E

Ha

b

c

4

a

ARR2AA

KODFEEP

1

vtctfaDpp

(uadaD

YJ

0d

Reproductive Toxicology 27 (2009) 55–62

Contents lists available at ScienceDirect

Reproductive Toxicology

journa l homepage: www.e lsev ier .com/ locate / reprotox

ffects of diethylstilbestrol on ovarian follicle development in neonatal mice

annah Kima, Shinji Hayashia, Pierre Chambonb, Hajime Watanabec, Taisen Iguchic, Tomomi Satoa,∗

International Graduate School of Arts and Sciences, Yokohama City University, Yokohama 236-0027, JapanInstitut de Génétique et de Biologie Moléculaire et Cellulaire, CNRS/INSERM/ULP, Collége de France, BP163, 67404 Illkirch Cedex, FranceThe Graduate University for Advanced Studies and Okazaki Institute for Integrative Bioscience, National Institute for Basic Biology, National Institutes of Natural Sciences, Okazaki44-8787, Japan

r t i c l e i n f o

rticle history:eceived 10 July 2008eceived in revised form2 September 2008ccepted 24 October 2008vailable online 5 November 2008

a b s t r a c t

Previous results show that diethylstilbestrol (DES) causes polyovular follicles through estrogen recep-tor (ER) � and increases the number of follicles, suggesting that DES might affect follicular growth anddevelopment. Effects of neonatal DES exposure on follicle development were precisely examined in theovaries of C57BL/6J and ER� knockout (�ERKO) mice. In the DES-exposed C57BL/6J mice, both primaryfollicle (PmF) progression from primordial follicles at 5 days of age and secondary follicle (SF) progressionfrom PmFs at 10 days of age were delayed as compared with those in the oil-exposed controls. These

eywords:varyESolliculogenesisR�R�

results indicate that DES may suppress follicle development in neonatal mouse ovaries. DES exposurealso decreased the number of follicles in 5-day-old C57BL/6J, WT and �ERKO mice, suggesting that DESinhibits follicle formation and development through ER� in the neonatal mouse ovaries.

© 2008 Elsevier Inc. All rights reserved.

oEDprEtptds

bce

olyovular follicle

. Introduction

In mice, neonatal exposure to diethylstilbestrol (DES) causesarious abnormalities in the female reproductive organs, skele-al tissues and muscles [1–5]. In the ovary, several morphologicalhanges are detected including absence of corpora lutea, hyper-rophy of interstitial tissue and hemorrhagic cysts [6]. Polyovularollicles (PFs), which contain two or more oocytes per follicle, arelso induced in the ovaries of mice exposed to DES perinatally [7].ES induces polyovular follicles in the ovary directly in vitro, soituitary gonadotropins may not be essential for the occurrence ofolyovular follicles [8].

The actions of estrogen are mediated by estrogen receptorsER), ER� and ER�. ER� is a predominant form of ER in theterus, vagina, ovary, testis, pituitary, mammary glands, kidney and

drenal glands, while ER� expresses potently in the prostate, epi-idymis and ovary [9]. In the ovary, ER� is localized in interstitialnd thecal cells, whereas ER� is localized in granulosa cells [10].ES can bind to both ER� and ER� with higher affinity than that

∗ Corresponding author at: International Graduate School of Arts and Sciences,okohama City University, 22-2 Seto, Kanazawa-ku, Yokohama 236-0027,apan. Tel.: +81 45 787 2394; fax: +81 45 787 2413.

E-mail address: tomomi@yokohama-cu.ac.jp (T. Sato).

dowmrcmocg

890-6238/$ – see front matter © 2008 Elsevier Inc. All rights reserved.oi:10.1016/j.reprotox.2008.10.005

f 17�-estradiol (E2) [9]. In a study of ER� knockout (�ERKO) andR� knockout (�ERKO) mice, it is shown that effects of neonatalES treatment on the uterus, oviduct, vagina, seminal vesicle androstate are mediated through ER� [11]. On the other hand, ouresults have shown that DES induces polyovular follicles throughR� [12]. In addition, an increase in the number of follicles largerhan 50 �m in diameter is induced in the DES-exposed mice com-ared with that in the oil-exposed mice [12]. This result suggestshat neonatal DES exposure might affect follicular growth andevelopment, however, which ER subtypes are involved in the DESignaling is not clear.

Folliculogenesis is a sequence of events which commences afterirth and continues through adulthood in rodents. Female germells proliferate and form cell clusters called germ cell cysts in thembryonic period [13]. Soon after birth, programmed cyst break-own results in germ cell loss and follicle formation. Approximatelyne-third of oocytes survive to form primordial follicles (PrFs),hile the others are lost via apoptosis. At 22.5 days post-coitus,ost germ cells are separated. Then an oocyte begins to be sur-

ounded by a monolayer of flat pregranulosa cells. Pregranulosa

ells might be associated with the cyst breakdown and PrF for-ation [14,15]. Some portion of PrFs at the inner region of the

vary (inner cortex) develop to primary follicles (PmFs), whichonsist of an oocyte larger than 20 �m surrounded by cuboidalranulosa cells. Then, PmFs grow to secondly follicles (SFs), which

5 ve Tox

c[

glcg(s(w

m(iafbP

F7(f

6 H. Kim et al. / Reproducti

onsist of an oocyte surrounded by multiple granulosa cell layers16].

