Effects of Estradiol and Progesterone on theReproduction of the Freshwater Crayfish

Cherax albidus

E. COCCIA1, E. DE LISA1, C. DI CRISTO1, A. DI COSMO2, AND M. PAOLUCCI1,*1Department of Biological and Environmental Sciences, Faculty of Sciences, University of Sannio,Via Port’Arsa, 11-82100 Benevento, Italy; and 2Department of Structural and Functional Biology,

University of Naples “Federico II,” Via Cinthia, 80126 Napoli, Italy

Abstract. In this study we have investigated the role of17�-estradiol and progesterone in the reproduction of thecrayfish Cherax albidus by using vitellogenin (VTG) as abiomarker. Early-vitellogenic (EV), full-vitellogenic (FV),and non-vitellogenic (NV) females of Cherax albidus weretreated with 17�-estradiol, progesterone, or both for 4weeks. Levels of VTG mRNA in the hepatopancreas weredetected by RT-PCR. The PCR product was sequenced andshowed 97% homology with Cherax quadricarinatus VTG.17�-estradiol was more effective than progesterone and17�-estradiol plus progesterone in increasing the vitelloge-nin transcript in the hepatopancreas of EV and FV females.On the contrary, progesterone was more effective than 17�-estradiol and 17�-estradiol plus progesterone in increasingthe vitellogenin concentration in the hemolymph of EV andFV females. Hepatopancreas histology and fatty acid com-position of females injected with hormones showed majormodifications. No effects were registered in NV females. Inconclusion, 17�-estradiol and progesterone influence VTGsynthesis, although our data indicate that they act throughdifferent pathways and are not effective until the properhormonal environment is established, as demonstrated bytheir inefficacy in NV females.

Introduction

Reproductive physiology in crustaceans is highly con-trolled and regulated by the nervous and endocrine systems

(Engelmann, 1994). Endocrine control of female reproduc-tion is governed by a variety of hormonal and neuronalfactors that involve neuropeptide hormones, such as gonad-stimulating hormone (GSH) and vitellogenesis-inhibitinghormone (VIH); terpenoids, such as methyl farnesoate, astimulator of vitellogenesis; ketosteroids, such as ecdy-steroids; and finally sex steroids such as estradiol and pro-gesterone (Huberman, 2000; Zapata et al., 2003). Ecdy-steroids are the primary hormonal factors of molting andpositively affect vitellogenesis also (Subramoniam, 2000).Crustacean ecdysteroids are very polar molecules, and thereis no evidence for carrier proteins in the hemolymph. How-ever, nucleotide sequences responsive to DNA binding do-main (DBD) of steroid receptors have been found in theDNA of Metapenaeus ensis, providing evidence that ste-roids, upon the binding to specific receptors, activate thetranscription of specific genes (Chan, 1998).

Vertebrate-type steroids have been reported to be presentin the hepatopancreas, ovary, and hemolymph of crusta-ceans, their levels changing in correlation with the oocytematuration cycle (Lafont and Mathieu, 2007 for review).Indeed, a positive correlation between vitellogenin (VTG)circulating levels and hemolymph levels of progesteroneand 17�-estradiol have been reported for crabs (Shih, 1997;Warrier et al., 2001; Zapata et al., 2003) and shrimps(Quinitio et al., 1994; Yano, 2000). Moreover, the stimula-tory effects of some vertebrate-type steroids such as 17�-estradiol and progesterone on ovarian growth in decapodshave been reported by several authors. In the crayfish Mac-robrachium rosenbergii, 17�-estradiol behaved as a meta-bolic activator at the cellular level, causing an increase inmitochondrial ATP-ase, cytosolic malate dehydrogenase,and glucose-6-phosphate dehydrogenase in the hepatopan-

Received 4 August 2009; accepted 17 November 2009.* To whom correspondence should be addressed. E-mail:

paolucci@unisannio.itAbbreviations: EV, early-vitellogenic; FV, full-vitellogenic; GSI, gona-

dosomatic index; NV, non-vitellogenic; VTG, vitellogenin.

Reference: Biol. Bull. 218: 36–47. (February 2010)© 2010 Marine Biological Laboratory

36

creas (Ghosh and Ray, 1993a). In Procambarus clarkii,17�-estradiol and 17�-hydroxyprogesterone produced asignificant increase in the gonadosomatic index, while onlythe latter brought about a significant increase in oocytediameter (Rodriguez et al., 2002b). On the other hand,17�-hydroxyprogesterone, when administered in combina-tion with methyl farnesoate, inhibited oocyte growth bysuppressing the stimulatory action of the methyl farnesoateon the ovary of Procambarus clarkii (Rodriguez et al.,2002a); and in Cherax quadricarinatus 17�-hydroxypro-gesterone administration failed to increase the number ofspawns during the reproductive period (Cahansky et al.,2003). An endogenous origin for vertebrate-type steroidhormones has been investigated through the presence ofsteroidogenic enzymes. The activity of 17�-hydroxysteroiddehydrogenase, a key enzyme in steroid metabolism, hasbeen determined in the hepatopancreas and the ovary ofMacrobrachium rosenbergii. The enzyme activity was up-regulated by 17�-estradiol and thus was higher in the hepa-topancreas of maturing females (Ghosh and Ray, 1993b).

Despite numerous reports on the occurrence of verte-brate-type steroid hormones in crustaceans, their exactmode of action remains to be elucidated. The evidencepoints to a physiological role for the vertebrate-type steroidsin crustaceans, which implies the presence of specific re-ceptors. Immunological evidence has recently been reportedfor progesterone receptors in the ovary and for both pro-gesterone and estradiol receptors in the hepatopancreas ofthe crayfish Austropotamobius pallipes (Paolucci et al.,2002), suggesting dichotomous roles for these hormones invitellogenesis.

Among crustaceans there is evidence that vitellogenin issynthesized in several tissues including the hepatopancreasand the ovary itself (Shafir et al., 1992; Khayat et al., 1994;Lee and Chang, 1999). In these animals, secondary vitello-genesis is accompanied by the accumulation of yolk, com-posed of lipids, carbohydrates, and proteins (Adiyodi andSubramoniam, 1983; Charniaux-Cotton and Payen, 1988),circulating in the hemolymph as VTG, a high-density li-poprotein (HDL) (Lee and Puppione, 1988; Komatsu et al.,1993). The HDL called LPII in Cherax quadricarinatus isspecific for secondary vitellogenic females and containsfour polypeptides with masses between 80 and 208 kDa(Abdu et al., 2000; Yehezkel et al., 2000). The lack of LPIIin the hemolymph of spawning females and in females thatare not in their reproductive season indicates that LPII maybe a useful marker of secondary vitellogenesis.

A complete VTG cDNA has been cloned in Cheraxquadricarinatus. The gene is expressed as a single transcriptand is present in the hepatopancreas of females duringsecondary vitellogenesis (Abdu et al., 2002; Serrano-Pintoet al., 2004); in intersex individuals it is negatively regu-lated by the androgenic gland, as demonstrated by the factthat removal of these glands results in VTG transcription

(Abdu et al., 2002). However, the investigation of VTGexpression in both female and intersex crayfish reveals thatthe gene is under a multifactorial regulation (Khalaila et al.,2001). The X-organ-sinus gland (XO-SG) inhibits the VTGgene, and its removal results in a partial recovery of VTGsynthesis in males and a total recovery in intersex individ-uals (Shechter et al., 2005). On the basis of these data, VTGin crustaceans seems to be under a multifactorial regulation,including vertebrate-like steroids, although with differentfeatures according to species.

In this study we investigate the effect of the sex steroids17�-estradiol and progesterone on crayfish reproduction,using VTG as a marker. We employed the genus Cherax(spp.) as a crayfish model because of the advanced status ofknowledge about its VTG structure and synthesis.

Materials and Methods

Animals

Males and females of the crayfish Cherax albidus (Clark,1936) were obtained from the “Pilot Aquaculture Labora-tory for Cherax spp. intensive farming,” located in Siculiana(Sicily, Italy), and transferred to our laboratory. Crayfishwere originally imported from Mulataga Aquaculture(Perth, Western Australia, P.O. Box 343 Gosnells 6110), asCherax albidus, in April 2005, and were, according to theEuropean Community Law, in good health and disease-free(Health Certificate n. 4436915). For the present study, ani-mals were kept under natural photoperiod and the watertemperature was set at 20 °C. Animals were fed a naturaldiet ad libitum every second day. We utilized adult femalesthat had already spawned once and that were in differentstages of the reproductive cycle at the time of the study. Thestage of the reproductive cycle was defined on the basis ofthe time of the year the animals were analyzed and on thegonadosomatic index (GSI) and the oocyte diameter accord-ing to Sagi et al. (1996, 1999). Mean oocyte diameter(�SD) was calculated from a sample of 15 oocytes perovary. Females were defined as non-vitellogenic (NV) witha GSI � 0.21 � 0.05 and whitish oocytes with a diameter �0.5 � 0.1 mm; early-vitellogenic (EV) with a GSI � 3.0 �0.5 and yellow oocytes with a diameter � 2.0 � 0.2 mm;and full-vitellogenic (FV) with a GSI � 5.0 � 0.5 and blueoocytes with a diameter � 2.5 � 0.3 mm. Adult males wereemployed as negative controls. Crayfish body weightranged from 25 to 40 g.

