Eo

BD

a

ARRA

KEERSBP

1

tuei(upssiac

tfp

s

0d

Journal of Biotechnology 145 (2010) 350–358

Contents lists available at ScienceDirect

Journal of Biotechnology

journa l homepage: www.e lsev ier .com/ locate / jb io tec

fficient production of extracellular proteins with Escherichia coli by means ofptimized coexpression of bacteriocin release proteins

enjamin Sommer, Karl Friehs ∗, Erwin Flaschelepartment of Fermentation Engineering, Faculty of Technology, Bielefeld University, POB 100 131, D-33501 Bielefeld, Germany

r t i c l e i n f o

rticle history:eceived 15 September 2009eceived in revised form 8 November 2009ccepted 24 November 2009

eywords:scherichia colixtracellular production

a b s t r a c t

Aiming to facilitate the accessibility of recombinant proteins produced with Escherichia coli, extracellularexpression may be achieved by means of bacteriocin release protein (BRP) coexpression. Different typesof BRPs were tested in order to optimize protein secretion into the culture medium. Those included thewell-studied BRPs of the Colicin E1 and Cloacin DF13 bacteriocins and variants thereof. BRP expressionwas stringently controlled by means of the arabinose inducible PBAD promoter, which accounts for abroad-range adjustment of expression strength. Using appropriate arabinose concentrations, a concen-tration range was determined, that allowed efficient secretion of the model proteins alkaline phosphataseand �-lactamase, with 90–95% of the proteins released into the culture medium. Kinetic investigationsinto BRP expression and protein secretion revealed a rapid increase of extracellular protein concentration

ecombinant protein expression

ecretionacteriocin release proteinromoter

within 5–10 min past induction. Alternatively to fine-tuned BRP expression during cultivation, proteinproduction and secretion could be decoupled by establishment of appropriate induction strategies andup to 90% of alkaline phosphatase was released into the culture medium within 3 h after reaching max-imum biomasss concentrations. Both, fine-tuned and growth decoupled BRP expression accounted forextracellular alkaline phosphatase concentrations of roughly 500 mg l−1 of culture broth and selectivities

er gr

of 50 mg of this enzyme p

. Introduction

Due to its simple genetic accessibility and competitive cultiva-ion costs Escherichia coli is and remains among the most frequentlysed hosts for recombinant protein production. High-level proteinxpression with product titers in the multi-gram-per-liter ranges achieved by the generation of optimized expression systemsMergulhao et al., 2005). Therefore, the major bottlenecks and man-facturing costs within the production process of a recombinantrotein are nowadays found in downstream processing, i.e. producteparation and purification. Addressing the first point, separation,ignificant expenses may be saved upon secretion of the proteinnto the culture medium. A simple liquid–solid-separation of cellsnd medium then is usually sufficient to remove of the majority of

ontaminating substances from the product.

Suffering from the absence of inherent export machineries, pro-eins expressed in E. coli are accumulated within the cells. Thisrequently comes along with increased degradation by cytoplasmicroteases (Gottesman, 1996) or the formation of aggregated inclu-

∗ Corresponding author. Fax: +49 521 106 6475.E-mail addresses: kfr@fermtech.techfak.uni-bielefeld.de,

ommer.benjamin@gmx.de (K. Friehs).

168-1656/$ – see front matter © 2009 Elsevier B.V. All rights reserved.oi:10.1016/j.jbiotec.2009.11.019

am of cell dry mass, respectively.© 2009 Elsevier B.V. All rights reserved.

sion bodies (IBs) which usually lack biological activity (Bowden etal., 1991).

However, inactive IBs may especially be beneficial, if the tar-get protein is toxic to the host. Moreover, protein expression inIBs is widely used in industry, as these aggregates can be isolatedfrom host cell proteins by simple centrifugation (Graumann andPremstaller, 2006). The usefulness of IBs has been significantlyimproved with the development of autocleavable N-terminalfusion peptides that promote on the one hand cytoplasmic aggrega-tion and on the other hand simplified IB renaturation after isolation(Achmuller et al., 2007).

Still, product access requires cell disruption prior to IB isolationand IB renaturation itself is a time-consuming step which usuallygoes in hand with a large volume expansion and which sets anadditional burden for subsequent purification.

Upon introduction of a determining N-terminal signal pep-tide (SP) the protein of interest may be directed to the bacterialperiplasm via either the general secretory (Sec) pathway or the twinarginine translocation (Tat) system. For recent reviews of theseexport routes be referred to Economou (1999) and Berks et al.

(2005). Subsequent to periplasmic targeting coexpression of bac-teriocin release proteins (BRP) can be used to release periplasmicproteins into the culture medium (Miksch et al., 1997b; Shokri etal., 2003; Choi and Lee, 2004; Mergulhao et al., 2005). BRPs aresmall (3 kDa) lipoproteins which bring about a partial degradation

B. Sommer et al. / Journal of Biotechnology 145 (2010) 350–358 351

Table 1List of vectors.

Plasmid Relevant characteristics/genotype Source/reference

pBAD18-Kan Cloning vector for PBAD regulated protein expression Guzman et al. (1995)pJL3 Native Cloacin DF13 BRP with the original signal

peptide (brp)Luirink et al. (1987)

pJL17lpp Cloacin DF13 BRP with the original signal peptidereplaced by the lpp signal peptide (lppbrp)

van der Wal et al. (1998)

pColE1 Native Colicin E1 BRP (kil) Sabik et al. (1983)pCH40 Alkaline phosphatase (phoA) preceded by bla signal

peptideHoffman and Wright (1985)

pUC19 Cloning vector; encodes �-lactamase (bla) Yanisch-Perron et al. (1985)pBAD18-KanLppBRP pBAD18-Kan derivative; lppbrp from pJL17lpp inserted

downstream of PBAD promoterThis work

pBAD-LppBRPphoA pBAD18-KanLppBRP derivative; phoA fragment frompCH40 inserted

This work

pBAD-LppBRPphoAbla pBAD-LppBRPphoA derivative; bla fragment frompUC19 inserted

This work

pBAD-BRPphoAbla pBAD-LppBRPphoAbla derivative; Cloacin DF13 BRPfrom pJL3 inserted downstream of PBAD promoter

This work

pBAD-KilE1phoAbla pBAD-LppBRPphoAbla derivative; Colicin E1 BRP frompColE1 inserted downstream of PBAD promoter

