Marine Pollution Bulletin 94 (2015) 217–227

Contents lists available at ScienceDirect

Marine Pollution Bulletin

journal homepage: www.elsevier .com/locate /marpolbul

Enterococcus species diversity and molecular characterization ofbiomarker genes in Enterococcus faecalis in Port Blair Bay, Andamanand Nicobar Islands, India

http://dx.doi.org/10.1016/j.marpolbul.2015.02.0270025-326X/� 2015 Elsevier Ltd. All rights reserved.

⇑ Corresponding authors at: Andaman and Nicobar Centre for Ocean Science andTechnology, ESSO-NIOT, Dollygunj, Port Blair 744 103, Andaman and NicobarIslands, India. Tel.: +91 96795 58081; fax: +91 3192 225089 (B. Meena). MarineBiotechnology Division, ESSO-National Institute of Ocean Technology (ESSO-NIOT),Ministry of Earth Sciences, Government of India, Pallikaranai, Chennai 600 100.Tel: +91 44 66783418; fax: +91 44 66783423 (R. Kirubagaran).

E-mail addresses: bmeena79@yahoo.com (B. Meena), anburajanl@yahoo.co.in(L. Anburajan), head.mbt@niot.res.in (R. Kirubagaran).

1 These authors contributed equally to this work.2 Tel.: +91 96795 50065.

Balakrishnan Meena a,⇑,1, Lawrance Anburajan a,1,2, Thadikamala Sathish a, Rangamaran Vijaya Raghavan b,Dilip Kumar Jha b, Pitchiah Venkateshwaran a, Apurba Kumar Das a, Palaiya Sukumaran Dheenan a,Nambali Valsalan Vinithkumar a, Gopal Dharani b, Ramalingam Kirubagaran b,⇑a Andaman and Nicobar Centre for Ocean Science and Technology, Earth System Sciences Organization-National Institute of Ocean Technology (ESSO-NIOT), Port Blair 744 103,Andaman and Nicobar Islands, Indiab Marine Biotechnology Division, Ocean Science and Technology for Islands Group, ESSO-NIOT, Ministry of Earth Sciences, Govt. of India, Chennai 600 100, India

a r t i c l e i n f o

Article history:Available online 20 March 2015

Keywords:Enterococcus sp.Biomarker genesBox-whisker plotsCluster analysisAntibiotic resistance

a b s t r a c t

This study was performed to evaluate the abundance and diversity of Enterococcus sp. and the dis-tribution of biomarker genes in Enterococcus faecalis in Port Blair Bay, Andaman and Nicobar Islands.The Enterococcus sp. densities at the seven sampling stations were highly influenced by tidal fluctuationsand season. The distributions and diversities of species varied in the inner and outer regions of Port BlairBay. Among the 1816 total isolates, the occurrence of fecal Enterococcus was high (1.78 � 104 CFU/100 mL) in Phoenix Bay. Moreover, 67.76% of the isolates were identified as Enterococcus, and the mostfrequently identified species were E. hirae, E. avium and E. faecalis. Assessments of antibiotic resistanceand biomarker genes revealed the maximum occurrence in the Aberdeen Bay isolates. The most prevalentbiomarker genes observed in the E. faecalis isolates were gelE and asa1, whereas cyl was not found amongthe isolates. In silico sequence analysis of biomarker genes of E. faecalis also revealed that they areevolutionarily well conserved with those of earlier reports. Further, multivariate analysis distinguishedthe JB, PB and OS stations from the other stations according to distinctive microbial densities andcompositions. In addition, the Shannon-Wiener diversity indices and box-whisker plots further facilitatedand supported the multivariate results.

� 2015 Elsevier Ltd. All rights reserved.

1. Introduction

Coastal waters generally contain both pathogenic and non-pathogenic microbes derived from runoff, sewage, industrial efflu-ent, agricultural activities, wild life and indigenous microorganisms.These pathogens can be hazardous to the health of bathers andconsumers when an infective dose colonizes a suitable growth siteof the body and leads to disease (Elmanama et al., 2005; WHO,

1998). Enterococcus bacteria are part of the normal intestinal floraof animals and humans, and they are released into the environmentdirectly or via sewage outlets (Farrel et al., 2003). Studies conductedby the Environmental Protection Agency (EPA) to determine thecorrelation between bacterial indicators and digestive systemillness have reported that the most prominent indicators for healthrisk from recreational water contact are E. coli and Enterococcus sp.in fresh and salt waters, respectively (USEPA, 2003).

In the last few decades, Enterococcus sp. has emerged as themost important causative organism of nosocomial infection andas a specific threat to public health (Heymann, 2006). The dis-tribution of infectious Enterococcus sp. in the environment viawater may cause an increase in the prevalence of these strains inhumans (Irani et al., 2011). Enterococcus faecalis and Enterococcusfaecium are important opportunistic pathogens (Harwood et al.,2004). Enterococci are able to grow at a temperature of 45 �C andpH 9.6 in 6.5% NaCl broth and to survive at 60 �C for 30 min(Sherman, 1937). Among the enterococci, E. faecalis can cope with

218 B. Meena et al. / Marine Pollution Bulletin 94 (2015) 217–227

unfavorable conditions by maintaining cell viability under starva-tion for extended periods and become resistant to UV radiation,heat, and differing/high concentrations of sodium hypochlorite,hydrogen peroxide, ethanol, and acid (Hartke et al., 1998). Majorfactors for the pathogenesis of enterococci include their resistanceto a wide range of antibiotics and virulence factors. Genes encodingvirulence factors include asa1, esp, hyl, gelE, ef0591, aadE, pbp4 andcylA (Kuzucu et al., 2005).