Experimental design

On the basis of the stage of their reproductive cycle,females were divided into three groups of 24 animals each:Group one � NV females; Group two � EV females;Group three � FV females. Each group was separated intothe following treatments, with 6 crayfish in each treatment:

37STEROIDS IN CRAYFISH REPRODUCTION

Control, injected with saline solution for freshwater crayfish(Van Harreveld, 1936); E treatment, injected with 17�-estradiol; P treatment, injected with progesterone; E�Ptreatment, injected with both steroid hormones.

Steroids were dissolved in ethanol and the obtained so-lutions were diluted in the saline solution to reach the finalconcentration of 10�7 mol l�1/crayfish, according to previ-ous studies on crayfish (Rodriguez et al., 2002b). The ste-roids were injected in the abdominal muscle, in proximity tothe fifth pleopod, two times a week for 4 weeks. Theinjection volume was 100 �l. The same experimental designwas carried out on males, with only two animals per group.At the end of the treatment, the animals were anesthetizedon ice, weighed, and sacrificed. First, the hemolymph wasextracted by a syringe from each animal, then transferredinto a glass tube with EDTA. The samples were centrifugedat 10000 � g for 1 h and were preserved at �80 °C.Subsequently, gonads and hepatopancreas were removedfrom each animal. The hepatopancreas was divided intothree pieces: one treated for histological and immunohisto-chemical analysis; one placed in a solution of phosphatebuffer and protease inhibitor to evaluate the lipidic profile;and one used for total RNA extraction. Ovaries were treatedfor histological analysis. The following variables were mea-sured: gonadosomatic index (GSI � fresh weight of ovary/whole crayfish � 100); hepatosomatic index (HIS � freshweight of hepatopancreas/whole crayfish � 100); meanoocyte diameter (MOD � major diameter � minor diame-ter/2).

Histological analysis

A piece of hepatopancreas and a piece of ovary for eachanimal were fixed in Bouin’s solution for about 10 h,dehydrated with ascending alcoholic series, cleared in xy-lene, and then embedded in paraffin wax. The sections werecut to a thickness of 7 �m and stained with hematoxylin-eosin.

Immunohistochemistry

For each animal, a piece of hepatopancreas was fixed informalin, dehydrated in ethanol, cleared in xylene, andembedded in paraffin wax. Serial sections (7 �m) were cutand placed on silane-coated slides. The sections were pro-cessed by the immunoperoxidase method. Tissues weredeparaffinized, rehydrated, and then washed in 0.1 mol l�1

phosphate buffer solution (PBS) at pH 7.4 for 15 min.Endogenous peroxidase activity was blocked by incubationfor 30 min in a 0.3% hydrogen peroxide solution diluted inmethanol. After incubation with nonfat dry milk (Bio-Rad)to reduce background staining, the sections were placedovernight in a moist chamber at 4 °C with anti-VTG pri-mary antibody made against Cherax quadricarinatus (agenerous gift of Prof. Sagi, Ben Gurion University, Beer

Sheva, Israel) at an optimal dilution of 1:500. Afterward, thesections were rinsed in several baths of PBS and incubatedfor 1 h at room temperature with secondary antibody—anti-rabbit IgG conjugated with horseradish peroxidase (Pierce),diluted 1:250. The peroxidase reaction was developed in asolution of 3,3�-diaminobenzidine tetrahydrochloride (SigmaChemical Co., St. Louis, MO) 0.015% w/v in Tris–HCl 0.01mol l�1, pH 7.5, containing 0.03% hydrogen peroxide.Slides were then dehydrated and mounted in Canada balsamand examined using a Nikon Eclipse E600 microscope.Controls were treated by the same methods except that theprimary antibody was omitted.

Fatty acid analysis

The hepatopancreas was homogenized in PBS and cen-trifuged at 14,000 � g. The pellet was employed for fattyacid analysis. Lipids were extracted following the two-stepmethod of Bligh and Dyer (1959). The fatty acid transes-terification was accomplished using the protocol suggestedby Kramer et al. (1997). Lipid analyses were performed atthe Lipidomic laboratory of Lipinutragen srl (Bologna, It-aly), a spin-off company of the Consiglio Nazionale delleRicerche, Bologna (Italy). Fatty acid methyl ester analysiswas carried out by gas chromatography on a Varian CP-3800 gas chromatograph equipped with a flame ionizationdetector and a Rtx-2330 column (90% biscyanopropyl-10%phenylcyanopropyl polysiloxane capillary column; 60 m,0.25 mm i.d., 0.20-�m film thickness). Helium was thecarrier gas at the constant pressure of 29 psi. Oven temper-ature started from 160 °C held for 55 min, followed by anincrease of 5 °C/min up to 195 °C, held for 10 min, followedby a second increase of 10 °C/min up to 250 °C. Fatty acidmethyl ester values were identified by comparison with theretention times of authentic samples (Ferreri et al., 2001,2002).

RNA extraction and cDNA synthesis

Total RNA was isolated from the hepatopancreas usingSV Total RNA Isolation System (Promega). Reverse tran-scription was performed using 4 �g of total RNA, oligo dTprimers and the ImProm-II Inverse Transcription System(Promega).

PCR amplification

Oligonucleotide primers (VgForward-5�AACGAGGAA-GACGCTGTGG 3�; VgReverse-5�GGGTATCGCCGAA-TAAAGG 3�) were designed on the cDNA sequence of theCherax quadricarinatus VTG reported by Abdu et al.(2002) (GenBank Accession no. AF306784). PCR amplifi-cation was carried out in a Helix Thermal Cycler (DiaTech),in a 20-�l reaction using 1.25 units of Taq DNA Poly, 1�Taq DNA Poly Buffer, 1.5 mmol l�1 MgCl2, 0.2 mmol l�1

38 E. COCCIA ET AL.

of each dNTP, 0.1 �mol l�1 of each primer, and 2–5 �l oftemplate cDNA. PCR conditions consisted of denaturationat 95 °C for 5 min, followed by 35 cycles of denaturation at94 °C for 30 s, annealing at 58 °C for 30 s, and extension at72 °C for 1 min. A final elongation step was performed at 72°C for 10 min. The PCR product was separated by 1%agarose gel electrophoresis with ethidium bromide and vi-sualized with Chemidoc UV transilluminator (BioRad).

cDNA cloning and nucleotide sequencing

The PCR fragment was purified using a QIAquick gelextraction (Qiagen). The PCR fragment (900-bp long) wascloned into a pGEM-T Easy Vector (Promega) to transformEscherichia coli (strain DH-5�) using standard methods.Clones containing the PCR insert were isolated and theplasmid DNA was purified using a QIAprep Spin Miniprepkit (Qiagen). The nucleotide sequence was carried out byPRIMM srl.

Real-Time RT-PCR

The amount of VTG mRNA was determined with real-time RT-PCR to estimate the effects of the hormonal treat-ments on the VTG expression in the hepatopancreas. Pre-liminary cDNA synthesis was performed as previouslydescribed. The VTG transcript was quantitatively analyzedand normalized using both VTG sense (5’-TTTTGGT-GAAGGCTACGC-3�) and antisense (5�-TCTTGCAGCT-GTTCCAGT-3�) primers and adding to the PCR reaction anadditional pair of primers amplifying a fragment of �-actincDNA as a housekeeping gene. The additional primers(sense: 5�-GGTCGGTATGGGTCAGAAG-3�; antisense:5�-GTGGTGGTGAAGGAGTAGCC-3�) were designedbased on the Cherax quadricarinatus �-actin cDNA se-quence reported in the GenBank database (Martınez-Perezet al., 2005) (GenBank Accession no. AY430093). Real-time reactions were carried out on an ABI 7300 Real-TimePCR System (Applied Biosystem, Foster City, CA) usingSYBR Green I dye. The real-time PCR mix contained 12.5�l of 2� Brilliant SYBR Green QPCR Master Mix (Strat-agene), 0.1 �mol l�1 upstream and 0.1 �mol l�1 down-stream primers, and 50 ng of template DNA in a 25-�l finalvolume. The system was initially incubated at 95 °C for 10min for the initial AmpliTaq enzyme activation, followedby 40 cycles of denaturation at 95 °C for 30 s, annealing at58 °C for 1 min, and extension at 72 °C for 1 min. A finalelongation step was performed at 72 °C for 10 min.

