43
Training materials Ensembl training materials are protected by a CC BY license http://creativecommons.org/licenses/by/4.0/ If you wish to re-use these materials, please credit Ensembl for their creation If you use Ensembl for your work, please cite our papers http://www.ensembl.org/info/about/publications.html

Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

  • Upload
    others

  • View
    5

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Training materials

• Ensembl training materials are protected by a CC BY license • http://creativecommons.org/licenses/by/4.0/• If you wish to re-use these materials, please credit Ensembl for

their creation• If you use Ensembl for your work, please cite our papers • http://www.ensembl.org/info/about/publications.html

Page 2: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Ben Moore

Ensembl Outreach Officer

EMBL-EBI

Browsing Genes and Genomes with Ensembl

Page 3: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Objectives

• What is Ensembl?

• What type of data can you get in Ensembl?

• How to navigate the Ensembl browser website.

• How to use Ensembl tools

• Where to go for help and documentation.

Page 4: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

This webinar course

Date Webinar topic Instructor

6th April Introduction to Ensembl Helen Sparrow

13th April Ensembl genes Emily Perry

20th April Data export with BioMart Victoria Newman

27th April Variation data in Ensembl and the Ensembl VEP Victoria Newman

4th May Comparing genes and genomes with Ensembl Compara Ben Moore

11th May Finding features that regulate genes – the Ensembl Regulatory Build

Ben Moore

18th May Uploading your data to Ensembl and advanced ways to access Ensembl data

Emily Perry

All webinars begin at 9am BST

Page 5: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Structure

Presentation:What the data/tool isHow we produce/process the data

Demo:Getting the data

Using the tool

Exercises:On the train online course

Page 6: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Questions?

• Ask questions in the Chat box in the webinar interface

• My Ensembl colleagues will respond during

• There’s no threading so please respond with @username

Emily Perry Victoria Newman

Page 7: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Course exerciseshttp://www.ebi.ac.uk/training/online/course/ensembl-browser-w

ebinar-series-2016

This text will be replaced by a YouTube (link to YouKu too) video of this webinar

and a pdf of the slides

The “next page”is the exercises for this

module

A link to exercises and their solutions are in the page hierarchy

Page 8: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Get help with the exercises

• Use the exercise solutions in the online course

• Join our Facebook group and discuss the exercises with everybody (see the online course for the link)

• Email us: [email protected]

Page 9: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

EBI is an Outstation of the European Molecular Biology Laboratory.

Ensembl Regulation

Page 10: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Regulation- Annotation of the genome with functional regulatory elements;

promoters, enhancers, repressors

- Epigenetic marks

- Histone modifications

- DNA methylation

- Transcription Factor binding

- RNA Pol binding

- Predicted open/closed chromatin

- DNase I sensitivity

Page 11: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Epigenetics

The study of heritable genetic changes, without changes in the DNA sequence.

This is known to regulate gene expression.

Page 12: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Epigenetic change -> cell differentiation

Page 13: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Epigenetic change -> cell differentiation

- Cells carry out different functions- Cells are morphologically different- Cells express different genes- Cells have different epigenomes

Page 14: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Epigenetic change -> cell differentiation

Stem cell

Differentiated cell

Page 15: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Histone modifications

We describe histone modifications using the form Subunit, Amino acid, Position, Modification, eg H3K36me3.

Page 16: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Histone code

Modification Histone

H3K4 H3K9 H3K14 H3K27 H3K79 H4K20 H2BK5

me1

me2

me3

ac

Page 17: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

GGCGGGATTGCGCGTTAGATCGCGCGCTTATGCTAGCCGCGCTGATAGCGGCGGGATTGCGCGTTAGATCGCGCGCTTATGCTAGCCGCGCTGATAGC

CH3CH3 CH3 CH3 CH3CH3CH3 CH3

GCTATCAGCGCGGCTAGCATAAGCGCGCGATCTAACGCGCAATCCCGCC

CH3CH3 CH3CH3CH3 CH3 CH3CH3

DNA methylation -> inactive

Page 18: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Bisulfite sequencing

GGCGGGATTGCGCGTTAGATCGCGCGCTTATGCTAGCCGCGCTGATAG

CH3 CH3 CH3

CH3 CH3

Bisulfite treatment

GGUGGGATTGUGUGTTAGATCGCGCGUTTATGUTAGUCGCGUTGATAG

Sequence and compare to reference

Page 19: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Promoters and enhancers

- TF-binding at promoters and enhancers is necessary for transcription

- Combinations of epigenetic marks affect the ability and probability of TF-binding at these sites

Page 20: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

ChIP-seq for histone mods & TF-binding

DNA

DNA-binding protein

Shear the genome

Crosslink

Covalent bond

Antibody

Pull down the protein with an antibody

Remove crosslinks and wash

Sequence fragments

ACGCTGACTAGAATCAATGGCTTCTCTTCGCATATGGCTGACTA

Page 21: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Open/closed chromatin

Open chromatin is transcriptionally active.Closed chromatin is inactive.