The coastal waters of the Andaman and Nicobar (A & N) Islandsare pristine compared with those of the highly populated mainlandIndia (Sahu et al., 2013). The diversity and distribution ofEnterococcus sp. in the environment and coastal waters are notreflective of the pollution rate; however, the population densityand distribution of virulence factors and the pathogenicity of thisindicator organism can define the microbial pollution rate andthe source of possible contamination in a particular zone. Theobjectives of this study were as follows: (i) to determine the sea-sonal impact on population density and the distribution ofEnterococcus sp. in Port Blair Bay; (ii) to evaluate the species diver-sity and dominance of Enterococcus sp. among selected stations;and (iii) to examine the antibiotic susceptibility and distributionof biomarker genes in E. faecalis during various seasons. This studyis the first to attempt to correlate the microbial pollution trend

Fig. 1. Sampling stations with drainage points alon

with the diversity of biomarker genes in E. faecalis from PortBlair Bay, A & N Islands.

2. Methods

2.1. Study area

Port Blair Bay is located in South Andaman Island and extendsfrom east to west and southwest, opening to the Andaman Seaon the eastern side (Fig. 1). This bay area is influenced by theanthropogenic activities of Port Blair city, where the majority ofthe population of the A & N Islands is congregated. In the presentstudy, seven stations were selected within Port Blair Bay, fromthe inner part of the bay to the Open Sea station, including FlatBay (FB), Minnie Bay (MB), Junglighat Bay (JB), Haddo Harbor(HH), Phoenix Bay (PB), Aberdeen Bay (AB) and Open Sea (OS)(Fig. 1).

2.2. Sample collection and analysis of microbial and physicochemicalcharacteristics

Sampling was performed quarterly according to seasonal pre-ference (February, May, August and November) from seven

g Port Blair Bay, Andaman and Nicobar Islands.

Table 1Gene-specific primers for the biomarker genes.

Gene Primer sequences 50-30 References

asaI GCACGCTATTACGAACTATGA This studyTAAGAAAGAACATCACCACGA

esp AGATTTCATCTTTGATTCTTGG This studyAATTGATTCTTTAGCATCTGG

hyl ACAGAAGAGCTGCAGGAAATG This studyGACTGACGTCCAAGTTTCCAA

gelE TATGACAATGCTTTTTGGGAT This studyAGATGCACCCGAAATAATATA

cylA ACTCGGGGATTGATAGGC This studyGCTGCTAAAGCTGCGCTT

ef0591 AGAGGGACGATCAGATGA This studyATTCCAATTGACGATTCA

pbp4 ATGGAACGAAGCAATCGT This studyCTTTGATATTGGCTGTT

aadE TGATTTGCTGGTTACGGTGAC This studyCGCTATGTTCTCTTGCTTTTG

B. Meena et al. / Marine Pollution Bulletin 94 (2015) 217–227 219

stations during low and high tides in 2013. Samples were collectedonboard at 0.3 m below the surface of the water using a GO-FLOwater sampler, and they were then transferred to sterile screw-cap bottles according to the sampling procedures described inthe USEPA microbiology methods manual (USEPA, 2003). The sam-ples were mixed thoroughly and filtered through sterile 0.22 lmmembrane filters (Millipore Corporation, USA), which were thenplaced on pre-prepared M-Enterococcus agar plates (HiMedia,India). After incubation overnight at 37 �C, bacterial colonies withdark brown colours were identified as presumptive Enterococcusspecies. The results were expressed as colony forming units(CFU)/100 mL for each water sample.

Temperature and pH were measured onboard using a calibratedthermometer with ±0.1 �C accuracy (Brannan, UK) and a pH meter(Thermo Orion 420 A plus, USA), respectively. The level of total sus-pended solids (TSS) was determined by filtering 1 L of seawaterthrough pre-dried and pre-weighed 0.45 lm pore-size filter paper(Millipore). Dissolved oxygen (DO) at the sampling stations wasmeasured by Winkler’s method (Strickland and Parsons, 1968).

2.3. Identification of Enterococcus sp.

Presumptive Enterococcus colonies with typical dark brown col-our on the membranes were selected for further characterization.The colonies were cultivated in Trypticase soy broth at 37 �C andidentified up to the species level using a biochemical identificationkey (Albert and Anicet, 1999). Those isolates that exhibited a posi-tive reaction by pyrrolidonyl arylamidase assay (PYR), esculinhydrolysis, growth at 45 �C, tolerance to 6.5% NaCl and catalasenegative were identified as Enterococcus sp. (American Society forMicrobiology, 2003).

2.4. Characterization and molecular identification of E. faecalis

Genomic DNA was extracted following the method described byAusubel et al. (1994). The universal 16S rRNA eubacterial primers16S f (50-ACTCAAAGGAATTGACGG-30) and 16S r (50-TACGGCTACCTTGTTACGACTT-30) were used for PCR amplification, and theamplicon was cloned in a T/A cloning vector, according to themanufacturer’s instructions provided in the InsTAclone PCRCloning Kit (MBI Fermentas, USA). Sequencing was performedusing an ABI PRISM 377 genetic analyzer (Applied Biosystems,USA) by the dye termination method. The acquired 16S rRNAsequences were used in a homology search of the availablesequences in GenBank using the BLAST program of NCBI (http://www.ncbi.nlm.nih.gov) to determine pairwise identities. Multiplesequence alignments of the sequences were performed usingCLUSTAL-X version 1.81 program, and a phylogenetic tree was con-structed with MEGA v5.0 using the neighbor-joining method.