Each reaction was run in triplicate. Accurate amplifica-tion of the target amplicon was checked by performing amelting curve. Data were analyzed according to the relativequantification method. All the statistical analyses were per-formed using GraphPad.

SDS-PAGE and Western blotting

Electrophoretic analysis was performed according to theLaemmli method (Laemmli, 1970) using a marker of knownmolecular weight (Color Burst, Sigma). Samples were re-suspended in 0.125 mol l�1 Tris-HCl (pH 6.8) containing2% SDS, 10% glycerol, 0.02% bromophenol blue, and 5%�-mercaptoethanol; boiled for 2 min; and loaded into thewells of a 7.5% denaturing SDS-polyacrylamide gel. Afterthe run the gel was electroblotted onto nitrocellulose filter(Millipore). The filter was blocked for 1 h with a solutioncontaining 0.1% Tween-20 in PBS and 5% BSA and thenincubated for 1 h with anti-VTG primary antibody (kindlyprovided by Prof. Sagi) diluted 1:5000 in 1% PBS-Tween-BSA. Subsequently, the filter was washed five times withPBS-Tween and incubated for 1 h with the secondary anti-body, anti-rabbit IgG conjugated with horseradish peroxi-dase (Pierce), diluted 1:10000 in 1% PBS-Tween-BSA.After five washings with PBS-Tween, the filter was devel-oped using Super Signal West-Pico Chemiluminescent Sub-strate kit (Pierce) reagents, and the bands were visualizedwith Chemidoc (Biorad).

Total protein concentration

Total protein concentration was determined with theBradford method (Sigma) using bovine serum albumin(BSA) as standard.

Statistical analysis

Values were expressed as mean � standard error (S.E.).Data were analyzed by one-way analysis of variance(ANOVA), and any significant difference was determined atthe 0.05 level by Duncan’s multiple range test. The analyseswere carried out with the Statistica statistical package, ver.7.0 (Statsoft Inc., Tulsa, OK).

Results

Histology of hepatopancreas

In decapods, the hepatopancreas is a bilobed brown andyellowish organ that occupies much of the cephalothoraciccavity. It is formed of a mass of blind tubules. Tubulesconsist of a cylindrical epithelial layer, which constitutes theglandular epithelium, surrounded by a basal lamina of con-nective tissue. Each tubule is differentiated into three zones:the distal and medial zones of the tubules delimit an irreg-ular and narrow lumen and constitute the cortical region ofthe gland, while the proximal zones form the medullarregion and delimit an ample tubular (Vogt, 1994). In Cheraxalbidus, as in other decapods, the hepatopancreas was com-posed by tubules lined by a single-layered epithelium. Fig-ure 1 shows the histological section of a typical mid-regionof hepatopancreatic tubules of NV, EV, and FV females. In

39STEROIDS IN CRAYFISH REPRODUCTION

untreated NV female the tubules were characterized bycylindrical epithelial cells with the nucleus basally locatedand numerous vacuoles in the apical zone. The lumen of thetubules was narrow. The hepatopancreas histology of fe-males injected with 17�-estradiol (E), progesterone (P), andboth hormones (E�P) did not show any changes whencompared to the control. In untreated EV females the tu-bules appeared similar to those of untreated NV females.The treatment with E caused an enlargement of the lumen ofthe tubules with a consequent compression of the epithelialcells, which formed a thin layer. The lumen of the tubuleswas occupied by abundant secretions. The treatment with Pand E�P caused an increase of the vacuoles present in thecylindrical epithelial cells, while the tubule lumen size wasunaffected (Fig. 1A–C). In untreated FV females the cylin-drical epithelial cells appeared swollen and were occupiedby voluminous vacuoles. After steroid treatment the epithe-lial cells appeared engorged with large vacuoles, the tubularwalls appeared brittle, and the whole tissue appeared to berather loose (Fig.1D–F).

Vitellogenin immunolocalization in the hepatopancreas

To determine the possible relationship between the stagesof females and the presence of VTG in the vacuoles ofepithelial cells of the hepatopancreas, we employed anantibody generated against Cherax quadricarinatus vitel-logenin. No VTG immunoreactivity was present in NVfemales or in males (not shown). In EV females (Fig. 2A)

VTG immunoreactivity was present in the vacuoles of someepithelial cells.

Fatty acid composition of hepatopancreas membranes

To investigate the cause of the crumbling of the tubulewalls of the hepatopancreas of the FV females treated withhormones, we analyzed the fatty acid composition of thecell membranes. Results are shown in Table 1. Data repre-sent the relative percentages of peaks observed in the GCanalysis. Peaks correspond to the more representative 13fatty acids, and their sum was set to 100. The relativepercentages indicate approximately the weight of everyfatty acid that constitutes the phospholipids of the cellularmembrane. The comparison of the data highlights possiblechanges in the metabolism and, consequently, in the typeand percentages of the fatty acids in the cellular membrane.

Palmitic was the most abundant among saturated fattyacids (SFA); oleic was the most abundant among the mono-unsaturated fatty acids (MUFA); and linoleic, eicosapen-tanoic acid (EPA), and docosahexanoic acid (DHA) werethe most abundant among polyunsaturated fatty acids(PUFA). When treated FV females were compared withuntreated FV controls, palmitic acid showed a statisticallysignificant increase with E treatment, oleic showed a statis-tically significant decrease with P and E�P treatment, lino-leic acid showed a statistically significant increase with Ptreatment, EPA showed a statistically significant increasewith E�P treatment, and DHA showed a statistically sig-

Figure 1. Histology of the hepatopancreas of early-vitellogenic females (A � control; B � animal injectedwith 17�-estradiol; C � animal injected with progesterone) and full-vitellogenic females (D � control; E �animal injected with 17�-estradiol; F � animal injected with progesterone). Scale bars � 35 �m (A, D, E, F)and 20 �m (B, C).

40 E. COCCIA ET AL.

nificant decrease with E treatment. Total SFA were higherin E- and E�P-treated females, while total PUFA andMUFA were lower in E- treated females.

VTG cDNA sequencing

The nucleotide sequence of the PCR fragment obtainedby amplification of the cDNA derived from the hepatopan-creas of the vitellogenic females was compared to VTGsequences deposited in GenBank. The result reported inFigure 3 shows that our cDNA fragment (GenBank Acces-sion no. GQ420689) shared 97% identity with the Cheraxquadricarinatus vitellogenin mRNA (GenBank Accessionno. AF306784).

VTG levels in the hepatopancreas

To ascertain the effect of steroids on the expression ofVTG, RNA from hepatopancreas of both untreated andtreated animals was employed as a template in real-time

PCR experiments. Samples were always run in triplicate,and the analysis of the dissociation curves from both exper-imental and �-actin control samples revealed a single melt-ing peak, indicating a specific signal for both transcripts. Inall negative control samples, no amplification of the fluo-rescent signal was detected. The quantitative analysis ofVTG gene expression was relative to the VTG mRNA levelin controls that was set as a reference value of one. TheVTG mRNA results for EV females treated with hormonesare as follows: when injected with E, the average increasewas 1.8-fold, corresponding to a percentage increase of 80%� 5.2%, which was statistically significant; when injectedwith P, the average increase was 1.67-fold, corresponding toan increase of 68% � 3.4%, which was statistically signif-icant; when injected with both steroids, the average increasewas 1.15-fold, corresponding to an increase of 10% �2.3%, which was not statistically significant. For FV fe-males, treatment with E produced an average VTG mRNAincrease of 1.32-fold, corresponding to a percentage in-crease of 35% � 4.2%; treatment with P induced an averageincrease of 1.25-fold, corresponding to an increase of 22%� 1.8%; injection with both steroids showed an averageincrease of 1.22-fold, corresponding to an increase of 24%� 2% (Fig. 4). The VTG increase in FV females was thusnot statistically significant with respect to the control. Fi-nally, in NV females and males, hormonal treatment did notcause any increase in VTG mRNA (data not shown).

