A and Erg4B were located 830

in endoplasmic reticulum. DAPI was used to visualize nucleus. Erg11A 831

was used to label endoplasmic reticulum. Scale bar = 5 μm. Transcript 832

level of erg4A and erg4B (relative to tubA) in the parental wild-type 833

strain (C) and in Δerg4B or Δerg4A mutants (D). 834

FIG 6 Comparison of the sensitivity of the parental wild-type, Δerg4A, 835

Δerg4B, and Δerg4AΔerg4B strains to cell stresses mediated by NaCl 836

(800 mM), D-sorbitol (1.2 M), H2O2 (3 mM), menadione (25 µM), 837

calcofluor white (CFW) (40 µg/ml), and congo red (CR) (150 µg/ml). 838

FIG 7 Δerg4AΔerg4B shows increased susceptibility to azoles 839

(itraconazole and voriconazole) but decreased susceptibility to terbinafine 840

or amphotericin B. (A) and (C) Colony growth of the related strains in 841

the presence of itraconazole (0.75 µg/ml), voriconazole (0.1 µg/ml), 842

terbinafine (0.2 µg/ml), amphotericin B (6 µg/ml), and caspofungin (0.3 843

µg/ml). (B) Minimum inhibitory concentrations (MICs) test. 844

1×105 conidia of the parental wild-type strain or Δerg4AΔerg4B was 845

mixed in YAG, and E-test strips of itraconazole or voriconazole was 846

placed on the plates incubated at 37°C for 1.5 days. 847


.asm.org/

Dow

nloaded from

http://aem.asm.org/

848

Table 1 A. fumigatus strains used in this study. 849

Strain Genotype Reference or source

A1160 Δku80, pyrG FGSC

A1160C Δku80, A1160::pyrG (22)

LN01 Δku80, pyrG, Δerg4A::hph This study

LN02 Δku80, pyrG, Δerg4B::pyr4 This study

LN03 Δku80, pyrG, Δerg4A::hph,

Δerg4B::pyr4

This study

LN04 Δku80, pyrG, erg4B::gfp::pyrG This study

LN05

LN06

LN07

LN08

LN09

LN10

LN11

Δku80, pyrG, gpdA(p)-gfp-erg4A, hph

Δku80, pyrG, Δerg4A::hph,

gpdA(p)-gfp-erg4A, pyr4

Δku80, pyrG, Δerg4B::pyr4,

erg4B(p)-erg4B-gfp, hph


Δerg4B::pyr4, erg4A, ptrA


Δerg4B::pyr4, erg4B, ptrA


Δerg4B::pyr4, erg4A, erg4B, ptrA


Δerg4B::pyr4, gpdA(p)-ku80, ptrA

This study

This study

This study

This study

This study

This study

This study

850

851

852

853


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Table 2 Primers used in this study. 854

Primer name Primer sequence 5' - 3'

erg4A P1 TGTTCAGACAGTAGTTCGCTTTTC

erg4A P2 CTACTGCGCTGATTCCGTTCT

erg4A P3 GTAGAGATACAAGGGAATTCGGTCTGTTGTACTCCGAAGTCAAT

erg4A P4 CCACTCCACATCTCCACTCGACTTTATTCCAGTAAGTTTCGCTGAT

erg4A P5 CATTGACGATGTACTCTTACCAACC

erg4A P6 GCTACTGAGTCGGAAAGGTTGA

erg4A S1 AGCAAAATGGCAGCAAAAGAC

erg4A S2

erg4A F

erg4A R

CAATAGTGAGATACCACGACGACA

GGTTCTGTGCATTTGCTAGATGC

TGCAGCTATCTGTCTATCATAC

erg4B P1 AGGTGGTCTTATGGGCGTGTA

erg4B P2 GAAATGTCTAATGCCCTCTTGAA

erg4B P3 CGATTAAGTTGGGTAACGCCACCCAGTTAAGAGGCAAGCAAT

erg4B P4 ATAAGTAGCCAGTTCCCGAAAGCGCGACGAACAGGCTGACTAAT

erg4B P5 CCAGGAATAGTGGGATGGAAC

erg4B P6 TGAACACTACGACACCAGGGA

erg4B S1 AAACCTACCTTTTGCGACAGC

erg4B S2

erg4B F

erg4B R

GAACCCGATCATCATGGACAG

GTGCAGGTGGTCTTATGGGCGTG

GTGAACCGCCGATGGACATCGAG

erg4B-gfp P1 TCCTTCGTCGCATACTTCT

erg4B-gfp P2 CAATCCTAGAATGTTCGGTAT

erg4B-gfp P3 CCAGCGCCTGCACCAGCTCCAGATGAGGAATAGCTTACAGGG

erg4B-gfp P4 CATCAGTGCCTCCTCTCAGACAGTGAAACGCGACGAACAGGCTGAC

erg4B-gfp P5 CTTGCTTGGCGTCTTGGAG

erg4B-gfp P6

gfp-pyrG F

GAACACTACGACACCAGGGA

GGAGCTGGTGCAGGCGCTGG


.asm.org/

Dow

nloaded from

http://aem.asm.org/

gfp-pyrG R

gfp-erg4A P1

gfp-erg4A P2

gfp-erg4A P3

gfp-erg4A P4

CTGTCTGAGAGGAGGCACTGATG

CCTTTAATCAAGCTTATCGATATGAGTAAAGGAGAAGAACTTTTCAC

CTGGATCTCGGAGATTTTGTATAG

CTATACAAAATCTCCGAGATCCAGAAGAGCAAAATGGCAGCAAAAGAC

CTCGAGGTCGACGGTATCGATCTAATCTGTCAGCTTATCCTTG

pyr4 F TGGCGTTACCCAACTTAATCG

pyr4 R GCTTTCGGGAACTGGCTACTTAT

hph F GAATTCCCTTGTATCTCTACACACAGGC

hph R

ptrA F

ptrA R

d-hph F

d-hph R

ku 80 F

ku 80 R

TCGAGTGGAGATGTGGAGTGGGCGCTTA

GCCTAGATGGCCTCTTGCATC

CATGGCAGACACTGAAGCAAC

CTCCTCTTCTTTACTCTGA

TCCATGTTGGTAGTTGTGA

CCTTTAATCAAGCTTATCGATATGGCTGAAAAGGAAGCAACCG

CTCGAGGTCGACGGTATCGATTCAGTATATGCCTCTCGAACTC

RT-erg4A F GTTCTTCGCTATTTCCTGG

RT-erg4A R GCGGTTGATATCTCGTCTC

RT-erg4B F AGACTTTCCCTCAGCTCCC

RT-erg4B R CCAGTTCAAGGCGAAATAA

RT-tubA F ACGTTACCTCACCTGCTCTGC

RT-tubA R GATGTTGTTGGGAATCCACTCA

855


.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/


.asm.org/

Dow

nloaded from

http://aem.asm.org/

Documents

Erg4A and Erg4B are required for conidiation and azole ... · Though the ergosterol biosynthesis pathway in Saccharomyces cerevisiae. 75 . has been characterized (12 ), little is