Enhanced 1,2-dichloroethane degradation in heavy metal co-contaminated wastewater undergoing biostimulation and bioaugmentation

Chemosphere xxx (2013) xxx–xxx

Contents lists available at SciVerse ScienceDirect

Chemosphere

journal homepage: www.elsevier .com/locate /chemosphere

Enhanced 1,2-dichloroethane degradation in heavy metalco-contaminated wastewater undergoing biostimulation andbioaugmentation

0045-6535/$ - see front matter � 2013 Elsevier Ltd. All rights reserved.http://dx.doi.org/10.1016/j.chemosphere.2013.06.034

⇑ Corresponding author. Tel.: +27 31 260 7400/7401; fax: +27 31 260 7809.E-mail address: [email protected] (A.O. Olaniran).

Please cite this article in press as: Arjoon, A., et al. Enhanced 1,2-dichloroethane degradation in heavy metal co-contaminated wastewater undbiostimulation and bioaugmentation. Chemosphere (2013), http://dx.doi.org/10.1016/j.chemosphere.2013.06.034

Ashmita Arjoon, Ademola O. Olaniran ⇑, Balakrishna PillayDiscipline of Microbiology, School of Life Sciences, University of KwaZulu-Natal (Westville Campus), Private Bag X54001, Durban 4000, South Africa

h i g h l i g h t s

� Problems of co-occurrence of organic and heavy metals pollutants in water.� Impacts of heavy metals on 1,2-dichloroethane (1,2-DCA) degradation.� Bioremediation of 1,2-DCA degradation in water co-contaminated with heavy metals.� Microbial population and diversity profiling in the co-contaminated water.� Identification of important bacterial phylotypes involved in the bioremediation process.

a r t i c l e i n f o

Article history:Received 12 November 2012Received in revised form 25 May 2013Accepted 7 June 2013Available online xxxx

Keywords:Co-contaminationBiostimulation1,2-DichloroethanePCR–DGGEDual-bioaugmentationHeavy metals

a b s t r a c t

Biostimulation, bioaugmentation and dual-bioaugmentation strategies were investigated in this study forefficient bioremediation of water co-contaminated with 1,2-dichloroethane (1,2-DCA) and heavy metals,in a microcosm set-up. 1,2-DCA concentration was periodically measured in the microcosms by gas chro-matographic analysis of the headspace samples, while bacterial population and diversity were deter-mined by standard plate count technique and Polymerase chain reaction and denaturing gradient gelelectrophoresis (PCR–DGGE) analysis, respectively. Dual-bioaugmentation, proved to be most effectiveexhibiting 22.43%, 26.54%, 19.58% and 30.49% increase in 1,2-DCA degradation in microcosms co-contam-inated with As3+, Cd2+, Hg2+ and Pb2+, respectively, followed by bioaugmentation and biostimulation.Dual-bioaugmented microcosms also exhibited the highest increase in the biodegradation rate constant(k1) resulting in 1.76-, 2-, 1.7- and 2.1-fold increase in As3+, Cd2+, Hg2+ and Pb2+ co-contaminated micro-cosms respectively, compared to the untreated microcosms. Dominant bacterial strains obtained fromthe co-contaminated microcosms were found to belong to the genera Burkholderia, Pseudomonas, Bacillus,Enterobacter and Bradyrhizobium, previously reported for 1,2-DCA and other chlorinated compounds deg-radation. PCR–DGGE analysis revealed variation in microbial diversity over time in the different co-con-taminated microcosms. Results obtained in this study have significant implications for developinginnovative bioremediation strategies for treating water co-contaminated with chlorinated organics andheavy metals.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction

Chlorinated organic pollutants are widespread groundwatercontaminants (Eguchi et al., 2001; Landmeyer et al., 2011). Of par-ticular concern is 1,2-dichloroethane (1,2-DCA) since it is the mostimportant quantitatively (De Wildeman and Verstraete, 2003),with an excess of 17.5 million tons produced per annum in the Uni-ted States, Western Europe and Japan in total (Field and Sierra-Alvarez, 2004). Furthermore, the Environmental Protection Agency

and the International Agency for Cancer Research have classified1,2-DCA as a probable human carcinogen (Williams et al., 2001).In addition to pollution by 1,2-DCA, there is a continuous influxof heavy metals into the biosphere from both natural and anthro-pogenic sources (Perelomov and Prinsky, 2003; Wuana and Okiei-men, 2011). Thus, high proportions of hazardous waste sites areco-contaminated with organic and metal pollutants (Sandrin andMaier, 2003).

The presence of heavy metals may inhibit biodegradation ofchlorinated organic contaminants by either inhibiting enzymes in-volved in biodegradation or those involved in microbial metabo-lism. The effects include extended acclimation periods, reduced

ergoing

http://dx.doi.org/10.1016/j.chemosphere.2013.06.034

mailto:[email protected]


http://www.sciencedirect.com/science/journal/00456535

http://www.elsevier.com/locate/chemosphere


2 A. Arjoon et al. / Chemosphere xxx (2013) xxx–xxx

biodegradation rates, and failure of target compound biodegrada-tion (Kuo and Genthner, 1996). Remediation of sites co-contami-nated with organic and metal pollutants is a complex problem,as the two components often must be treated differently (Sandrinand Maier, 2003). Previous approaches to remediate co-contami-nated environments include; the addition of metal-chelatingadsorbents (Malakul et al., 1998), the use of treatment additives,pH adjustments and the addition of divalent cations (Sandrin andMaier, 2003, 2002). However, these methods only target heavy me-tal removal and do not target degradation of the organic pollutant.In addition, they are expensive and can produce other waste prob-lems, which have limited their industrial applications (Srivastavaand Majumder, 2008). Bioremediation can be an environmentallyand economical feasible alternative and can include bioattenua-tion, biostimulation and bioaugmentation. Microorganisms canconvert 1,2-DCA into innocuous end products via different path-ways and various bacterial strains, including Xanthobacter autotro-phicus and Ancylobacter aquaticus capable of 1,2-DCA degradationhave been previously described (Janssen et al., 1989; Van DenWijngaard et al., 1992; Govender and Pillay, 2011). Microbesmay also contain mechanisms to resist metal toxicity (Bruinset al., 2000; Ahemad, 2012) and sites contaminated with heavymetals can be bioaugmented by using these heavy metal resistantstrains.