VTG in the hemolymph

The antibody generated against the Cherax quadricari-natus yolk polypeptide of 106 kDa crossreacted with animmunoreactive band of about 80 kDa in the hemolymph ofCherax albidus EV (Fig. 5) and FV (Fig. 6) females. In bothcases, treatment with steroids increased the intensity of theimmunoreactive band. This increase was mainly evident infemales injected with progesterone. The immunoreactiveband was not present in the hemolymph of NV females anduntreated males, which were used as a negative control (datanot shown).

Discussion

In this study the effects of 17�-estradiol and progesteroneon the reproduction of the freshwater crayfish Cherax albi-dus are reported. Vitellogenin (VTG) as a marker of repro-duction is widely employed in both vertebrates and inver-tebrates (Sumpter and Jobling, 1995; Marin and Matozzo,2004). The use of VTG as a marker of endocrine disruptionhas revealed itself to be particularly useful (Hutchinson andPickford, 2002; Rotchell and Ostrander, 2003; Porte et al.,2006, for review). Moreover, progesterone or its metabo-lites seems to induce VTG synthesis in some invertebrates,although the effects are not entirely clear. A direct stimu-latory effect of 17�-hydroxyprogesterone on VTG produc-

Figure 2. Vitellogenin immunoreactivity in the hepatopancreas ofearly-vitellogenic females (A). (B) control. Scale bar � 35 �m (A, B).

41STEROIDS IN CRAYFISH REPRODUCTION

tion has been suggested in the red swamp crayfish Procam-barus clarkii (Rodriguez et al., 2002b), and Reddy et al.(2006) demonstrated that this hormone induced ovariangrowth and ovarian VTG synthesis in the freshwater crabOziotelphusa senex senex. This study shows that in vivotreatment with 17�-estradiol and progesterone, alone or incombination, brought about an increase in VTG mRNA inearly-vitellogenic (EV) females and, although to a lesserextent, in full-vitellogenic (FV) females of the crayfishCherax albidus. 17�-estradiol seemed to be more effectivethan progesterone on VTG mRNA synthesis in the hepato-pancreas, in agreement with Yano (2000) and Yano andHoshino (2006) who suggest that in penaeids 17�-estradiolcould be the actual hormone that stimulated VTG produc-tion, using progesterone as a precursor. Hepatopancreasexplants of the shrimp Metapenaeus ensis incubated in vitrowith steroid hormones demonstrated that both 17�-estradioland progesterone stimulated VTG gene expression, al-though 17�-estradiol was more effective (Tiu et al., 2006).In our study both 17�-estradiol and progesterone stimulatedVTG mRNA synthesis, although at different rates; and thetreatment with 17�-estradiol plus progesterone did not showany additive effect on mRNA VTG transcription, provingthat these steroids do not act in synergy, at least in the dosesemployed here. Although hemolymph levels of 17�-estra-diol and progesterone have not been detected in crayfish, thedose employed here falls within the physiological concen-trations reported for both hormones in the hemolymph ofthe mud crab Scylla serrata (Warrier et al., 2001) and the

prawn Marsupenaeus japonicus (Okumura and Sakiyama,2004). It seems that in Cherax albidus 17�-estradiol andprogesterone act differently on VTG regulation. Moreover,dichotomous roles for these hormones in vitellogenesis havebeen hypothesized for the red mud crab Scylla serrata, inwhich maximum levels of 17�-estradiol were found in thehepatopancreas but the highest concentration of progester-one was detected in the ovary (Warrier et al., 2001).

A strong correlation between estrogens and expression ofthe heat shock protein HSP90 in the shrimp Metapenaeusensis indicates that the expression of VTG may be under theregulation of estrogen hormones through a mechanism sim-ilar to that in vertebrates (Wu and Chu, 2008). However, thepresence of an estrogen receptor gene in crustaceans is stillcontroversial. Estrogen receptors have not been reported incrustaceans, although nuclear receptors sharing high simi-larity with estrogen receptors have been identified in Dro-sophila (Maglich et al., 2001); and specific androgen bind-ing sites—but no estrogen binding sites—have been foundin the amphipod Hyalella azteca (reviewed in Koheler et al.,2007).

In this study, the effect of steroid treatment was bluntedduring the full vitellogenesis period in comparison to theearly vitellogenesis period. This phenomenon may beascribable to the higher rate of VTG expression in FVfemales that were therefore less responsive to steroid stim-ulation than EV females. In contrast, neither VTG mRNAnor circulating VTG in the hemolymph were detected in NVfemales of Cherax albidus treated with sex steroids. These

Table 1

Fatty acid composition of the hepatopancreas membranes of full-vitellogenic Cherax albidus females injected with steroids 17�-estradiol (E2),progesterone (P), 17�-estradiol plus progesterone (E2�P), and females injected with saline solution (control)

Fatty acids Control E2 P E2�P

16:0 (palmitic acid) 20.37 � 1.15a 23.37 � 1.18b 20.71 � 1.14a 20.29 � 1.16a16:1 (palmitoleic acid) 6.96 � 0.60 7.09 � 1.09 6.99 � 1.07 5.63 � 0.7018:0 (stearic acid) 4.96 � 0.52 6.00 � 0.63 4.93 � 0.52 6.06 � 0.799-trans 18:1 (elaidic acid) 0.18 � 0.02 0.09 � 0.02 0.13 � 0.01 0.07 � 0.039-cis 18:1 (oleic acid) 27.69 � 1.10a 27.07 � 1.14a 25.83 � 1.18b 25.15 � 1.15b11-cis 18:1 (vaccenic acid) 5.03 � 0.53 4.62 � 0.49 4.11 � 0.43 4.15 � 0.4718:2 (linoleic acid) 19.21 � 1.12a 18.53 � 1.15a 20.98 � 1.21b 19.95 � 1.18a20:2 (eicosadienoic acid) 0.85 � 0.08 0.88 � 0.03 0.79 � 0.01 0.86 � 0.0220:3 (dihomo-�-linolenic acid) 0.17 � 0.01 0.13 � 0.01 0.15 � 0.2 0.10 � 0.0120:4n-6 (arachidonic acid) 1.17 � 0.10 1.30 � 0.09 1.01 � 0.93 1.63 � 0.95Trans 20:4 (trans-arachidonic acid) 0.18 � 0.03 0.17 � 0.02 0.16 � 0.01 0.14 � 0.0220:5n-3 (EPA) 7.14 � 0.80a 6.25 � 0.79a 8.16 � 0.71a 9.31 � 0.88b22:6n-3 (DHA) 5.48 � 0.52a 3.79 � 0.38b 5.47 � 0.60a 6.15 � 0.61aTotal PUFA 34.02 � 0.38a 30.88 � 0.35b 36.56 � 0.52c 38.00 � 0.53cTotal MUFA�PUFA 21.99 � 0.47a 20.29 � 0.51b 22.91 � 0.57c 23.37 � 0.56cTotal SFA 12.67 � 0.83a 14.68 � 0.90b 12.82 � 0.83a 13.17 � 0.98a

Values are reported as relative percentage of peaks with the total sum of peaks set at 100%. Each examination was carried out on three animals; tablevalues are the mean � standard error. Values were analyzed by factorial ANOVA. Values in the same row with different letters are significantly different(P � 0.05). EPA� eicosapentanoic acid; DHA, docosahexanoic acid; SFA� saturated fatty acids; MUFA�monounsaturated fatty acids; PUFA�polyunsaturated fatty acids.

42 E. COCCIA ET AL.

results are consistent with those reported by Tsukimura(2001) for the ridgeback shrimp Sicyonia ingentis, in whichsexually quiescent females treated with progesterone, 17�-hydroxyprogesterone, and 17�-estradiol did not show in-creased levels of yolk protein precursor in the hemolymph.One possible explanation the author advanced for theseresults is that the endocrine environment of NV femalesprobably involves high levels of gonadotropin inhibitinghormone, causing the animals to be unresponsive to verte-brate-like steroids. According to our data we can extend anddeepen these observations by suggesting that neither pro-gesterone nor 17�-estradiol affects VTG synthesis inCherax albidus females in a sexual quiescent phase.

The localization of the VTG mRNA in the hepatopan-creas of Cherax albidus confirms what has already beenshown in other crayfish, that exogenous VTG synthesisoccurs in the hepatopancreas. The site of VTG synthesis incrustaceans has been established in many species. The ovary

(Lui et al., 1974; Lui and O’Connor, 1976, 1977; Eastman-Reks and Fingerman, 1985; Yano and Chinzei, 1987;Rankin et al., 1989; Browdy et al., 1990), hepatopancreas(Paulus and Laufer, 1987; Lee and Watson, 1995), or adi-pose tissue (Tom et al., 1987) have been proposed as organsof VTG synthesis in decapod crustaceans. Hepatopancreaswas suggested as the main synthetic site of this protein inthe freshwater crayfish Macrobrachium rosenbergii (Leeand Chang, 1999; Chen et al., 1999) and Macrobrachiumnipponense (Han et al., 1994). The presence of the VTGmRNA in the hepatopancreas of Cherax albidus representsfurther evidence that this organ is the synthetic site of VTG.

