Hui Wang, Yang Chen, Xin-an Lu, Guanghua Liu, Yan Fu, and Yongzhang Luo

Endostatin Prevents Dietary-InducedObesity by Inhibiting Adipogenesis andAngiogenesisDiabetes 2015;64:2442–2456 | DOI: 10.2337/db14-0528

Endostatin is a well-known angiogenesis inhibitor. Al-though angiogenesis has been considered as a potentialtherapeutic target of obesity, the inhibitory effect ofendostatin on adipogenesis and dietary-induced obesityhas never been demonstrated. Adipogenesis playsa critical role in controlling adipocyte cell number, bodyweight, and metabolic profile in a homeostatic state.Here we reveal that endostatin inhibits adipogenesisand dietary-induced obesity. The antiadipogenic mech-anism of endostatin lies in its interaction with Sam68RNA-binding protein in the nuclei of preadipocytes. Thisinteraction competitively impairs the binding of Sam68to intron 5 of mammalian target of rapamycin (mTOR),causing an error in mTOR transcript. This consequentlydecreases the expression of mTOR, results in de-creased activities of the mTOR complex 1 pathway,and leads to defects in adipogenesis. Moreover, ourfindings demonstrate that the antiangiogenic functionof endostatin also contributes to its obesity-inhibitoryactivity. Through the combined functions on adipo-genesis and angiogenesis, endostatin prevents die-tary-induced obesity and its related metabolicdisorders, including insulin resistance, glucose intoler-ance, and hepatic steatosis. Thus, our findings revealthat endostatin has a potential application for antiobe-sity therapy and the prevention of obesity-relatedmetabolic syndromes.

Obesity and its consequent dysregulation, as importantrisk factors for type 2 diabetes, nonalcoholic fatty liverdisease (NAFLD), cardiovascular diseases, and varioustypes of cancer, represent significant threats to globalhealth (1,2). When food intake exceeds energy

expenditure, excess nutrients are stored as fat. Thisprocess causes white adipocyte tissue (WAT) expansionand, ultimately, obesity (3). The expansion of WAT isa complex process that involves the enlargement ofexisting adipocytes and an increased number of adipo-cytes through adipogenesis (4). A better understandingof adipogenesis and its physiological function in adi-pose tissue can help us to understand and preventobesity and its associated consequences in humanhealth.

Adipocyte fate determination and differentiation aremediated by several master transcription factors, in-cluding peroxisome proliferator–activated receptor-g(PPAR-g) and CCAAT/enhancer–binding proteins (C/EBPs)(4,5). Actually, transient expression of C/EBP-b is oneof the earliest events in adipogenesis after the stimu-lation by adipogenic signals. It then triggers the tran-scription of C/EBP-a and PPAR-g (6–8). PPAR-g isconsidered to be the master and proximal regulatorof adipogenesis, which coordinately activates andmaintains the expression of adipocyte-specific genes(8,9).

Recently, Sam68 (Src-associated substrate in mitosis;68 kDa) was reported to inhibit adipogenesis and obesitydevelopment by regulating alternative RNA splicing ofmammalian target of rapamycin (mTOR) (10). Sam682/2

mice exhibit a lean phenotype and are protected againstdietary-induced obesity (10). Moreover, adipocytes fromSam682/2 mice have decreased expression of PPAR-g andits downstream adipocyte-specific genes, which can in-hibit adipogenesis (10). Sam68, as a prototypical memberof the signal transduction activator of RNA (STAR) family,

National Engineering Laboratory of Anti-tumor Protein Therapeutics, Beijing KeyLaboratory of Protein Therapeutics, and Cancer Biology Laboratory, School of LifeSciences, Tsinghua University, Beijing, China

Corresponding author: Yongzhang Luo, yluo@tsinghua.edu.cn.

Received 2 April 2014 and accepted 13 January 2015.

This article contains Supplementary Data online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db14-0528/-/DC1.

© 2015 by the American Diabetes Association. Readers may use this article aslong as the work is properly cited, the use is educational and not for profit, andthe work is not altered.

See accompanying article, p. 2326.

2442 Diabetes Volume 64, July 2015

OBESITY

STUDIES

functions in RNA metabolism, mRNA recruitment, andalternative splicing (10,11). Sam682/2 mice retain intron5 within the mTOR transcript. This induces an error inthe RNA splicing of mTOR, which leads to a reduced ex-pression of wild-type mTOR and, consequently, results indefects in adipogenesis (10).

Similar to tumor tissue, WAT development in physio-logical and pathological contexts is accompanied by theformation of vascular networks (12,13), and several an-giogenesis inhibitors have been reported to exert an an-tiobesity effect by inhibiting angiogenesis in adiposetissue (13,14). As a result of these studies, adipose tissueangiogenesis has a great potential as a therapeutic targetfor obesity and metabolic diseases (12). Endostatin isa well-documented angiogenesis inhibitor. Despite theseintriguing studies, the mechanistic role of endostatin inadipogenesis and dietary-induced obesity, which is themost common form of human obesity (15), remains tobe elucidated.

Here we report that endostatin directly inhibits adipo-genesis and angiogenesis, thereby protecting mice fromdietary-induced obesity and its associated metabolicdisorders, including insulin resistance, glucose intoler-ance, and hepatic steatosis. The antiobesity and anti-adipogenic functions of endostatin provide new insightsinto the biological relevance of this protein, which leads topotential clinical therapeutics.

RESEARCH DESIGN AND METHODS

Reagents and AntibodiesEscherichia coli–expressed recombinant human endostatinwas obtained from Protgen Ltd. (Beijing, China). The anti-bodies used in this study are described in the Supplemen-tary Experimental Procedures.

Animal StudiesC57BL/6J male mice were purchased from Beijing VitalRiver (Beijing, China). All animal studies were approvedby the Tsinghua University Institutional Animal Care andUse Committee. Seven-week-old mice were fed witha high-fat diet (HFD) providing 60% kcal from fat(Research Diets, Inc., New Brunswick, NJ) or a normaldiet (ND), providing 10% kcal from fat. The HFD-fed micewere randomly assigned to each therapeutic group andwere treated with endostatin (12 mg/kg/day) or saline(0.9% sodium chloride) by daily intraperitoneal injectionfor 60 days (the first injection was designated as day 0).All drugs were diluted with saline. Mice body weight wasmeasured every 3 days. Weight of WAT, liver, heart, lung,and kidney was measured after treatments were com-pleted. Liver and fat pads were collected and fixed in 4%paraformaldehyde for further analysis.

Insulin Tolerance Test and Glucose Tolerance TestInsulin tolerance tests (ITTs) and glucose tolerance tests(GTTs) were performed as previously described (10,16) af-ter mice were treated with endostatin (12 mg/kg/day) orsaline for 60 days. For the ITT, mice were given a dose of

insulin (0.5 units/kg; Novolin R; Novo Nordisk) by intra-peritoneal injection. For the GTT, mice were starved over-night and then orally fed with 1 mg glucose (20 mg/mL,solution water) per gram of body weight. Blood glucose wasmeasured with a OneTouch Basic glucose meter (Roche).

Histology and Matrigel Plug AssayWAT and liver tissue were fixed in 4% paraformaldehyde,embedded in paraffin, and then sliced and stained withhematoxylin and eosin according to standard procedures.The detailed description of histology and the matrigelplug assay is provided in the Supplementary ExperimentalProcedures.

Preadipocyte DifferentiationFor differentiation, 3T3-L1 preadipocytes (3T3-L1s) weretreated as described previously with slight modification(17). As shown in Fig. 2A, 2-day postconfluent 3T3-L1swere incubated with 0.5 mmol/L 3-isobuty-1-methylxanthine,1 mmol/L dexamethasone, and 10 mg/mL insulin (MDI) inDMEM with 10% FBS (MDI medium) (designated as day 0).After 2 days, the medium was changed to insulin medium foradditional 2 days. Insulin medium is 10 mg/mL insulin inDMEM with 10% FBS, and FBS medium is DMEMwith 10% FBS. Adipogenesis was detected by Oil Red Ostaining.

