of January 6, 2019.This information is current as

SpirochetesPutative Virulence Factor of Relapsing Fever Factor H and Plasminogen Discloses aRegulator-Acquiring Surface Protein for -Associated Complement

Borrelia hermsiiDual Binding Specificity of a

Zipfel and Reinhard WallichSkerka, Michael Kirschfink, Markus M. Simon, Peter F. Evelyn Rossmann, Peter Kraiczy, Pia Herzberger, Christine

http://www.jimmunol.org/content/178/11/7292doi: 10.4049/jimmunol.178.11.7292

2007; 178:7292-7301; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/178/11/7292.full#ref-list-1

, 34 of which you can access for free at: cites 61 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists All rights reserved.Copyright © 2007 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on January 6, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

by guest on January 6, 2019

http://ww

w.jim

munol.org/

Dow

nloaded from

Dual Binding Specificity of a Borrelia hermsii-AssociatedComplement Regulator-Acquiring Surface Protein for FactorH and Plasminogen Discloses a Putative Virulence Factor ofRelapsing Fever Spirochetes1,2

Evelyn Rossmann,3* Peter Kraiczy,3† Pia Herzberger,† Christine Skerka,‡ Michael Kirschfink,*Markus M. Simon,§ Peter F. Zipfel,‡ and Reinhard Wallich4*

Tick-borne relapsing fever in North America is primarily caused by the spirochete Borrelia hermsii. The pathogen employsmultiple strategies, including the acquisition of complement regulators and antigenic variation, to escape innate and humoralimmunity. In this study we identified in B. hermsii a novel member of the complement regulator-acquiring surface protein(CRASP) family, designated BhCRASP-1, that binds the complement regulators factor H (FH) and FH-related protein 1 (FHR-1)but not FH-like protein 1 (FHL-1). BhCRASP-1 specifically interacts with the short consensus repeat 20 of FH, thereby main-taining FH-associated cofactor activity for factor I-mediated C3b inactivation. Furthermore, ectopic expression of BhCRASP- 1converted the serum-sensitive Borrelia burgdorferi B313 strain into an intermediate complement-resistant strain. Finally, wereport for the first time that BhCRASP-1 binds plasminogen/plasmin in addition to FH via, however, distinct nonoverlappingdomains. The fact that surface-bound plasmin retains its proteolytic activity suggest that the dual binding specificity ofBhCRASP-1 for FH and plasminogen/plasmin contributes to both the dissemination/invasion of B. hermsii and its resistanceto innate immunity. The Journal of Immunology, 2007, 178: 7292–7301.

B orrelia hermsii and Borrelia turicatae are the main vec-tor-borne pathogens causing human relapsing fever, anacute infectious disorder, in the United States (1). In case

of B. hermsii, spirochetes are transmitted to humans within min-utes through the bite of infected soft ticks, in particular Ornithodo-ros hermsii. B. hermsii has evolved multiple strategies to escapeinnate and adaptive immune responses and to persist in the blood(2, 3), including multiphasic antigenic variation mediated by Vmpproteins (4–6).

A further strategy of bacteria to resist hosts’ innate immunity,which constitutes the first barriers to infection, is their potential toacquire fluid phase complement regulators, particularly those ofthe alternative complement pathway such as factor H (FH),5 to the

spirochetal surface. Bound FH controls complement activation byaccelerating the decay of the C3 convertase of the alternative path-way and by inactivating newly formed C3b (7, 8) as shown forseveral important human pathogens, e.g., Candida albicans, Neis-seria gonorrhoeae, Streptococcus pyogenes, and Streptococcuspneumoniae (9–14). FH represents the main human fluid phaseregulator of the alternative pathway of complement activation andbelongs to the factor H protein family, which consists of sevenstructurally related proteins in humans including FH-like protein 1(FHL-1) and the FH-related proteins (FHRs) (15). All FH proteinfamily members are composed of short consensus repeats (SCRs)(15, 16). In contrast to FH and FHL-1, the precise function(s) ofthe FHR proteins is currently unknown. For B. hermsii, surface-bound FH was shown to participate as a cofactor for factorI-mediated cleavage of C3b (17–19). Furthermore, for theclosely related spirochete Borrelia burgdorferi, the causal agentof Lyme disease, a strong correlation between the serum resis-tance of a given isolate and its expression profile of FH-bindingouter surface lipoproteins, termed complement regulator-ac-quiring surface proteins (CRASP), was reported (20 –28).Moreover, it was suggested that the dominant FH binding mol-ecule of serum-resistant B. burgdorferi strains, BbCRASP-1, isnecessary to resist killing by human serum (29).