In addition to the effect of steroids on VTG transcription,we also analyzed VTG presence in the hemolymph. Weemployed antibodies generated against a Cherax quadri-carinatus egg yolk polypeptide of about 106 kDa. In thehemolymph of Cherax albidus the antibodies against the106-kDa polypeptide crossreacted with a polypeptide that

Cherax quadricarinatus AGATGCAACAATGACTTTCCGTGTGATTAACGAGGAAGACGCTGTGGTGGACATAGCTGG 5789 Cherax albidus CGACGCCATGGCGGCTCTCCGTTTGATTAACGAGGAAGACGCTGTGGTGGACATAGCTGG 60 ** ** * * ** ***** ************************************* Cherax quadricarinatus TGTGATGGGGCCAGAAAAAGATCCTGAGTGTAACGGCGTCAACATCAAGGGTGTGGCTTA 5849 Cherax albidus TGTGATGGGACCAGAAAAAGATCCTGAGTGTAACGGCGTCAACATCAAGGCTGTGGCTTA 120 ********* **************************************** ********* Cherax quadricarinatus CGCTTCTCCCATCGGAAGTTATGATATTCGCTCCAAACTTTGTAGACCATTCTTCTTCGA 5909 Cherax albidus CACTTCTCCACTCGGAAGTTATGACATTCGCTCCAAACTTTGTAGACCATTCTTCTTCGA 180 * ******* ************* *********************************** Cherax quadricarinatus ACTGATTTCGAAGAAACAAGAAAGTCAAAAGGAATTCATAACGAAACTTGGCCTGCAATG 5969 Cherax albidus AATGATTACGAAGAAACAAGAAAGTCAAAAGGAATTCATAACGAAACTTGGCCTGCAATG 240 * ***** **************************************************** Cherax quadricarinatus TCCGAACAGAGCTGAGATTAGCTTATCGGAAAGTAACCTGGATCAACCGTGGAGAAACGC 6029 Cherax albidus TCCGAACAGAGCTGAGATTAGCTTATCGGAAAGTAACCTGGATCAACCGTTTAGAAACGC 300 ************************************************** ******** Cherax quadricarinatus AATAGCAATGGCCCGTGACAAACTTCCCTCTCCTACTGTTGCTGAAGTTCACTTCGTTTA 6089 Cherax albidus AATAGCAATGGCCCGTGACAAACTTCCATCTCCTACTGTTGCTGAAGTTCACTTCGTTTA 360 *************************** ******************************** Cherax quadricarinatus CGAATCTGAAAATATGCACACGGTGAAGGGCGCTTTGAAGGAAGACTGGCAGAGAGTGAT 6149 Cherax albidus CGAATCTGAAAATATGCACACGGTGAAGGGCGCTTTGAAGGAAGACTGGCAGATGGTGAT 420 ***************************************************** ***** Cherax quadricarinatus GGAGTCTGCTCACTCATGGGCTGACAGTGTGTCTAGATATCTGGAGGAACAAGCACAGCA 6209 Cherax albidus GGAGTCTGCTCACTCATGGGCTGACAGTGTGTCTAGATATCTGGAGGAACAAGCACAGCA 480 ************************************************************ Cherax quadricarinatus ACAAGGCACTACCTTCCCTAACCCAGAGATCGAAACACTTCTCGAAGAAGTCAAACATGA 6269 Cherax albidus ACAAGGCACTACCTTCCCTAACCCAGAGATCGAAACACTTATGGAAGAAGTCAAACATGA 540 **************************************** * ***************** Cherax quadricarinatus TCTTAGGGAAATATATCATGATCTGATTTATAAAGAAATCATCCCACATTATGAGGCTTT 6329 Cherax albidus TCTTAGGGAAATATATCATGATCTGATTTATAAAGAAATCATCCCTCATTATGAGGCTTT 600 ********************************************* ************** Cherax quadricarinatus CCGTGAATTCCTAAGGCGTCCGCCAGCTTCGTACGTTATACAATTTTCTTCAAGCATCCT 6389 Cherax albidus CCGTGAATTCCTAAGGCGTCCGCCAGCTTCGTACGTTATACACTTTTCTTCAAGCATCCT 660 ****************************************** ***************** Cherax quadricarinatus CTCAGGTATAGCCAAGATACAGAGAGACCTAAGAAGTCGTCTTCTCCATGAGGTTCTAGC 6449 Cherax albidus CTCAGGTATAGCCAAGATACAGAGAGACCTTAGAAGTCGTCTTCTCCATGAGGTTCTAGC 720 ****************************** ***************************** Cherax quadricarinatus TTGGCAAGAAGAATTTAAGGATATCACAGAGCGCATCATTGAACTTTTGGTGAAGGCTAC 6509 Cherax albidus TTGGCAAGAAGAGTTTAAGGATATCACAGAGGGCATCATTGAATTTTTGGTGAAGGCTAC 780 ************ ****************** *********** **************** Cherax quadricarinatus GCGTTGGGTGGAGACCGGTGAGATTCCAGAGCCAGTGCGTCGCCTACTGGAACAGCTGCA 6569 Cherax albidus GCATTGTGTGGAGACCGGTGAGATTCCAGAGCCAGTGCGTCGCCTACTGGAACAGCTGCA 840 ** *** ***************************************************** Cherax quadricarinatus AGAAACTAGGATCTTCAGAATGTTTAAGAGGGACGTCGACGCCTTTATTCGGCGATACCC 6629 Cherax albidus AGAAACTAGGATCTTCAGAATGTTTAAGAGGGACGTCGACGCCTTTATTCAGCAATACCC 900 ************************************************** ** ******

Figure 3. Alignment of the nucleotide sequence obteined by PCR amplification of a VTG mRNA fragmentin Cherax albidus (GenBank Accession no. GQ420689) with the VTG mRNA sequence of the crayfish Cheraxquadricarinatus (GenBank Accession no. AF306784). The alignment was done using the CLUSTAL W method.The numbers on the right refer to the nucleotide sequences and the asterisk stands for conserved nucleotides.

43STEROIDS IN CRAYFISH REPRODUCTION

appeared as a band of about 80 kDa (present data). Thedifference in molecular weight may reflect the high vari-ability of polypeptides generated by the proteolytic cleavageof VTG when analyzed under denaturing conditions. Al-though it appears that the VTG gene organization andexpression pattern in decapods is highly conserved (Tiu etal., 2009), a vast array of VTG subunits of different molec-

ular weight has been reported (Tsang et al., 2003; Kung etal., 2004; Serrano-Pinto et al., 2004; Mak et al., 2005; Tiuet al., 2006). The 80-kDa band of Cherax albidus crossre-acted with the antibodies against the 106-kDa polypeptidecorresponding to the molecular weight of one of the fourVTG proteins that Yehezkel et al. (2000) considered spe-cific to secondary-vitellogenic females. The absence of the80-kDa band in both the male and intersex (data not shown)of Cherax albidus strongly sustains its validity as a markerof vitellogenesis in this species. The treatment with sexsteroids caused an increase in the intensity of the 80-kDaband that was particularly evident in the hemolymph ofvitellogenic females treated with progesterone. In proges-terone-treated females in early vitellogenesis, progesteronebrought about a 2-fold increase in the optical density of the80-kDa band with respect to the control, while in the FVfemales there was a 3-fold increase. This result is in conflictwith the effect of sex steroids on VTG mRNA levels in thehepatopancreas, where 17�-estradiol was more effectivethan progesterone. This result may indicate different VTGregulation at the level of gene transcription and proteintranslation. RNA metabolism regulation involves an emerg-ing class of proteins—the RNA binding proteins (Burd andDreyfuss, 1994; Mattaj, 1993)—that appear to play criticalroles in mRNA splicing (Hodgkin, 1989; Dreyfuss et al.,1993), nuclear export (Maquat, 1991), translation (Kozak,1992; Melefors and Hentze, 1993), stabilization and degra-dation (Nielsen and Shapiro, 1990a; Sachs, 1993). Thecontrol of mRNA stability and degradation represents acrucial step in the coupling (or uncoupling) of gene tran-

Figure 4. Effect of steroids on the expression of VTG mRNA in thehepatopancreas of Cherax albidus. On the ordinate axis are reported thelevels of VTG mRNA expressed as value � standard error relative to thecontrol, which is set to one. On the abscissa axis are indicated the injectedhormones (C � saline solution; E2 � 17�-estradiol; P � progesterone).The white bars refer to the results obtained in EV females, while thehatched bars refer to the results obtained in FV females. Statistical analyseshave been done on at least six experiments, in triplicate, for each measure-ment. The asterisks indicate statistically significant values.