Despite the frequent occurrences of co-contaminated sites, lim-ited studies have been carried out to address this problem, whichcontinue to pose serious environmental health risk as a result ofcontinuous release of chlorinated organic compounds and heavymetals into the environment by many industries, refineries andmines (Basak and Gokcay, 2005). Heavy metals also enter thewater supply from acid rain which breaks down soils and rocks,releasing heavy metals into streams, lakes and groundwater (Alluriet al., 2007). Chemical mixtures of pollutants (organic–organic,inorganic–inorganic, and organic–inorganic) are generally morecomplicated to study than individual chemicals (Ramakrishnanet al., 2011).

In order to determine the best way of improving bioremediationof co-contaminated sites, the present study investigated variousbioremediation options for effective 1,2-DCA degradation in waterco-contaminated with heavy metals. Microbial diversity was alsoprofiled at the different stages of the degradation process to deter-mine the combined effect of chlorinated organics and heavy metalcontamination on the indigenous microorganisms in water micro-cosms receiving different treatments. Bacterial species active in thebioremediation of the co-contaminated water were also identifiedusing both culture-dependent and culture-independent methods.

2. Materials and methods

2.1. Bacterial cultures and standardization

Eighty bacterial isolates previously obtained from soil co-con-taminated with 1,2-DCA and heavy metals were screened for heavymetal resistance. The isolates were grown on plate count agar(Merck Biolabs) supplemented with different concentrations ofAs3+, Cd2+, Hg2+ and Pb2+ separately. Four bacteria capable ofgrowing at 2 mM concentration of the heavy metals were furtherpurified, identified and used in the dual-bioaugmentation studies.These organisms are Delftia sp. (As), Pseudomonas sp. (Cd), Cupriavi-dus sp. (Hg) and Stenotrophomonas sp. (Pb). X. autotrophicus GJ10was used in both the bioaugmentation and dual-bioaugmentationstudies. Pure culture of each organism was grown in nutrient brothand incubated for 72 h at 30 �C on a rotary shaker at 150 rpm.Thereafter, the cultures were centrifuged (Beckman, USA, ModelJ2-21) at 15000g for 15 min, followed by washing (twice) of pellets

Please cite this article in press as: Arjoon, A., et al. Enhanced 1,2-dichloroethabiostimulation and bioaugmentation. Chemosphere (2013), http://dx.doi.org/1

in sodium phosphate buffer (pH 7.3) and re-suspended in the samesolution. The cultures were then standardized to an optical densityvalue of 1.0 at 600 nm using the Biochrom, Libra S12 UV-VisibleSpectrophotometer.

2.2. Sample collection and microcosm set-up

Wastewater sample used in the microcosm set-up was collectedfrom the secondary clarifier of the Northern wastewater treatmentplant, Durban, South Africa. The physico-chemical properties of thewastewater were analyzed by Clean Stream (South Africa). Co-con-taminated water microcosms were set up with 150 mL of waste-water, 2.5 mM of 1,2-DCA and the heavy metal (As, Cd, Hg or Pb)added separately to a final concentration that would theoreticallycause an 80% reduction in k1 (0.19 mM As3+, 0.20 mM Cd2+,0.15 mM Hg2+ or 0.26 mM Pb2+). Biostimulated microcosms con-tained 1% (w/v) glucose (Merck, Saarchem), while 1.5 mL of stan-dardized culture X. autotrophicus GJ10 was added to thebioaugmented co-contaminated microcosm. Dual bioaugmenta-tion was carried out by adding 1.5 mL of a mixed culture inoculumprepared from the standardized culture of X. autotrophicus GJ10and the respective heavy metal resistant strain to the co-contami-nated microcosm. Wastewater microcosms fortified with 1,2-DCAand no heavy metal were used as a positive control while auto-claved wastewater fortified with 1,2-DCA and no heavy metalserved as a negative (biologically inactive) control. The bottleswere shaken for 2 h on a rotary shaker at 150 rpm at 25 �C to allowfor the equilibration of 1,2-DCA between the gas and aqueousphases before determining the initial 1,2-DCA concentration.Thereafter, the bottles were incubated at 25 �C with no shakingfor the course of the experiment.

2.3. Analytical procedures

1,2-DCA concentrations were determined by periodically with-drawing 1 mL of headspace samples from the microcosms using agas tight syringe (Hamilton) and injected into a gas chromatograph(GC) (Agilent 6820) equipped with a flame ionization detector. Thesamples were analyzed, with the injector at 240 �C and detector at250 �C and a capillary column (DB1) with an initial temperature of55 �C which was held for 10 s and then ramped up to 60 �C at a rateof 4 �C min�1. Ultra high purity nitrogen was used as the carriergas. 1,2-DCA concentrations were quantified over time as previ-ously described (Olaniran et al., 2009).

2.4. Assessment of microbial population and diversity

2.4.1. 1,2-DCA degrading bacterial population and identificationSamples taken from the microcosms were serially diluted in

sterile distilled water before spread plating 0.1 mL onto mineralsalts medium [KH2PO4 1.36 g, Na2HPO4�12H2O 5.37 g, (NH4)2SO4

0.5 g, MgSO4�7H2O 0.2 g, Trace element solution 5 mL (CaCl2

530 mg, FeSO4�7H2O 200 mg, ZnSO4�7H2O 10 mg, H3BO3 10 mg,CoCl2�6H2O 10 mg, MnSO4�5H2O 4 mg, Na2MoO4�2H2O 3 mg, NiCl2-

�6H2O 2 mg) Bacteriological agar 12 g] using 1,2-DCA as the solecarbon source for growth. Plates were aerobically incubated at30 �C for 48 h before counting the emerging colonies, which werethen expressed as colony forming units (CFU) per mL. Representa-tive bacteria based on colonial characteristics on plates, were puri-fied and identified by 16S rRNA gene sequencing. Sequences werecompared to those in the GenBank database and relevant identitieswere determined using the BLAST algorithm.