This work

pBAD-LppBRP-His6phoAbla pBAD-LppBRPphoAbla derivative; His6-tagged CloacinDF13 LppBRP from pJL17lpp inserted downstream ofPBAD promoter

This work

phoA f

tive; b

a1otmrw

bcetEn(imspcto(

tpi1tstSrbDa

phw

pBAD18-KanPhoA pBAD18-Kan derivative;inserted; no BRP

pBAD18-KanPhoAbla pBAD18-KanPhoA derivapUC19 inserted; no BRP

nd permeabilization of the cell’s outer membrane (Dekker et al.,999; Snijder et al., 2001) and account for a diffusive secretionf a subfraction of periplasmic proteins. Although protein secre-ion subsequent to periplasmic export through the Sec pathway by

eans of BRP coexpression is a common approach, we have justecently shown the compatibility of BRP-mediated protein releaseith Tat-routed proteins (Sommer, 2008; Sommer et al., 2009).

However, BRP coexpression is critical with respect to cell via-ility as the disintegration of the outer membrane rapidly stopsell division (van der Wal et al., 1995). Stationary phase dependentxpression was found to be an appropriate strategy to overcomehis drawback of BRP-mediated secretory protein production with. coli (Miksch et al., 1997a, 2008; Beshay et al., 2007). As an alter-ative approach, the PBAD promoter of the E. coli araBAD operonEnglesberg et al., 1969) was used in this work to allow arabinosenduced BRP expression with maximum adjustability. The PBAD pro-

oter is characterized by the capability of modulating expressiontrengths up to 2000-fold the level of basal expression using appro-riate concentrations of arabinose (Guzman et al., 1995). In theontext of expressing a potential cytotoxic protein such as BRP,his feature renders the PBAD promoter preferable compared tother prominent inducible promoters, e.g. that of the lacZYA operonJacob and Monod, 1961).

BRPs of different origins predominantly vary in the structure ofheir signal peptides (van der Wal et al., 1995). That is, the matureortions of the prominent BRPs of Cloacin DF13 and Colicin E1 differ

n only two of 28 amino acids (Yamada et al., 1982; Oudega et al.,984), rendering them functionally interchangeable with respecto bacteriocin release (Hakkaart et al., 1981). However, their SPshow considerable differences in proteolytic degradation posterioro SPase processing. The increased stability of the Cloacin DF13 BRPP causes a jamming of inner membrane Sec pores and an additionaleduction of cell viability. In contrast, an exchange of the nativey the unstable murein lipoprotein (Lpp) signal peptide (CloacinF13 LppBRP) was shown to reduce the BRP’s toxicity (Luirink et

l., 1991; van der Wal et al., 1998).

Using two distinct model proteins, the 46 kDa alkaline phos-hatase (AP) from E. coli and the 29 kDa �-lactamase (Bla), weave examined BRP-mediated protein secretion. Both enzymesere directed to the periplasm via the Sec pathway by either the

ragment from pCH40 This work

la fragment from This work

native Bla leader peptide or the N-terminal addition of the Blaleader peptide to the mature portion of AP (Hoffman and Wright,1985). Different BRP and different induction strategies were testedin order to optimize extracellular protein production.

2. Materials and methods

2.1. Bacterial strains

E. coli Top10 [F− mcrA �(mrr-hsdRMS-mcrBC) �80lacZ�M15�lacX74 recA1 araD139 �(ara-leu)7697 galU galK rpsL (StrR) endA1nupG] (Invitrogen, Paisley, UK) was used for molecular cloningprocedures. E. coli Ara1655 [�araBA (CmR)], a derivative of theprominent wild-type strain E. coli K12 MG1655 (Blattner et al.,1997), was constructed as a host for protein expression. In orderto abolish arabinose metabolism, the araA and araB genes weredeleted in Ara1655 through homologous recombination with thechloramphenicol resistance (CmR) mediating cat gene according tothe method of Hamilton et al. (1989). The complete strain construc-tion is described elsewhere (Sommer, 2008).

2.2. Vector construction

Molecular cloning procedures were performed using standardlaboratory techniques (Sambrook and Russell, 2001). The vectorsused and constructed in this work are listed in Table 1. All finalexpression vectors were derivatives of pBAD18-Kan (Guzman etal., 1995).

The construction of pBAD-LppBRPphoAbla required multiplesteps. Initially, the LppBRP gene from pJL17lpp (van der Walet al., 1998) was amplified by PCR using primers 1 and 2(Table 2). After cleavage with EcoRI and SalI the PCR productwas inserted downstream of PBAD into the EcoRI and SalI sitesof pBAD18-Kan yielding plasmid pBAD18-KanLppBRP. Then, a1.7 kb PCR fragment encoding alkaline phosphatase preceded by

the �-lactamase SP and controlled by Pbla was isolated fromplasmid pCH40 (Hoffman and Wright, 1985) using primers 3and 4 and cloned into pBAD18-KanLppBRP (Eco47III/NdeI) giv-ing pBAD-LppBRPphoA. Finally, pBAD-LppBRPphoAbla was createdby insertion of a 1.0 kb expression encoding Pbla followed by the

352 B. Sommer et al. / Journal of Biotechnology 145 (2010) 350–358

Table 2List of PCR primers used for vector construction and qRT-PCR.

No. Restriction site Sequence (5′ → 3′)a +/−b

1 EcoRI AAAGAATTCGGATGAGTTGAAATACAGG +2 SalI TTTGTCGACGCCAGTTACCTTCGGAAAAA −3 Eco47III TTTTAGCGCTTAATGGTTTCTTAGACGTCA +4 NdeI TTTAACATATGAAAAAACCAGACCGAAAAGC −5 NdeI TTTTTCATATGTTGTTTATTTTTCTAAATA +6 NdeI TTTTTCATATGGAAGTTTTAAATCAATCTA −7 NheI ACTGAGCTAGCGGATGAGTTGAAATACAGGC +8 SalI ACTGGTCGACTTAGTGATGGTGATGGT-GATGGTTAACCGCGATCCCCGTCAGTTC −9 NheI ACGTCGCTAGCTTTTATAAGGATCGAGTTATG +10 SalI TTTGTCGACGCCAGTTACCTTCGGAAAAA −11 – AGCTACTAAACTGGTACTG +

ATCC

oduce

bf5

ccgrLCEmapp

blpc

wB

2

sgvwoKFCHd

madtacacais

12 – CTAGTTAACCGCG

a Restriction sites are underlined. The bases of primer no. 8 typed in boldface intrb Orientation of primer annealing: (+) forward; (−) reverse.

la gene to pBAD-LppBRPphoA (NdeI). The cassette was isolatedrom pUC19 (Yanisch-Perron et al., 1985) by PCR with primersand 6.