Identification of Endostatin-Binding ProteinsEndostatin or BSA was coupled with CNBr-activatedSepharose 4B (GE Healthcare), according to the manu-facturer’s instructions, and incubated with 3T3-L1slysates overnight at 4°C. The samples were subjected toSDS-PAGE or immunoblotting. Gel slices containing pro-tein bands were analyzed by liquid chromatography–massspectrometry, as previously described (18).

RNA-Binding Assay3T3-L1s at day 2 of differentiation were incubated withendostatin (0, 25, 50 mg/mL) for 3 h at 37°C. Afterward,RNA-binding assay was performed, as previously de-scribed (10). The RNA sequences of two 59 biotin-taggedputative Sam68-binding sites (SBS1 and SBS2) (10) weresynthesized by GenePharma (Shanghai, China).

Tube Formation Assay and Cell Migration AssayTube formation assay, transwell migration assay, and scratchwound–healing assay were performed on SVEC4-10 cellsas previously described (18). In each assay, SVEC4-10 cellswere treated with DMEM, adipocyte-conditioned media(adipocyte-CM), or a combination of endostatin andadipocyte-CM.

ImmunoprecipitationImmunoprecipitation was performed as previously described(18). The detailed description of immunoprecipitation isprovided in the Supplementary Experimental Procedures.

Plasmid Construction and TransfectionpcDNA3.0-Sam68 and pcDNA3.0-Sam68-KH-delete astemplates were obtained from Addgene (Addgeneplasmid 17690 and 17688). Hemagglutinin (HA)-tagged

diabetes.diabetesjournals.org Wang and Associates 2443

Sam68 truncations of functional domains (Fig. 3F) wereconstructed by the QuikChange Site-Directed and trans-fected with TurboFect in vitro transfection reagent (Fer-mentas), according to the manufacturer’s instructions.

Quantitative Real-Time PCRRNA was extracted and cDNA generated as described (19).Primers designed for quantitative PCR are listed in Table 1.

Immunofluorescence3T3-L1s (day 2 of differentiation) cultured on coverslipswere incubated with 25 mg/mL Rh-conjugated endostatin(Rh-endostatin) (20) for 3 h at 37°C. Afterward, cells wereimmunofluorescence stained as previously described (20).

Statistical AnalysisThe quantitative data are shown as mean 6 SD, unlessnoted otherwise. The two-sided Student t test was usedfor comparisons between two groups. One-way ANOVA,followed by post hoc analysis using the Dunnett test, wasperformed to test the significant difference between thecontrol group and treatment groups. All P values ,0.05were considered statistically significant.

RESULTS

Endostatin Protects Mice From Dietary-InducedObesityTo determine whether endostatin affects the develop-ment of dietary-induced obesity, we fed 7-week-oldC57BL/6J male mice with the HFD or ND. Animals inthe experimental groups were systemically treated withendostatin by daily intraperitoneal injection for 60 days.We found that the HFD-fed mice treated with endostatinwere resistant to dietary-induced body weight gain, whichwas 38% lower than that of the untreated HFD-fed mice(Fig. 1A and Table 2), whereas no significant body weightchange was observed in ND-fed group (SupplementaryFig. 1A). Necropsy showed that endostatin-treated

HFD-fed mice contained deposits of epididymal fat thatwere reduced in mass volume compared with untreatedHFD-fed animals (Fig. 1B). Similarly, the weight of totalWAT was significantly decreased in endostatin-treatedHFD-fed mice compared with the untreated HFD-fed mice(Fig. 1C and Table 2). Interestingly, the weight of otherorgans, including heart, lungs, and kidneys was unaffectedin endostatin-treated HFD-fed mice (Table 2). We alsoperformed a detailed histological analysis of WAT, whichrevealed that the sizes of adipocytes in endostatin-treatedHFD-fed mice were smaller than those in untreated HFD-fed animals (Fig. 1D). Thus, endostatin is effective in theinhibition of obesity development in HFD-fed mice.

Endostatin Mitigates Obesity-Induced MetabolicDisordersAdipocyte dysfunction is tightly linked to metabolicdisorders such as insulin resistance, glucose intolerance,and hepatic steatosis (4,8). The glucose levels of the HFD-fed mice with or without endostatin treatment were de-termined. Decreased glucose levels were observed in theendostatin-treated group compared with HFD-fed mice(Supplementary Fig. 1B). We further tested whether endo-statin could affect HFD-induced insulin resistance andglucose intolerance in HFD-fed mice. The results showedthat the glucose levels were decreased in endostatin-treated HFD-fed mice, whereas untreated HFD-fed micedeveloped insulin resistance and glucose intolerance (Fig.1E and F).

The phosphorylation of Akt serves as a powerfulindicator of insulin sensitivity. Blocking the activity ofAkt can cause insulin resistance (21). Consistently, weobserved a lower phosphorylation level of Akt at Thr308in HFD-fed mice, whereas compensating effects were ob-served by endostatin treatments (Fig. 1J and Supplemen-tary Fig. 10A). Furthermore, we observed that the weightof liver was significantly decreased in endostatin-treated

Table 1—Quantitative PCR primer sequences

Mouse genes Forward sequence 59 Reverse sequence 39

PPAR-g GGAAGCCCTTTGGTGACTTTA GCAGCAGGTTGTCTTGGATGT

PPAR-g1 ACAAGATTTGAAAGAAGCGGTGA GCTTGATGTCAAAGGAATGCGAAGGA

PPAR-g2 CGCTGATGCACTGCCTATGAG TGGGTCAGCTCTTGTGAATGGAA

C/EBP-a GGCTCCTAATCCCTTGCTTTT TGGTCCCCGTGTCCTCCTAT

C/EBP-b GCCATCGACTTCAGCCCCTA CGAGGCTCACGTAACCGTAG

aP2 GCGTAAATGGGGATTTGGTCAC TCGTTTTCTCTTTATTGTGGTCG

CD36 ATTCTCATGCCAGTCGGAGAC TTTCCTTGGCTAGATAACGAACT

Glut4 GGCTGTGCCATCTTGATGAC AAGACGTAAGGACCCATAGCAT

mTOR CTGGGTGCTGACCGAAATGA TCTCTCAGACGCTCTCCCTC

mTORi5 CTGGGTGCTGACCGAAATGA AATGCTGGGATTATAGGGGTGTC

VEGF TCAGAGCGGAGAAAGCATTTGT GGTGACATGGTTAATCGGTCTT

FGF-2 GCGAGAAGAGCGACCCACAC AACTGGAGTATTTCCGTGACCG

PlGF GCGAGCTTTGAAATGCTGTGTC AGCCATGCTTTGAGGTTTGGTC

b-Actin GCCAACCGTGAAAAGATGACC CCCTCGTAGATGGGCACAGT

2444 Endostatin Inhibits Adipogenesis and Obesity Diabetes Volume 64, July 2015

Figure 1—Endostatin inhibits dietary-induced obesity and its related metabolic disorders. Seven-week-old male C57BL/6J micewere fed with a ND or HFD. The HFD-fed mice were treated with or without endostatin at a dose of 12 mg/kg/day for 60 days (n =8 mice/group). A: The body weight of mice was measured every 3 days, expressed as the mean body weight (n = 8 mice/group). Dataare mean 6 SEM. B: Macroscopic appearance and autopsy examination of mice and epididymal white fat pad. The areas of theepididymal white fat pads in the images were quantified (n = 8 mice/group). C: Total WAT weight and total WAT weight-to-bodyweight ratio (n = 8 mice/group). D: High-magnification photomicrographs of hematoxylin and eosin–stained abdominal WAT slicesare shown. Mean adipocyte areas of epididymal WAT from ND- and HFD-fed mice, with or without endostatin, were quantified. Atotal of 50 adipocytes per adipose tissue were measured (n = 8 mice/group). Data are mean 6 SEM. E and F: ITT and GTT wereperformed on mice treated with endostatin for 60 days. E: For ITT, blood glucose of mice was monitored over time after theintraperitoneal administration of insulin. F: For GTT, HFD-fed mice treated with or without endostatin were starved overnight andthen given an oral glucose bolus (dose), followed by monitoring of blood glucose over time. G: Liver weight. H and I: Hematoxylin andeosin–stained liver slices. Hepatic steatosis was blindly assessed on five random fields from different areas of each liver.H: Representative liver tissue sections. I: Hepatic steatosis was quantified according to the percentage of hepatocytes containingcytoplasmic vacuoles (n = 6 mice/group). Data are mean 6 SEM. J: Immunoblotting assays detected the basal protein and phos-phorylation level of Akt (Thr308) in the epididymal WAT. Results are representative of two of eight mice per group. The quantified dataare shown in Supplementary Fig. 10A. Data are mean6 SD unless denoted otherwise. $$$P< 0.001 ND group vs. HFD group at the end ofthe experiment; ###P < 0.001 HFD group vs. HFD + endostatin group at the end of the experiment; *P < 0.05, **P < 0.01, ***P < 0.001.