2.4.2. Bacterial community profilingBacterial diversity in the different co-contaminated micro-

cosms was determined via polymerase chain reaction and dena-

ne degradation in heavy metal co-contaminated wastewater undergoing0.1016/j.chemosphere.2013.06.034


Table 1Physico-chemical properties of the wastewater sample used inthis study.

Determinant

Calcium (mg Ca L�1) 14.13Magnesium (mg Mg L�1) 5.49Sodium (mg Na L�1) 72.98Potassium (mg K L�1) 16.86Iron (mg Fe L�1) 0.018Nitrite (soluble) (mg N L�1) 0.15Nitrate (soluble) (mg N L�1) 6.94Sulphate (mg SO4 L�1) 29.26Total organic carbon (mg C L�1) 11.2Orthophosphate (PO4) mg L�1 as P 1.81Total kjeldahl nitrogen (mg N L�1) 1.3

A. Arjoon et al. / Chemosphere xxx (2013) xxx–xxx 3

turing gradient gel electrophoresis (PCR–DGGE) according toMuyzer et al. (1997). Following DNA extraction, PCR amplifica-tion of the 16S rRNA gene region was performed using the prim-ers F341-GC (CCTACGGGAGGCAGCAG) with a 50 GC-clamp:CGCCCGCCG CGCCCCGCGCCCGTCCCGCCGCCCCCGCCCG and R907(CCGTC AATTCMTTTGAGTTT) (Casamayor et al., 2002). The PCRreaction mixture contained 2 lL of DNA template (26-30 ng lL�1) and 48 lL of a PCR mix [1 � PCR buffer, 1.25 mMMgCl2, 0.5 lM each of both the forward and reverse primers,0.2 mM dNTPs and 0.5 U of SuperTherm Taq DNA polymerase(Southern Cross Biotech)]. The PCR was performed using theGeneAmp PCR System (Version 2.25, Perkin Elmer) using a mod-ified (Muyzer et al., 1997) touchdown thermal profile technique(Watanabe et al., 1998).

The PCR products (585 bp) were separated on200 mm � 200 mm, 1 mm thick 6% polyacrylamide:bisacrylamide(37.5:1) gels using the D-Code Universal Mutation Detection

(a)

(c)Fig. 1. Effects of biostimulation, bioaugmentation and dual-bioaugmentation on the bioHg2+ and (d) Pb2+. A = unautoclaved water + 1,2-DCA + heavy metal; B = water + 1,2-DCAD = water + 1,2-DCA + heavy metal + X. autotrophicus GJ10 + heavy metal resistant straiindicate the average of triplicate samples while the error bars show the standard deviat


System (BioRad) following the method of Muyzer et al. (1997)with a denaturing gradient ranging from 30% to 60% (100% dena-turant contained 7 M urea and 40% [v/v] formamide). Prior tosample loading, a pre-run was performed at a constant voltageof 150 V at 60 �C for 1 h to facilitate sample migration out ofthe wells during the electrophoretic run. Following the pre-run, samples were loaded into the gel and DGGE was conductedat a constant voltage of 60 V at 60 �C for 16 h in 1� TAE buffer.After electrophoresis, the gel was stained in 0.5 lg mL�1 ethi-dium bromide (BioRad) in 1� TAE buffer for 30 min, destainedin 1� TAE buffer for a further 20 min and thereafter visualizedby UV transillumination (Chemi-Genius2 BioImaging System,Syngene). The individual DGGE profiles were compared to eachother, by using the Sorenson’s index pairwise similarity coeffi-cient Cs, which was determined as follows: Cs = 2j/(a + b) � 100,where a and b represent the number of DGGE bands in lanes1 and 2, respectively, and j the number of DGGE bands commonto both lanes. Two identical DGGE profiles had a Cs value of100%, and two completely different profiles had a Cs value of0% (Murray et al., 1996).

2.4.3. Sequencing and analysis of DGGE fragmentsDominant DGGE bands to be sequenced were excised from the

gel, with sterile scalpels and placed into Eppendorf tubes contain-ing 0.1 mL of sterile MilliQ water and stored at 4 �C overnight toelute the DNA. The gel fragments were then briefly centrifuged at16000g for 1 min and the supernatant aspirated. An aliquot ofsupernatant was used for PCR reamplification using the F341(without the GC-clamp) and R907 primer sets with the PCR condi-tions as previously described. The reamplified PCR products weresequenced and the resulting sequences were subjected to a BLASTsearch to determine the most similar sequences.

(d)

(b)

degradation of 1,2-DCA in wastewater co contaminated with (a) As3+, (b) Cd2+, (c)+ heavy metal + glucose; C = water + 1,2-DCA + heavy metal + X. autotrophicus GJ10;n; E = unautoclaved water + 1,2-DCA; F = autoclaved wastewater + 1,2-DCA. Valuesion.



Table 2Biodegradation rate constants (d�1) of 1,2-DCA in water co-contaminated with heavy metals, under different treatmentconditions.

Treatment

Positive control 0.054 ± 0.0052Negative control 0.014 ± 0.0012

As3+

Biostimulation 0.047 ± 0.0026Bioaugmentation 0.053 ± 0.0023Dual bioaugmentation 0.058 ± 0.007No treatment 0.033 ± 0.002

Cd2+


Hg2+


Pb2+


Values are averages of triplicate results ± standard deviation.


3. Results

3.1. Wastewater characterization

The physico-chemical properties of the wastewater used in thisstudy are shown in Table 1. The sodium level in the water sample

(A)

(C)Fig. 2. 1,2-DCA degrading bacterial population in arsenic (A), cadmium (B), mercury (CValues indicate the averages of triplicate samples while the error bars show the standa


was the highest and iron concentration, the least. The nitrateconcentration was 49.26-fold higher than the nitrite concentration.The ratio of essential nutrients was as follows C:N:P = 8.62:1:1.39.