Various intraovarian factors such as transcription factors androwth factors are essential for the growth and development in fol-icles [15]. Interaction between oocytes and surrounding somaticells, which are sources of intraovarian factors and their tar-ets, is also important for folliculogenesis. Factor in germline �

FIG�), newborn ovary homeobox encoding gene (Nobox) andpermatogenesis- and oogenesis-specific basic helix–loop–helixbHLH) transcription factor 1 (Sohlh1) are transcription factorshich express in oocytes and have crucial roles in the PrF develop-

PTmg

ig. 1. Histology of ovaries in oil- (A, C, E, G and I) or neonatally DES-exposed (B, D, F, H-day-old mice, ovaries show the outer cortex (C, D, G and H) and the inner cortex (E, F, I anarrowheads) in the outer cortex (A–D and H), and primordial follicles (PrFs) (arrows) (Collicle (SF) (open arrowhead) (I). Polyovular follicles (asterisks) were also seen in DES-ex

icology 27 (2009) 55–62

ent [17–19]. In granulosa cells, Foxl2, a member of the forkheadFoxo)/hepatocyte nuclear factor 3 gene family, and Foxo3a aremportant to PmF development [20–22]. Nerve growth factor (NGF)nd TrkB receptor have also important roles in PmF progressionrom PrF [23–25]. Kit ligand (KL), secreted from granulosa cells,inds to its receptor (Kit), which is present in the oocyte membrane.arrott and Skinner [26] show that KL stimulates PrF to develop into

mF and promotes thecal cell recruitment from stromal cells in rats.hus, folliculogenesis is a very comprehensive event, however, itsechanism is not completely understood. If DES affects folliculo-

enesis, DES may alter the expression of these intraovarian factors.

and J) mice. Ovaries of 3- (A and B), 5- (C–F) and 7-day-old mice (G-J). In 5- andd J), respectively. Both oil- and DES-exposed mouse ovaries contain germ cell cysts

, D, G and H), primary follicles (PmFs) (open arrows) (E, F, G and J) and secondaryposed mice (F and J). Scale bar = 25 �m.

H. Kim et al. / Reproductive Tox

Table 1Sequences of oligonucleotides used as primers for RT-PCRor real-time quantitativePCR.

Gene Forward sequence (5′ → 3′) Reverse sequence (5′ → 3′)

Fig� CCAAAGAGCGTGAACGGATAA AGAGCCTTCAGCTTGGCAAAGNobox TGCCGCTGGAGCTAAAGAGTA CAACATAGCAGGCCAGTCCATSohlh1 CCTGGCGAATCAGATTGCA CCGAGACACAGCAGATGGTTTFoxl2 AGCCAAGTTCCCGTTCTACGA AGGTTGTGGCGGATGCTATTCFoxo3a AAGAACTCCATCCGGCACAA CCCGTGCCTTCATTCTGAANGF GGCCGAGGTGAACATTAACAA CGGCACTTGGTCTCAAAAAAGTrkB CCTGCGGCACATAAATTTCA GAACGGATTACCCGTCAGGATKit TACACGT

GCAGCAACAGCAAGAAGGCCAACCAGGAAAAGTT

K

C

temFDo

2

2

lwactamo�M5

2

otat 8 �m and stained with HE. The number of primordial follicles, primary folli-

Fw

L GGA AAAT AGT GGATGACCACGT GT

TGGCCTCTTCGGAGATTCTTT

yclophilin AGGTCCTGGCATCTTGTCCAT CCATCCAGCCATTCAGTCTTG

This study examined the effects of neonatal DES exposure onhe cyst breakdown and formation of PrFs. In order to study theffects of DES on follicle growth, we examined histology and the

RNA expression using real-time PCR in neonatal mouse ovaries.

urthermore, to elucidate the involvement of ER subtypes in theES signaling, histological analysis was performed in �ERKO mousevaries.

cFsFf

ig. 2. Histology of ovaries in 10-day-old, oil- (A and C) or neonatally DES-exposed (B anere observed (A and B). SFs (open arrowheads) are seen in inner cortex (C and D). A poly

icology 27 (2009) 55–62 57

. Materials and methods

.1. Animals

Adult C57BL/6J mice (CLEA Japan Inc., Tokyo, Japan) were kept under 12 hight/12 h dark by artificial illumination (lights on 0800-2000) at 23–25 ◦C. They

ere fed a commercial diet (MF, Oriental Yeast Co. Ltd., Tokyo, Japan) and tap waterd libitum. All animals were maintained in accordance with the NIH guide for theare and use of laboratory animals, and all experiments were approved by the insti-utional animal care committee of the Yokohama City University. �ERKO mice fromC57BL6/129sv background, were obtained by mating females heterozygous andales homozygous for ER� gene disruption, as described previously [27]. The day

f birth was regarded as day 0 of age. Female pups of C57BL/6J, wild-type (WT) andERKO mice were injected subcutaneously with 3 �g DES (Sigma Chemical, St Louis,O, U.S.A.) dissolved in 0.02 ml sesame oil or the vehicle alone from days 0 to 4 fordays.

