Integrating the work of many other previous iGEM teams (Tokyo NoKoGen 2010, Chiba 2009, 2010, British Columbia 2009, Cambridge 2010, UNAM-Genomics México 2010, ITESM Monterrey 2010), the aim of this project was to develop a way of giving a cell the command to perform a function at user’s will, improving current lock-and-key mechanisms. A novel system based on an E. coli chassis, was designed with two main objectives: to sense arabinose reporting its concentration and to use light receptors to trigger the expression of the required pathways. The first receptor enables E. coli activity, expressing the arabinose sensing mechanism; whereas the second receptor activates a quick deactivation (degradation) of the sensing mechanism, depriving the cell of that capability.

Aguilar, Mónica; Amaya, Laura; Campos, Patricia; Cano, Nelson; Colunga, Indira I.; Díaz, Aldo A. ; Guerrero, Israel; Machado, Rodrigo; Maycotte, David; Morales, Cintli C.; Nieto, Mariana; Taveras, Rossel; Vásquez Jorge A.; Villarreal, Antonio.

ADVISORS: Mishra Prashant K. (pmishra@itesm.mx); Vázquez-Flores, Sonia (svazquef@itesm.mx)

Dual Light Controlled Arabinose Biosensor

The construct combines three plasmids, the green receptor activates the expression of the RecA final product, a protein that binds into the operators, allowing the expression of pBAD´s in presence of arabinose (depending on concentration). When there is a high concentration, the low concentration plasmid will be inactivated by the iTa-st. If there is a low concentration, the plasmid will activate the pBAD´s along with keys and anti-keys in order to avoid the expression of both fluorescent proteins.

Photoreceptor mechanism Inspired by the Tokio-Nokogen iGEM team 2009. This mechanism was modified by adding the green light receptor instead of the whole mechanism, including also the red light receptor mechanism. The most important modification of this system was the inclusion of the protein RecA in our construct, making it compatible to the regulation system of the lambda phage incorporated into the concentration scheme. The green receptor, used to initiate the entire mechanism, is composed of eight parts, in a sequence of twelve . RecA is a protein used for the cleavage of the protein lambda, it has been shown that it has a cleavage activity when a lambda repressor is bound. This is an essential part of the project, because these interactions are the links between the photoreceptor and the concentration mechanisms by the lambda repressor and the lambda operators.

Concentration mechanism Based on the experiments and mechanisms developed by British Columbia University iGEM team in 2009. We re-designed certain pieces to make them more specific, modifying the lock and key mechanism, and creating more parts: one lock and key specific for the high concentration and other lock and key designed for low concentrations. We included also a new Biobrick® that regulates one of the keys by inactivating it. This operators can only be free once the RecA protein cleaves the lambda repressor, so the expression can continue. To assure that only the high concentration mechanism is enabled , there is the need to turn down the low concentration, this is achieved by expressing an antisense sequence key (iTa-st) that inhibits the production of the low concentration key (Ta-st) sequence, thus the low-concentration lock (Crx-st) will activate and will inhibit the expression of GFP.

Future research

Conclusions

Millions of numbers. There are wide varieties of biosensors in the World, responsible for detecting a specific factors but not all of them can tell exactly the amount of such factor. We propose a biosensor that can be capable of detecting a specific analyte by glowing according to the detected concentration. Switch off. Just as electrical energy, “if you are not using it…turn it off”, our mechanism is designed to be useful just when in need, when it matters. As it had been set to express two kind of fluorescent proteins, this biosensor can be easily interpreted, by anyone with no previous training. Applications. The mechanism of the bacteria can be set for different analytes, giving the opportunity to expand the market of the biosensor to practically any industry. Examples: Contaminants , intelligent medicines, domestic care

The GFP fluorescent mechanism was successfully designed, incorporated and tested in a bacterial system in one occasion (a + b + c), and lately the separate composites: constitutive promoter + Crx-st + RBS + GFP + Stop; constitutive promoter + Ta-st + Stop; constitutive promoter + iTa-st + Stop. The system has yet to be tested for low and high arabinose quantities, as well as for the lowest detection level of fluorescence with fluorocytometry. Nonetheless, this study opens a new window for further experimentation for concentration dependent detection mechanisms for other metabolites.