3.2. Effect of biostimulation and bioaugmentation on thebiodegradation of 1,2-DCA in co-contaminated water

In the unautoclaved samples not contaminated with heavy met-als (positive control), 80% degradation of 1,2-DCA was observed.However, in co-contaminated microcosms (Fig. 1a–d), As3+, Cd2+,Hg2+ and Pb2+ inhibited degradation by 18.65%, 16.51%, 23.97%and 15.76%, respectively after 28 d. Biostimulation improved bio-degradation by 11.43%, 13.92%, 6.53% and 22.33% respectively(Fig. 1a–d), and bioaugmentation by 18.60%, 20.47%, 12.64% and26.07% (Fig. 1a and b), respectively in wastewater co-contaminatedwith As3+, Cd2+, Hg2+ and Pb2+. However, dual bioaugmentationdemonstrated the most degradation compared to biostimulatedor bioaugmented microcosms, exhibiting 22.43%, 26.54%, 19.58%and 30.49% increase in 1,2-DCA degradation after 28 d (Fig. 1aand b) in microcosms co-contaminated with As3+, Cd2+, Hg2+ andPb2+, respectively. The degradation rate constants (k1) of 1,2-DCA(Table 2) ranged from 0.033 to 0.93 d�1 in treated co-contaminatedmicrocosms. Dual bioaugmentation, bioaugmentation and biosti-mulation of arsenic co-contaminated water resulted in 1.76-, 1.6-and 1.42-fold increase in k1, respectively and 2-, 1.65- and 1.35-fold increase in k1 respectively in cadmium co-contaminatedmicrocosms. Similarly 1.7-, 1.44- and 1.22-fold increase in k1 inmercury co-contaminated microcosms, and a 2.1-, 1.71- and 1.5-fold increase in k1 in lead co-contaminated microcosms wasobserved for dual bioaugmentation, bioaugmentation and biosti-mulation, respectively compared to the untreated co-contami-nated microcosms.

(D)

(B)

) and lead (D) co-contaminated wastewater under different treatment conditions.rd deviation.



Table 3Identity of 1,2-DCA degrading bacteria isolated from co-contam-inated water microcosms.

Organism Accession number

Burkholderia sp. HQ441255.1Pseudomonas sp. DQ226203.1Bacillus sp. HQ331104.1Enterobacter sp. EU196755.1Pseudomonas sp. HM468082.1Bradyrhizobiaceae bacterium EU177519.1Bacillus sp. FR727718.1


3.3. Culturable 1,2-DCA-degrading bacterial population in co-contaminated wastewater under different bioremediation conditions

The culturable 1,2-DCA degrading bacterial population seemedto vary based on the heavy metal present and the bioremediationstrategy exploited. The highest 1,2-DCA degrading bacterial popu-lation was obtained in microcosms co-contaminated with lead,when compared to other heavy metals tested, with a peak popula-tion of 49.69, 28.10 and 20.23 (�105 CFU mL�1) obtained in micro-cosms undergoing dual bioaugmentation, bioaugmentation andbiostimulation, respectively after 28 d. These values were 8.07-,4.57- and 3.28-fold respectively, higher compared to lead

1 2 3 4 5 M

1 2 3 4

A1 A2A3

A4

A5

A6

A7

(a)

(c)Fig. 3. DGGE profiles of 16S rRNA gene fragments of wastewater co-contaminated with 13, 4 and 5 represents day 0, 7, 14, 21 and 28, while M represents the marker.


co-contaminated microcosms not receiving any treatment(Fig. 2D). Bacterial population were 6.58-, 5.12- and 2.24-foldhigher in cadmium co-contaminated microcosms receiving dual-bioaugmentation, bioaugmentation and biostimulation, respec-tively after 28 d when compared to microcosms not receivingany treatment (Fig. 2B). Similar trend was observed in arsenic(Fig. 2A) and mercury (Fig. 2C) co-contaminated wastewater. Sevenbacterial isolates obtained from the co-contaminated microcosmswere identified and listed in Table 3.

3.4. PCR–DGGE analysis of bacterial community diversity

Fig. 3a–c represents DGGE profiles of the biostimulated micro-cosms, showing different banding patterns based on the type ofheavy metal used. In arsenic co-contaminated wastewater(Fig. 3a) the bands are bright at day 0; however the brightness ofthe bands fade over day 7 to day 14. Band A1 was constantthroughout the 28 d, while bands A5 and A6 was absent at day 0but observed from day 7 to day 28 with increasing intensity, whilea very faint band (A4) was observed at day 0. Bands A2 and A3were also present at days 0, 21 and 28, while band A7 was onlypresent at day 0. The DGGE profile at day 0 exhibited a 16.67% sim-ilarity to days 7 and 14, and 26.67% similarity to that on day 28,while 100% similarity was observed between days 7 and 14. Inmicrocosms co-contaminated with cadmium (Fig. 3b), two bright

M 1 2 3 4 5 6

5 M

B1B2

B3

B4

B5

C1

C2

C3

B6

C4

(b)

,2-DCA and As3+ (a), Cd2+ (b) and Pb2+ (c) and biostimulated with glucose. Lanes 1, 2,




bands (B1 and B5) were observed at day 0, with a decrease inbrightness observed at days 7 and 14; however the brightness in-creased from day 21 to day 28. Bands B2, B3 and B4 were present atlow concentrations at day 0 and not detected subsequently, untilday 28, while band B6 was only present at day 0. The DGGE profileat day 0 shows a 16.67% similarity to day 7 and 40% similarity today 28, with 100% similarity obtained between days 14 and 21.For lead co-contaminated microcosms (Fig. 3c), band C1 wasbrightly present at day 0, and faintly present at days 7, 14, and21, with an increase in brightness at day 28. The presence of dom-inant bands (C2, C3 and C4) was observed at the latter stage of thebiostimulation process, with 100% similarity in the banding pat-tern obtained from days 7 to 28.