.2. Histological analysis

Ovaries of 5-day-old C57BL/6J, WT or �ERKO mice treated neonatally with oilr DES were fixed overnight in Bouin’s solution at room temperature for Häma-oxylin and Eosin (HE) stain. Ovaries were embedded in paraffin, serially sectioned

les, secondary follicles and polyovular follicles in a section of ovaries was counted.ive different sections in the mid-portion of each ovary at least 50 �m apart wereelected for counting the number of PmFs, SFs, polyovular follicles and all follicles.ive animals in WT or �ERKO mice exposed to oil or DES were used for counting theollicles.

d D) mice. In the outer cortex of the ovary, PrFs (arrows) and PmFs (open arrows)ovular follicle (asterisk) is also seen in DES-exposed mice. Scale bar = 25 �m.

5 ve Toxicology 27 (2009) 55–62

2

nIoSt(assmp

2

dm

3

3

cBbo(tmloooceSeo(

3

1ftoso

cti7o

3

ppfe

Fig. 3. The number of follicles per section of oil- or DES-treated mouse ovaries (A).Poca

3D

5BIoainjected �ERKO mice, however, no SF was detected in 5-day-oldDES-exposed �ERKO mice (Fig. 5D and E). While PFs were fre-quently observed in ovaries of 5-day-old DES-exposed WT mice(Fig. 5F), PFs were not found in DES-exposed �ERKO mice (Fig. 5D).

8 H. Kim et al. / Reproducti

.3. Real-time quantitative PCR

Total RNA was isolated from the ovaries of 2-day-old C57BL/6J mice treatedeonatally with oil or DES, and reverse transcribed into cDNA by the Super Script

I reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, U.S.A.) using 0.05 mMilgo dT primer (Invitrogen). Real-time PCR was carried out by a Smart Cycler IIystem (Takara Bio Inc., Otsu, Japan) with SYBR Premix Ex TaqTM (Takara). Rela-ive mRNA expression of Fig�, Nobox, Sohlh1, Foxl2, Foxo3a, NGF, TrkB, Kit and KLTable 1) was determined by the second derivative method. Cyclophilin was chosens an internal standard to control variability in amplification due to differences intarting mRNA concentration. Melt curve analysis showed a single sharp peak for allamples. Five to ten mice were used for each group and three independent experi-ents were carried out for each study. Data analysis was performed followed by a

aper previously described [28].

.4. Statistical analysis

Parametric variables were analyzed by two-way analysis of variables with Stu-ent’s t-test, Dunnett or Fisher’s exact probability tests. Data were expressed as theean ± standard error. p < 0.05 was considered significantly different.

. Results

.1. Histological analysis

In 3-day-old mice, germ cell cysts were observed in the outerortex of both oil- and DES-exposed mouse ovaries (Fig. 1A and). Primordial follicles, follicles that were an oocyte surroundedy a squamous granulosa cell layer, were observed both in theuter and inner cortex (Fig. 1A and B; arrows). Germ cell cystsarrowheads) were observed in the ovaries of 3- and 5-day-old con-rol mice (Fig. 1A and C) and 3-, 5- and 7-day-old DES-exposed

ice (Fig. 1B, D and H). In 5- and 7-day-old mice, primary fol-icles, follicles that were an oocyte surrounded by a monolayerf cuboidal granulosa cells, were formed in the inner cortex ofvaries both oil- and DES-exposed mice (Fig. 1E, F, I and J). Sec-ndary follicles, follicles including two or more layers of granulosaells, have begun to appear in 7-day-old control mice, how-ver, no SF was detected in DES-exposed mice (Fig. 1I and J).Fs were observed in both ovaries of 10-day-old oil- and DES-xposed mice (Fig. 2B and D). Polyovular follicles were frequentlybserved in ovaries of 5-, 7- and 10-day-old DES-exposed miceFig. 1F and J and Fig. 2D).

.2. Ontogenic changes in the percentages of PrFs, PmFs and SFs

The number of follicles per section did not change from 5- to0-day-old oil control mice (Fig. 3A). In contrast, the number ofollicles in 5-day-old DES-exposed mice was significantly less thanhat of oil controls. PrFs decreased significantly with age in bothil control and DES-exposed mice and the percentage of PrFs perection in DES-exposed mice was significantly higher than that inil control mice (Fig. 3B).