diabetes.diabetesjournals.org Wang and Associates 2445

HFD-fed mice compared with untreated HFD-fed mice(Fig. 1G and Table 2). The histological analyses of livershowed that endostatin alleviated hepatic steatosis,which was typical in HFD-fed mice (Fig. 1H and I), sug-gesting that it might suppress the progression ofNAFLD. Taken together, all of these results supportthat endostatin mitigates dietary obesity–induced meta-bolic disorders.

Endostatin Inhibits AdipogenesisTo determine whether endostatin affects adipogenesis invitro, we investigated its effect on the differentiation of3T3-L1s. As shown in Fig. 2B, lipid droplet (LD) formationoccurred at day 3 of adipocyte differentiation, the pointwhen a difference between the groups with and withoutendostatin treatment could first be detected. At days 5and 6, a clear difference between the endostatin-treatedand -untreated group was visible: most endostatin-treated3T3-L1s contained fewer and smaller LDs, whereas cells inthe control group contained more and larger LDs (Fig. 2B).By day 8, fewer 3T3-L1s in the endostatin-treated groupswere differentiated into adipocytes compared with the con-trol group (Fig. 2B). Furthermore, Oil Red O staining ofdifferentiated 3T3-L1s on day 8 confirmed that endostatininhibited adipogenesis in a dose-dependent manner(Fig. 2C).

C/EBPs and PPAR-g are master transcription factors ofadipogenesis (8). Their expressions are always increasedduring adipogenesis. We hypothesized that endostatinmight have an inhibitory effect on these factors. Consis-tently, endostatin significantly reduced the RNA and pro-tein levels of PPAR-g and C/EBP-a and -b (Fig. 2D and Fand Supplementary Fig. 10B). We then evaluated the ef-fect of endostatin on adipocyte fatty acid–binding protein(aP2), cluster of differentiation 36 (CD36), and glucosetransporter 4 (Glut4), which are the downstream genes ofPPAR-g and C/EBP-a and considered as adipogenesismarkers. The results showed that endostatin significantlyreduced the expression of aP2, CD36, and Glut4 duringadipogenesis (Fig. 2F). These effects were consistent with

changes in cell morphology induced by endostatin duringadipogenesis.

To further determine whether endostatin inhibitsadipogenesis in vivo, we detected the expression levelsof PPAR-g, C/EBP-a, C/EBP-b, aP2, CD36, and Glut4 inHFD-fed mice. Compared with the ND, the HFD increasedthe expression levels of PPAR-g, C/EBP-a, C/EBP-b, aP2,and CD36, whereas endostatin attenuated these effects(Fig. 2E and Supplementary Figs. 2A and 10C). However,the HFD decreased the expression level of Glut4 in vivo,and endostatin treatment significantly reversed this effect(Supplementary Fig. 2A).

Endostatin Interacts With Sam68To investigate the mechanism that endostatin inhibitsadipogenesis, we set out to identify potential endostatin-interacting proteins in 3T3-L1s. 3T3-L1 cell lysates wereapplied to endostatin-linked CNBr-activated Sepharose 4Bcolumn (CNBr-endostatin). After elution and separatingbound proteins by SDS-PAGE, mass spectrometry analysisrevealed the presence of Sam68: seven distinct peptidescomprising the polypeptide sequences of Sam68 wereidentified (Fig. 3A and B). Furthermore, Western blotconfirmed the presence of Sam68 in the eluted solutionof CNBr-endostatin (Fig. 3C). Next, the result of recipro-cal immunoprecipitation confirmed that endostatin phys-ically interacted with Sam68 (Fig. 3D). To determine thesubcellular compartment in which endostatin binds toSam68, we performed internalization and immunofluo-rescence assays and found that endostatin was internal-ized by 3T3-L1s (Supplementary Fig. 3) and thencolocalized with Sam68 in the nuclei (Fig. 3E). Thus, endo-statin physically interacts with Sam68 in the nuclei of3T3-L1s.

To determine which structural domain of Sam68(11) interacts with endostatin, we constructed a seriesof HA-tagged Sam68 truncations in which differentfunctional domains were deleted (Fig. 3F) and thendetected their abilities to interact with endostatin.This analysis revealed that the binding of Sam68D96-157

Table 2—Body, WAT, liver, heart, lung, and kidney weight of HFD-fed mice

ND (n = 8) HFD (n = 8) HFD + endostatin (n = 8) P valueb P valuec

Body weightInitial (g)a 22.4 6 0.8 23.5 6 0.9 23.5 6 1.3 NS NSFinal (g)a 28.1 6 0.9 37.9 6 1.4 32.4 6 0.8 ,0.001 ,0.001Gain (g)a 5.7 6 0.7 14.4 6 2.5 8.9 6 1.8 ,0.001 ,0.001

WAT (g) 0.66 6 0.13 2.89 6 0.59 1.51 6 0.67 ,0.001 ,0.001

Liver (g) 0.86 6 0.15 1.22 6 0.18 0.93 6 0.14 ,0.001 ,0.001

Heart (g) 0.133 6 0.006 0.131 6 0.007 0.132 6 0.008 NS NS

Lung (g) 0.141 6 0.018 0.142 6 0.008 0.142 6 0.006 NS NS

Kidney (g) 0.181 6 0.014 0.18 6 0.01 0.189 6 0.015 NS NS

Seven-week-old male C57BL/6J mice were fed with the ND or HFD. The HFD-fed mice were treated with or without endostatin at a doseof 12 mg/kg/day for 60 days. Initial and final body weight of mice were measured. The weight of liver, heart, lung, and kidney wasmeasured. Data are expressed as mean 6 SD (n = 8 per group) unless denoted otherwise. aData are mean 6 SEM. bComparisonbetween ND group and HFD group. cComparison between HFD group and HFD + endostatin group.

2446 Endostatin Inhibits Adipogenesis and Obesity Diabetes Volume 64, July 2015

Figure 2—Endostatin inhibits adipogenesis of 3T3-L1s. A: Adipogenic differentiation protocols for 3T3-L1s. For differentiation of 3T3-L1preadipocytes into adipocytes, 2-day postconfluent 3T3-L1s were stimulated to differentiate by incubation with MDI medium (designatedas day 0). B–D: During adipogenesis, confluent 3T3-L1s (day 22) were treated with or without endostatin (0–50 mg/mL) until the end of theexperiment on day 8. B: Light microscopy comparison of lipid droplet formation and changes on different days (days 3 to 8) of differen-tiation in endostatin-treated or -untreated groups. Scale bars represent 20 mm. The result shown is representative of three independentexperiments. C: Day 8 adipocytes differentiated from 3T3-L1s treated with or without endostatin were stained with Oil Red O, and cellspositive for Oil Red O staining (n = 15) were quantified. Data are mean 6 SD. D: Western blot analyses were conducted of PPAR-g and

diabetes.diabetesjournals.org Wang and Associates 2447

or Sam68D96-279 to endostatin was dramatically disruptedcompared with Sam68WT, whereas the interactions betweenother truncated protein constructs and endostatin wereunaffected (Fig. 3G). These findings suggest that endostatininteracts with the NK (N-terminal of KH) domain of Sam68,which resides in the amino acid region 96-157. This domainregulates the specificity of interactions between Sam68and RNA elements (11), which implies that the binding ofendostatin to the NK domain of Sam68 affects Sam68-mediated RNA metabolism.