On the basis of pBAD-LppBRPphoAbla, similar vectors wereonstructed for expression of other BRPs. pBAD-BRPphoAbla wasreated by PCR amplification of the native Cloacin DF13 BRPene (brp) from pJL3 using primers 7 and 2 and cloning of theaised 0.3 kb fragment into the NheI and SalI sites of pBAD-ppBRPphoAbla, thereby replacing the lppbrp gene. Similarly, theloacin DF13 LppBRP-His6 (lppbrphis6), as well as the Colicin1 BRP (kil) were cloned after obtaining 0.2 kb and 0.3 kb frag-ents from plasmids pJL17lpp and pColE1 with primer pairs 7/8

nd 9/10, respectively. The resulting plasmids were designatedBAD-LppBRP-His6phoAbla for the Cloacin DF13 LppBRP-His6 andBAD-KilE1phoAbla for the Colicin E1 BRP.

A BRP free reference plasmid pBAD18-KanPhoAbla was obtainedy a similar cloning procedure to that of pBAD-LppBRPphoAbla,

eaving out the first cloning step, i.e. insertion of the lppbrp intoBAD18-Kan at the EcoRI and SalI sites and starting directly withloning of the AP and bla expression cassettes.

All cloning steps were verified by sequencing the cloned regions,hich was carried out at the Sequencing Core Facility of CeBiTec,ielefeld University, Germany.

.3. Culture media, cultivation conditions and induction

Cultivation of E. coli for cloning purposes was performed onolid LB medium (Sambrook and Russell, 2001) or in a semi-definedlycerol medium as described previously (Voss et al., 2003). Culti-ations for analytical purpose, either in shake flasks or fermentor,ere carried out using a chemically defined medium composed

f (per l): 15 g glycerol; 5 g (NH4)2SO4; 6.62 g KH2PO4; 13.53 g2HPO4; 0.585 g MgSO4; 1.71 g citric acid; 8.4 mg EDTA; 10.8 mgeCl3·6 H2O; 2.76 mg ZnSO4·7 H2O; 3.7 mg MnSO4·H2O; 1.12 mgoSO4·7 H2O; 0.34 mg CuCl2; 2.0 mg H3BO3; 5.0 mg Na2MoO4·22O (pH 7.0). The concentrations of glycerol and (NH4)2SO4 wereoubled in bioreactor cultivations.

For shake flask cultivation 1 l shake flasks filled with 0.15 l ofedium were used. Fermentations were carried out in a 7 l biore-

ctor (MBR, Wetzikon, Switzerland) with a working volume of 5 l. Aissolved oxygen concentration of 60% saturation was controlled byhe stirrer speed starting from 200 min−1 and the space velocity oferation was set to 1 vvm. The pH and temperature were automati-ally adjusted to 7.0 and 37 ◦C, respectively. 2 M sodium hydroxide

nd 2 M sulfuric acid were applied for pH correction. Foaming wasounteracted by automatic addition of Pluronic PE-8100 antifoamgent (BASF, Ludwigshafen, Germany). Exhaust gas carbon diox-de concentration was monitored by means of a URAS10E analysisystem (Hartmann & Braun, Frankfurt, Germany). Samples were

−a hexahistidin extension to the C-terminus of Cloacin DF13 LppBRP.

withdrawn automatically and chilled to 2 ◦C until further process-ing.

Both shake flask and bioreactor cultivations were inoculated toan initial OD600 of 1.0 with over-night shake flask cultures madefrom the same medium and incubated at 37 ◦C on a rotary shaker atan agitation frequency of 160 min−1 (eccentricity 2.5 cm). In biore-actor cultivations preculture volumes were reduced to 50 ml bycentrifugation for 5 min at 5000 × g. Final cultures were supple-mented with 100 mg l−1 of kanamycin, precultures with 50 mg l−1

of kanamycin.Taking into account the cell density at the point of induction,

BRP expression was induced by the addition of an OD600-referred arabinose concentration (specific inducer concentration)of 0–1000 mg l−1 (approximately 0–0.35 g l−1 g−1 arabinose pervolume per cell dry mass).

2.4. Determination of cell density and dry mass concentration

Cell growth was monitored spectrophotometrically at 600 nm(OD600) by measuring the absorption of the culture. Cell dry masswas determined gravimetrically. In short, the cells of 2 ml culturevolume were harvested by centrifugation in tared reaction tubes(5 min; 15,000 × g), washed with 1 ml of 9 g l−1 NaCl and vacuumdried at 60 ◦C for 24 h. The dry mass was calculated by the massdifference. In the absence of BRP coexpression, one OD600 unit wasdetermined to be equivalent to 0.35 g l−1 of cell dry mass for theE. coli strains Ara1655 pBAD-LppBRPphoAbla and Ara1655 pBAD-LppBRP-His6phoAbla cultivated in the bioreactor in chemicallydefined medium.

2.5. Cell separation and disruption

Cultures were separated into intra- and extracellular fractionsaccording to the method of Khosla and Bailey (1989). In short,2 ml of culture volume were centrifuged for 5 min at 15,000 × g.The supernatant was kept as the extracellular/medium fraction.Cells were resuspended in 2 ml of a solution containing 0.2 M Tris(pH 8.0), 200 g l−1 sucrose and 0.1 M EDTA. After inclined shakingfor 20 min, cells were harvested by centrifugation for 15 min at15,000 × g and resuspended in 2 ml of a second solution containing10 mM Tris (pH 8.0) and 5 mM MgSO4. Subsequent to an inclinedshaking incubation step on ice for 10 min, spheroplasts were pel-leted by centrifugation (10 min; 5000 × g; 4 ◦C) and the supernatant

was kept as the periplasmic fraction. Spheroplasts were dissolved in2 ml of the second solution and disrupted by ultrasonication usinga Branson Sonifier 450 in cycles of 20 s sonication and 20 s chillingon ice. The cycles were repeated until the solution was transparent.Cell debris was removed by centrifugation (10 min; 15,000 × g) and

iotechnology 145 (2010) 350–358 353

taTtp

2

m(r[s41brt

2

sNdpwaa

fiap

2

em(M1wsmado

2

CuRtoRS

2e

o

Fig. 1. Genetic organization of the pBAD18-Kan derived vectors for constitutiveexpression of the model proteins AP (phoA) and Bla (bla) and controllable BRP (brp)expression. Both, AP and Bla are expressed from the constitutive Pbla promoter anddirected to the periplasm by the Sec-dependent Bla signal peptide (SPbla). Two dif-ferent native BRP (Colicin E1 and Cloacin DF13) and two modified BRPs (CloacinDF13 LppBRP and Cloacin DF13 LppBRP-His6) are compared (see text). Its expres-sion from the arabinose-adjustable promoter PBAD is controlled by the AraC regulator