2.5. Antibiotic susceptibility test

The antibiotic susceptibilities of the isolates were assessedusing the disc diffusion method on Muller-Hinton agar (HiMedia,India), according to the Clinical and Laboratory StandardsInstitute recommendations (CLSI, 2009). Antibiotic discs of ampi-cillin (10 lg), gentamycin (10 lg), clindamycin (2 lg), tetracycline(30 lg), chloramphenicol (30 lg), streptomycin (30 lg), van-comycin (30 lg) and erythromycin (15 lg) were placed on agarplates seeded with E. faecalis isolates and incubated overnight at37 �C. The diameter of the antibiotic inhibition zone was measuredin millimeters and recorded as follows, according to CLSI M02-A10:susceptible (S), intermediate resistant (IR) or resistant (R).E. faecalis ATCC19433 and Staphylococcus aureus MTCC3160 wereused as positive and negative control strains, respectively.

2.6. PCR detection of biomarker genes

The biomarker genes asa1, esp, hyl, gelE, ef0591, aadE, pbp4 andcylA were PCR-amplified using gene-specific primers (Table 1). PCRwas performed in a 25 lL reaction mixture that contained 50 ng ofgenomic DNA, 0.5 lM of each primer, 200 lM of each dNTP (MBIFermentas), 1.25 U of Taq DNA polymerase (MBI Fermentas),1 � Taq buffer, 2.0 mM MgCl2 and autoclaved Millipore water.Amplification was performed in a Mastercycler (Eppendorf,Germany) under the following conditions: initial denaturation at94 �C for 3 min followed by 30 repeated cycles of 94 �C for 30 s,51 �C for 1 min and 72 �C for 2 min, and a final extension at 72 �Cfor 10 min. PCR amplicons were analyzed on a 1.5% agarose gelalong with a DNA molecular weight marker (MBI Fermentas) anddocumented with a gel documentation system (UVP BioSpectrumImaging system, USA). Each PCR assay was performed withE. faecalis ATCC19433 as a positive control. Positive amplicons asdetermined by size were purified using a MinElute GelPurification Kit (Qiagen, Germany).

2.7. Molecular cloning and sequencing of biomarker genes

Gel-eluted PCR amplicons of the biomarker genes were clonedin a T/A cloning vector according to the manufacturer’sinstructions provided in an InsTAclone PCR Cloning Kit (MBIFermentas). pTZ57R/T-biomarker gene constructs were trans-formed into competent E. coli JM109 (recA1, endA1, gyrA96, thi-1,hsdR17 (rK–mk+), e14–(mcrA–), supE44, relA1, and D(lac-proAB)/F0

(traD36, proAB+, lac Iq, lacZ DM15), plated on Luria–Bertani (LB)agar containing 100 lg/mL ampicillin, 50 lM isopropyl-b-D-thiogalactoside (IPTG) and 80 lg/mL X-gal and incubated over-night at 37 �C. White colonies were selected for PCR amplificationwith vector primers M13f-M13r (MBI Fermentas), and clones withthe correct insert as determined by size were sequenced with anABI PRISM 377 genetic analyzer (Applied Biosystems).

2.8. In silico sequence analysis of biomarker genes

The obtained nucleotide sequences were compared with data-base sequences using the BLAST program of NCBI (http://www.ncbi.nlm.nih.gov) and were aligned and clustered using CLUSTAL-X program. The output alignments were imported into GeneDocprogram (http://www.psc.edu/biomed/genedoc/) and BioEditversion 7.05 (www.mbio.ncsu.edu/BioEdit/) to calculate the per-cent identities among the nucleotide and amino acid sequences.A phylogenetic tree was constructed using MEGA version 5.0 bythe neighbor-joining method.

220 B. Meena et al. / Marine Pollution Bulletin 94 (2015) 217–227

2.9. Statistical analysis

Multivariate analyses were carried out using PRIMER (Clarkeand Warwick, 1994; Clarke and Gorley, 2006). Non-parametricagglomerative hierarchical cluster analysis (AHCA) was performedto classify the assemblages/clusters (Clarke and Warwick, 1994).Non-metric multidimensional scaling (MDS) ordinations based onBray-Curtis similarities of species abundance data were producedto provide a visual representation in a two-dimensional plot ofthe relative similarities in species composition and abundance atthe different sampling stations. Further, SPSS software (version18.0) was used for box-whisker plots, and the diversity index ofEnterococcus sp. in Port Blair Bay at the different stations wasanalyzed using PAST program (Ryan et al., 1995).

3. Results

3.1. Evaluation of physicochemical parameters at sampling stations

The atmospheric and surface water temperatures varied from27.1 �C to 32.2 �C and from 28.2 �C to 30.3 �C, respectively. Thesalinity and pH ranged from 29.75 to 33.08 PSU and from 7.87 to8.38 units, respectively. The relative humidity of the ambientatmosphere ranged from 50% to 80%. The concentration of totalsuspended solids (TSS) widely fluctuated from 9.3 to 53.9 mg/Land the DO ranged from 4.82 to 7.38 mg/L. The annual rainfall dur-ing the sampling seasons of this study amounted to approximately3405 mm and was prolonged from May to December of 2013.Maximum precipitation was recorded during south-west monsoon(May to October) and north-east monsoon (November toDecember).

3.2. Enterococcus population

The results clearly indicate the impact of tidal influences andseasonal climatic changes on the Enterococcus count at the sevenstations in Port Blair Bay during the sampling period (Fig. 2). A trendof increasing Enterococcus counts was observed in the bays, and areduction in number was observed toward the open sea.However, the Enterococcus counts were substantially increased atthe PB, JB and AB stations. Throughout the seasons, the low-tidesamples had a higher Enterococcus count compared with the high-tide samples, and the fecal indicator bacterial counts highly fluctu-ated according to the season and sampling site (Fig. 2). The maximalindicator bacterial density was observed in November of 2013 at PB,and the minimum density was recorded in February of 2013 at AB.