Fig. 4a–c represents DGGE profiles of bioaugmented micro-cosms. In arsenic co-contaminated wastewater (Fig. 4a), band D1was absent at day 0, faintly present at day 7 but brightly presentfrom days 14 to 28 (Fig. 4a). Two faint bands (D2 and D3) werepresent at day 0, absent at day 7 and brightly present from days14 to 28. The DGGE profiles at days 7, 14, 21 and 28 were com-pletely identical, with a Cs value of 100%. These profiles were only25% identical to the profile at day 0. In cadmium co-contaminatedwastewater (Fig. 4b), bands E1 and E5 were present from day 0through day 28 at the same intensity. Bands E3 and E4 were notdetected at day 0; however these bands were present at a highintensity from day 14 to day 28. Band E2 was not detected atday 0, and only faintly present at day 7 and 14, with an increased

1 2 3 4 5 M

M 1 2 3

D1

D2

D3

(a)

(c)Fig. 4. DGGE profiles of 16S rRNA gene fragments of wastewater co-contaminated withLanes 1, 2, 3, 4 and 5 represents day 0, 7, 14, 21 and 28, while M represents the marker


brightness observed at days 21 and 28. For cadmium bioaugment-ed water, 100% similarity in banding patterns was observedamongst days 7, 14, 21 and 28. In microcosms co-contaminatedwith lead (Fig. 4c), bands F1, F2, F3 were not detected at day 0,but observed from day 7 until day 28, while band F4 was only de-tected at day 0 and not observed subsequently. A 100% similarity inbanding patterns was also observed from day 7 to day 28, with a Csvalue of 22.2% obtained when compared to DGGE profiles at day 0.

Fig. 5a–c represents DGGE profiles of dual-bioaugmentedmicrocosms. In arsenic co-contaminated wastewater (Fig. 5a),bands G1, G4, G5 and G6 were not detected at day 0, but presentfrom days 7 to 28 at the same brightness intensity. Bands G2 andG3 were also not detected at day 0, however these bands were ob-served at days 7 and 21 but faintly at day 28. The DGGE profiles ofarsenic dual-bioaugmented microcosms were 100% similar at days7, 14, 21 and 28, however they exhibited only 44.44% similarity today 0. In cadmium co-contaminated microcosms (Fig. 5b), bandsH1-H7 were present at a constant intensity from day 7 to day 28.For cadmium dual-bioaugmented water, days 7, 14, 21 and 28exhibited 100% similarity to each other, and 36.36% similarity today 0 profile. For microcosms co-contaminated with lead(Fig. 5c), the intensity of band I1 increased from day 21 to day28. Bands I2, I3, and I5 were absent at day 0, but present fromday 7 to day 28 at a relatively constant brightness. Similarly in leadbioaugmented water microcosms, days 7, 14, 21 and 28 exhibited100% similarity to each other, and only 66.66% similarity to day 0

M 1 2 3 4 5

4 5

E1

E4

E2

E3

E5

F1

F3 F2

F4

(b)

1,2-DCA and As3+ (a), Cd2+ (b) and Pb2+ (c) and bioaugmented with X. autotrophicus..



1 2 3 4 M M 1 2 3 4

1 2 3 4 M

G2

G4

G5

G6

H1

H4H3

H2

H6

H7

G3

G1

I1

I2

I3

I4I5

H5

(a) (b)

(c)Fig. 5. DGGE profiles of 16S rRNA gene fragments of wastewater co-contaminated with 1,2-DCA and As3+ (a), Cd2+ (b) and Pb2+ (c) and bioaugmented with X. autotrophicusand heavy metal resistant strains. Lanes 1, 2, 3, and 4 represents day 0, 7, 21 and 28, while M represents the marker.

Table 4Identity of bacterial isolates represented by the excised bands from DGGE gels.

Band Identification Accession number

B1 Clostridium pasteurianum strain CH7 EF140983.1F1 Klebsiella pneumonia JN545035.1I5 Dechloromonas sp. PC1 AY126452.1E4 Cupriavidus sp. DE7 JN226398.1H4 Enterobacter sp. ICB551 HM748088.1


profile. Identification of the dominant bands excised from the gelsreveals that the organisms represented by these bands belong tothe genera; Clostridium, Cupriavidus, Dechloromonas, Enterobacterand Klebsiella (Table 4).

4. Discussion

All the bioremediation options investigated in this study provedeffective for improving biodegradation of 1,2-DCA in the presenceof heavy metals. Despite the limits of bioaugmentation, such as indelivery of the inoculant to the desired location (Streger et al.,2002), rapid decline in introduced microbial numbers and deathof the exogenous microorganisms (Goldstein et al., 1985; Megharajet al., 2011), biougmentation and dual-biougmentation proved tobe effective remediation options in the present study. Heavy metal


resistant strains are known to protect the metal-sensitiveorganic-degrading population from metal toxicity, primarilythrough detoxification, such that organic degradation was no long-er inhibited (Roane et al., 2001). Roane et al. (2001) reported thatdual-bioaugmentation, involving inoculation of soil with both me-tal-detoxifying (Ralstonia eutropha JMP134) and organic-degrading(Pseudomonas H1) bacteria, facilitated the degradation of 2,4-dichlorophenoxyacetic acid in the presence of cadmium co-con-taminant. This was also confirmed by Fernandes et al. (2009) whenbacterial strains capable of withstanding considerable concentra-tions of Cd2+ or Hg2+ or Pb2+ were coupled with strains that showedgood performance at degrading methyl tertiary butyl ether or tri-chloroethane. High metal concentrations can form selective pres-sure for the inoculated heavy metal resistant and organicdegrading strains, thus reducing competition from metal-sensitive,non-degrading microorganisms and increasing biodegradation(Sandrin and Maier, 2003). Also, a link between metal toleranceand antibiotic resistance in bacteria has been attributed to the pos-sibility that both metal tolerance gene and antibiotic resistancegene may be located closely together on the same plasmid andconsequently more likely to be transported together in the envi-ronment (Kawane, 2012).