B. Sommer et al. / Journal of B

he supernatant was kept as the cytoplasmic fraction. Periplasmicnd cytoplasmic fractions were combined as intracellular fraction.his method showed a higher reproducibility than cell disrup-ion by exclusive ultrasonication. Cell debris contained cyto- anderiplasmic membranes and was used for BRP analyses.

.6. Quantitation of AP activity

AP activity was quantified using a modified protocol of theethod of Torriani and Rothman (1961). 650 �l of reaction buffer

1 M Tris–HCl [pH 8.0]; 1 mM MgCl2) were mixed with 250 �l ofeagent (14.5 mM p-nitrophenyl phosphate [pNPP] in 1 M NaHCO3pH 8.0]). The reaction was started by the addition of 100 �l ofample. pNPP hydrolysis was monitored spectrophotometrically at05 nm. One unit is defined as the amount of AP which hydrolyzes�mol of pNPP per minute. Host cell AP activity was proven toe below the assay’s detection limit and did not interfere withecombinant AP activity. AP concentrations were calculated fromhe specific activity of 60 U mg−1 (Mandecki et al., 1991).

.7. Quantitation of ˇ-lactamase activity

�-Lactamase activity was quantified using the chromophoricubstrate NitrocefinTM (Calbiochem, San Diego, CA). 10 mg ofitrocefinTM were dissolved in 1 ml of dimethyl sulfoxide andiluted to 20 ml with phosphate buffer (0.1 M potassium phos-hate; 1 mM EDTA; pH 7.0) to obtain a final reagent. The reactionas started by adding 50 �l of sample to 750 �l of the final reagent

nd monitored spectrophotometrically at 486 nm (O’Callaghan etl., 1972).

�-Lactamase activity was calculated using an adsorption coef-cient of ε486 = 20.5 ml �mol−1 cm−1. One unit is defined as themount of �-lactamase which hydrolyzes 1 �mol of NitrocefinTM

er minute.

.8. Quantitation of ˇ-galactosidase activity

�-Galactosidase was used as a cytoplasmic marker protein forvaluation of cell lysis. Activity was quantified using the chro-ophoric substrate o-nitrophenyl-�-d-galactopyranosid (ONPG)

Sigma–Aldrich, Munich, Germany) according to the method ofiller (1972). 900 �l of Z buffer (0.1 M sodium phosphate [pH 7.0];

0 mM KCl; 1 mM MgSO4; 50 mM 2-mercaptoethanol) were mixedith 200 �l of substrate (4 mg ml−1 in Z buffer). The reaction was

tarted by adding 200 �l of sample and monitored spectrohoto-etrically at 420 nm. �-Galactosidase activity was calculated using

n adsorption coefficient of ε420 = 21.3 ml �mol−1 cm−1. One unit isefined as the amount of �-galactosidase which hydrolyzes 1 �molf ONPG per minute.

.9. Quantitation of relative BRP transcription level by qRT-PCR

Real-time RT-PCR was used to quantify the relative amounts ofloacin DF13 LppBRP-His6 transcripts. First, total RNA was isolatedsing the Qiagen RNeasy Mini Kit in combination with the QiagenNase-Free DNAse set, following the guidelines of the manufac-urer (Qiagen, Hilden, Germany). Then, qRT-PCR was performedn a Rotor-Gene 3000 Real-Time Multiplexing System (Corbettesearch, Sydney, Australia) by means of the Qiagen QuantiTectYBR Green RT-PCR Kit using primers 11 and 12 (Table 2).

.10. Sodium dodecyl sulphate polyacrylamide gellectrophoresis (SDS-PAGE) and immunoblotting

SDS-PAGE analyses were performed according to the methodf Schägger and von Jagow (1987) using Tris–Tricine gels. Proteins

protein. A further vector without a BRP was used as a negative control. phoAm andblam encode for the mature parts (without SP) of AP and Bla, respectively. Featuresizes are not true to scale. See Tables 1 and 3 for a detailed description of the vectorsencoding the different BRPs.

were separated in pre-cast Novex® 16% Tricine gels using the cor-responding Novex® Tricine SDS Running Buffer and operated in aXCell SureLockTM electrophoresis system following the guidelinesof the manufacturer (all products provided by Invitrogen, Paisley,UK). As a molecular mass standard, PageRulerTM Prestained ProteinLadder (Fermentas, St. Leo-Rot, Germany) was chosen.

Western transfer to a polyvinylidene fluoride membrane (RothGmbH, Karlsruhe, Germany) and immunodetection were carriedout in accordance with standard laboratory methods (Sambrookand Russell, 2001). Cloacin DF13 LppBRP-His6 was detected by aprimary Penta His Antibody (Qiagen, Hilden, Germany) and a sec-ondary Anti-Mouse IgG AP conjugated antibody (Sigma–Aldrich,Munich, Germany). Western blots were developed using theBCIP/NBT substrate system (Sigma–Aldrich, Munich, Germany).