FB, MB, PB, AB and OS showed the highest indicator bacterialcounts of 1.62 � 103, 2.00 � 103, 1.78 � 104, 6.83 � 102 and3.40 � 101 CFU/100 mL, respectively, during November of 2013and minimum counts of 6.67 � 101, 1.67 � 101, 3.20 � 102,1.33 � 101 and 6.67 � 100 CFU/100 mL, respectively, duringAugust of 2013. At JB and HH, the maximum (3.43 � 103 and9.83 � 102 CFU/100 mL, respectively) counts were observed inMay of 2013, and minimum counts were detected (3.67 � 102

and 3.33 � 101 CFU/100 mL, respectively) in August of 2013.Among the sampling sites, the highest Enterococcus counts wererecorded at the PB and JB stations. The Enterococcus count wasfound to exceed the USEPA limits at all other study stations, exceptOS.

Cluster analysis (Fig. 3a) showed that the stations were groupedinto two major clusters with 40% similarity level based onEnterococcus sp. density and species composition. The stations OSand HH formed a single cluster. In terms of bacterial contaminationfrom anthropogenic sources, the OS station stood apart from theother stations, as shown by MDS (Fig. 3b). However, it was closestto HH because both of these stations are located in the outer region

of Port Blair Bay. The low bacterial contamination at this stationcan be attributed to frequent water circulation and its position inthe bay compared with the other stations. Further, OS and HHhad similar density counts of 17 and 53, respectively. PB and JBhad higher levels of bacterial contamination and formed a differentcluster, showing over 90% similarity by CA. Aberdeen Bay formed acluster with MB, which may have been due to the similarities oftheir counts, which were 153 and 150, respectively. Further, FBformed a separate cluster due to the abundant bacterial count atthat station.

A box-plot of variations in microbial density (Enterococcus sp.)in Port Blair Bay according to station is presented in Fig. 4a. Thisgraph shows that the microbial counts of the JB station remainedconsistent, irrespective of the tide or season, because of an adja-cent major fish landing center as well as sewage discharge lineslocated in this region. However, the PB station showed higherbacterial counts mainly during low tide because of untreatedmunicipal sewage discharge, whereas tidal flushing reduced thecount during high tide. Further, the OS station, which continuouslyreceives oceanic water, showed a negligible bacterial count, sug-gestive of a healthy environment and the absence of contaminationtoward the open sea. No conspicuous differences were revealed forany of the other stations by the boxplot graphs.

3.3. Enterococcus species assemblages

A total of 1816 presumptive Enterococcus sp. were identified atall sampling stations. Of the 1816 isolates, 69% (1261/1816) wereEnterococcus sp., 30.56% (555/1816) were non-Enterococcus sp.,and 1.9% (34/1816) were unidentified (Table 2a). E. avium and E.hirae were predominant throughout the marine ecosystem ofPort Blair Bay. However, E. durans, E. faecium, E. mundii, E. saccha-rolyticus and E. casseliflavus were also frequently recorded at thedifferent stations. Nevertheless, E. faecalis was the most frequentlyidentified species at the AB station.

Shannon diversity indices were predicted to study microbialspecies richness, and the results are presented in Table 2b.Species richness (D) was high at JB (18) and MB (18), indicatingthe presence of all Enterococcus sp. However, the least richnesswas recorded at the OS station (3) due to minimal fecal contam-ination. Among all of the sampling sites, the highest D value(0.481) was observed at OS, which may have been due to the domi-nance of E. hirae over other species at that station. ShannonWiener’s diversity index was high at MB (H0 = 2.361), denotingthe maximum diversity of Enterococcus sp. compared with OS(H0 = 0.893). A greater amount of species diversity was observedat MB. However, the individuals were distributed more evenly atOS (J0 = 0.814), which may have been due to the stable waterenvironment. Further, PB and JB showed maximum counts of 371and 347 due to high levels of fecal contamination.

3.4. Species verification of E. faecalis

The 16S rRNA sequences generated in this study were depositedin GenBank (GenBank accession nos. KJ726742, KJ726743,KJ726744, and KJ726745). BLAST and phylogenetic analysesrevealed that the deduced nucleotide sequences were highlyhomologous (99%) with the reported 16S rRNA sequences ofE. faecalis (KC478511, FJ608830, JQ340031 and HM057977). Basedon phylogenetic analysis, the isolates were identified as E. faecalis.

3.5. Antibiotic susceptibility test

E. faecalis isolates were subjected to an antimicrobial sus-ceptibility test. A total of 50.89% (57/112) of the E. faecalis isolateswere susceptible to ampicillin, and 62.5% (70/112) were resistant

Fig. 2. Seasonal and tidal variations in the Enterococcus populations at sampling stations in Port Blair Bay during the year 2013.

B. Meena et al. / Marine Pollution Bulletin 94 (2015) 217–227 221

to streptomycin. No antibiotic resistance was observed for gen-tamycin, tetracycline, clindamycin, penicillin G or erythromycin.However, no antibiotic-resistant E. faecalis isolates were detectedat FB and OS, which are located at the far ends of Port Blair Bay.A maximum of 97.2% isolates were resistant to ampicillin andstreptomycin at the AB station. At the JB, PB, MB, and HH stations,small numbers of isolates showed resistance to ampicillin andstreptomycin. Multi-drug-resistant E. faecalis was not detected at

any of the sampling stations. Hence, the waters of Port Blair Bayare much safer compared with those of mainland India.

3.6. Distribution of biomarker genes

The biomarker genes (asa1, esp, hyl, gelE, ef0591, aadE, pbp4 andcylA) of E. faecalis encode polynucleotides of 713, 510, 276, 213, 844,284, 640 and 517 bp in length, respectively (Fig. 5a). Of the 112 E.