Endostatin Mediates Retention of Intron 5 of mTORmRNA During AdipogenesisSam68 deficiency leads to an error in alternative splicing ofmTOR, producing a mutated unstable form of mTORmRNA, termed “mTORi5,” which is a mutated tran-script terminated within intron 5 (10). Thus, we detectedwhether endostatin directly interfered with the interac-tions between Sam68 and the two putative Sam68-bindingsites (SBS1 and SBS2) within intron 5 of mTOR (10) usingRNA-binding assay. Our result showed that endostatin at-tenuated the binding of Sam68 to SBS1 and SBS2 ina dose-dependent manner (Fig. 4A). These findings sug-gested that endostatin impaired the binding of Sam68 tointron 5 of mTOR, which predicted that endostatin led tointron 5 retained within the mTOR transcript and thenreduced the expression of wild-type mTOR.

To determine whether endostatin indeed affects themTOR transcript during adipogenesis, we measured thelevels of mTOR, mTORi5, and Sam68 at days 0 and 4 ofdifferentiation in the endostatin-treated or -untreatedgroup. Consistent with previous observations (10), theexpression of mTOR, mTORi5, and Sam68 was in-creased at day 4 compared with day 0 of undifferenti-ated 3T3-L1s (Fig. 4B and D and SupplementaryFig. 10E). Moreover, in the endostatin-treated group,wild-type mTOR expression was decreased whereasmTORi5 expression was increased compared with thosein the control groups at day 0 and day 4 (Fig. 4B–D andSupplementary Fig. 10D and E). However, the expres-sion of Sam68 was unaffected by the endostatin treat-ment (Fig. 4D and Supplementary Fig. 10E). We furtherdetected the expression level of mTOR in vivo andfound that HFD-induced upregulation of mTOR wasinhibited by endostatin treatment in WAT (Fig. 5Cand Supplementary Fig. 10H).

We next investigated whether the overexpression ofSam68 could rescue the inhibitory effect of endostatin onmTOR transcription. If so, which domains of Sam68 areresponsible for it? Interestingly, endostatin-induced upreg-ulation of mTORi5 and downregulation of wild-typemTOR were abrogated by the overexpression of Sam68WTand Sam68D1-96 but not by the overexpression ofSam68D96-157 and Sam68D96-279, in which theendostatin-interacting domains were deleted (Figs. 4Eand 5D and Supplementary Fig. 10I). Thus, it is throughthe competitive interaction with Sam68 that endostatininhibits Sam68-mediated alternative splicing of mTOR,which results in retaining intron 5 within the mTORtranscript, leading to the downregulation of mTOR.

Endostatin Decreases the Activity of mTOR Complex 1The inhibitory effect of endostatin on mTOR expressionwould be predicted to influence the activity of mTORcomplex 1 (mTORC1). To determine whether endostatininfluences mTORC1, we tested its effects on phosphory-lation of eIF4E-binding protein 1 (4E-BP1), p70 S6ribosomal kinase (S6K), and the ribosomal protein S6(RPS6), which indicate the activities of downstreamkinases of mTORC1 (22,23). The results showed thatthe phosphorylation levels of 4E-BP1 and S6K at Thr389were decreased in a dose-dependent manner in vitro(Fig. 5A and Supplementary Figs. 4A and 10F). Thedecreased phosphorylation level was also observedat Ser240/244 of RPS6 (Fig. 5A and SupplementaryFig. 10F), which acted as the downstream effector ofS6K activation in adipocytes or preadipocytes (22,23).In addition, the phosphorylation levels of 4E-BP1,S6K (Thr389), and RPS6 (Ser240/244) in WAT werelower in endostatin-treated mice than those in HFD-fed mice (Fig. 5C and Supplementary Figs. 4B and10H). Raptor is a representative component of mTORC1.Wang et al. (24) reported that the phosphorylation ofraptor at Ser863 is important for the activation ofmTORC1 toward substrates of 4E-BP1 and S6K. Consis-tently, the protein level and phosphorylation levelof raptor at Ser863 were also downregulated in theendostatin-treated groups in vitro and in vivo (Supple-mentary Fig. 5A and B).

We then tested whether Sam68 overexpression couldrescue the inhibitory effects of endostatin on the activitiesof S6K and RPS6. As shown in Fig. 5D and Supplementary

C/EBP-a and -b in endostatin-treated or -untreated groups at different days of differentiation. Equal amounts of proteins were collectedfrom different days of differentiation (D0, before differentiation induction; D2 and D6, after differentiation induction). The results shown arerepresentative of three independent experiments. Quantification of immunoblots is shown in Supplementary Fig. 10B. E: Seven-week-oldmale C57BL/6J mice were fed with the ND or HFD. The HFD-fed mice were treated with or without endostatin at a dose of 12 mg/kg/day for60 days. Western blot analyses were conducted of PPAR-g and C/EBP-a and -b in the epididymal WAT. Results are representative of twoof eight mice per group. The quantified data are shown in Supplementary Fig. 10C. F: Total RNA was isolated before the induction ofdifferentiation (day 0), as well as 2 and 6 days later. The mRNA levels of PPAR-g, C/EBP-a and -b, aP2, CD36, and Glut4 were assessed byquantitative PCR. Data were normalized to b-actin and are expressed as relative fold changes compared with the untreated group at day0 (n = 6). All data are mean 6 SD. *P < 0.05, **P < 0.01, ***P < 0.001 vs. endostatin-untreated group on the same day.

2448 Endostatin Inhibits Adipogenesis and Obesity Diabetes Volume 64, July 2015

Figure 3—Endostatin physically interacts with Sam68 in 3T3-L1s. A–C: 3T3-L1 cell lysates were incubated with CNBr-BSA as a control orwith CNBr-endostatin for 12 h. A: The precipitation samples were subjected to SDS-PAGE and stained with Coomassie blue. Protein bandsof great variation compared with control were analyzed by liquid chromatography–mass spectrometry. B: Seven peptides that span thesequence of Sam68 were identified by mass spectrometry. C: The immunoprecipitated (IP) proteins were immunoblotted with anti-Sam68antibody. Cell lysates were immunoblotted with antibody against Sam68 as input control and actin and b-tubulin as loading controls, re-spectively. The results shown are representative of three independent experiments. D: 3T3-L1s were incubated with endostatin (25 mg/mL)for 3 h. The cell lysates were immunoprecipitated with anti-endostatin antibody, anti-Sam68 antibody, or relevant IgG isotype control,respectively, and subsequently immunoblotted with anti-endostatin or anti-Sam68 antibodies. Cell lysates were immunoblotted with

diabetes.diabetesjournals.org Wang and Associates 2449

Fig. 10I, overexpression of Sam68WT and Sam68D1-96,but not Sam68D96-157 and Sam68D96-279, which lackthe endostatin-interacting domain, could rescue the in-hibitory effects of endostatin on the activities of S6K andRPS6. Furthermore, the inhibitory effect of endostatinon adipocyte differentiation also could be abrogated byoverexpression of Sam68WT and Sam68D1-96 but notSam68D96-157 and Sam68D96-279 (Fig. 5E and F).Thus, through directly interacting with Sam68, endosta-tin impaired the activity of mTORC1, consequently lead-ing to the inhibition of adipogenesis.