The identification of arsenic resistant bacteria that was usedin dual bioaugmentation studies as Delftia sp. was not surprisingas Cai et al. (2009) also identified Delftia sp. as one of the majorgenera of arsenic resistant bacteria from four arsenic-contami-




nated soils tested. Microorganisms are known to influence ar-senic geochemistry by their metabolism, i.e., reduction, oxida-tion, and methylation (Muller et al., 2007). Cadmium ions aretoxic to bacteria, and when incorporated into sensitive cells,cause a cessation of respiration by binding to sulfhydryl groupsin proteins (Foster, 1983). Microbial resistance to cadmium isusually based on energy-dependent efflux mechanisms (Silver,1996). A fluorescent Pseudomonad has been shown to tolerateup to 5 mM cadmium and able to remove >99% of the cadmiumfrom solution after 140 h (Wang et al., 1997), P. aeruginosa E1was used as a biosorbent for cadmium ion uptake from aqueoussolution (Zeng et al., 2009). This makes Pseudomonas sp. idealcandidates for bioremediation of cadmium in the environmentas observed in this study. Similar to the observation in thisstudy, Cupriavidus sp. have been known to be resistant to mer-cury (Rojas et al., 2011; Li et al 2013), while Stenotrophomonassp. are known to tolerate high concentrations of lead (Chienet al., 2007; Pages et al., 2008).

An increase in the total number of 1,2-DCA degrading bacte-rial populations was observed in the dual-bioaugmented andbioaugmentated microcosms compared to those biostimulated,with a corresponding increase in 1,2-DCA degradation. Thegenera of the 1,2-DCA degrading bacterial isolates identifiedfrom the co-contaminated microcosms, in this study, have beenpreviously implicated in 1,2-DCA degradation and heavy metalresistance and detoxification (Hage and Hartmans, 1999; Satoet al., 2005; Olaniran et al., 2007; El-Deeb, 2009; Kumar et al.,2010; Singh et al., 2010; Bianucci et al., 2011). In addition, manystrains of these bacterial genera have been shown to be involvedin other chlorinated hydrocarbon compounds in the presence orabsence of heavy metals (Tarawneh et al., 2010; Sato et al.,2005). The PCR–DGGE analysis of samples is a widespread meth-od used to assess the impact of contamination and allows formonitoring reclamation processes (Li et al., 2006; Chikereet al., 2011) and was used to profile the bacterial diversity inthe microcosms undergoing different bioremediation options.Microorganisms identified from bands excised from DGGE gelswere identified as strains of Clostridium, Klebesilla, Dechloromon-as, Cupriavidus and Enterobacteriae. These organisms except forEnterobacteriae were not detected by plate count assay. This dif-ference in isolates obtained in pure culture on plates and theisolates identified by culture independent methods further high-light the bias known as the ‘‘great plate anomaly’’. The observeddecrease in band brightness in biostimulated microcosms couldbe due to the fact that organisms in these microcosms has noprotection from metal stress (Roane et al., 2001), thereforeallowing for a negative impact of the heavy metals on themicrobial population during the first 14 d. However, once theglucose is metabolized, the population acclimatizes to the heavymetal, as indicated by the brightness of DGGE bands. However,in microcosms that were dual-bioaugmented and bioaugmented,no decrease in band intensity was observed from day 0, exceptfor bioaugmented arsenic microcosms. Additional bands notpresent at day 0 were later observed throughout the experiment,possibly due to the heavy metal resistant strain offering protec-tion to the organic degrading population (Roane et al., 2001).The observed lower Sorenson index from day 0 to day 7 and100% similarity between the DGGE profiles observed from day7 to day 28 for bioaugmentated and dual-bioaugmentatedmicrocosms indicated that there was a shift in community diver-sity from day 0 to day 7, however once the microcosms acclima-tizes to the treatment, no change was observed. In general, PCR–DGGE profiles did exhibit a change in community structure overtime, whereby the number of bands was reduced, the intensityof certain bands increased, and new bands appeared.


5. Conclusions

Biostimulation and bioaugmentation are important for effectiveremediation of water co-contaminated with 1,2-DCA and heavymetals. In particular, dual-bioaugmentation seemed to be the mostpromising option, resulting in the most degradation of 1,2-DCA.PCR–DGGE also revealed the important bacterial phylotypes play-ing active roles in the degradation process, some of which were notculturable. However, it should be taken into consideration that anybioremediation approach is site specific and the ecology of the siteand the local physico-chemical constraints should be taken intoconsideration while formulating a bioremediation strategy forcleaning sites co-contaminated with chlorinated organics and hea-vy metals.

Acknowledgements

This work was financially supported by The University of KwaZ-ulu-Natal and the National Research foundation of South Africa.Many thanks to Prof D.B. Janssen for providing us with the cultureof X. autotrophicus GJ10 used in this study.

References

Ahemad, M., 2012. Implications of bacterial resistance against heavy metals inbioremediation: a review. IIOABJ 3, 39–46.

Alluri, H.K., Ronda, S.R., Settalluri, V.S., Bondili, J., Suryanarayana, V., Venkateshwar,P., 2007. Biosorption: an eco-friendly alternative for heavy metal removal. Afr. J.Biotechnol. 6, 2924–2931.

Basak, K.T., Gokcay, F.C., 2005. Degradation of chlorinated compounds by Penicilliumcamemberti in batch and up-flow column reactors. Process Biochem. 40, 917–923.

Bianucci, E., Fabra, A., Castro, S., 2011. Cadmium accumulation and tolerance inBradyrhizobium spp. (Peanut Microsymbionts). Curr. Microbiol. 62, 96–100.

Bruins, M.R., Kapil, S., Oehme, F.W., 2000. Microbial resistance to metals in theenvironment ecotoxicol. Environ. Saf. 45, 198–207.

Cai, L., Liu, G., Rensing, C., Wang, G., 2009. Genes involved in arsenic transformationand resistance associated with different levels of arsenic-contaminated soils.BMC Microbiol. 9, 4–15.

Casamayor, E.O., Pedros-Alio, C., Muyzer, G., Amann, R., 2002. Microheterogeneity in16S ribosomal DNA-defined bacterial populations from a stratified planktonicenvironment is related to temporal changes and to ecological adaptations. Appl.Environ. Microbiol. 68, 1706–1714.