(a)

(b)

Fig. 3. (a) Bray-Curtis cluster analysis of Enterococcus sp. density at different stations in Port Blair Bay as determined by group average linkage. (b) Bray-Curtis similaritybased on Enterococcus sp. abundance.

222 B. Meena et al. / Marine Pollution Bulletin 94 (2015) 217–227

faecalis isolates, 54.46% possessed the gelE gene, 45.54% had the asaIgene, 20.54% had the esp gene, 4% had the hyl gene, 16.96% pos-sessed the ef0591 gene, 50.89% had the pbp4 gene and 62.5% hadthe aadE gene (Table 3). Among all of the sampling stations, themaximum number of virulence determinants was found atAberdeen Bay. The major virulent gene, cylA, was not detected inany of the isolates throughout the sampling seasons. The gelE genewas determined to be the dominant biomarker gene among the iso-lates. A total of 12 isolates possessed gelE and asa1, 5 had gelE, asa1and esp, and one was detected with gelE, asa1, esp, and hyl. Amongthe Enterococcus sp., biomarker genes were detected only in E. fae-calis, and other dominant species, such as E. avium, E. hirae, E. fae-cium, and E. pseudoavium were not found to possess these genes.

3.7. Sequence analysis of key biomarker genes

In silico sequence analysis of the biomarker genes revealed sig-nificant levels of similarity between the sequences obtained in thisstudy and those determined by previous studies that were avail-able in the sequence database. The penicillin-binding protein andEnterococcus surface protein genes showed less significant diver-gence from reported sequences from other species (Fig. 5b andc). Sequence analysis of the aadE and asa1 genes revealed signifi-cant homology with previously reported sequences; hence,

insignificant variation was observed in the phylogenetic tree(Fig. 5d and f). For the gelE gene, Enterococcus sp. alone formed acluster that was separate from other sequences.

4. Discussion

E. coli and enterococci are generally regarded as microbial indi-cators of water quality (Davis et al., 2005). Several studies of recre-ational and drinking water have suggested that enterococci aremore relevant indicators than fecal coliforms (Kinzelman et al.,2003). Port Blair is the capital city of the A & N Islands, and it is alsoa major center of anthropogenic activity. An earlier study per-formed by Nallathambi et al. (2002) examined health indicatorsin Port Blair Bay waters. The current study was the first fecal pollu-tion trend analysis of Port Blair Bay with respect to biomarkers andantibiotic resistance patterns of E. faecalis isolated during the year2013. We demonstrated the tidal and seasonal influences on thespecies distribution of Enterococcus isolates using statistical tools.Our findings may provide insights into the possible rises in infec-tious disease and gastrointestinal infections in individuals thatare linked with the seafood chain (Rees, 1993).

Higher Enterococcus counts were found in low-tide samplescompared with high-tide samples during all seasons. At the OpenSea station, the tidal effect was diminished compared with the

(a)

(b)

Fig. 4. (a) Variations in Enterococcus sp. at each station in Port Blair Bay. For each box-plot, the central point represents the median, the box shows the interval between the25th and 75th percentiles, and the whisker indicates the range. The outlier values are shown as dots. (b) Heat map depicting the abundance of Enterococcus across samplinglocations with single linkage clustering.

B. Meena et al. / Marine Pollution Bulletin 94 (2015) 217–227 223

other stations of Port Blair Bay, and the Enterococcus counts wererecorded minimum in this station. There are many variables thataffect indicator bacterial densities, including tidal stage, winddirection and speed, water temperature, season and sample loca-tion (Ferretti et al., 2011). Tidal current also plays an importantrole in regulating water quality in semi-closed coastal bays(Dheenan et al., 2014). Sahu et al. (2013) have previously reportedthe presence of a higher organic load during low tide comparedwith high tide in Port Blair Bay. The maximum Enterococcus countwas recorded during November of 2013, and the minimum countwas observed in August of 2013. Tropical cyclone Lehar producedheavy rainfall, affecting the South Andaman region duringNovember of 2013, and it may have been the reason for theincreases in fecal contamination and the Enterococcus populationduring this season. Increased Enterococcus counts in coastal watersafter heavy rainfall due to soil resuspension and seasonal influencehas been previously reported by Janelidze et al. (2011). The maxi-mum Enterococcus counts were recorded at PB and JB at all seasons

in the current study. These two stations receive more sewage out-put in Port Blair Bay and have been reported to have higher organicloads by Sahu et al. (2013), which may have been the reason for theincreased counts of indicator bacteria in these regions.

Cluster analysis showed that JB and PB stations formed a singlecluster. These stations were critically affected by anthropogenicfactors, such as domestic waste, untreated municipal sewage andwaste from fish landing centers. Further, the residence period oftide-influenced water is higher at JB (a major fish landing center)(Sahu et al., 2013) and becomes worse due to untreated municipalsewage outfall and fish trawler activities. Similarly, strong anthro-pogenic influences of ferries and sewage outfall were observed atPB (a major inter-island ferry service providing harbor). The sta-tions OS and HH formed one cluster, and it is known that OS is apristine environment compared with other stations (Sahu et al.,2013) in Port Blair Bay. However, MDS revealed that OS remainedclustered near HH, which is because both of these stations arelocated in the outer region of the bay. The low microbial

Tabl

e2a

Div

ersi

tyof

Ente

roco

ccus

sp.d

urin

gth

eye

ar20

13.

Stat

ion

No.

ofis

olat

esPo

siti

veis

olat

esEn

tero

cocc

ussp

.dis

trib

uti

on

E. faec

alis

E. faec

ium

E. hira

eE. as

ini

E. aviu

mE. ca

ssel

iflav

usE. du

rans

E. galli

naru

mE. m

alod

orat

usE. m

undi

iE. ps

eudo

aviu

mE. so

litar

ius

E. raffi

nosu

sE. ce

coru

mE. di

spar

E. sacc

haro

lyti

cus

E. flave

scen

sEn

tero

cocc

ussp

.