Rictor is a representative component of mTORC2. S6Khas been reported to directly phosphorylate rictor atThr1135. We found that endostatin inhibited Thr1135phosphorylation of rictor in vitro and in vivo (Supple-mentary Fig. 5A and B), which is consistent with ourobservation that endostatin suppresses the activity ofS6K. However, the relationship between the phosphory-lation of rictor at Thr1135 and the activity of mTORC2was not well defined (25,26). Therefore, we further ex-amined the activity of mTORC2 by assessing Ser473phosphorylation of Akt (27) at days 0 and 2 of differen-tiation. The results showed that only a high dose ofendostatin (50 mg/mL) treatment, but not a low dose(25 mg/mL), significantly suppressed the phosphoryla-tion of Akt at Ser473 (Fig. 5B and SupplementaryFig. 10G). Meanwhile, there was no significant changein the phosphorylation level of Akt at Ser473 in theHFD-fed mice treated with endostatin (12 mg/kg/day)(Fig. 5C and Supplementary Fig. 10H). Lamming et al.(28) reported that inhibition of mTORC2 might not begood over the long-term because it leads to insulin re-sistance. Thus, endostatin did not affect the mTORC2pathway in vivo, which is consistent with our observa-tion that it improved insulin resistance in HFD-fed mice.Actually, the situation in vivo is more complicated thanthat of in vitro. A possible explanation of the contradic-tory observations of mTORC2 activity in vitro and invivo is caused by the effect of endostatin on insulin re-sistance, which could be a secondary effect to its anti-obesity function.

We also tested mTOR-regulated cell behaviors, in-cluding cell apoptosis and proliferation in vitro. Endo-statin significantly promoted the apoptosis of 3T3-L1sduring adipogenesis (Supplementary Fig. 6A and B). How-ever, the proliferation of 3T3-L1s remained unchanged

after endostatin treatment (Supplementary Fig. 6C andD). These results are consistent with our previous obser-vations (29,30). Thus, the apoptosis-promoting effect ofendostatin may contribute to its antiadipogenic function.The Antiangiogenic Activity of Endostatin Contributesto Its Antiobesity FunctionTo study whether endostatin exerts an antiobesity effectvia its antiangiogenic activities, we examined the degreeof vascularization in adipose tissues of endostatin-treatedor -untreated mice. Our result showed that adipose tissuewas highly vascularized in HFD-fed mice compared withND-fed mice, as shown by immunostaining for thevascular endothelial marker CD31 (Fig. 6A and B). Com-pared with untreated HFD-fed mice, a striking reductionin vascular density in the WAT of endostatin-treatedHFD-fed mice was observed (Fig. 6A and B). We furtherobserved that endostatin inhibited HFD-induced upregu-lation of angiogenic factors, including vascular endothelialgrowth factor (VEGF), fibroblast growth factor (FGF)-2,and placental growth factor (PlGF) in WAT (Supplemen-tary Fig. 7A and B). Consistently, VEGF, FGF-2, and PlGFwere also highly expressed in mature adipocytes com-pared with undifferentiated preadipocytes, which couldbe compensated by endostatin treatment during adipo-genesis in vitro (Supplementary Fig. 7C).

Many angiogenic factors could be secreted by adipo-cytes in vitro and in vivo (31). We consistently found thatproangiogenic factors, including VEGF, FGF-2, and PlGF,were also secreted by adipocytes in vitro (SupplementaryFig. 7D), which prompted us to explore whether endo-statin could counteract the angiogenic activity inducedby such secretions. We treated SVEC4-10 murine endo-thelial cells with adipocyte-CM, and tested whether endo-statin inhibited this treatment-induced endothelial cellvascular tube formation and migration in vitro. Ourresults showed that adipocyte-CM led to increased tubeformation and transwell migration of SVEC4-10 murineendothelial cells and that these effects were reversedby endostatin treatment in a dose-dependent manner(Fig. 6C, D, and F). Similarly, in a scratch wound–healingassay, we found that wound healing was significantlydelayed in the endostatin-treated groups (Fig. 6E and F).In addition, we used the in vivo matrigel plug assay toconfirm these in vitro results. Consistent with our in vitroresults, endostatin markedly reduced blood vessel formationin the matrigel plugs supplemented with adipocyte-CM in

antibodies against endostatin and Sam68 as input controls, with actin and b-tubulin as loading controls. The results shown are repre-sentative of three independent experiments. E: Endostatin colocalizes with Sam68 intracellularly in 3T3-L1s. 3T3-L1s were incubated with25 mg/mL rhodamine (Rh)-conjugated endostatin (Rh-endostatin) for 3 h at 37°C and were fixed and immunofluorescence-stained by anti-Sam68 antibody. Scale bars = 20 mm (four left panels) and 5 mm (magnified). The result shown is representative of three independentexperiments. F: HA-tagged Sam68 truncations encompassing various functional domains were constructed. CK, C-terminal of KH; HA,hemagglutinin tag; KH, heteronuclear ribonucleoprotein particle K homology domain; NK, N-terminal of KH; NLS, nuclear localizationsignal; YY, C-terminal tyrosine-rich domain. G: Confluent 3T3-L1s were transfected with control HA vehicle or HA-tagged Sam68 trun-cations for 48 h and then incubated with endostatin (25 mg/mL) for 3 h. The cell lysates were immunoprecipitated with anti-endostatin oranti-HA antibodies and subsequently immunoblotted with anti-endostatin or anti-HA antibodies. Transfected 3T3-L1 lysates wereimmunoblotted with antibodies against endostatin or HA tag as input controls, with actin and b-tubulin as loading controls. The resultsshown are representative of three independent experiments.

2450 Endostatin Inhibits Adipogenesis and Obesity Diabetes Volume 64, July 2015

a dose-dependent manner (Fig. 6G and H). Thus, the well-known antiangiogenic activity of endostatin is an additionalmechanism for its antiobesity function.

Endothelial cell angiogenesis involves activation of multi-ple signaling pathways, such as FAK, p38 mitogen-activated

protein kinase (MAPK), and extracellular signal–relatedkinase (ERK) (20), prompting us to determine whetherendostatin inhibits any of these pathways activated bysecretory products of adipocytes. As shown in Fig. 6I andSupplementary Fig. 10J, adipocyte-CM stimulated the

Figure 4—Endostatin retains intron 5 in mTOR transcript and decreases the expression of mTOR. A: 3T3-L1s at day 2 of differentiationwere treated with endostatin (0–50 mg/mL) for 3 h. The cell lysates were incubated with biotin-labeled RNA sequence of scramble, intron 5SBS1 or SBS2 and then precipitated by streptavidin agarose resin. The precipitation samples were immunoblotted with Sam68 antibody. Celllysates were immunoblotted with antibody against Sam68 as input control and actin and b-tubulin as loading controls, respectively. The resultsshown are representative of three independent experiments. B–D: During adipogenesis, confluent 3T3-L1s were treated with or withoutendostatin (0–50 mg/mL) until the end of the experiment on day 4. B: The mRNA levels of mTOR and mTORi5 were assessed by quantitativePCR. Data were normalized to b-actin and expressed as relative fold changes compared with the untreated group at day 0 (n = 6). C: RT-PCRanalyses of mTORi5 in endostatin-treated or -untreated groups at day 0 and day 4 of differentiation. The results shown are representative ofthree independent experiments. The quantified data are shown in Supplementary Fig. 10D. D: Western blot analyses of mTOR and Sam68expression in endostatin-treated or -untreated groups at days 0 and 4 of differentiation were conducted. The results shown are representativeof three independent experiments. The quantified data are shown in Supplementary Fig. 10E. E: Confluent 3T3-L1 cells were transfected withHA-tagged vehicle plasmid or HA-Sam68 truncations for 48 h and then treated with endostatin (0 or 50 mg/mL) supplemented in MDI medium(Fig. 2A) for 48 h. The mRNA levels of mTOR and mTORi5 normalized to b-actin were assessed by quantitative PCR. The data are expressedas relative values compared with endostatin-untreated vehicle vector group (n = 6). DNK, N-terminal of KH domain was deleted; DNP, N-terminal of proline-rich motifs was deleted; DSTAR, the signal transduction activator of RNA domain (region 96-279) was deleted; WT, wild-type Sam68. All data are mean6 SD. *P< 0.05, **P< 0.01, ***P< 0.001 vs. with endostatin-untreated vehicle vector transfection group; #P<0.05, ##P < 0.01, ###P < 0.001 vs. with endostatin-treated vehicle vector transfection group.