Chien, C., Hung, C.W., Han, C., 2007. Removal of cadmium ions during stationarygrowth phase by an extremely cadmium-resistant strain of Stenotrophomonassp.. Environ. Toxicol. Chem. 26, 664–668.

Chikere, C.B., Okpokwasili, G.C., Chikere, B.O., 2011. Monitoring of microbialhydrocarbon remediation in the soil. 3 Biotech. 1, 117–138.

De Wildeman, S., Verstraete, W., 2003. The quest for microbial reductivedechlorination of C(2) to C(4) chloroalkanes is warranted. Appl. Microbiol.Biotechnol. 61, 94–102.

Eguchi, M., Kitagawa, M., Suzuki, Y., Nakamuara, M., Kawai, T., Okamura, K., Sasaki,S., Miyake, Y., 2001. A field evaluation of in situ biodegradation oftrichloroethylene through methane injection. Water Res. 35, 2145–2152.

El-Deeb, B., 2009. Plasmid mediated tolerance and removal of heavy metals byEnterobacter sp.. Am. J. Biochem. Biotechnol. 5, 47–53.

Fernandes, V.C., Albergaria, J.T., Oliva-Teles, T., Delerue-Matos, C., De Marco, P.,2009. Dual augmentation for aerobic bioremediation of MTBE and TCE pollutionin heavy metal-contaminated soil. Biodegradation 20, 375–382.

Field, J.A., Sierra-Alvarez, R., 2004. Biodegradability of chlorinated solvents andrelated chlorinated aliphatic compounds. Rev. Environ. Sci. Biotechnol. 3, 185–254.

Foster, T.J., 1983. Plasmid-determined resistance to antimicrobial drugs and toxicmetal ions in bacteria. Microbiol. Rev. 47, 361–409.

Goldstein, M.G., Mallory, L.M., Alexander, M., 1985. Reasons for possible failure ofinoculation to enhance biodegradation. Appl. Environ. Microbiol. 50, 977–983.

Govender, A., Pillay, B., 2011. Characterization of 1,2-dichloroethane (DCA)degrading bacteria isolated from South African waste water. Afr. J. Biotechnol.10, 11567–11573.

Hage, J.C., Hartmans, S., 1999. Monooxygenase-mediated 1,2-dichloroethanedegradation by Pseudomonas sp. Strain DCA1. Appl. Environ. Microbiol. 65,2466–2470.

Janssen, D.B., Pries, F., Van der Ploeg, J., Kazemier, B., Terpstra, P., Witholt, B., 1989.Cloning of 1,2-dichloro-ethane degrading genes of Xanthobacter autotrophicusGJ10 and expression and sequencing of the dhlA gene. J. Bacteriol. 171, 6791–6799.

Kawane, R.S., 2012. Studies on antibiotics and heavy metal resistance profiling of


http://refhub.elsevier.com/S0045-6535(13)00876-X/h0005























































Escherichia coli from drinking water and clinical specimens. Biosci. Disc. 3, 292–295.

Kumar, A., Bisht, B.S., Joshi, V.D., 2010. Biosorption of heavy metals by fouracclimated microbial species, Bacillus spp., Pseudomonas spp., Staphylococcusspp. and Aspergillus niger. J. Biol. Environ. Sci. 4, 97–108.

Kuo, C., Genthner, B.R.S., 1996. Effect of added heavy metal ions onbiotransformation and biodegradation of 2-chlorophenol and 3-chlorobenzoate in anaerobic bacterial consortia. Appl. Environ. Microbiol. 62,2317–2323.

Landmeyer, J.E., Miller, S., Campbell, B.G., Vroblesky, D.A., Gill, A.C., Clark, A.P., 2011,Investigation of the potential source area, contamination pathway, andprobable release history of chlorinated-solvent-contaminated groundwater atthe capital city Plume Site, Montgomery, Alabama, 2008–2010. U.S.Environmental Protection Agency. U.S. Geological Survey, Reston, Virginia.Scientific Investigations, Report 2011-5148.

Li, Z., Xu, J., Tang, C., Wu, J., Muhammad, A., Wang, H., 2006. Application of 16SrDNA-PCR amplification and DGGE fingerprinting for detection of shift inmicrobial community diversity in Cu-, Zn-, and Cd-contaminated paddy soils.Chemosphere 62, 1374–1380.

Li, L.G., Cai, L., Zhang, T., 2013. Genome of Cupriavidus sp. HMR-1, a heavy metal-resistant bacterium. Genome Announc. 1, e00202–12.

Malakul, P., Srinivasan, K.R., Wang, H.Y., 1998. Metal toxicity reduction innaphthalene biodegradation by use of metal-chelating adsorbents. Appl.Environ. Microbiol. 64, 4610–4613.

Megharaj, M., Ramakrishnan, B., Venkateswarlu, K., Sethunathan, N., Naidu, R.,2011. Bioremediation approaches for organic pollutants: a critical perspective.Environ. Int. 37, 1362–1375.

Muller, D., Medigue, C., Koechler, S., Barbe, V., Barakat, M., Talla, E., Bonnefoy, V.,Krin, E., Arse‘ne-Ploetze, F., Carapito, C., Chandler, M., Cournoyer, B., Cruveiller,S., Dossat, C., Duval, S., Heymann, S., Leize, E., Lieutaud, A., Lie‘vremont, D.,Makita, Y., Mangenot, S., Nitschke, W., Ortet, P., Perdrial, N., Schoepp, B., Siguier,P., Simeonova, D.D., Rouy, Z., Segurens, B., Turlin, E., Vallenet, D., Dorsselaer, A.,Weiss, S., Weissenbach, J., Lett, M., Danchin, A., Bertin, P.N., 2007. A tale of twooxidation states: bacterial colonization of arsenic-rich environments. PLoSGenet. 3, 518–530.