The percentages of PmFs and SFs per section increased signifi-antly in both oil control and DES-exposed mouse ovaries from 7o 10 days of age compared with those in 5 days (Fig. 3C). However,n DES-exposed mice, the percentages of PmFs at 5 days and SFs at

and 10 days were significantly lower than those in age-matchedil controls (Fig. 3C).

.3. Polyovular follicles in the ovary of DES exposed mice

In 5-, 7- and 10-day-old mice treated with DES neonatally, theercentage of polyovular follicles was significantly higher as com-ared with that in oil controls (Fig. 4). No age related change wasound in the percentage of polyovular follicles in either oil- or DES-xposed mice between 5 and 10 days of age.

FD

ercentages of PrFs (B), PmFs and SFs (C) per section of oil- or DES-treated mousevaries. *p < 0.05, compared with age-matched oil control mice. (a and b) p < 0.05,ompared with 5-day-old mice exposed to oil (a) or DES (b). Squares indicate PrFsnd circle indicate SFs.

.4. Histological analysis of ˇERKO mice treated neonatally withES

Germ cell cysts, PrFs and PmFs were observed in the ovaries of-day-old WT mice exposed to oil or DES neonatally (Fig. 5A and). However, no SF was found in both oil- or DES-exposed WT mice.

n �ERKO mice, germ cell cysts, PrFs and PmFs were observed invaries of 5-day-old mice exposed to oil or DES neonatally (Fig. 5Cnd D). Interestingly, SFs have begun to appear in 5-day-old oil-

ig. 4. Percentage of polyovular follicles per section in ovaries from oil- or neonatallyES-treated mice. *p < 0.05, compared with age-matched oil controls.

H. Kim et al. / Reproductive Toxicology 27 (2009) 55–62 59

F sed tot WT mP

3W

slirPocmci

l(ctpD

3

Two

4

dDtsDp

ig. 5. Histology of ovaries in 5-day-old WT (A, B and F) or �ERKO (C–E) mice exporeated �ERKO mice (open arrowhead). F shows a polyovular follicle in DES treatedrFs. Open arrow indicate PmF. Scale bar = 25 �m.

.5. Changes in the number of follicles from oil- or DES-exposedT or ˇERKO mice

In DES-exposed 5-day-old WT mice, the number of follicles perection was significantly less than that in oil-exposed mice simi-ar to the results in C57BL/6J mice (Fig. 6A). A significant decreasen the follicle number caused by neonatal DES treatment was alsoecognized in �ERKO mice (Fig. 6A). In WT mice, the percentages ofrFs and PmFs were not changed by DES treatment (Fig. 6B). More-ver, in �ERKO mice, the percentages of PrFs and PmFs were nothanged by neonatal DES treatment similar to the results in WTice (Fig. 6B). As described above, the percentage of SFs signifi-

antly decreased in DES-exposed �ERKO mice compared with thatn oil-exposed �ERKO mice (Fig. 6B).

DES treatment increased number of mice with polyovular fol-icles significantly both in WT and �ERKO mice at 5 days of age

Fisher’s exact probability test). The percentage of polyovular folli-les per section in DES-exposed WT mice was significantly higherhan that in oil controls (Fig. 6B). However, the percentage ofolyovular follicles per section did not change in oil controls andES-exposed �ERKO mice.

mPini

oil (A, C and E) or DES (B, D and F) neonatally. E shows SF in the inner cortex of oilouse ovaries (asterisk). Arrowheads indicate germ cell cysts and arrows indicate

.6. Changes in the mRNA expression in 2-day-old mouse ovaries

The mRNA expression of Fig�, Nobox, Sohlh1, Foxl2, Foxo3a, NGF,rkB, Kit and KL, genes which are associated with follicular growth,as not changed by neonatal DES treatment in 2-day-old mouse

varies (Fig. 7).

. Discussion

This study shows that neonatal DES exposure delayed follicleevelopment in C57BL/6J mouse ovaries. In the ovary of 5-day-oldES-exposed mice, the percentage of PrFs was significantly higher

han that in oil-exposed mice, whereas the percentage of PmFs wasignificantly lower. The number of follicles was also decreased byES exposure in 5-day-old mice. These results suggest that DES sup-resses PrF formation and PmF progression from PrFs in 5-day-old

ouse ovaries. In 10-day-old DES-exposed mice, the percentage of

rFs was not altered, however, the percentage of SFs was signif-cantly lower than that in oil controls. These results suggest thateonatal DES exposure also suppresses SF progression from PmFs

n 10-day-old mice.

60 H. Kim et al. / Reproductive Tox

Fig. 6. The number of follicles per section of 5-day-old oil- or DES-treated WT and�po

bfultmng1simcttieI

Fm

lsmoPPmeipirfPadaAotsoobDaTi

iaeEunhrPlpdP

ERKO mouse ovaries (A). Percentages of PrFs, PmFs, SFs and polyovular follicles (B)er section of oil or DES-treated mouse ovaries. *p < 0.05, compared with respectiveil-treated mice. **p < 0.05, compared with WT oil control mice.