Figure 5. Upper panel: western blotting analysis carried out on EVfemales. Lower panel: densitometric analysis of the immunoreactive bands.Each value represents the mean � standard error of six independentexperiments. The asterisk indicates statistically significant value. (C �control; E2 � animals injected with 17�-estradiol; P � animals injectedwith progesterone; E2�P � animals injected with 17�-estradiol and pro-gesterone).

Figure 6. Upper panel: western blotting analysis carried out on FVfemales. Lower panel: densitometric analysis of the immunoreactive bands.Each value represents the mean � standard error of six independentexperiments. The asterisk indicates statistical significant value. (C �control; E2 � animals injected with 17�-estradiol; P � animals injectedwith progesterone; E2�P � animals injected with 17�-estradiol and pro-gesterone).

44 E. COCCIA ET AL.

scription and protein production. An increasing number ofmolecules have been shown to regulate RNA stability, in-cluding steroid hormones (Brock and Shapiro, 1983; Note-born et al., 1986; Paek and Axel, 1987; Nielsen and Sha-piro, 1990b). Dodson et al. (1995) identified, in Xenopuslaevis liver, a protein that binds, in a specific manner, asegment of the 3�-untranslated region (3�-UTR) of VTGmRNA. This protein is induced by 17�-estradiol and me-diates stabilization of VTG transcript. It can be hypothe-sized that, in Cherax albidus, progesterone induces an in-crease of VTG synthesis while 17�-estradiol induces anincrease of gene transcription and/or stabilizes immaturemRNA, regulating its translation. In this way 17�-estradiolmay avoid a sudden impoverishment of the whole VTGmRNA pool.

In this study, 17�-estradiol and progesterone treatmentmodified the hepatopancreas morphology of EV and FVfemales. In contrast, NV females did not show any differ-ence between the control and steroid-treated females, aresult consistent with the unresponsiveness of NV femalesto steroid stimulation in this phase of the reproductive cycle.In EV and FV females the histological analysis of thehepatopancreas highlighted that an increase in the size ofthe cells in females treated with steroids was mainly due tolarge vacuoles probably occupied in vivo by lipids. Theimmunohistochemistry of vitellogenic females showed thatthe content of some, but not all, vacuoles crossreacted withantibodies against Cherax quadricarinatus VTG.

In FV females treated with steroids the hepatopancreastubular walls were fragmented and brittle in appearance.Since SFA reduce the permeability and fluidity of mem-branes and promote their stiffening while PUFA maintainpermeability and fluidity (Vance and Vance, 2002), weanalyzed hepatopancreas membrane fatty acid compositionin control and treated females to get an insight into thepossible causes of membrane fragility. We found that 17�-estradiol treatment caused an increase in SFA and a de-crease in PUFA and MUFA, which might explain the mem-brane fragility. On the other hand, progesterone treatmentincreased both MUFA and PUFA, which does not provideany satisfactory explanation for the membrane fragility.However, we should keep in mind that the paucity of dataavailable in the literature does not allow the formulation ofany hypothesis, and that although the effects of 17�-estra-diol on lipid biosynthesis have been reported, these are notdirectly related to reproduction (Smith et al., 1978; Canesiet al., 2007; Sharpe and MacLatchy, 2007).

In conclusion, in this study we have monitored how theadministration of 17�-estradiol and progesterone affects thereproduction of the crayfish Cherax albidus. We evaluatedthe effects mainly in terms of changes in VTG expression inthe hepatopancreas and VTG concentration in the hemo-lymph in relation to the phase of the reproductive cycle.Both sex steroids caused an increase in VTG expression and

concentration, although their effects were not cumulativeand depended on the phase of the reproductive cycle. Theemerging picture is one of great complexity due to the highvariability of actions ascribable to the so-called “vertebratesex steroids.” In support of this view, the ample literatureavailable along with this study requires a deep investigationinto the molecular mechanisms underlying sex steroid reg-ulation of VTG in invertebrates.

Acknowledgments

This research was supported by the “Camera di Commer-cio di Benevento” and the “Regione Siciliana, AssessoratoAgricoltura e Foreste” grants to Professoressa Marina Pa-olucci. We thank Sig. Dario D’Argenio for his technicalassistance and Dr. Carla Ferreri for assistance in lipid anal-ysis.

Literature Cited

Abdu, U., G. Yehezkel, and A. Sagi. 2000. Oocyte development andpolypeptide dynamics during ovarian maturation in the red-claw cray-fish Cherax quadricarinatus. Invertebr. Reprod. Dev. 37: 75–83.

Abdu, U., C. Davis, I. Khalaila, and A. Sagi. 2002. The vitellogenincDNA of Cherax quadricarinatus encodes a lipovitellin with calciumbinding ability, and its expression is induced following the removal ofthe androgenic gland in a sexually plastic system. Gen. Comp. Endo-crinol. 127: 263–272.

Adiyodi, R. G., and T. Subramoniam. 1983. Arthropoda-Crustacea.Pp. 443–495 in Reproductive Biology of Invertebrates, Oogenesis,Oviposition and Oosorption, K. G. Adiyodi and R. G. Adiyodi, eds.Wiley, New York.

Bligh, E. G., and W. J. Dyer. 1959. A rapid method of total lipidextraction and purification. Can. J. Biochem. Physiol. 37: 911–917.

Brock, M. L., and D. J. Shapiro. 1983. Estrogen stabilizes vitellogeninamRNA against cytoplasmic degradation. Cell 34: 207–214.

Browdy, C. L., M. Fainzilber, M. Tom, Y. Loya, and E. Lubzens. 1990.Vitellin synthesis in relation to oogenesis in in vitro-incubated ovariesof Penaeus semisulcatus (Crustacea, Decapoda, Penaeidae). J. Exp.Zool. 255: 205–215.

Burd, C. G., and G. Dreyfuss. 1994. Conserved structures and diversityof functions of RNA-binding proteins. Science 265: 615–621.

Cahansky, A. V., L. S. Lopez Greco, and E. M. Rodrıguez. 2003.Incremento de la produccion de hembras ovıgeras de la Langosta deAgua Dulce (Cherax quadricarinatus) durante el perıodo reproductivo,mediante la administracion de hormonas y neuroreguladores. II Con-greso Iberoamericano Virtual de Acuicultura (CIVA 2003), 512–517.

Canesi, L., C. Borghi, R. Fabbri, C. Ciacci, L. C. Lorusso, G. Gallo,and L. Vergani. 2007. Effects of 17�-estradiol on mussel digestivegland. Gen. Comp. Endocrinol. 153: 40–46.

Chan, S. M. 1998. Cloning of a shrimp (Metapanaeus ensis) cDNAencoding a nuclear receptor superfamily member: an insect homologueof E75 gene. FEBS Lett. 436: 395–400.

Charniaux-Cotton, H., and G. Payen. 1988. Crustacean reproduction.Pp. 279–303 in Endocrinology of Selected Invertebrate Types, H.Laufer, and R. G. H. Downer, eds. Alan R. Liss. New York.

Chen, Y. N., D. Y. Tseng, P. Y. Ho, and C. M. Kuo. 1999. Site ofvitellogenin synthesis determined from cDNA encoding a vitellogeninfragment in the freshwater prawn Macrobrachium rosenbergii. Mol.Reprod. Dev. 54: 215–222.

Dodson, R. E., M. R. Acena, and D. J. Shapiro. 1995. Tissue distri-bution, hormone regulation and evidence for a human homologue of the

45STEROIDS IN CRAYFISH REPRODUCTION

estrogen-inducible Xenopus laevis vitellogenin mRNA binding protein.J. Steroid Biochem. Mol. Biol. 52: 505–515.

Dreyfuss, G., M. J. Matunis, S. Pinol-Roma, and C. G. Burd. 1993.hnRNP proteins and the biogenesis of mRNA. Annu. Rev. Biochem. 62:289–321.

Eastman-Reks, S., and M. Fingerman. 1985. In vitro synthesis ofvitellin by the ovary of the fiddler crab, Uca pugilator. J. Exp. Zool.233: 111–116.