FB27

317

09

249

1160

312

11

612

01

01

10

1M

B24

515

011

332

841

35

34

512

44

25

21

5JB

462

347

2811

8721

103

67

25

832

26

17

151

5H

H10

653

91

100

171

10

03

50

00

01

05

PB43

737

119

1211

113

103

611

39

846

28

07

51

7A

B25

215

336

538

535

02

12

45

22

03

32

8O

S41

170

011

03

00

00

00

00

00

00

3

Tota

l18

1612

6111

234

338

5836

219

3810

2134

112

1021

323

275

34

Table 2bDiversity of Enterococcus sp. in Port Blair Bay.

Station* AB FB HH JB MB OS PB

Richness (S) 16 15 10 18 18 3 17Individuals 153 170 53 347 150 17 371Dominance (D) 0.177 0.226 0.189 0.175 0.143 0.481 0.19Shannon diversity

index (H)2.079 1.856 1.888 2.145 2.361 0.893 2.074

Evenness (J) 0.5 0.426 0.66 0.474 0.588 0.814 0.468

* AB: Aberdeen Bay; FB: Flat Bay; HH: Haddo Harbor; JB: Junglighat Bay; MB:Minnie Bay; OS: Open Sea; and PB: Phoenix Bay.

224 B. Meena et al. / Marine Pollution Bulletin 94 (2015) 217–227

contamination at this station can be attributed to frequent watercirculation and its position in the bay compared with the other sta-tions. Further, OS and HH had similar density counts of 17 and 53,respectively. However, pollutants in the bay are diluted due to itslarge area (nearly 30 km2) and high tidal amplitude (2.4 m), whichrapidly diminish the effects of contaminants (Jha et al., 2014).Nevertheless, the OS station was found to be a healthy environ-ment due to good water mixing and had the lowest bacterial countaccording to the USEPA standards. The bacterial populations in thebays were higher than those in the open sea because coastalhuman habitation depends more on these water bodies for fishingand navigation purposes. Domestic waste is also released directlyinto the bay, ultimately diminishing water quality and increasingthe bacterial load (Dunn et al., 2012).

The identified Enterococcus sp. were speciated to determine thesources and ecology of these organisms in the marine environment.Of the 1816 isolates, the predominant species identified in thewater samples at all seven study stations were as follows:E. avium, E. hirae, E. faecalis and E. pseudoavium. Species distributionanalysis elucidated the pollution source of this particular site.E. faecalis and E. faecium are predominant in the intestinal micro-flora of humans and animals and are considered to be opportunisticpathogens. E. hirae and E. avium are found in animal microflora, andE. gallinarum, E. casseliflavus and E. mundii are associated withplants and soil (Moore et al., 2008). In this study, the abundanceand distribution of Enterococcus sp. were found to be high at theJB and PB stations. Biodiversity parameters, such as richness, Hindex and population size, were also significantly elevated at thesestations. E. hirae was the dominant species recorded at these sta-tions, followed by E. gallinarum, E. casseliflavus and E. mundii.These results clearly verify that natural sources, such as plantsand land runoff during heavy rainfall, were the major sources ofpollution at these stations. The prevalences of E. gallinarum,E. casseliflavus and E. mundii at beaches and in runoff samples withsoil, plants and animals have been previously reported by Sternet al. (1994).

At FB and MB, the dominance and diversity of Enterococcus sp.widely fluctuated during all seasons. These sites are located atthe inner most part of Port Blair Bay and receive freshwater inputand terrestrial runoff from adjacent areas (Sahu et al., 2013). At theHH and OS stations, the Enterococcus sp. counts and diversity werelower, and these bays are situated in the outer region of Port BlairBay, where depth and mixing are high. The negative richness (J)value and positive D value indicate that anthropogenic activitieshad the least influence at these stations. At the AB station, theEnterococcus sp. counts were lower compared with the other innerbay sites. However, E. faecalis was found to be the dominantspecies throughout the seasons, with a low D value observed nearthe MB station. The dominance of E. faecalis at this study areaclearly indicates the presence of human fecal pollution. Theseresults suggest that anthropogenic influences at the AB stationdiffered from those at the other bays due to increased recreationalwater games and untreated municipal waste outlets. The higherpercentages of E. faecalis and E. faecium in the environmental and

a b c d e f g h I j k l m

(a)

(b)

(c)

(d)

(e)

(f)

Fig. 5. (a) Agarose gel electrophoresis of the PCR amplicons of biomarker genes: lanes a, d, g, h, j, and m; 1 kb DNA ladder; lane b, gelE amplicon (213 bp); lane c, asaI amplicon(713 bp); lane e, esp amplicon (510 bp); lane f, ef0591 amplicon (844 bp); lane i, aadE amplicon (284 bp); lane k, hyl amplicon (276 bp); and lane l, pbp4 amplicon (640 bp). (b)Phylogenetic analysis of the major biomarker genes in E. faecalis, including (b) pbp4, (c) esp, (d) aadE, (e) asa1, and (f) gelE.

B. Meena et al. / Marine Pollution Bulletin 94 (2015) 217–227 225

Table 3Prevalence of biomarker genes in E. faecalis during the year 2013 in Port Blair Bay.