Page 22: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

DNase hypersensitivity

Sequence and compare to reference

DNase treatment

Purify

Page 23: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Methods of gene regulation

Method of regulation Detection Method

Histone modifications ChIP-seq

Transcription factor binding ChIP-seq

Open/closed chromatin DNase sensitivity

DNA methylation Bisulfite sequencing

Page 24: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Current data

Page 25: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

The future

Page 26: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

A subset of cell types

- Only a subset of available data is displayed in Ensembl.- We display cell types that have, at a minimum:

- CTCF binding- DNase or FAIRE data- H3K4me3, H3K27me3, H3K36me3 data

- We display all TFBS and histone modification data known in these cell types.

- We process these data to predict activity.

- Further data can be added using track hubs.

Page 27: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Processing the data

- The raw data is taken from the various sources.- This is processed to predict the positions of regulatory

features, such as promoters, enhancers and insulators.- The activity of these features is predicted in the different

cell types.

- All of this can be viewed in the genome browser.

Page 28: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Raw data

Transcription Factor ATranscription Factor BTranscription Factor CHistone mod1Histone mod2Histone mod3

Page 29: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Searching for patterns

known promoter

known promoter

known promoter

Page 30: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Segmentation

Transcription Factor ATranscription Factor BTranscription Factor C

Histone mod1Histone mod2Histone mod3

Page 31: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

MultiCell features

Cell type 1

Cell type 2

Cell type 4

Cell type 3

Page 32: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Cell-specific features

Cell type 1

Cell type 2

Cell type 4

Cell type 3

MultiCell

Page 33: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

We do not…- …link promoters/enhancers/insulators or any other

regulatory features to genes. We allow you see what is where and make your own inferences.

- …link regulatory features to gene expression. We have cell-line specific regulation data and tissue specific expression data – make of it what you will.

Regulatory data is incredibly complex and still in relative infancy. There is no comprehensive database of regulation data.

Page 34: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Hands on

- We’re going to look at the region of a gene LIMD2 to find regulatory features and explore what cells types they are active in and what evidence there is to show this.

Page 35: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

This webinar courseDate Webinar topic Instructor

6th April Introduction to Ensembl Helen Sparrow

13th April Ensembl genes Emily Perry

20th April Data export with BioMart Victoria Newman

27th April Variation data in Ensembl and the Ensembl VEP Victoria Newman

4th May Comparing genes and genomes with Ensembl Compara Ben Moore

11th May Finding features that regulate genes – the Ensembl Regulatory Build Ben Moore

18th May Uploading your data to Ensembl and advanced ways to access

Ensembl data

Emily Perry

Page 36: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Course exercises

http://www.ebi.ac.uk/training/online/course/ensembl-browser-webinar-series-2016

This text will be replaced by a YouTube (link to YouKu too) video of the webinar

and a pdf of the slides.

The “next page” will be the exercises

A link to exercises and their solutions will appear in the page

hierarchy

Page 37: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Get help with the exercises

• Use the exercise solutions in the online course

• Join our Facebook group and discuss the exercises with everybody (see the online course for the link)

• Email us: [email protected]

Page 38: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Help and documentationCourse online http://www.ebi.ac.uk/training/online/subjects/11

Tutorials www.ensembl.org/info/website/tutorials

Flash animations

www.youtube.com/user/EnsemblHelpdesk

http://u.youku.com/Ensemblhelpdesk

Email us [email protected]

Ensembl public mailing lists [email protected], [email protected]

Page 39: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Follow us

www.facebook.com/Ensembl.org

@Ensembl

www.ensembl.info

Page 40: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Publications

Aken, BL. et al

Ensembl 2017

Nucleic Acids Research

http://europepmc.org/articles/PMC5210575

Xosé M. Fernández-Suárez and Michael K. SchusterUsing the Ensembl Genome Server to Browse Genomic Sequence Data.Current Protocols in Bioinformatics 1.15.1-1.15.48 (2010)www.ncbi.nlm.nih.gov/pubmed/20521244

Giulietta M Spudich and Xosé M Fernández-SuárezTouring Ensembl: A practical guide to genome browsingBMC Genomics 11:295 (2010)www.biomedcentral.com/1471-2164/11/295

Javier Herrero et al

Ensembl Regulation Resources

Database (Oxford) 2016: bav119

https://academic.oup.com/database/article-lookup/doi/10.1093/database/bav119

http://www.ensembl.org/info/about/publications.html

Page 41: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Ensembl 2017

Page 42: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Ensembl Acknowledgements

Page 43: Ensembl training materials are protected by a CC BY license … · 2017-05-11 · 6th April Introduction to Ensembl Helen Sparrow 13th April Ensembl genes Emily Perry 20th April Data

Training materials

• Ensembl training materials are protected by a CC BY license • http://creativecommons.org/licenses/by/4.0/• If you wish to re-use these materials, please credit Ensembl for

their creation• If you use Ensembl for your work, please cite our papers • http://www.ensembl.org/info/about/publications.html