Engelmann, F. 1994. Invertebrates: hormone-regulated gonadal activity.Pp. 36–40 in Prospective in Comparative Endocrinology, K. G.Davey, R. E. Peter, and S. S. Tobe, eds. National Research Council ofCanada, Ottawa, ON.

Ferreri, C., C. Costantino, L. Perrotta, L. Landi, Q. G. Mulazzani, andC. Chatgilialoglu. 2001. Cis-trans isomerization of polyunsaturatedfatty acid residues in phospholipids catalyzed by thiyl radicals. J. Am.Chem. Soc. 123: 4459–4468.

Ferreri, C., M. R. Faraone-Mennella, C. Formisano, L. Landi, and C.Chatgilialoglu. 2002. Arachidonate geometrical isomers generatedby thiyl radicals: the relationship with trans lipids detected in biologicalsamples. Free Radic. Biol. Med. 33: 1516–1526.

Ghosh, D., and A. K. Ray. 1993a. Subcellular action of estradiol-17� ina freshwater prawn, Macrobrachium rosenbergii. Gen. Comp. Endo-crinol. 90: 274–281.

Ghosh, D., and A. K. Ray. 1993b. 17�-hydroxysteroid dehydrogenaseactivity of ovary and hepatopancreas of freshwater prawn, Macrobra-chium rosenbergii: relation to ovarian condition and estrogen treat-ment. Gen. Comp. Endocrinol. 89: 248–254.

Han, C. H, T. Okumura, Y. Suzuki, K. Aida, and I. Hanyu. 1994.Immunocytochemical identification of the site of vitellogenin synthesisin the freshwater prawn Macrobrachium nipponense. Fish. Sci. 60:149–154.

Hodgkin, J. 1989. Drosophila sex determination: a cascade of regulatedsplicing. Cell 56: 905–906.

Huberman, A. 2000. Shrimp endocrinology. A review. Aquaculture191: 191–208.

Hutchinson, T. H., and D. B. Pickford. 2002. Ecological risk assess-ment and testing for endocrine disruption in the aquatic environment.Toxicology 181–182: 383–387.

Khalaila, I., T. Katz, U. Abdu, G. Yehezkel, and A. Sagi. 2001. Effectsof implantation of hypertrophied androgenic glands on sexual charac-ters and physiology of the reproductive system in the female red clawcrayfish, Cherax quadricarinatus. Gen. Comp. Endocrinol. 121: 242–249.

Khayat, M., E. Lubzens, A. Tietz, and B. Funkenstein. 1994. Arevitellin and vitellogenin coded by one gene in the marine shrimpPenaeus semisulcatus? J. Mol. Endocrinol. 12: 251–254.

Koheler, H.-R., W. Kloas, M. Schirling, I. Lutz, A. L. Reye, J.-S.Langen, R. Triebskorn, R. Nagel, and G. Schonfelder. 2007. Sexsteroid receptor evolution and signalling in aquatic invertebrates. Eco-toxicology 16: 131–143.

Komatsu, M., S. Ando, and S.-I. Teshima. 1993. Comparison of he-molymph lipoprotein from four species of crustacean. J. Exp. Zool.266: 257–265.

Kozak, M. 1992. Regulation of translation in eukaryotic systems. Annu.Rev. Cell Biol. 8: 197–225.

Kramer, J. K. G., V. Fellner, M. E. R. Dugan, F. D. Sauer, M. M.Mossoba, and M. P. Yurawecz. 1997. Evaluating acid and basecatalyst in the methylation of milk and rumen fatty acids with specialemphasis on conjugated dienes and total trans fatty acid. Lipids 32:1219–1228.

Kung, S. Y., S. M. Chan, J. H. Hui, W. S. Tsang, A. Mak, and J. G. He.2004. Vitellogenesis in the sand shrimp, Metapenaeus ensis: thecontribution from the hepatopancreas-specific vitellogenin gene(MeVg2). Biol. Reprod. 71: 863–870.

Laemmli, U. K. 1970. Cleavage of structural proteins during the assem-bly of the head of bacteriophage T4. Nature 227: 680–685.

Lafont, R., and M. Mathieu. 2007. Steroids in aquatic invertebrates.Ecotoxicology 16: 109–130.

Lee, C. Y., and R. D. Watson. 1995. In vitro study of vitellogenesis inthe blue crab (Callinectes sapidus): site and control of vitellin synthe-sis. J. Exp. Zool. 271: 364–372.

Lee, F. Y., and C. F. Chang.1999. Hepatopancreas is the likely organ ofvitellogenin synthesis in the freshwater prawn, Macrobrachium rosen-bergii. J. Exp. Zool. 284: 798–806.

Lee, R. F., and D. L. Puppione. 1988. Lipoproteins I and II from thehemolymph of the blue crab Callinectes sapidus: Lipoprotein II asso-ciated with vitellogenesis. J. Exp. Zool. 248: 278–289.

Lui, C. W., and J. D. O’Connor. 1976. Biosynthesis of lipovitellin bythe crustacean ovary: II. Characterization of in vitro incorporation ofamino acids into the purified subunits. J. Exp. Zool. 195: 41–52.

Lui, C. W., and J. D. O’Connor. 1977. Biosynthesis of crustaceanlipovitellin: III. The incorporation of labeled amino acid into thepurified lipovitellin of the crab Pachygrapsus crassipes. J. Exp. Zool.199: 105–108.

Lui, C. W., B. A. Sage, and J. D. O’Connor. 1974. Biosynthesis oflipovitellin by the crustacean ovary. J. Exp. Zool. 188: 289–296.

Maglich, J. M., A. Sluder, X. Guan, Y. Shi, D. D. McKee, K. Carrick,K. Kamdar, T. M. Willson, and J. T. Moore. 2001. Comparison ofcomplete nuclear receptor sets from the human, Caenorhabditis el-egans and Drosophila genomes. Genome Biol. 2: 0029.1–0029.7.

Mak, A. S. C., C. L. Choi, S. H. K. Tiu, J. H. L. Hui, J.-G. He, S. S.Tobe, and S.-M. Chan. 2005. Vitellogenesis in the red crab Charyb-dis feriatus: hepatopancreas-specific expression and farnesoic acidstimulation of vitellogenin gene expression. Mol. Reprod. Dev. 70:288–300.

Maquat, L. E. 1991. Nuclear mRNA export. Curr. Opin. Cell Biol. 3:1004–1012.

Marin, M. G., and V. Matozzo. 2004. Vitellogenin induction as abiomarker of exposure to estrogenic compounds in aquatic environ-ments. Mar. Pollut. Bull. 48: 835–839.

Martınez-Perez, F., S. Zinker, G. Aguilar, J. Valdes, and H. Arechiga.2005. Circadian oscillations of RPCH gene expression in the eyestalkof the crayfish Cherax quadricarinatus. Peptides 26: 2434–2444.

Mattaj, I. W. 1993. RNA recognition: a family matter? Cell 73: 837–840.

Melefors, O., and M. W. Hentze. 1993. Translational regulation bymRNA/protein interactions in eukaryotic cells: ferritin and beyond.Bioessays 15: 85–90.

Nielsen, D. A., and D. J. Shapiro. 1990a. Insights into hormonal controlof messenger RNA stability. Mol. Endocrinol. 4: 953–957.

Nielsen, D. A., and D. J. Shapiro. 1990b. Estradiol and estrogen recep-tor-dependent stabilization of a mini-vitellogenin mRNA lacking 5,100nucleotides of coding sequence. Mol. Cell. Biol. 10: 371–376.

Noteborn, M. H., M. O. Bakker, M. A. W. Dejonge, M. Gruber, and G.Ab. 1986. Differential estrogen responsiveness of the vitellogeninand apo very low density lipoprotein II genes in the rooster liver. J.Steroid Biochem. 24: 281–285.

Okumura, T., and K. Sakiyama. 2004. Hemolymph levels of verte-brate-type steroid hormones in female kuruma prawn Marsupenaeusjaponicus (Crustacea: Decapoda: Penaeidae) during natural reproduc-tive cycle and induced ovarian development by eyestalk ablation. Fish.Sci. 70: 372–380.

Paek, I., and R. Axel. 1987. Glucocorticoids enhance stability of humangrowth hormone mRNA. Mol. Cell. Biol. 7: 1496–1507.

Paolucci, M., C. Di Cristo, and A. Di Cosmo. 2002. Immunologicalevidence for progesterone and estradiol receptors in the freshwatercrayfish Austropotamobius pallipes. Mol. Reprod. Dev. 63: 55–62.