Murray, A.E., Hollibaugh, J.T., Orrego, C.N., 1996. Phylogenetic compositions ofbacterioplankton from two Californian estuaries compared by denaturinggradient gel electrophoresis of 16S rDNA Fragments. Appl. Environ. Microbiol.62, 2676–2680.

Muyzer, G., Brinkhoff, T., Nübel, U., Santegoeds, C., Schäfer, H., Wawer, C., 1997.Denaturing gradient gel electrophoresis (DGGE) in microbial ecology. In:Akkermans, A.D.L., van Elsas, J.D., deBruijn, F.J. (Eds.), Molecular MicrobialEcology Manual. Kluwer Academic Publishers, The Netherlands, Dordrecht, pp.1–27.

Olaniran, A.O., Naidoo, S., Masango, M.G., Pillay, B., 2007. Aerobic biodegradation of1,2 dichloroethane and 1,3-dichloropropene by bacteria isolated from a pulpmill wastewater effluent in South Africa. Biotechnol. Bioproc. Eng. 12, 276–281.

Olaniran, A.O., Balgobind, A., Balgobind, B., 2009. Impacts of heavy metals on 1,2-dichloroethane biodegradation in co-contaminated soil. J. Environ. Sci. 21, 661–666.

Pages, D., Rose, J., Conrod, S., Cuine, S., Carrier, P., Heulin, T., Achouak, W., 2008.Heavy metal tolerance in Stenotrophomonas maltophilia. PLoS ONE 3, e1539.

Perelomov, L.V., Prinsky, D.I., 2003. Manganese, lead and zinc compounds in grayforest soils of the central Russian upland, Eurasian. Soil Sci. 6, 610–618.


Ramakrishnan, B., Megharaj, M., Venkateswarlu, K., Sethunathan, N., Naidu, R.,2011. Mixtures of environmental pollutants: effects on microorganisms andtheir activities in soils. Rev. Environ. Contam. Toxicol. 211, 63–120.

Roane, T.M., Josephson, K.L., Pepper, I.L., 2001. Dual-bioaugmentation strategy toenhance remediation of cocontaminated soil. Appl. Environ. Microbiol. 67,3208–3215.

Rojas, L.A., Yanez, C., Gonzalez, M., Lobos, S., Smalla, K., Seeger, M., 2011.Characterization of the metabolically modified heavy metal-resistantCupriavidus metallidurans strains MSR33 generated for mercurybioremediation. PLoS ONE 6, 1–10.

Sandrin, T.R., Maier, R.M., 2002. Effect of pH on cadmium toxicity, speciation andaccumulation during naphthalene biodegradation. Environ. Toxicol. Chem. 21,2075–2079.

Sandrin, T.R., Maier, R.M., 2003. Impact of metals on the biodegradation of organicpollutants. Environ. Health Perspect. 111, 1093–1101.

Sato, Y., Monincova, M., Chaloupkova, R., Prokop, Z., Ohtsubo, Y., Minamisawa, K.,Tsuda, M., Damborsky, J., Nagata, Y., 2005. Two rhizobial strains, Mesorhizobiumloti MAFF303099 and Bradyrhizobium japonicum USDA110, encode haloalkanedehalogenases with novel structures and substrate specificities. Appl. Environ.Microbiol. 71, 4372–4379.

Silver, S., 1996. Bacterial resistances to toxic metal ions: a review. Gene 179, 9–19.Singh, V., Chauhan, P.K., Kanta, R., Dhewa, T., Kumar, V., 2010. Isolation and

characterization of Pseudomonas resistant to heavy metals contaminants. Int. J.Pharmaceut. Sci. Res. 3, 164–167.

Srivastava, N.K., Majumder, C.B., 2008. Novel biofiltration methods for thetreatment of heavy metals from industrial wastewater. J. Hazard. Mater. 15,1–8.

Streger, S.H., Vainberg, S., Dong, H., Hatzinger, P.B., 2002. Enhancing transport ofhydrogenophaga flava ENV735 for bioaugmentation of aquifers contaminatedwith methyl tert-butyl ether. Appl. Environ. Microbiol. 68, 5571–5579.

Tarawneh, K.A., Irshaid, F., Ajlundi, I.H., Abboud, M.M., Mohammed, N.A., Khleifat,A.M., 2010. Biodegradation kinetics of four substituted chlorobenzoic acids byEnterobacter aerogenes. Biorem. J. 14, 55–66.

Van Den Wijngaard, A.J., Van Der Kamp, K.W.H.J., Van Der Ploeg, J., Pries, F.,Kazemier, B., Janssen, D.B., 1992. Degradation of 1,2-dichloroethane byAncylobacter aquaticus and other facultative methylotrophs. Appl. Environ.Microbiol. 58, 976–983.

Wang, C.L., Michels, P.C., Dawson, S.C., Kitisakkul, S., Baross, J.A., Keasling, J.D., Clark,D.S., 1997. Cadmium removal by a new strain of Pseudomonas aeruginosa inaerobic culture. Appl. Environ. Microbiol. 63, 4075–4078.

Watanabe, K., Teramoto, M., Futamata, H., Harayama, S., 1998. Molecular detection,isolation, and physiological characterization of functionally dominant phenol-degrading bacteria in activated sludge. Appl. Environ. Microbiol. 64, 4396–4402.

Williams, M., Bosch, S., Citra, M., 2001. Toxicology profile for 1,2-dichloroethane.Agency for toxic substances and disease registry. Atlanta GA: ATSDR, PublicHealth Service, USA. Department of Health and Human Services. NTIS AccessionNo. PB-2001-109103.

Wuana, R.A., Okieimen, F.E., 2011. Heavy metals in contaminated soils: a review ofsources, chemistry, risks and best available strategies for remediationInternational Scholarly Research Network. ISRN Ecology. Article ID 402647.

Zeng, X., Liu, X., Jiang, P., Li, W., Tang, J., 2009. Cadmium removal by Pseudomonasaeruginosa E1. In: International Conference on Energy and EnvironmentTechnology, China.






























































































Documents

Enhanced 1,2-dichloroethane degradation in heavy metal co-contaminated wastewater undergoing biostimulation and bioaugmentation