The following composite parts were cloned into DH5α and BW27783 competent cells using the standard CaCl2 transformation protocol: a. Constitutive promoter + Crx-st + RBS + GFP + Stop b. Constitutive promoter + Ta-st + Stop c. Constitutive promoter + iTa-st + Stop

First,weneedtohaveour

transformedcellswiththe

entireconstructandapply

greensomelightto

activatethemechanismOncethegreenlightanda

smallamountofarabinose

ispresentIexpressGFP

IfIdetecthigherconcentrationof

arabinoseIcanproducetheCyan

FluorescentProtein,butfirstI

havetoblocktheGFPexpression

Withsomeredlightallmy

fluorescentproteinwill

starttodegradeandthe

mechanismwillbereset

Figure 2. Construct conformation and part assembly

Figure 1. Plasmid assembly

Figure 3. Scheme of the photoreceptor mechanism

Figure 4. Scheme of the concentration mechanism

Lane Sample Expected size Digestion

enzymes

1 Ladder 1 kb

3 Ta-wk Vector pUC57: 2710 bp Insert: 122 bp EcoR1-Pst1

4 Rec A Vector pUC57: 2710 bp Insert: 1103 bp EcoR1-Pst1

5 CR12+DNAx Vector pUC57: 2710 bp Insert: 78 bp EcoR1-Pst1

6 iTa-st Vector pUC57: 2710 bp Insert: 124 bp EcoR1-Pst1

7 DH5α DNA competent cell EcoR1-Pst1

8 Ta-st’ Vector pUC57: 2710 bp Insert: 123 bp EcoR1-Pst1

9 Ta-wk’ Vector pUC57: 2710 bp Insert: 122 bp EcoR1-Pst1

10 RecA’ Vector pUC57: 2710 bp Insert: 1103 bp EcoR1-Pst1

11 iTa-st’ Vector pUC57: 2710 bp Insert: 124 bp EcoR1-Pst1

12 Crxst’ Vector pUC57: 2710 bp Insert: 78 bp EcoR1-Pst1

We have some evidence that the construct fully assembled. Bacteria were inoculated into several Petri dishes with LB agar and the appropriate antibiotic (chloramphenicol) to screen for transformants. After a 24 hour incubation at 37°C, there were white colonies in most of the dishes that had bacteria transformed with all the composite parts. These dishes were submitted to UV light to see if they produced fluorescence, although there was evidence of reaction, it was not conclusive, nor uniform in all the cultures. Three biobricks were registered BBa_K587002 (Crx-st Lock sequence for concentration mechanism); BBa_K587004 (Ta-wk -> Key to unlock Crx-wk); BBa_K587005 (iTa-st -> inhibits the action of Ta-st). The design of three pairs of primers was performed with CLCbio software: BS1F (TGCCACCTGACGTCTAAGAA) & BS1R (CGGAAGATTCTGGTCCGTAG); BS2F (GTTCCATGGATGTGGAAACC) & BS2R(CAGCGATTTTGTTCTTCACC); BS3F (GGGTAACCTGAAGCAGTCCA) & BS3R (AACCGTATTACCGCCTTTGA). Sequencing of the parts a, b and c are currently being performed in INB-UNAM, Mexico.

Lane Sample Molecular weight of expected bands

10 pSB1C3 PCR

3139 bp

11 pSB1C3 PCR

3139 bp

2% gel with PCR product of the constructed Backbone BBAJ_04450 with a 4µl of Fermentas

O’Gene RulerTM 100 kb.

Figure 6. Culture of part A with evidence of white colonies

Figure 5. Photoreceptor mechanism dual light response

Figure 7. Evidence of bands of some successful ligations and PCR products of the

Backbone BBAJ_04450

1 % gel, V Ligated pieces with lambda phage T4, 4µl of Fermentas O’Gene RulerTM 1kb ; digested DNA 10 µl in 0. 5µl of

6x Orange DNA Loading Dye . The gel was run at 100 V for 30 minutes.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15