Paulus, J. E., and H. Laufer. 1987. Vitellogenocytes in hepatopancreas

46 E. COCCIA ET AL.

of Carcinus maenas and Libinia emarginata (Decapoda, Brachyura).Invertebr. Reprod. Dev. 11: 29–44.

Porte, C., G. Janer, L. C. Lorusso, M. Ortiz-Zarragoitia, M. P. Ca-jaraville, M. C. Fossi, and L. Canesi. 2006. Endocrine disruptors inmarine organisms: approaches and perspectives. Comp. Biochem.Physiol. Part C 143: 303–315.

Quinitio, E. T., A. Hara, K. Yamauchi, and S. Nakao. 1994. Changesin the steroid hormone and vitellogenin levels during the gametogeniccycle of the giant tiger shrimp, Penaeus monodon. Comp. Biochem.Physiol. Part C 109: 21–26.

Rankin, S. M., J. Y. Bradfield, and L. L. Keeley. 1989. Ovarian proteinsynthesis in the South American white shrimp, Penaeus vannamei,during the reproductive cycle. Invertebr. Reprod. Dev. 15: 27–33.

Reddy, P. R., P. Kiranmayi, K. T. Kumari, and P. S. Reddy. 2006.17�-Hydroxyprogesterone induced ovarian growth and vitellogenesisin the freshwater rice field crab Oziotelphusa senex senex. Aquaculture254: 768–775.

Rodriguez, E. M., L. S. Lopez Greco, D. A. Medesani, M. Fingerman,and H. Laufer. 2002a. Effect of methyl farnesoate, alone and incombination with other hormones, on ovarian growth of the red swampcrayfish, Procambarus clarkii, during vitellogenesis. Gen. Comp. En-docrinol. 125: 34–40.

Rodriguez, E. M., D. A. Medesani, L. S. Lopez Greco, and M. Finger-man. 2002b. Effects of some steroids and other compounds on ovar-ian growth of the red swamp crayfish, Procambarus clarkii, duringearly vitellogenesis. J. Exp. Zool. 292: 82–87.

Rotchell, J. M., and G. K. Ostrander. 2003. Molecular markers ofendocrine disruption in aquatic organisms. J. Toxicol. Environ. HealthB Crit. Rev. 6: 453–496.

Sachs, A. B. 1993. Messenger RNA degradation in eukaryotes. Cell 74:413–421.

Sagi, A., I. Khalaila, A. Barki, G. Hulata, and I. Karplus. 1996.Intersex red claw crayfish, Cherax quadricarinatus (von Martens):functional males with pre-vitellogenic ovaries. Biol. Bull. 190: 16–23.

Sagi, A., I. Khalaila, U. Abdu, R. Shoukrun, and S. Weil. 1999. Anewly established ELISA showing the effect of the androgenic glandon secondary-vitellogenic-specific protein in the hemolymph of thecrayfish Cherax quadricarinatus. Gen. Comp. Endocrinol. 115: 37–45.

Serrano-Pinto, V., I. Landais, M.-H. Ogliastro, M. Gutierrez-Ayala, H.Mejıa-Ruiz, H. Villareal-Colmenares, A. Garcıa-Gasca, and C.Vazquez-Boucard. 2004. Vitellogenin mRNA expression in Cheraxquadricarinatus during secondary vitellogenic at first maturation fe-males. Mol. Reprod. Dev. 69: 17–21.

Shafir, S., M. Tom, M. Ovadia, and E. Lubzens. 1992. Protein, vitel-logenin, and vitellin levels in the hemolymph and ovaries duringovarian development in Penaeus semisulcatus (de Haan). Biol. Bull.183: 394–400.

Sharpe, R. L., and D. L. MacLatchy. 2007. Lipid dynamics in goldfish(Carassius auratus) during a period of gonadal recrudescence: effectsof �-sitosterol and 17�-estradiol exposure. Comp. Biochem. Physiol.Part C 145: 507–517.

Shechter, A., E. D. Aflalo, C. Davis, and A. Sagi. 2005. Expression ofthe reproductive female-specific vitellogenin gene in endocrinologi-cally induced male and intersex Cherax quadricarinatus crayfish. Biol.Reprod. 73: 72–79.

Shih, J. T. 1997. Sex steroid-like substances in the ovaries, hepatopan-creas, and body fluid of female Mictyris brevidactylus. Zool. Stud. 36:136–145.

Smith, D. F., T. M. Penning, A. Q. Ansari, K. A. Munday, and M.

Akhtar. 1978. Oestrogen-induced cholesterol and fatty acid biosyn-thesis in Xenopus laevis liver during vitellogenic response. Biochem. J.174: 353–361.

Subramoniam, T. 2000. Crustacean ecdysteroids in reproduction andembryogenesis. Comp. Biochem. Physiol. Part C 125: 135–156.

Sumpter, J. P., and S. Jobling. 1995. Vitellogenesis as a biomarker forestrogenic contamination of the aquatic environment. Environ. HealthPerspect. 103 Suppl. 7: 173–178.

Tiu, S. H. K., J.-G. He, S. S. Tobe, and S.-M.Chan. 2006. Character-ization of vitellogenin in the shrimp Metapenaeus ensis: expressionstudies and hormonal regulation of MeVg1 transcription in vitro. Mol.Reprod. Dev. 73: 424–436.

Tiu, S. H. K., H. L. Hui, B. Tsukimura, S. S. Tobe, J.-G. He, andS.-M.Chan. 2009. Cloning and expression study of the lobster (Ho-marus ameicanus) vitellogenin: conservation in gene structure amongdecapods. Gen. Comp. Endocrinol. 160: 36–46.

Tom, M., M. Goren, and M. Ovadia. 1987. Localization of the vitellinand its possible precursors in various organs of Parapenaeus longiros-tris (Crustacea, Decapoda, Penaeidae). Invertebr. Reprod. Dev. 12:1–12.

Tsang, W.-S., L. S. Quackenbush, B. K. C. Chow, S. H. K. Tiu, J.-G.He, and S.-M. Chan. 2003. Organization of the shrimp vitellogeningene: evidence of multiple genes and tissue specific expression by theovary and hepatopancreas. Gene 303: 99–109.

Tsukimura, B. 2001. Crustacean vitellogenesis: its role in oocyte devel-opment. Am. Zool. 41: 465–476.

Vance, D. E., and J. E. Vance. 2002. Biochemistry of Lipids, Lipopro-teins and Membranes. Elsevier Science, Amsterdam.

Van Harreveld, A. V. 1936. A physiological solution for freshwatercrustaceans. Proc. Soc. Exp. Biol. Med. 34: 408–432.

Vogt, G. 1994. Life-cycle and functional cytology of the hepatopancre-atic cells of Astacus astacus (Crustacea, Decapoda). Zoomorphology114: 83–101.

Warrier, S. R., R. Tirumalai, and T. Subramoniam. 2001. Occurrenceof vertebrate steroids, estradiol-17� and progesterone in the reproduc-ing females of the mud crab Scylla serrata. Comp. Biochem. Physiol.Part A 130: 283–294.

Wu, L. T., and K. H. Chu. 2008. Characterization of heat shock protein90 in the shrimp Metapenaeus ensis: evidence for its role in theregulation of vitellogenin synthesis. Mol. Reprod. Dev. 75: 952–959.

Yano, I. 2000. Endocrine control of reproductive maturation in econom-ically important crustacea for aquaculture. Pp. 161–194 in Reproduc-tive Biology of Invertebrates, K. G. Adiyodi and R. G. Adiyodi, eds.Wiley, New York,

Yano, I., and Y. Chinzei. 1987. Ovary is the site of vitellogenin syn-thesis in Kuruma prawn, Penaeus japonicus. Comp. Biochem. Physiol.Part B 86: 213–218.

Yano, I., and R. Hoshino. 2006. Effect of 17 �-estradiol on thevitellogenin synthesis and oocyte development in the ovary of kurumaprawn (Marsupenaeus japonicus). Comp. Biochem. Physiol. Part A144: 18–23.

Yehezkel, G., R. Chayoth, U. Abdu, I. Khalaila, and A. Sagi. 2000.High-density lipoprotein associated with secondary vitellogenesis inthe hemolymph of the crayfish Cherax quadricarinatus. Comp. Bio-chem. Physiol. Part B 127: 411–421.

Zapata, V., L. S. L. Greco, D. Medesani, and E. M. Rodriguez. 2003.Ovarian growth in the crab Chasmagnathus granulata induced byhormones and neuroregulators throughout the year. In vivo and in vitrostudies. Aquaculture 224: 339–352.

47STEROIDS IN CRAYFISH REPRODUCTION