3. Results and discussion

3.1. Construction of expression vectors

A set of vectors that allowed expression of different BRP and tar-get proteins was originated from the basis of pBAD18-Kan (Guzmanet al., 1995). In order to avoid a mutual influence, the vectors com-prised two independent, oppositely oriented expression units forBRPs and model proteins, respectively. As shown in Fig. 1, expres-sion and export of the model enzymes AP (Hoffman and Wright,1985) and Bla (Yanisch-Perron et al., 1985) were controlled by theconstitutive Pbla promoter in combination with the Sec-dependentbla signal peptide. BRP expression was regulated by the PBAD pro-moter of the E. coli araBAD operon (Englesberg et al., 1969) andL-arabinose adjustable. Two native BRPs, the Cloacin DF 13 BRPand the Colicin E1 BRP as well as a modified Cloacin DF13 BRPfor which the original SP is exchanged by the unstable SP of themurein lipoprotein Lpp (Cloacin DF13 LppBRP) were compared.In addition, a further derivative with a C-terminal hexahistidintag (Cloacin DF13 LppBRP-His6), which allowed straightforwardimmunological detection, was established. A vector without a BRPgene downstream of PBAD was employed as a negative control.

3.2. Comparison of different native and modified BRPs

The applicability of different BRP with respect to extracellularprotein production was analyzed by comparison of their function-

354 B. Sommer et al. / Journal of Biotechnology 145 (2010) 350–358

Table 3Overview of the BRP variants and their plasmid background. Four different BRP, two native and two modified BRP, were analyzed and compared to a BRP free reference.

Plasmid BRP SP His6-tag Plasmid size (kb)

pBAD18-KanPhoAbla – – − 7.86

amtBwc

ocdwacae

Fcdi1

pBAD-KilE1phoAbla Colicin E1 BRPpBAD-BRPphoAbla Cloacin DF13 BRPpBAD-LppBRPphoAbla Cloacin DF13 LppBRPpBAD-LppBRP-His6phoAbla Cloacin DF13 LppBRP-His6

lity, i.e. their ability to enhance protein release into the cultureedium, as well as their toxicity, i.e. their disturbing effect on bac-

erial growth. The goal of these analyses was to identify a favorableRP for further in-depth optimization. Therefore, E. coli Ara1655as equipped with the BRP expression vectors listed in Table 3 and

ultivated in shake flasks.Fig. 2 shows the behavior of these E. coli strains upon induction

f BRP expression with varying specific (OD600-normalized) con-entrations of the inducer arabinose in the range of 0–1000 mg l−1

uring exponential growth phase. In general, only slight differencesere observed for the different BRP, concerning both functionality

nd toxicity (Fig. 2A–D). For all tested BRP, specific inducer con-entrations above 10 mg l−1 of arabinose brought about a stop orstrong attenuation of the bacterial growth, respectively. How-

ver, substitution of the original Cloacin DF13 BRP signal peptide

ig. 2. Growth and secretory protein production of E. coli expressing different native and gompared to the SP modified Cloacin DF13 LppBRP (c) and a further His6-tagged variant teensity at 600 nm (open symbols) and secretion is displayed by the extracellular AP act

nducer concentrations of 0–1000 mg l−1 of arabinose. Cultivations of E. coli Ara1655 equ5% of a chemically defined medium.

Native − 8.13Native − 8.13Lpp − 8.13Lpp + 8.07

(Fig. 2A) by the unstable Lpp SP of Cloacin DF13 LppBRP (Fig. 2C)slightly increased the tolerance to BRP expression, as demonstratedby a weaker influence on the cultures optical densities. Especiallyat critical specific arabinose concentrations of 10–50 mg l−1 growthwas less perturbed with the SP modified BRP variant. A comparisonof the Cloacin DF13 LppBRP (Fig. 2C) and its derivative Cloacin DF13LppBRP-His6 (Fig. 2C) revealed that the C-terminal His6 extension,did neither significantly affect functionality nor toxicity.

For all of the four BRPs, optimal conditions were determined atspecific inducer concentrations of 5–10 mg l−1 arabinose, allowinga continuous AP secretion upon maintenance of bacterial growth,

albeit at reduced velocity (Fig. 2A–D). While entering the stationaryphase, the extracellular AP activity ranged from 10.5 to 12.2 U ml−1,revealing a difference in efficiency of less then 14% for all four BRPs.This observation can be explained by the similarity of the BRP’s

enetically modified BRP. The native BRP of Cloacin DF13 (a) and Colicin E1 (b) werermed Cloacin DF13 LppBRP-His6 (d). Growth is documented by the culture’s opticalivity (filled symbols). BRP expression was induced at various levels using specificipped with the vectors listed in Table 3 were carried out in shake flasks filled with

B. Sommer et al. / Journal of Biotechnology 145 (2010) 350–358 355

Table 4Distribution of AP and Bla at the end of cultivation (depletion of glycerol) in dependence of the inducer concentration applied. See Fig. 3 for related data [�ara,spec, specificarabinose concentration; tf , time of final substrate depletion; aint/aext/atot, intra-/extracellular/total activity].

�ara,spec. (mg l−1) tf (h) Alkaline phosphatase �-Lactamase

aint (U ml−1) aext (U ml−1) atot (U ml−1) aint (U ml−1) aext (U ml−1) atot (U ml−1)

No BRP 11 36.1 (79%) 9.4 (21%) 45.5 (100%) 26.9 (65%) 14.5 (35%) 41.4 (100%)0 10 32.8 (79%) 8.9 (21%) 41.7 (100%) 29.8 (65%) 15.9 (35%) 45.7 (100%)1 11 29.6 (66%) 15.1 (34%) 44.7 (100%) 20.8 (50%) 20.4 (50%) 41.2 (100%)5 13 12.3 (29%) 30.5 (71%) 42.8 (100%) 11.5 (26%) 33.2 (74%) 44.7 (100%)10 18 2.7 (10%) 24.9 (90%) 27.6 (100%) 2.0 (5%) 36.1 (95%) 38.1 (100%)1000 22 1.2 (12%) 9.1 (88%) 10.3 (100%) 0.3 (2%) 12.7 (98%) 13.0 (100%)

Fig. 3. Distribution of AP and Bla between cells and medium. Coexpression of the Cloacin DF13 LppBRP-His6 was induced with varying specific (OD600-normalized) arabinoseconcentrations in the range of 1–1000 mg l−1 (C–F), or kept non-induced as a control (A/B) [E. coli Ara1655 pBAD-LppBRP-His6phoAbla; 5 l of chemically defined medium; 7 lbioreactor].