Formation of PrF and an initiation of PrF to PmF transition haveeen shown without gonadotropins in vitro [29,30]. In addition,olliculogenesis of LH or FSH receptor knockout mice is normalntil the preantral stage [31,32], suggesting that the early follicu-

ogenesis is independent on gonadotropins, and local factors arehought to be the main regulators in this process. Expression of

RNAs which are associated with PrF and PmF development wasot changed by DES exposure in 2-day-old C57BL/6J mice. It sug-ests that the delay of follicle development by DES exposure in 5- to0-day-old mice is not accompanied with changes in mRNA expres-ion of Nobox, Fig�, Sohlh1, Foxl2, Foxo3a, Kit, KL, NGF and TrkBn 2-day-old mice. There are few PmFs fully formed in 2-day-old

ouse ovaries. If any of these factors are expressed only in follicleells, changes in their expression level may not be detected againsthe background of the other cell types making up the majority of

he ovary. Therefore, further studies are needed to identify ovar-an cell types expressing these genes in this stage and to examinexpression of these genes at late stage of ovarian development.n addition, other factors may be involved in the disorder of fol-

ig. 7. Changes in mRNA expression of genes related to follicular growth in 2-day-oldouse ovaries.

ebonE

cfme5ebTEEtt[f

an

icology 27 (2009) 55–62

iculogenesis in DES-exposed neonatal mice. Müllerian inhibitingubstance (MIS), also known as anti-Müllerian hormone (AMH), is aember of the TGF� superfamily and is produced by granulosa cells

f small growing follicles [33]. MIS inhibits recruitment of PrFs tomFs directly and indirectly inhibits FSH action which progressesmFs to SFs [34]. In 5-day-old DES-exposed mouse ovaries, MISRNA is high compared with that in oil-exposed mice [12]. Nagai

t al. [35] have shown that the expression of MIS mRNA is increasedn PmFs of 7-day-old DES-exposed rats. In addition, MIS mRNA androtein expression are increased but follicular growth is inhibited

n estradiol benzoate-exposed rats [36]. Therefore, MIS may playoles in the delay of PmF progression from PrFs and SF progressionrom PmFs in neonatally DES-exposed mice. SF progression frommFs requires other local factors such as GDF-9, BMP-4, BMP-7 andctivins [37]. In GDF-9 null mice, follicle development beyond PmFsoes not occur [38]. Addition of BMP-4 and BMP-7 decreases PrFs,nd increases PmFs and preantral follicle number in vitro [39,40].ctivin stimulates granulosa cell proliferation in preantral folliclesf immature mice [41]. The follicle development is also arrested athe early antral stage in activin type-IIB receptor deficient mice,uggesting further supporting roles of activin in the promotionf granulosa cell proliferation/differentiation [42]. Thus, the dis-rder of folliculogenesis induced by neonatal DES exposure maye correlated with changes in TGF� superfamily. In fact, neonatalES or E2 exposure decreases the number of small antral follicles,ctivin �-subunit mRNA and protein levels [43]. The expression ofGF� superfamily genes in neonatally DES-exposed mice should benvestigated to elucidate the mechanisms of early folliculogenesis.

Studies using ER� and/or ER� knockout mice showed their rolesn the ovary. Adult �ERKO mice have large hemorrhagic folliclesnd absence of corpora lutea in the ovary because of chronicallylevated LH levels caused by lack of the negative feedback throughR� in the hypothalamus [44]. Folliculogenesis proceeds normallyp to the preantral stage in �ERKO mice [27,45]. Therefore, ER� isot thought to be essential for early folliculogenesis. On the otherand, �ERKO mice carry less copora lutea in the ovary and showeduced fertility compared to WT mice [27]. In adult �ERKO mice,rFs are increased but PmFs are decreased, and large preantral fol-icles in immature �ERKO mice are increased [46]. Thus, ER� maylay a role in controlling early folliculogenesis. It is suggested byata from aromatase knockout mice that estrogen may regulate therF pool [47]. Hegele-Hartung et al. [48] have elucidated that directffects of estrogen on ovarian follicle development are mediatedy ER�· Furthermore, ER� and ER� double knockout mouse showsvarian follicle transdifferentiation to structures resembling semi-iferous tubules of the testis [49]. These reports suggest that bothR� and ER� are involved in early follicle formation and regulation.

In 5-day-old �ERKO mice, the number of follicles did not changeompared with that in WT mice, suggesting that ER� is not crucialor PrF formation. Numbers of PrFs and PmFs in immature �ERKO

ice are similar to those in WT mice [46]. Thus, ER� is not nec-ssary for PrF formation in either neonatal or immature mice. In-day-old WT mice, the number of follicles was decreased by DESxposure as well as in C57BL/6J mice. Similar to WT mice, the num-er of follicles was also decreased by DES exposure in �ERKO mice.hese results suggest that DES inhibits the follicle formation andR� is not involved in this DES effect. Although an innate role ofR� in the neonatal ovary is not yet known, our results suggesthat ER� may mediate DES signals to inhibit PrF assembly. However,here are membrane-associated receptors that also bind estrogen

50]. It is also possible that these non-canonical ERs are involved inolliculogenesis.