Some bacteria, such as Porphyromonas gingivalis, Pseudomo-nas aeruginosa, and Clostridium perfringens, produce their ownproteolytic enzymes that digest the extracellular matrix to facilitateinvasion (30). Others, like B. burgdorferi and Borrelia crocidurae,make use the hosts’ fibrinolytic system to invade tissues (31–34).

*Infectious Immunology Group, Institute for Immunology, University of Heidelberg,Heidelberg, Germany; †Institute of Medical Microbiology and Infection Control, Uni-versity Hospital of Frankfurt, Frankfurt, Germany; ‡Molecular Immunobiology Groupand Department of Infection Biology, Leibniz-Institute for Natural Products Re-search, Jena, Germany; and §Metschnikoff Laboratory, Max-Planck-Institute for Im-munobiology, Freiburg, Germany

Received for publication November 20, 2006. Accepted for publication March13, 2007.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 We are indebted for the financial support of the Deutsche ForschungsgemeinschaftGrants Wa 533/7-1 (to R.W.) and Kr 3383/1-1 (to P.K.). This work forms part of thePh.D. thesis of E.R. and P.H.2 The sequence presented in this article has been submitted to EMBL/GenBank underaccession number AM408562.3 E.R. and P.K. contributed equally to this work.4 Address correspondence and reprint requests to Dr. Reinhard Wallich, InfectiousImmunology Group, Institute for Immunology, University of Heidelberg, Im Neuen-heimer Feld 305, Heidelberg, Germany. E-mail address: wallich@uni-hd.de5 Abbreviations used in this paper: FH, factor H; FHL-1, FH-like protein 1; FHR,FH-related protein; CRASP-1, complement regulator-acquiring surface protein 1;BbCRASP-1, Borrelia burgdorferi CRASP-1; BhCRASP-1, Borrelia hermsii

CRASP-1; NHS, normal human serum; Osp, outer surface protein; SCR, shortconsensus repeat; uPA, urokinase-type plasminogen activator.

Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00

The Journal of Immunology

www.jimmunol.org

by guest on January 6, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

Accordingly, spirochetes bind the host plasminogen that is subse-quently processed via urokinase-type plasminogen activator (uPA)to active plasmin, a broad-spectrum serine protease, leading toextracellular matrix degradation (31, 33, 35–37). B. burgdorferiorganisms bind host plasminogen via a multitude of outer surfaceproteins (Osp), such as OspA and OspC, a 70-kDa protein, andseveral low molecular weight proteins (33, 35, 38, 39). Thus, thefact that relapsing fever spirochetes, including B. hermsii, alsodisseminate from the blood to many distinct organs suggests theinvolvement of plasminogen-binding proteins in these processes.

By screening a B. hermsii expression library we have now identi-fied a novel 21.5 kDa outer surface lipoprotein termed BhCRASP-1.We demonstrate for the first time that BhCRASP-1 displays dualbinding specificities both for members of the FH complement reg-ulator protein family and for plasminogen/plasmin and that the twohost proteins bind to distinct, nonoverlapping BhCRASP-1domains.

Materials and MethodsBacterial strains and growth conditions

B. hermsii (ATCC35209) strain HS1 and YOR isolates (provided by T.Schwan, Rocky Mountain Laboratories) and the Lyme disease spirochetesB. burgdorferi isolate B31 and mutant B313 were cultivated in Barbour-Stoenner-Kelly (BSK)-H complete medium (PAN Biotech) supplementedwith 5% rabbit serum (Cell Concept) at 30°C. B313 mutant spirochetesharbor plasmids cp32-1, cp32-2, cp32-3, cp32-4, cp26, and lp7 exclusivelyand therefore lack expression of BbCRASP-1 to BbCRASP-4 (27). Bac-teria were harvested by centrifugation and washed with PBS. The densityof spirochetes was determined using dark-field microscopy and a Kovacounting chamber (Hycor Biomedical). Escherichia coli DH5� andMC1061 were grown at 37°C in 2�YT or Luria-Bertani medium,respectively.