3 iotechnology 145 (2010) 350–358

maeqocLt

3p

uatcwwbsA

sdptobfipnsidcc

tw(t

7Eo

iaei3cws9HppsTa

me

Fig. 4. Kinetics of BRP expression and protein secretion after strong induction. (a)BRP expression and protein secretion were monitored quantitatively by qRT-PCR

56 B. Sommer et al. / Journal of B

ature parts, which act on the cell’s outer membranes and is inccordance with the functional interchangeability of BRP shownarlier for the release of bacteriocins (Hakkaart et al., 1981). Conse-uently, a BRP’s SP does not significantly affect cell viability and allf the BRPs analyzed were found to be equally suitable for extra-ellular protein expression. For further analysis the Cloacin DF13ppBRP-His6 was chosen due to its slightly decreased toxicity andhe simplified detectability provided by the His6-tag.

.3. Fine-tuning of BRP coexpression for optimized extracellularrotein production

After showing the applicability of the PBAD promoter for the reg-lation of BRP expression, the dependence of BRP expression levelnd efficiency of protein secretion was analyzed in bioreactor cul-ivations, allowing maximum reproducibility and maintenance ofultivation conditions. E. coli Ara1655 pBAD-LppBRP-His6phoAblaas cultivated in chemically defined medium and BRP expressionas induced at 5 h of cultivation at an optical density of OD600 ∼5–6

y the addition of arabinose, as shown in Fig. 3. The efficiency ofecretion was evaluated by the distribution of the model proteinsP and Bla between cells and medium.

Two negative controls, one without induction of BRP expres-ion (Fig. 3B) and one without even the presence of a BRP geneownstream of PBAD (Fig. 3A) revealed the extent of spontaneousrotein release and the potential effect of basal BRP expression onhe secretion of AP and Bla. At the end of cultivation, i.e. the timef substrate depletion, the model proteins were equally distributedetween cells and medium in both controls, with an extracellularraction of 21% for AP and 35% for Bla, respectively (Table 4). Thisndicates the predominant intracellular localization of both modelroteins, as well as the tight repression of the PBAD promoter andegligible basal BRP expression in the absence of arabinose. Duringtationary phase, enzyme localization continuously shifted fromntra- to extracellular for both controls (Fig. 3A and B). Since theecrease of intracellular activity outweighed the increase of extra-ellular activity, the resulting loss of total activity was explained byombined proteolytic degradation and cell lysis (see below).

Upon induction of BRP coexpression, enforced relocation ofhe model proteins towards the culture medium was obtainedith increasing inducer concentrations. Using 1 mg l−1 of arabinose

Fig. 3C and Table 4), 21% of AP and 35% of Bla were released intohe culture medium at final substrate depletion.

With 5 mg l−1 of arabinose (Fig. 3D and Table 4), 71% of AP and4% of Bla were secreted and applying 10 mg l−1 of arabinose (Fig. 3and Table 4), the extracellular fractions could be raised to 90% (AP)r 95% (Bla), respectively.

Nevertheless, process time was stringently dependent on thentensity of BRP coexpression. Strong induction (1000 mg l−1 ofrabinose) provoked a full breakdown of bacterial growth, proteinxpression and, hence, secretory protein production, as presentedn Fig. 3F. Consequently, maximum extracellular activities of0.5 U ml−1 (AP) and 33.2 U ml−1 (Bla) were achieved at a spe-ific inducer concentration of 5 mg l−1 of arabinose (Table 4),hich allowed efficient secretion without abolishing cell divi-

ion, whereas at full induction (1000 mg l−1 of arabinose), only.1 U ml−1 (AP) and 12.7 U ml−1 (Bla) were released from the cells.ence, the optimum BRP expression level was found to be a com-romise between maximum protein release and minimum growtherturbation. Although inhibiting cultivation, strong BRP expres-ion obviously permits rapid secretion of synthesized AP and Bla.

his observation was investigated in more detail by a kineticpproach.

As an indicator of cell lysis, the distribution of the cytoplas-ic enzyme �-galactosidase between cells and medium has been

valuated. Even after strongly induced BRP expression (1000 mg l−1

and extracellular AP/Bla activity, respectively. (b) Qualitative tracking of the CloacinDF13 LppBRP-His6 was achieved by immunoblotting. Diffuse banding in the Westernblot is caused by residual membrane fragments attached to the BRP. BRP expressionand protein secretion were analyzed within the bioreactor culture shown in Fig. 3F.

of arabinose,), �-galactosidase was strictly located inside the cellswith consistently more than 98% of cellular activity, indicating thatcell lysis did not occur to a significant extent (data not shown).Solely for the non-induced control culture, a slight relocationtowards the medium was observed during late stationary phase (upto 10% extracellular �-galactosidase activity). This explained boththe decrease of biomass concentration and the continuous releaseof AP and Bla during this period (cf. Fig. 3B).

3.4. Kinetics of BRP expression and protein secretion upon stronginduction

In order to evaluate the kinetics of extracellular protein release,BRP expression and protein secretion were monitored during theperiod immediately after addition of a specific inducer concentra-tion of 1000 mg l−1 of arabinose. Fig. 4 A shows the course of BRPexpression by tracking both, its mRNA and peptide. Protein secre-tion is given in Fig. 4B by means of the extracellular AP and Blaactivities. The relative Cloacin DF13 LppBRP-His6 transcript levelincreased significantly within the first two minutes after arabinoseaddition and reached a maximum at 10 min past induction (Fig. 4A).Consequently, the Cloacin DF13 LppBRP-His6 was detected withinthe cell membranes at 2 min after induction (Fig. 4B). Protein secre-tion traceably started with a short delay at 5–10 min after induction,documented by increasing extracellular AP and Bla activities andreached a maximum at trel = 15–20 min, simultaneously with incip-ient growth inhibition (Fig. 4B). Since the extracellular activitiesentered a steady state at approximately one hour after induction,most of AP and Bla were obviously secreted at this time.

Thus, rapid and strong induction of BRP expression, potentiallyaccounting for a short-termed efficient protein release at the end ofa fermentation process, was supposed to be a suitable alternativeto fine-tuned BRP expression accompanying the entire cultivationprocess.