diabetes.diabetesjournals.org Wang and Associates 2451

Figure 5—Endostatin reduces the activity of mTORC1 pathway. During adipogenesis as shown in Fig. 2A, confluent 3T3-L1s were treatedwith or without endostatin (0–50 mg/mL) until the end of the experiment on day 6. A: Western blots were used to detect the expression ofSam68 as well as the basal protein and phosphorylation levels of S6K and RPS6 in the endostatin-treated or -untreated group at day 0 (beforethe induction of differentiation) and at days 2, 4, and 6 of differentiation. The results shown are representative of three independent experi-ments. Quantification of immunoblots is shown in Supplementary Fig. 10F. B: Immunoblotting assays detected the basal protein andphosphorylation level of Akt in the endostatin-treated or -untreated group at day 0 (before the induction of differentiation) and day 2 ofdifferentiation. The results shown are representative of three independent experiments. Quantification of immunoblots is shown in Supple-mentary Fig. 10G. C: Seven-week-old male C57BL/6J mice were fed with the ND or HFD. The HFD-fed mice were treated with or withoutendostatin at a dose of 12 mg/kg/day for 60 days. Immunoblotting assays detected the protein levels of mTOR as well as the basal proteinand phosphorylation levels of S6K, RPS6, and Akt in the epididymal WAT. Results are representative of two of eight mice per group. Thequantified data are shown in Supplementary Fig. 10H. D: Confluent 3T3-L1s were transfected with HA-tagged vehicle plasmid or HA-Sam68 truncations for 48 h and then treated with endostatin (0 or 50 mg/mL) supplemented in MDI medium (Fig. 2A) for 48 h. Immuno-blotting assays detected the protein levels of mTOR and HA-tagged Sam68 as well as the basal protein and phosphorylation levels of S6Kand RPS6 in vehicle vector or Sam68 truncations expression vector groups. The results shown are representative of three independentexperiments. Quantification of immunoblots is shown in Supplementary Fig. 10I. E and F: 3T3-L1s were transiently transfected with vehiclevector or Sam68 truncations expression vector, were induced to differentiate, and were treated with or without endostatin (50 mg/mL) untilthe end of the experiment on day 6. Transfections were repeated 1 day after differentiation initiation, and adipogenesis was visualized by OilRed O staining. E: The results shown are a representative graph of differentiated adipocytes in different groups. F: Cells positive for Oil RedO staining were quantified (n = 15). All data are mean6 SD. ***P< 0.001 vs. vehicle vector transfection group without endostatin treatment.DNK, NK domain was deleted; DNP, N-terminal of proline-rich motifs was deleted; DSTAR, the signal transduction activator of RNA domain(region 96-279) was deleted; WT, wild-type Sam68.

2452 Endostatin Inhibits Adipogenesis and Obesity Diabetes Volume 64, July 2015

Figure 6—Endostatin prevents angiogenesis in WAT. A: Seven-week-old male C57BL/6J mice were fed with the ND or HFD. The HFD-fedmice were treated with or without endostatin at a dose of 12 mg/kg/day for 60 days. Blood vessels in WAT were analyzed by immuno-fluorescence staining for the vascular endothelial marker CD31. Scale bars represent 100 mm. B: Quantification of the blood vessel densityin WAT is presented (n = 6 mice/group). ###P < 0.01. C–F: SVEC4-10 endothelial cells were treated with fresh DMEM or adipocyte-CM ora combination of adipocyte-CM and endostatin (10–20 mg/mL), and then tube formation (n = 15) at 12 h (C ), transwell migration (n = 15) at6 h (D), and the percentage of scratch wound healing (n = 9) at 48 h (E ) were measured, respectively. F: The results shown are represen-tative images of tube formation (Up), transwell migration (Middle), and wound healing (Bottom). Scale bars represent 500 mm (Up), 50 mm(Middle), and 100 mm (Bottom). G and H: Matrigel mixed with DMEM or adipocyte-CM or adipocyte-CM containing endostatin (40 mg/mL)

diabetes.diabetesjournals.org Wang and Associates 2453

phosphorylation of FAK, p38 MAPK, and ERK1/2 inendothelial cells, which was attenuated by endostatin ina dose-dependent manner.

DISCUSSION

Here, the dietary-induced obesity model, in which theHFD can dramatically stimulate adipogenesis, angio-genesis, and then the expansion of WAT compared withthe ND, was used to study the antiobesity function ofendostatin. This study reports that endostatin protectsmice against dietary-induced obesity and its relatedmetabolic disorders through both antiadipogenic andantiangiogenic mechanisms. We find that endostatininhibits adipogenesis by the mechanism of impairingSam68-mediated alternative splicing of mTOR andreducing the activity of the mTORC1 pathway. Inaddition, we demonstrate that the well-known anti-angiogenic activity of endostatin also contributes to itsantiobesity effect, which is consistent with previousobservations that several angiogenesis inhibitors, in-cluding angiostatin and TNP-470, prevent obesity inmice (13,14).

We reveal that the antiadipogenic function of endo-statin is mediated by competitive interaction withSam68 in the nuclei of 3T3-L1s and then inhibitsSam68-mediated RNA splicing of mTOR. However, themechanism by which endostatin is internalized andthen translocated to the nuclei of 3T3-L1s is stillunclear. Our previous study discovered that cell surfacenucleolin is the functional receptor of endostatin (29).Nucleolin, which is mainly located in the nuclei, cantranslocate to the cell surface when endothelial cellsare stimulated by extracellular matrix and VEGF (32).When endostatin binds to cell surface nucleolin, bothcan be internalized and then translocated to the nucleiof endothelial cells (20,29,33). Here we found that adi-pogenesis stimulated nucleolin expression on the cellsurface of differentiating 3T3-L1s at days 2, 4, and 6of differentiation (Supplementary Fig. 8). Moreover, theexpression of cell surface nucleolin dramatically de-creased in nondifferentiating preadipocytes and differ-entiated adipocytes (Supplementary Fig. 8). Together,we infer that cell surface nucleolin mediates the inter-nalization and translocation of endostatin in 3T3-L1sduring adipogenesis so that endostatin can specificallytarget adipogenesis in WAT.

Our study shows that the antiadipogenic function ofendostatin is mechanistically linked to the mTORC1pathway. Upon physically binding to Sam68 in the nucleiof preadipocytes, endostatin competitively inhibits theinteraction between Sam68 and intron 5 of mTOR, therebyit can decrease the expression of wild-type mTOR andfinally inhibit the activity of the mTORC1/S6K pathway.Consistent with our findings, Huot et al. (10) reported thatSam68 is a critical mediator of mTOR alternative splicingin WAT. Sam682/2mice show inhibition of mTORC1 path-way and are protected from obesity (10). In addition,mTOR inhibition decreases cell size of adipocytes andprevents obesity in humans (23,34). The inhibition ofmTORC1/S6K consistently downregulates the expressionof C/EBP-a and PPAR-g and then blocks adipogenesis(35). Adipose tissue–specific mTORC1 knockout micewere lean and resistant to dietary-induced obesity (36).Thus, our results showed that the activity of mTORC1/S6K in the HFD-fed mice was suppressed by endostatin,which could explain why endostatin treatment led to thereduction of body weight.