While neonatal DES exposure delays PmF progression from PrFsnd SF progression from PmFs in 5- and 10-day-old C57BL/6J mice,umbers of PrFs and PmFs in WT mice were not changed by DES

ve Tox

eme

o[StmctTlcDtp

gmlpm

lwtFon

C

A

tSeoto

R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

H. Kim et al. / Reproducti

xposure. It seems that effects of DES on follicular developmentay be dependent on mouse strains. Strain differences in DES

ffects are also reported in the induction of polyovular follicles [51].On the other hand, SFs were occasionally observed in 5-day-

ld �ERKO mice. SFs usually appear around 7 days of age in mice16]. Thus, SF progression from PmFs is promoted in �ERKO mice.ince SF progression from PmFs requires granulosa cell prolifera-ion, ER� may negatively regulate the cell proliferation of neonatal

ouse granulosa cells. ER� plays a role in the inhibition of epithelialell proliferation in the adult prostate and uterus [52,53]. However,he mechanisms by which ER� inhibit cell proliferation are unclear.he percentage of SFs in DES-exposed �ERKO mice was significantlyower than that in oil-exposed �ERKO mice. This suggests that pre-ocious SF progression due to lack of ER� is cancelled by neonatalES exposure via ER�. DES may inhibit granulosa cell proliferation

hrough ER� or restore a negative signaling pathway that affects SFrogression.

Jefferson et al. [54] have reported that neonatal treatment ofenistein induced polyovular follicles in wild-type mice and �ERKOice but not �ERKO mice, suggesting ER� in induction of polyovu-

ar follicles. In the present study, neonatal DES treatment inducedolyovular follicles in C57BL mice and WT mice but not in �ERKOice, agreeing with previously reported findings [54].In conclusion, this study shows that the induction of polyovu-

ar follicles and the delay of follicle development in neonatal miceere caused by neonatal DES treatment. DES affects follicle forma-

ion and suppresses follicular development via ER� but not ER�.urther study is needed to investigate the molecular mechanismf DES action in the induction of follicular developmental delay inewborn mouse ovaries.

onflict of interest

There is no conflict of interest.

cknowledgments

This work was partially supported by a Grant-in-Aid for Scien-ific Research (B) (T.I.), a Grant-in-Aid for Encouragement of Youngcientists (T.S.) from the Ministry of Education, Culture, Sports, Sci-nce and Technology of Japan, Grants for Support of the Promotionf Research at Yokohama City University (No. K17030 and W18005,o S.H. and T.S.), a Health Sciences Research Grant from the Ministryf Health, Labor and Welfare, Japan (to T.I.).

eferences

[1] Takasugi N. Vaginal cornification in persistent-estrous mice. Endocrinology1963;72:607–19.

[2] Forsberg JG. Developmental mechanism of estrogen-induced irreversiblechanges in the mouse cervicovaginal epithelium. Natl Cancer Inst Monogr1979;51:41–56.

[3] Newbold RR, McLachlan JA. Diethylstilbestrol associated defects in murinegenital tract developmental. In: McLachlan JA, editor. Estrogens in the environ-ment II: influences in development. New York: Elsevier North Holland; 1985.p. 288–318.

[4] Iguchi T. Cellular effects of early exposure to sex hormones and abnormalitiesof female reproduction. Int Rev Cytol 1992;139:1–57.

[5] Iguchi T, Sato T. Endocrine disruption and developmental abnormalities offemale reproduction. Am Zool 2000;40:402–11.

[6] Tenenbaum A, Forsberg JG. Structural and functional changes in ovaries fromadult mice treated with diethylstilbestrol in the neonatal period. J Reprod Fertil1985;73:465–77.

[7] Iguchi T, Takasugi N, Bern HA, Mills KT. Frequent occurrence of polyovular fol-licles in ovaries of mice exposed neonatally to diethylstilbestrol. Teratology1986;34:29–35.

[8] Iguchi T, Fukuzawa Y, Uesugi Y, Takasugi N. Polyovular follicles in mouseovaries exposed neonatally to diethylstilbastrol in vivo and in vitro. Biol Reprod1990;43:478–84.

[

[

icology 27 (2009) 55–62 61

[9] Kuiper GGJM, Carlsson B, Grandien K, Enmarkr E, Haggblad J, Nilsson S, et al.Comparison of ligand binding specificity and transcript tissue distribution ofestrogen receptors � and �. Endocrinology 1997;138:863–70.

10] Sar M, Welsch F. Differential expression of estrogen receptor-� and estrogenreceptor-� in rat ovary. Endocrinology 1999;140:963–71.

11] Couse JF, Korach KS. Estrogen receptor-� mediates the detrimental effects ofneonatal diethylstylbestrol (DES) exposure in the murine reproductive tract.Toxicology 2004;205:55–63.