3.5. Rapid protein secretion at final biomass concentrations

The efficiency of secretory protein production was investigatedin the context of strong BRP expression at maximum biomass con-centrations. BRP expression was induced with a specific inducerconcentration sufficient for full induction (∼100 mg l−1 of arabi-

B. Sommer et al. / Journal of Biotechnology 145 (2010) 350–358 357

F point1 togethA tor].

n1ttsseschAttp

3

ecauodlfFFiTtu4era

4

fBtdsm

ig. 5. Strong induction of BRP expression at final biomass concentration. (a) The1.33 h representing the final substrate depletion. (b) Distribution of AP activityra1655 pBAD-LppBRP-His6phoAbla; 5 l of chemically defined medium; 7 l bioreac

ose) immediately after the point of final substrate depletion at1.33 h of cultivation, as indicated by the exhaust gas CO2 concen-ration (Fig. 5). A glycerol concentration of 5 g l−1 was providedogether with the inducer, in order to ensure sufficient energyupply for BRP synthesis and export. The provision of additionalubstrate caused a temporal increase of cell respiration until BRPxpression reached a toxic level. Prior to induction 77% of theynthesized AP was located inside the cells but within one houronditions changed showing 72% of AP in the culture medium. Twoours later, a steady state was reached, at which the extracellularP fraction was found to be 89%. The correlation of protein secre-

ion with BRP expression was confirmed by the strong increase ofhe relative Claocin DF13 LppBRP-His6 transcript level during thiseriod.

.6. Fine-tuned versus strong BRP coexpression

Under the conditions used, both fine-tuned and strong BRPxpression were found to be similarly applicable regarding extra-ellular protein expression. A fairly quantitative release of AP withn extracellular fraction of 89% through 90%, was achieved bysing either optimized specific inducer concentrations of 10 mg l−1

f arabinose or strong induction (∼100 mg l−1), respectively (dataerived from Fig. 3E and Fig. 5B). Similarly, the calculated extracel-

ular AP concentrations were in a comparable range of 508.3 mg l−1

or fine-tuned induction with 5 mg l−1 of arabinose (derived fromig. 3D) to 541.7 mg l−1 for strong, late induction (derived fromig. 5B), respectively. Calculations are based on a specific activ-ty of alkaline phosphatase of 60 U mg−1 (Mandecki et al., 1991).aking into account the underlying dry biomass concentration athese conditions, the process selectivity, i.e. the amount of prod-ct generated per amount of dry biomass, was in the range of7.1–52.4 mg g−1 for both strategies. In comparison to strong BRPxpression, optimized induction necessitates less of arabinose, butequires extensive optimization in order to determine an appropri-te inducer concentration.

. Concluding remarks

Regulated BRP coexpression was found to be a suitable approachor efficient extracellular protein production with E. coli. Different

RPs were equally applicable for secretory protein expression asheir mature portions are highly conserved and the signal peptidesid not significantly affect functionality. An adequate BRP expres-ion mode compromised between maximum protein release andinimum growth disturbance. Hence, BRP coexpression either had

of induction was indicated by the decrease of exhaust gas CO2 concentration ater with Cloacin DF13 LppBRP-His6 expression before and after induction [E. coli

to be fine-tuned to an optimized level, or needed to be decoupledfrom the growth process and induced strongly at the end of cul-tivation. Both methods accounted for a fairly complete release ofthe target proteins (at least 90% extracellular fraction) with extra-cellular alkaline phosphatase concentrations of roughly 500 mg l−1

and similar process selectivities of approximately 50 mg productprotein per gram of cell dry mass. Since efficient BRP expression rig-orously slows microbial growth and requires extensive fine-tuning,strong induction at final biomass concentrations probably is favor-able under most conditions, especially in large scale productionprocesses which are usually long-term, high cell density fermenta-tion.

Acknowledgements

This work was funded by the German Research Foundation(Deutsche Forschungsgemeinschaft, DFG; project FR 837/3). Theirsupport is gratefully acknowledged. pJL17lpp DNA was a kind gift ofB. Oudega from the Vrije Universiteit Amsterdam, The Netherlands.

References

Achmuller, C., Kaar, W., Ahrer, K., Wechner, P., Hahn, R., Werther, F., Schmidinger, H.,Cserjan-Puschmann, M., Clementschitsch, F., Striedner, G., Bayer, K., Jungbauer,A., Auer, B., 2007. N(pro) fusion technology to produce proteins with authenticN termini in E. coli. Nat. Methods 4, 1037–1043.

Berks, B.C., Palmer, T., Sargent, F., 2005. Protein targeting by the bacterial twin-arginine translocation (Tat) pathway. Curr. Opin. Microbiol. 8, 174–181.

Beshay, U., Miksch, G., Friehs, K., Flaschel, E., 2007. Increasing the secretion abilityof the kil gene for recombinant proteins in Escherichia coli by using a strongstationary-phase promoter. Biotechnol. Lett. 29, 1893–1901.

Blattner, F.R., Plunkett III, G., Bloch, C.A., Perna, N.T., Burland, V., Riley, M.,Collado-Vides, J., Glasner, J.D., Rode, C.K., Mayhew, G.F., Gregor, J., Davis, N.W.,Kirkpatrick, H.A., Goeden, M.A., Rose, D.J., Mau, B., Shao, Y., 1997. The completegenome sequence of Escherichia coli K-12. Science 277, 1453–1474.

Bowden, G.A., Paredes, A.M., Georgiou, G., 1991. Structure and morphology of proteininclusion bodies in Escherichia coli. Biotechnology (NY) 9, 725–730.

Choi, J.H., Lee, S.Y., 2004. Secretory and extracellular production of recombinantproteins using Escherichia coli. Appl. Microbiol. Biotechnol. 64, 625–635.

Dekker, N., Tommassen, J., Verheij, H.M., 1999. Bacteriocin release protein trig-gers dimerization of outer membrane phospholipase A in vivo. J. Bacteriol. 181,3281–3283.

Economou, A., 1999. Following the leader: bacterial protein export through the Secpathway. Trends Microbiol. 7, 315–320.

Englesberg, E., Squires, C., Meronk Jr., F., 1969. The L-arabinose operon in Escherichiacoli B-r: a genetic demonstration of two functional states of the product of aregulator gene. Proc. Natl. Acad. Sci. U.S.A. 62, 1100–1107.

Gottesman, S., 1996. Proteases and their targets in Escherichia coli. Annu. Rev. Genet.

30, 465–506.

Graumann, K., Premstaller, A., 2006. Manufacturing of recombinant therapeutic pro-teins in microbial systems. Biotechnol. J. 1, 164–186.

Guzman, L.M., Belin, D., Carson, M.J., Beckwith, J., 1995. Tight regulation, modulation,and high-level expression by vectors containing the arabinose PBAD promoter. J.Bacteriol. 177, 4121–4130.