Cloning of BhCRASP-1, construction of expression plasmids,and production of recombinant proteins

A B. hermsii genomic DNA expression library was prepared and screenedusing recombinant FH deletion constructs as previously described (22).Briefly, bacterial colonies were plated onto Luria-Bertani agar plates andtransferred to nitrocellulose filters. Membranes were incubated with super-natant of Sf9 cells infected with recombinant FHL-1 or various recombi-nant deletion constructs of FH (FH15–20, FH8–20, FH19–20) for 12 h at4°C. After three washings with TBS containing 0.2% Tween 20, filterswere incubated with antisera to SCR1–4 (8) and a mAb (VIG8) specific forSCR20 (40) in the presence of 1% MC1061 cell lysate, followed by incu-bation with the appropriate peroxidase-conjugated secondary Ab. B. herm-sii genomic DNA fragments cloned in pUEX1 or pGEX-2T plasmid de-rivatives were sequenced by using the BigDye terminator cycle sequencing

kit (PE Applied Biosystems) in accordance with the manufacturer’srecommendation.

The gene encoding BhCRASP-1 was amplified by PCR amplificationusing plasmid pGEMbh, the primers BhBam and BhR (Table I), and aMastercycler gradient (Eppendorf). Denaturation was conducted at 94°Cfor 30s, annealing at 50°C for 30s, and extension at 68°C for 30s, respec-tively. After digestion with BamHI and EcoRI, the amplified DNA frag-ment was ligated in-frame into the vector pGEX-2T, which included theglutathione S-transferase gene at the N terminus of the recombinant pro-tein. The resulting plasmid was used to transform JM109 host cells. Ex-pression of the GST-BhCRASP-1 fusion protein in E. coli JM109, affinitypurification, and endoproteinase thrombin cleavage of the fusion proteinwere performed as recommended by the manufacturer (AmershamBioscience).

C-terminal and N-terminal deletion mutants of BhCRASP-1 were con-structed by PCR amplification using the BhBam primer and BhR primerin combination with the Eco�-12 primer and the �130Bam and�195Bam primers, respectively (Table I). The amplified DNA frag-ments were digested with BamHI and ligated in-frame with the His6 tagencoding sequence into the pQE30Xa vector (Qiagen), resulting in plas-mids BhCRASP-121–173, BhCRASP-151–185, and BhCRASP-176 –185.These plasmids were used for transformation of the JM109 host cells.Expression of the respective fusion proteins and affinity purificationwere performed as recommended by the manufacturer.

Expression of recombinant proteins of FH, FHL-1, and FHR-1

Deletions constructs of FH (FH1–2, FH1–3, FH1–4, FH1–5, FH1–6,FH8–20, FH15–20, and FH19–20), FHL-1, and FHR-1 were expressed inSpodoptera frugiperda Sf9 insect cells infected with a recombinant bacu-lovirus. The cloning, expression, and purification of various deletion con-structs have been described previously (8, 41).

Construction of a shuttle vector for transformation withBhCRASP-1

The BhCRASP-1-encoding cspA gene, including its native promoter re-gion, was amplified by PCR using BhF and BhR primers containing therespective restriction sites. Highly purified DNA obtained from the B.hermsii strain HS1 was used as the DNA template for PCR. The resultingamplicon was digested with SacI and SphI and cloned into pKFSS1 at thecorresponding restriction sites yielding the shuttle vector pBH. The shuttlevector was transformed into E. coli JM109 and purified plasmids weresubjected to nucleotide sequencing to verify that no mutations were intro-duced during PCR. E. coli transformants were grown in Luria-Bertanibroth containing 50 �g of streptomycin (Sigma-Aldrich) per milliliter andthe expression of BhCRASP-1 was checked by ligand affinity blot analysisof whole cell lysates (data not shown) as described (27).

Characterization of B. burgdorferi B313 transformants

The transformation of B. burgdorferi B313 and the characterization oftransformants were previously described (27). Several clones were selected