Station No. ofisolates

Biomarker genes

gelE asaI esp hyl cylA ef0591 pbp4 aadE

FB 9 0 0 0 0 0 0 – –MB 11 2 0 0 0 0 0 4 4JB 28 16 13 2 1 0 4 10 17HH 9 1 1 0 0 0 0 1 3PB 19 11 10 4 0 0 1 7 11AB 36 31 27 17 4 0 14 35 35OS 0 0 0 0 0 0 0 – –

Total 112 61 51 23 5 0 19 57 70

226 B. Meena et al. / Marine Pollution Bulletin 94 (2015) 217–227

wastewater samples indicated the presence of human and animalfeces.

The misuse or abuse of antibiotics is the primary reason for theemergence of antibiotic resistance in bacteria. Antibiotics areexcreted from humans and animals due to poor absorption in theintestines and reduced degradation in the human body, and theyare discharged into sewage. Thus, animal waste plays a major rolein the distribution of antibiotic-resistant bacteria in the environ-ment (Tao et al., 2010). Of the 112 E. faecalis isolates evaluated,the distribution of biomarker genes and antibiotic resistance werethe greatest at the AB station, indicating that human and animalfecal contamination must be a pollution source. Among the bio-marker genes, gelE was the most dominant virulence factordetected among the isolates. The presence of gelE in clinical andenvironmental E. faecalis isolates has been previously recorded(Vankerckhoven et al., 2004). In silico sequence analysis of biomar-ker genes in E. faecalis in this study revealed that they are compara-tively well conserved at both the nucleotide and amino acid levelswith those of previous reports. The exact roles of environmentaland clinical E. faecalis isolates in human disease are not clear(Moellering, 1992).

5. Conclusion

In this study, a seasonal assessment of water quality in terms ofthe presence of fecal indicator bacteria and their biomarker geneswas performed at seven sampling stations in Port Blair Bay. Basedon the results, the monitoring of coastal waters for enterococci andthe determination of the prevalences of virulence and antibioticresistance factors are highly recommended to combat microbialpollution and prevent potential waterborne diseases. Except theOpen Sea station, the Enterococcus counts at all six stations wereabove the acceptable limit reported by the USEPA. In addition, clus-ter and PC analyses revealed that the Enterococcus counts anddiversity were high at the JB and PB stations. The assessment ofspecies diversity of the inner bays revealed that the major pollu-tion sources were land runoff, soil leaching, sewage and biogenoussources. Anthropogenic perturbations at the AB station weredemonstrated by the maximal E. faecalis counts and prevalenceof biomarker genes. The detection of pathogenicity and virulencefactors in E. faecalis at monitoring stations is considered to be aneffective tool for detecting pollution and its sources, in order toprevent waterborne diseases. Hence, the presence of antibioticresistance and virulent enterococci in coastal waters of populousnations demands improved surveillance for risk assessment andpreventive strategies for the protection of public health.

Acknowledgements

The authors gratefully acknowledge the financial support pro-vided by the Earth System Sciences Organization, Ministry of EarthSciences, Government of India, New Delhi for conducting the survey

and research. The authors are thankful to Dr. M. A. Atmanand,Director, ESSO-National Institute of Ocean Technology (NIOT),Chennai for providing support and encouragement to perform thisresearch. The authors are profoundly thankful to Dr. M.Vijayakumaran for his critical comments and suggestions forimproving this manuscript and to Dr. Toms C. Joseph, SeniorScientist, Central Institute of Fisheries Technology (CIFT), Kochi,India for performing DNA sequencing and in silico sequence analysis.

References

Albert, M., Anicet, R.B., 1999. Identification of Enterococcus spp. with a biochemicalkey. Appl. Environ. Microbiol. 65, 4425–4430.

American Society for Microbiology, 2003. Manual of Clinical Microbiology, 8th ed.ASM Press, Washington, DC, pp. 415, 422–426, 435, 438–439.

Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Scidman, J.G., Smith, J.A.,Strichi, K., 1994. Current Protocols in Molecular Biology. Wiley, NewYork,2.0.1–2.14.8.

Clarke, K.R., Gorley, R.N., 2006. PRIMER v6: User Manual/Tutorial, Primer-E Ltd.,Plymouth: 91.

Clarke, K.R., Warwick, R.M., 1994. Change in Marine Communities: An Approach toStatistical Analysis and Interpretation. Natural Environment Research Council,Plymouth Marine Laboratory, Plymouth, UK, 144.

CLSI, 2009. Performance Standards for Antimicrobial Disk Susceptibility Tests;Approved Standard-Tenth Edition. CLSI Document M02–A10, Clinical andLaboratory Standards Institute, Wayne.

Davis, K., Anderson, M.A., Yates, M.V., 2005. Distribution of indicator bacteria inCanyon Lake, California. Water Res. 39, 1277–1288.

Dheenan, P.S., Jha, D.K., Vinithkumar, N.V., Angelin Ponmalar, A., Venkateshwaran,P., Kirubagaran, R., 2014. Spatial variation of physicochemical andbacteriological parameters elucidation with GIS in Rangat Bay, MiddleAndaman, India. J. Sea. Res. 85, 534–541.

Dunn, R.J.K., Catterall, K., Hollingsworth, A., Kirkpatrick, S., Capati, G., Hudson, S.,Khan, S., Panther, J.C., Stuart, G., Szylkarski, S., Teasdale, P.R., Tomlinson, R.B.,Welsh, D.T., 2012. Short-term variability of nutrients and faecal indicatorbacteria within the gold coast Seaway, southern Moreton Bay (Australia). J.Coast. Res. 28, 80–88.

Elmanama, A.A., Fahd, M.I., Afifi, S., Abdallah, S., Bahr, S., 2005. Microbiologicalbeach sand quality in Gaza Strip in comparison to seawater quality. Environ.Res. 99, 1–10.

Farrel, D.J., Morrissey, I., De Rubeis, D., Robbins, M., Felmingham, D., 2003. A UKmulticentre study of the antimicrobial susceptibility of bacterial pathogenscausing urinary tract Infection. J. Infect. 46, 94–100.