3 iotech

H

H

H

J

K

L

L

M

M

M

M

M

M

O

Yamada, M., Ebina, Y., Miyata, T., Nakazawa, T., Nakazawa, A., 1982. Nucleotide-

58 B. Sommer et al. / Journal of B

akkaart, M.J., Veltkamp, E., Nijkamp, H.J., 1981. Protein H encoded by plasmid CloDF13 involved in lysis of the bacterial host. I. Localisation of the gene and iden-tification and subcellular localisation of the gene H product. Mol. Gen. Genet.183, 318–325.

amilton, C.M., Aldea, M., Washburn, B.K., Babitzke, P., Kushner, S.R., 1989. Newmethod for generating deletions and gene replacements in Escherichia coli. J.Bacteriol. 171, 4617–4622.

offman, C.S., Wright, A., 1985. Fusions of secreted proteins to alkaline phosphatase:an approach for studying protein secretion. Proc. Natl. Acad. Sci. U.S.A. 82,5107–5111.

acob, F., Monod, J., 1961. Genetic regulatory mechanisms in the synthesis of pro-teins. J. Mol. Biol. 3, 318–356.

hosla, C., Bailey, J.E., 1989. Evidence for partial export of Vitreoscilla hemoglobininto the periplasmic space in Escherichia coli—implications for protein function.J. Mol. Biol. 210, 79–89.

uirink, J., de Graaf, F.K., Oudega, B., 1987. Uncoupling of synthesis and release ofcloacin DF13 and its immunity protein by Escherichia coli. Mol. Gen. Genet. 206,126–132.

uirink, J., Duim, B., de Gier, J.W., Oudega, B., 1991. Functioning of the stable signalpeptide of the pCloDF13-encoded bacteriocin release protein. Mol. Microbiol. 5,393–399.

andecki, W., Shallcross, M.A., Sowadski, J., Tomazic-Allen, S., 1991. Mutagenesis ofconserved residues within the active site of Escherichia coli alkaline phosphataseyields enzymes with increased kcat. Protein Eng. 4, 801–804.

ergulhao, F.J., Summers, D.K., Monteiro, G.A., 2005. Recombinant protein secretionin Escherichia coli. Biotechnol. Adv. 23, 177–202.

iksch, G., Fiedler, E., Dobrowolski, P., Friehs, K., 1997a. The kil gene of the ColE1plasmid of Escherichia coli controlled by a growth-phase-dependent promotermediates the secretion of a heterologous periplasmic protein during the station-ary phase. Arch. Microbiol. 167, 143–150.

iksch, G., Neitzel, R., Fiedler, E., Friehs, K., Flaschel, E., 1997b. Extracellular produc-tion of a hybrid beta-glucanase from Bacillus by Escherichia coli under differentcultivation conditions in shaking cultures and bioreactors. Appl. Microbiol.Biotechnol. 47, 120–126.

iksch, G., Ryu, S., Risse, J.M., Flaschel, E., 2008. Factors that influence the extra-cellular expression of streptavidin in Escherichia coli using a bacteriocin releaseprotein. Appl. Microbiol. Biotechnol. 81, 319–326.

iller, J.H., 1972. Assay of beta-galactosidase. In: Miller, J.H. (Ed.), Experiments inMolecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,pp. 352–355.

’Callaghan, C.H., Morris, A., Kirby, S.M., Shingler, A.H., 1972. Novel method fordetection of beta-lactamases by using a chromogenic cephalosporin substrate.Antimicrob. Agents Chemother. 1, 283–288.

nology 145 (2010) 350–358

Oudega, B., Ykema, A., Stegehuis, F., Degraaf, F.K., 1984. Detection and subcellularlocalization of mature protein H, involved in excretion of cloacin DF13. FEMSMicrobiol. Lett. 22, 101–108.

Sabik, J.F., Suit, J.L., Luria, S.E., 1983. cea-kil operon of the ColE1 plasmid. J. Bacteriol.153, 1479–1485.

Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, 3rd edn.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Schägger, H., von Jagow, G., 1987. Tricine-sodium dodecyl sulfate-polyacrylamidegel electrophoresis for the separation of proteins in the range from 1 to 100 kDa.Anal. Biochem. 166, 368–379.

Shokri, A., Sanden, A.M., Larsson, G., 2003. Cell and process design for targeting ofrecombinant protein into the culture medium of Escherichia coli. Appl. Microbiol.Biotechnol. 60, 654–664.

Snijder, H.J., Kingma, R.L., Kalk, K.H., Dekker, N., Egmond, M.R., Dijkstra, B.W., 2001.Structural investigations of calcium binding and its role in activity and activa-tion of outer membrane phospholipase A from Escherichia coli. J. Mol. Biol. 309,477–489.

Sommer, B., 2008. Novel strategies for the extracellular production of recombinantproteins with Escherichia coli. Ph.D. Thesis. Bielefeld University.

Sommer, B., Friehs, K., Flaschel, E., Reck, M., Stahl, F., Scheper, T., 2009. Extracellularproduction and affinity purification of recombinant proteins with Escherichiacoli using the versatility of the maltose binding protein. J. Biotechnol. 140, 194–202.

Torriani, A., Rothman, F., 1961. Mutants of Escherichia coli constitutive for alkalinephosphatase. J. Bacteriol. 81, 835–836.

van der Wal, F.J., Koningstein, G., ten Hagen, C.M., Oudega, B., Luirink, J., 1998.Optimization of bacteriocin release protein (BRP)-mediated protein release byEscherichia coli: random mutagenesis of the pCloDF13-derived BRP gene touncouple lethality and quasi-lysis from protein release. Appl. Environ. Microbiol.64, 392–398.

van der Wal, F.J., Luirink, J., Oudega, B., 1995. Bacteriocin release proteins: modeof action, structure, and biotechnological application. FEMS Microbiol. Rev. 17,381–399.

Voss, C., Schmidt, T., Schleef, M., Friehs, K., Flaschel, E., 2003. Production of super-coiled multimeric plasmid DNA for biopharmaceutical application. J. Biotechnol.105, 205–213.

sequence of the structural gene for colicin-E1 and predicted structure of theprotein. Proc. Natl. Acad. Sci. U.S.A. 79, 2827–2831.

Yanisch-Perron, C., Vieira, J., Messing, J., 1985. Improved M13 phage cloning vectorsand host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.Gene 33, 103–119.