Like tumor tissues, WAT contains a diversity of celltypes, including adipocytes and other adipocyte stromalcells, such as preadipocytes, endothelial cells, andinflammatory cells (12), comprising a complex adiposemicroenvironment. Interestingly, there is evidence fora functional link between adipogenesis and angiogene-sis during deposition of fat mass, whereby the angio-genic capacity of WAT may determine the extent ofadipogenesis and propensity of a subject to gain weight(37,38). In addition, several studies have shown thatendothelial cells control adipogenesis in WAT throughVEGF and matrix metalloproteinases pathways (39–42). Accordingly, we revealed that factors derivedfrom endothelial cells stimulated adipogenesis of3T3-L1s. Furthermore, the conditioned media from en-dothelial cells precultured in the presence of VEGFaccelerated adipocyte differentiation (SupplementaryFig. 9A and B). In addition, these adipogenic-promotingeffects on adipogenesis were reversed by the pretreatmentof endostatin on endothelial cells (Supplementary Fig. 9Aand B). These data indicate that vascular endothelial cellspromote adipogenesis in a paracrine manner and thatendostatin can attenuate this effect. In this study, wetreated the mice with endostatin systemically, and there-fore cannot exclude the possibility that its action on

was injected subcutaneously near the abdominal midline of C57BL/6J mice. After 8 days, the matrigel plugs were dissected and immu-nofluorescent detection of CD31 was performed. G: The results shown are representative images of immunofluorescence detection ofblood vessels (green, CD31 staining) in matrigel plugs using a Nikon A1 microscope. Scale bars represent 100 mm. H: Quantification of theblood vessel density in matrigel plugs is presented (n = 6 mice/group). #P < 0.05, ##P < 0.01. I: SVEC4-10 endothelial cells were starvedovernight, incubated with 0, 10, or 20 mg/mL endostatin for 60 min, and then stimulated with adipocyte-CM for 10 min. The basal proteinand phosphorylation levels of FAK, p38 MAPK, and ERK1/2 were assessed by immunoblotting. The results shown are representative ofthree independent experiments. Quantification of immunoblots is shown in Supplementary Fig. 10J. All data are mean 6 SD. **P < 0.01,***P < 0.001 vs. group treated with adipocyte-CM alone.

2454 Endostatin Inhibits Adipogenesis and Obesity Diabetes Volume 64, July 2015

endothelial cells also contributed to the antiadipogeniceffect of endostatin.

In the current study, endostatin was observed to in-hibit angiogenesis by suppressing FAK, p38 MAPK, andERK1/2, which is consistent with a previous study (20). Inaddition, the angiogenesis factors including VEGF, FGF-2,and PlGF were also downregulated in the endostatin-treated group. FGF-2 was reported to activate S6K(43,44). Moreover, Pende et al. (43) reported that theS6K pathway mediates CREB phosphorylation in responseto protein kinase C activation and FGF-2 stimulation. Inaddition, rapamycin inhibits the expression of adipogeniccontrol transcription factors, including C/EBP-a andPPAR-g, by blocking the mTOR/S6K pathway (35). Thesetogether could be a possible explanation why the antian-giogenic effect of endostatin led to the inhibitory effecton adipogenesis through mTOR/S6K.

Insulin resistance and glucose intolerance are impor-tant characteristics of metabolic disorders. Here we foundthat systemically administered endostatin improved in-sulin resistance and glucose intolerance in mice, suggest-ing that it may provide a potential therapeutic targetfor the prevention of type 2 diabetes. Um et al. (45)reported that mTORC1 promotes insulin resistance inadipose tissue through the S6K-mediated inhibition ofinsulin signaling, which is consistent with our findingthat endostatin improves insulin resistance and impairsthe activity of S6K.

Our results showed that endostatin inhibited theexpression of Glut4 during adipogenesis in vitro. How-ever, Glut4 was downregulated in the WAT of HFD-fedmice, whereas this effect was significantly reversed byendostatin treatment. Studies have consistently reportedthat Glut4 is downregulated in WAT and skeletal muscleof obese mice that were fed with an HFD over long-termand that the mice developed insulin resistance andglucose intolerance (46,47). A possible explanation ofthe contradictory observations of Glut4 expressionchanges in vitro and in vivo is due to the effects of endo-statin on insulin resistance and glucose intolerance, whichcould be a secondary effect to its antiobesity function.

Although endostatin has been tested as an antitumordrug in human clinical trials, this is not a good model todetermine the effect of endostatin on body weightbecause of the combined use of endostatin and chemo-therapy drugs. Clinical trials of the Pichia pastoris–expressed endostatin were terminated at phase II studies.The China Food and Drug Administration (CFDA) subse-quently approved E. coli–expressed N-terminal–modifiedendostatin. The likely reason for this difference was thatthe P. pastoris–expressed endostatin suffered from N-terminaltruncations that influenced its correct folding and furtherdecreased its antiangiogenic capacity. Our previous workreported that correct refolding and N-terminal integritywere critical for the activities of this molecule (48); therefore,we used E. coli–expressed recombinant endostatin inthe current study.

Many therapeutic approaches, including restrictingfood intake, increasing physical exercise, medication,and surgical intervention, have been developed to reduceobesity. However, these approaches are limited by theirpoor efficacy for treating some types of obesity, poorlong-term adherence rates, and serious adverse effects(12). Thus, new approaches to obesity prevention andtreatment are urgently needed. We demonstrated in thisreport that endostatin effectively protects mice againstdietary-induced obesity and related metabolic disorders.Even so, the correlation between obesity and the endo-statin concentration in blood circulation was not well de-fined (49,50). The basal levels of endostatin in bloodcirculation of obese individuals need to be investigatedin the future. However, endostatin still has a great poten-tial to be used in antiobesity therapy and in the preven-tion of obesity-related metabolic disorders.

Acknowledgments. The authors thank Lin Li (the Luo Laboratory mem-ber) for her helpful suggestions.Funding. This work was partly supported by the General Programs of theNational Natural Science Foundation of China (nos. 81171998 and 81272529)and the National Science and Technology Major Project for “Major New DrugsInnovation and Development” (2013ZX09509103).Duality of Interest. No potential conflicts of interest relevant to this articlewere reported.Author Contributions. H.W. designed and performed experiments, an-alyzed results, and wrote the manuscript. Y.C., X.-a.L., G.L., and Y.F. analyzedresults and reviewed the manuscript. Y.L. designed experiments, analyzedresults, and wrote the manuscript. Y.L. is the guarantor of this work and, assuch, had full access to all the data in the study and takes responsibility for theintegrity of the data and the accuracy of the data analysis.

References1. Finucane MM, Stevens GA, Cowan MJ, et al.; Global Burden of MetabolicRisk Factors of Chronic Diseases Collaborating Group (Body Mass Index).National, regional, and global trends in body-mass index since 1980: sys-tematic analysis of health examination surveys and epidemiological stud-ies with 960 country-years and 9$1 million participants. Lancet 2011;377:557–5672. Malik VS, Willett WC, Hu FB. Global obesity: trends, risk factors and policyimplications. Nat Rev Endocrinol 2013;9:13–273. Guyenet SJ, Schwartz MW. Clinical review: regulation of food intake, energybalance, and body fat mass: implications for the pathogenesis and treatment ofobesity. J Clin Endocrinol Metab 2012;97:745–7554. Cristancho AG, Lazar MA. Forming functional fat: a growing understandingof adipocyte differentiation. Nat Rev Mol Cell Biol 2011;12:722–7345. Rosen ED, Walkey CJ, Puigserver P, Spiegelman BM. Transcriptional reg-ulation of adipogenesis. Genes Dev 2000;14:1293–13076. Cao Z, Umek RM, McKnight SL. Regulated expression of three C/EBPisoforms during adipose conversion of 3T3-L1 cells. Genes Dev 1991;5:1538–15527. Yeh WC, Cao Z, Classon M, McKnight SL. Cascade regulation of terminaladipocyte differentiation by three members of the C/EBP family of leucine zipperproteins. Genes Dev 1995;9:168–1818. Tang QQ, Lane MD. Adipogenesis: from stem cell to adipocyte. Annu RevBiochem 2012;81:715–7369. Tontonoz P, Spiegelman BM. Fat and beyond: the diverse biology ofPPARgamma. Annu Rev Biochem 2008;77:289–312