12] Kirigaya A, Sato T, Iguchi T, Hayashi S. Involvement of MIS and ER� in inductionof polyovular follicles (PF) in mouse ovary treated with DES neonatally. ZoolSci 2004;21:1341.

13] Pepling ME, Spradling AC. Female mouse germ cell form synchronously dividingcysts. Dev Biol 1998;125:3323–8.

14] Pepling ME, Spradling AC. Mouse ovarian germ cell cysts undergo programmedbreakdown to form primordial follicles. Dev Biol 2001;234:339–51.

15] Epifano O, Dean J. Genetic control of early folliculogenesis in mice. TrendsEndocrinol Metabol 2002;13:169–73.

16] Peters H. The development if mouse ovary from birth to maturity. ActaEndocrinol 1969;62:98–116.

17] Soyal SM, Amleh A, Dean J. FIG�, a germ cell-specific transcription factorrequired for ovarian follicle formation. Dev Biol 2000;127:4645–54.

18] Rajkovic A, Pangas SA, Ballow D, Suzumori N, Martzuk MM. Nobox deficiencydisrupts early folliculogenesis and oocyte-specific gene expression. Science2004;305:1157–9.

19] Pangas SA, Choi Y, Ballow DJ, Zhao Y, Westphal H, Matzuk MM, et al. Oogenesisrequires germ cell-specific transcriptional regulaters Sohlh1 and Lhx8. ProcNatl Acad Sci USA 2006;103:8090–5.

20] Loffler KA, Zarkower D, Koopman P. Etiology of ovarian failure in blepharophi-mosis ptosis epicanthus inversus syndrome: FOXL2 is a conserved, early-actinggene in vertebrate ovarian development. Endocrinology 2003;144:3237–43.

21] Schmidt D, Ovitt CE, Anlag K, Fehsenfeld S, Gredsted L, Treier AC, et al. Themurine winged-helix transcription factor Foxl2 is required for granulose celldifferentiation and ovary maintenance. Development 2004;131:933–42.

22] Casteillon DH, Miao L, Kollipara R, Horner JW, Depinho RA. Suppression ofovarian follicle activation in mice by the transcription factor Foxo3a. Science2003;301:215–8.

23] Dissen GA, Romero C, Hirshfield AN, Ojeda SR. Nerve growth factor is requiredfor early follicular development in the mammalian ovary. Endocrinology2001;142:2078–86.

24] Ojeda SR, Romero C, Tapia V, Dissen GA. Neurotrophic and cell–cell dependentcontrol of early follicular development. Mol Cell Endocrinol 2000;163:67–71.

25] Paredes A, Romero C, Dissen GA, DeChiara TM, Reichardt L, Cornea A, et al.TrkB receptors are required for follicular growth and oocyte survival in themammalian ovary. Dev Biol 2004;267:430–49.

26] Parrott JA, Skinner MK. Kit-ligand/stem cell factor induces primordial folli-cle development and initiates folliculogenesis. Endocrinology 1999;140:4262–71.

27] Dupont S, Krust A, Gansmuller A, Dierich A, Chambon P, Mark M. Effects ofsingle and compound knockouts of estrogen receptors � (ER�) and � (ER�) onmouse reproductive phenotypes. Development 2000;127:4277–91.

28] Bookout AL, Mangelsdorf DJ. Quantitative real-time PCR protocol for analysisof nuclear receptor signaling pathways. Nuc Receptor Signal 2003;1:e012.

29] Kezele P, Skinner MK. Regulation of ovarian primordial follicle assembly anddevelopment by estrogen and progesterone: endocrine model of follicle assem-bly. Endocrinology 2003;144:3329–37.

30] Chen Y, Jefferson WN, Newbold RR, Banks EP, Pepling ME. Estradiol, proges-terone and genistein inhibit oocyte nest breakdown and primordial follicleassembly in the neonatal mouse ovary in vitro and in vivo. Endocrinology2007;148:3580–90.

31] Zhang FP, Poutanen M, Wilbertz J, Huhtaniemi I. Normal prenatal but arrestedpostnatal sexual development of luteinizing hormone receptor knockout(LuRKO) mice. Mol Endocrinol 2001;15:172–83.

32] Abel MH, Huhtaniemi I, Pakarinen P, Kumar TR, Charlton HM. Age-relateduterine and ovarian hypertrophy in FSH receptor knockout and FSH� subunitknockout mice. Reproduction 2003;125:165–73.

33] Baarends WM, Uilenbroek JT, Kramer P, Hoogerbrugge JW, van Leeuwen EC,Themmen AP, et al. Anti-Müllerian hormone and anti-Müllerian hormone typeII receptor messenger ribonucleic acid expression in rat ovaries during postna-tal development, the estrous cycle, and gonadotropin-induced follicle growth.Endocrinology 1995;136:4951–62.