Ferretti, J.A., Tran, H.V., Cosgrove, E., Protonentis, J., Loftin, V., Conklin, C.S., Grant,N.R., 2011. Comparison of Enterococcus density estimates in marine beach andbay samples by real-time polymerase chain reaction, membrane filtration anddefined substrate testing. Mar. Poll. Bull. 62, 1066–1072.

Hartke, A., Giard, J.C., Laplace, J.M., Auffray, Y., 1998. Survival of Enterococcus faecalisin an oligotrophic microcosm: changes in morphology, development of generalstress resistance and analysis of protein synthesis. Appl. Environ. Microbiol. 64,4238–4245.

Harwood, V.J., Delahoya, N.C., Ulrich, R.M., Kramer, M.F., Whitlock, J.E., Garey, J.R.,Lim, D.V., 2004. Molecular confirmation Enterococcus faecalis and Enterococcusfaecium from clinical fecal and environmental sources. Lett. Appl. Microbiol. 38,476–482.

Heymann, D.L., 2006. Resistance to anti-infective drugs and the threat to publichealth. Cell 124, 671–675.

Irani, R., Megan, H., Flavia, H., 2011. SNP diversity of Enterococcus faecalis andEnterococcus faecium in a South East Queenland Waterway, Australia, andassociated antibiotic resistance gene profiles. BMC Microbiol. 11, 201.

Janelidze, N., Jaiani, E., Lashkhi, N., Tskhvediani, A., Kokashvili, T., Gvarishvili, T.,Jgenti, D., Mikashavidze, E., Diasamidze, R., Narodny, S., Obiso, R., Whitehouse,C.A., Huq, A., Tediashvili, M., 2011. Microbial water quality of the Georgiancoastal zone of the Black sea. Mar. Poll. Bull. 62, 573–580.

Jha, Dilip Kumar, Vinithkumar, N.V., Sahu, Biraja Kumar, Das, Apurba Kumar,Dheenan, P.S., Venkateshwaran, P., Begum, Mehmuna, Ganesh, T., PrashanthiDevi, M., Kirubagaran, R., 2014. Multivariate statistical approach to identifysignificant sources influencing the physico-chemical variables in Aerial Bay,North Andaman, India. Mar. Poll. Bull. 85, 261–267.

Kinzelman, J., Ng, C., Jackson, E., Gradus, S., Bagley, R., 2003. Enterococci asindicators of Lake Michigan Recreational water Quality: comparison of twomethodologies and their impacts on Public Health Regulatory Events. Appl.Environ. Microbiol. 69, 92–96.

Kuzucu, C., Cizmeci, Z., Durmaz, R., Durmaz, E., Ozerol, H., 2005. The prevalence offecal colonization of enterococci, the resistance of the isolates to ampicillin,vancomycin and high-level aminoglycosides, and the clonal relationship amongisolates. Micro. Drug. Resist. 11, 159–164.

Moellering, R.C., 1992. Emergence of Enterococcus as a significant pathogen. Clin.Infect. Dis. 14, 1173–1176.

Moore, D.F., Guzman, J.A., McGee, C., 2008. Species distribution and antimicrobialresistance of enterococci isolated from surface and ocean water. J. Appl.Microbiol. 105, 1017–1025.

B. Meena et al. / Marine Pollution Bulletin 94 (2015) 217–227 227

Nallathambi, T., Eashwar, M., Kuberaraj, K., 2002. Abundance of indicator andgeneral heterotrophic in Port Blair Bay, Andamans. Indian J. Mar. Sci. 31,65–68.

Rees, G., 1993. Health implications of sewage in coastal waters: the British case.Mar. Poll. Bull. 26, 14–19.

Ryan, P.D., Harper, D.A.T., Whalley, J.S., 1995. PALSTAT, Statistics forPalaeontologists. Kluwer Academic Publishers.

Sahu, B.K., Mehmuna, B., Khadanga, M.K., Jha, D.K., Vinithkumar, N.V., Kirubagaran,R., 2013. Evaluation of significant sources influencing the variation of physic-chemical parameters in Port Blair Bay, South Andaman, India by usingmultivariate statistics. Mar. Poll. Bull. 66, 246–251.

Sherman, J.M., 1937. The streptococci. Bacteriol. Rev. 1, 3–97.Stern, C.S., Carvalho Mda, G., Teixeira, L.M., 1994. Characterization of enterococci

isolated from human and non-human sources in Brazil. Diagn. Microbiol. Infect.Dis. 20, 61–67.

Strickland, J.D.H., Parsons, T.R., 1968. Determination of dissolved oxygen. In: APractical Handbook of Seawater Analysis, vol. 167. Fisheries Research Board ofCanada, Bulletin, pp. 71–75.

Tao, R., Ying, G.G., Su, H.C., Zhou, H.W., Sidhu, J.P., 2010. Detection of antibioticresistance and tetracycline resistance genes in Enterobacteriaceae isolated fromthe Pearl rivers in South China. Environ. Pollut. 158, 2101–2109.

US EPA, 2003. Bacterial Water Quality Standards for Recreational Waters (FreshWaters and Marine Waters).

Vankerckhoven, V., Autgaerden, T.V., Vael, C., Lammens, C., Chapelle, S., Rossi, R.,Jabes, D., Goossens, H., 2004. Development of a multiplex PCR for the detectionof asa1, esp, hyl, gelE and cyl in enterococci and survey of virulence determinantsamong European hospital isolates of Enterococcus faecium. J. Clin. Microbiol. 42,4473–4479.

WHO, 1998. Draft Guidelines for Safe Recreational water Environment: Coastal andFresh water, World Health Organization, Geneva.