diabetes.diabetesjournals.org Wang and Associates 2455

10. Huot ME, Vogel G, Zabarauskas A, et al. The Sam68 STAR RNA-bindingprotein regulates mTOR alternative splicing during adipogenesis. Mol Cell 2012;46:187–19911. Richard S. Reaching for the stars: Linking RNA binding proteins to diseases.Adv Exp Med Biol 2010;693:142–15712. Daquinag AC, Zhang Y, Kolonin MG. Vascular targeting of adipose tissue asan anti-obesity approach. Trends Pharmacol Sci 2011;32:300–30713. Rupnick MA, Panigrahy D, Zhang CY, et al. Adipose tissue mass can beregulated through the vasculature. Proc Natl Acad Sci U S A 2002;99:10730–1073514. Kim MY, Park BY, Lee HS, et al. The anti-angiogenic herbal compositionOb-X inhibits adipose tissue growth in obese mice. Int J Obes (Lond) 2010;34:820–83015. Wabitsch M. The acquisition of obesity: insights from cellular and geneticresearch. Proc Nutr Soc 2000;59:325–33016. Lamia KA, Peroni OD, Kim YB, Rameh LE, Kahn BB, Cantley LC. Increasedinsulin sensitivity and reduced adiposity in phosphatidylinositol 5-phosphate4-kinase beta-/- mice. Mol Cell Biol 2004;24:5080–508717. Sun Y, Ma YC, Huang J, Chen KY, McGarrigle DK, Huang XY. Requirement ofSRC-family tyrosine kinases in fat accumulation. Biochemistry 2005;44:14455–1446218. Ding Y, Song N, Liu C, et al. Heat shock cognate 70 regulates the trans-location and angiogenic function of nucleolin. Arterioscler Thromb Vasc Biol2012;32:e126–e13419. Wang X, Song X, Zhuo W, et al. The regulatory mechanism of Hsp90alphasecretion and its function in tumor malignancy. Proc Natl Acad Sci U S A 2009;106:21288–2129320. Chen Y, Wang S, Lu X, Zhang H, Fu Y, Luo Y. Cholesterol sequestration bynystatin enhances the uptake and activity of endostatin in endothelium viaregulating distinct endocytic pathways. Blood 2011;117:6392–640321. Guo S. Insulin signaling, resistance, and the metabolic syndrome: insightsfrom mouse models into disease mechanisms. J Endocrinol 2014;220:T1–T2322. Avruch J, Hara K, Lin Y, et al. Insulin and amino-acid regulation of mTORsignaling and kinase activity through the Rheb GTPase. Oncogene 2006;25:6361–637223. Laplante M, Sabatini DM. mTOR signaling in growth control and disease.Cell 2012;149:274–29324. Wang L, Lawrence JC Jr, Sturgill TW, Harris TE. Mammalian target of ra-pamycin complex 1 (mTORC1) activity is associated with phosphorylation ofraptor by mTOR. J Biol Chem 2009;284:14693–1469725. Julien LA, Carriere A, Moreau J, Roux PP. mTORC1-activated S6K1 phos-phorylates Rictor on threonine 1135 and regulates mTORC2 signaling. Mol CellBiol 2010;30:908–92126. Treins C, Warne PH, Magnuson MA, Pende M, Downward J. Rictor is a noveltarget of p70 S6 kinase-1. Oncogene 2010;29:1003–101627. Bhaskar PT, Hay N. The two TORCs and Akt. Dev Cell 2007;12:487–50228. Lamming DW, Ye L, Katajisto P, et al. Rapamycin-induced insulin resistanceis mediated by mTORC2 loss and uncoupled from longevity. Science 2012;335:1638–164329. Shi H, Huang Y, Zhou H, et al. Nucleolin is a receptor that mediates anti-angiogenic and antitumor activity of endostatin. Blood 2007;110:2899–290630. Yuan S, Fu Y, Wang X, et al. Voltage-dependent anion channel 1 is involvedin endostatin-induced endothelial cell apoptosis. FASEB J 2008;22:2809–282031. Aoki N, Yokoyama R, Asai N, et al. Adipocyte-derived microvesicles areassociated with multiple angiogenic factors and induce angiogenesis in vivo andin vitro [retracted in: Endocrinology 2013;154:4437]. Endocrinology 2010;151:2567–2576

32. Huang Y, Shi H, Zhou H, Song X, Yuan S, Luo Y. The angiogenic function ofnucleolin is mediated by vascular endothelial growth factor and nonmusclemyosin. Blood 2006;107:3564–357133. Song N, Ding Y, Zhuo W, et al. The nuclear translocation of endostatin ismediated by its receptor nucleolin in endothelial cells. Angiogenesis 2012;15:697–71134. Rovira J, Marcelo Arellano E, Burke JT, et al. Effect of mTOR inhibitor onbody weight: from an experimental rat model to human transplant patients.Transpl Int 2008;21:992–99835. Kim JE, Chen J. regulation of peroxisome proliferator-activated receptor-gamma activity by mammalian target of rapamycin and amino acids in adipo-genesis. Diabetes 2004;53:2748–275636. Polak P, Cybulski N, Feige JN, Auwerx J, Rüegg MA, Hall MN. Adipose-specific knockout of raptor results in lean mice with enhanced mitochondrialrespiration. Cell Metab 2008;8:399–41037. Lemoine AY, Ledoux S, Quéguiner I, et al. Link between adipose tissueangiogenesis and fat accumulation in severely obese subjects. J Clin EndocrinolMetab 2012;97:E775–E78038. Tran KV, Gealekman O, Frontini A, et al. The vascular endothelium of theadipose tissue gives rise to both white and brown fat cells. Cell Metab 2012;15:222–22939. Sung HK, Doh KO, Son JE, et al. Adipose vascular endothelial growth factorregulates metabolic homeostasis through angiogenesis. Cell Metab 2013;17:61–7240. Fukumura D, Ushiyama A, Duda DG, et al. Paracrine regulation of angio-genesis and adipocyte differentiation during in vivo adipogenesis. Circ Res 2003;93:e88–e9741. Lijnen HR, Maquoi E, Hansen LB, Van Hoef B, Frederix L, Collen D. Matrixmetalloproteinase inhibition impairs adipose tissue development in mice. Arte-rioscler Thromb Vasc Biol 2002;22:374–37942. Bouloumié A, Sengenès C, Portolan G, Galitzky J, Lafontan M. Adipocyteproduces matrix metalloproteinases 2 and 9: involvement in adipose differenti-ation. Diabetes 2001;50:2080–208643. Pende M, Fisher TL, Simpson PB, Russell JT, Blenis J, Gallo V. Neuro-transmitter- and growth factor-induced cAMP response element binding proteinphosphorylation in glial cell progenitors: role of calcium ions, protein kinase C,and mitogen-activated protein kinase/ribosomal S6 kinase pathway. J Neurosci1997;17:1291–130144. Pardo OE, Arcaro A, Salerno G, et al. Novel cross talk between MEK and S6K2in FGF-2 induced proliferation of SCLC cells. Oncogene 2001;20:7658–766745. Um SH, Frigerio F, Watanabe M, et al. Absence of S6K1 protects againstage- and diet-induced obesity while enhancing insulin sensitivity. Nature 2004;431:200–20546. Ramdas M, Harel C, Armoni M, Karnieli E. AHNAK KO mice are protectedfrom diet-induced obesity but are glucose intolerant. Horm Metab Res 2015;47:265–27247. Koren-Gluzer M, Aviram M, Hayek T. Paraoxonase1 (PON1) reduces insulinresistance in mice fed a high-fat diet, and promotes GLUT4 overexpression inmyocytes, via the IRS-1/Akt pathway. Atherosclerosis 2013;229:71–7848. Fu Y, Tang H, Huang Y, Song N, Luo Y. Unraveling the mysteries of en-dostatin. IUBMB Life 2009;61:613–62649. Brixius K, Schoenberger S, Ladage D, et al. Long-term endurance exercisedecreases antiangiogenic endostatin signalling in overweight men aged 50-60years. Br J Sports Med 2008;42:126–129; discussion 12950. Seida A, Wada J, Kunitomi M, et al. Serum bFGF levels are reduced inJapanese overweight men and restored by a 6-month exercise education. Int JObes Relat Metab Disord 2003;27:1325–1331

2456 Endostatin Inhibits Adipogenesis and Obesity Diabetes Volume 64, July 2015