34] Visser AJ, Themmen APN. Anti-Müllerian hormone and folliculogenesis. MolCell Endocrinol 2005;234:81–6.

35] Nagai A, Ikeda Y, Aso T, Eto K, Ikeda M. Exposure of neonatal rats to diethyl-stilbestrol affects the expression of genes involved in ovarian differentiation. JMed Dent Sci 2003;50:35–40.

36] Ikeda Y, Nagai A, Ikeda M, Hayashi S. Increased expression of Müllerian-inhibiting substance correlates which inhibition of follicular growth in thedeveloping ovary rats treated with E2 benzoate. Endocrinology 2002;143:

304–12.

37] Knight PG, Glister C. TGF-beta superfamily members and ovarian follicle devel-opment. Reproduction 2006;132:191–206.

38] Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N, Matzuk M. Growth dif-ferentiation factor-9 is required during early ovarian folliculogenesis. Nature1996;383:531–5.

6 ve Tox

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[estrogen receptor � in uterine stroma and epithelium: insights from estrogen

2 H. Kim et al. / Reproducti

39] Lee WS, Yoon SJ, Yoon TK, Cha KY, Lee SH, Shimasaki S, et al. Effects of bonemorphogenetic protein-7 (BMP-7) on primordial follicular growth in the mouseovary. Mol Reprod Dev 2004;69:159–63.

40] Nilsson EE, Skinner MK. Bone morphogenetic protein-4 acts as an ovarian fol-licle survival factor and promotes primordial follicle development. Biol Reprod2003;69:1265–72.

41] Liu L, Rajareddy S, Reddy P, Jagarlamudi K, Shen Y, Gunnarsson D, et al. Infertilitycaused by retardation of follicular development in mice with oocyte-specificexpression of Foxo3a. Development 2007;134:199–209.

42] Matzuk MM, Kumar TR, Shou W, Coerver KA, Lau AL, Behringer RR, et al.Transgenic models to study the roles of inhibins and activins in reproduction,oncogenesis, and development. Rec Progr Horm Res 1996;51:123–54.

43] Kipp JL, Kilen SM, Bristol-Gould S, Woodruff TK, Mayo KE. Neonatal exposureto estrogens suppresses activin expression and signaling in the mouse ovary.Endocrinology 2007;148:1968–76.

44] Couse JF, Yates MM, Deroo BJ, Korach KS. Estrogen receptor � is critical togranolosa cell differentiation and the ovulatory response to gonadotropins.Endocrinology 1999;146:3247–62.

45] Shomberg DW, Couse JF, Mukerjee A, Lubahn DB, Sar A, Mayo KE, et al. Targeted

disruption of estrogen receptor-� gene in female mice: characterization ofovarian responses and phenotype in adult. Endocrinology 1999;140:2733–44.

46] Emmen JMA, Couse JF, Elmore SA, Yates MM, Kissling GE, Korach KS. In vitrogrowth and ovulation of follicles from ovaries of estrogen receptor (ER) � andER� null mice indicate a role for ER� in follicular maturation. Endocrinology2005;146:2817–26.

[

icology 27 (2009) 55–62

47] Britt KL, Saunders PK, Mcpherson SJ, Misso ML, Simpson ER, Findlay JK. Estro-gen actions on follicle formation and early follicle development. Biol Reprod2004;71:1712–23.

48] Hegele-Hartung C, Siebel P, Peters O, Kosemund D, Müller G, Hillisch A, et al.Impact of isotype-selective estrogen receptor agonists on ovarian function. ProcNatl Acad Sci USA 2004;101:5129–34.

49] Couse JF, Hewitt SC, Bunch DO, Sar M, Walker VR, Davis BJ, Korach. Postnatalsex reversal of the ovaries in mice lacking estrogen receptors � and �. Science1999;286:2328–31.

50] Marino M, Galluzzo P, Ascenzi P. Estrogen signaling multiple pathways toimpact gene transcription. Curr Genomics 2006;7:497–508.

51] Iguchi T, Ohta Y, Fukuzawa Y, Takasugi N. Strain differences in the induction ofpolyovular follicles by neonatal treatment with diethylstilbestrol in mice. MedSci Res 1987;15:1407–8.

52] Imamov O, Morani A, Shim GJ, Omoto Y, Andersson CT, Warner M, et al. Estrogenreceptor � regulates epitherial cellular differentiation in the mouse ventralprostate. Proc Natl Acad Sci USA 2004;101:9375–80.

53] Hiraike OW, Hiraike H, Okinaga H, Imamov O, Barros RPA, Morani A, et al. Role of

receptor �−/− mice. Proc Natl Acad Sci USA 2006;103:18350–5.54] Jefferson WN, Couse JF, Padilla-Banks E, Korach KS, Newbold RR. Neonatal expo-

sure to genistein induces estrogen receptor (ER)� expression and multioocytefollicles in the maturing mouse ovary: evidence for ER�-mediated and none-strogenic actions. Biol Reprod 2002;67:1285–96.