Table I. Oligonucleotides used in this study

Primer Sequence (5� to 3�) Used in This Study

BhBam ATTATTAAGCCTTGCTGGATCCGA Generation of fusion proteins�130Bam GCTCTCCATTTACTTTGGATCCACACTTCAAG Generation of fusion proteins�195Bam GATTTAGAGGGATCCAAAAAAGCTCCTGG Generation of fusion proteinsEco�-12 CATTATGAATTCAAAAAATTAGTCCGGATTGC Generation of fusion proteinsBhR CATCAGTTTGATTTATAGGATCAAC Amplification of cspA gene of B. hermsiiBhF ACAACAGATAGACTCAATTTACAG Amplification of cspA gene of B. hermsiiCRASP-1 57(�) CTTTAATTTGCACCGGATCCGCACCTTTTAGGAAAATC Amplification of cspA gene of B. burgdorferiCRASP-1 234(�) CTTTGTAATATGCATCAAAGTGTTTTGCCAGTATTTTCTCATTATC Amplification of cspA gene of B. burgdorferiCSPZ-1 GTAGCAATATACTTGTGCTAGAGG Amplification of cspZ geneCSPZ-2 TCTCTTTTGATAAATTGGCTTAAG Amplification of cspZ geneBbCRASP-3 79(�) GATGAGCAAAGTAGTGGTGAGATAAACC Amplification of erpP geneBbCRASP-3 520(�) CTATTTTAAATTTTTTTTGGATCCTTATTATGGTATTGCATA Amplification of erpP geneBbCRASP-5 79(�) GATGAGCAAAGCAATGGAGAGGTAAAGGTC Amplification of erpA geneErpA 3nc(�) GTTTTTTTATTCATATACGGGCCCTCCTATATTTCTAAC Amplification of erpA geneOspA1 GGGAATAGGTCTAATATTAGCC Amplification of ospA geneOspA2 CTAGTGTTTTGCCATCTTCTTTGA Amplification of ospA geneFla 6 AACACACCAGCATCGCTTTCAGGGTCT Amplification of flaB geneFla 7 TATAGATTCAAGTCTATTTTGGAAAGCACCTA Amplification of flaB gene

7293The Journal of Immunology

by guest on January 6, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

and expanded for 7 days. The analysis of genes harbored by B313 trans-formants was determined by PCR using specific primers (Table I). PCRwas conducted for 25 cycles using following parameters: denaturation at94°C for 1 min, annealing at 50°C for 1 min, and extension at 72°C for 1min. The expression of the BhCRASP-1 of posttransformation B. burg-dorferi B313 was determined by Western blotting using mAb BH-1.

Serum susceptibility testing for Borrelia strains

The serum susceptibility of B. hermsii HS1 mutants B313 and B313 con-taining shuttle vector pBH was assessed using a growth inhibition assay(42). Briefly, cells grown to mid-logarithmic phase were harvested,washed, and resuspended in fresh Barbour-Stoenner-Kelly medium. Spi-rochetes (1.25 � 107 B. hermsii and 2.5 � 107 B. burgdorferi B313 orB313/pBH organisms) diluted in a final volume of 100 ml in Barbour-Stoenner-Kelly medium containing 240 �g/ml phenol red were incu-bated with 50% normal human serum (NHS) or 50% heat-inactivatedNHS in microtiter plates for 72 h at 33°C (Costar). B313 and B313/pBHwere incubated with 25% NHS or 25% heat-inactivated NHS. Barbour-Stoenner-Kelly medium instead of human serum was included in allassays as control. Growth of spirochetes was monitored by measuring theindicator color shift of the medium at 562/630 nm in an ELISA reader(PowerWave 200� Bio-Tek Instruments). For calculation of the growthcurves, the MikroWin version 3.0 software (Mikrotek) was used.

Serum adsorptions assays using intact borrelial cells

To determine whether B. hermsii HS1 can bind FH, FHR-1, and plasmin-ogen, a whole cell absorption assay was performed as previously described.Borreliae (2 � 109 cells) were grown to mid-log phase, harvested by cen-trifugation (5000 � g for 30 min at 4°C) and resuspended in 100 �l ofveronal-buffered saline supplemented with 1 mM Mg2�, 0.15 mM Ca2�,and 0.1% gelatin (pH 7.4). To inhibit complement activation, NHS wasincubated with 0.34 M EDTA for 15 min at room temperature. The cellsuspension was then incubated in 1.5 ml NHS-EDTA for 1 h at roomtemperature with gentle agitation. After three washes with PBSA (0.15 MNaCl, 0.03 M phosphate, and 0.02% sodium azide, pH 7.2) containing0.05% Tween 20, the proteins bound to the cells were eluted by incubationwith 0.1 M glycine-HCl (pH 2.0) for 15 min. Borrelial cells were removedby centrifugation at 14,000 � g for 20 min at 4°C and the supernatant wasanalyzed by Western blotting and probed with mAb VIG8 for FH andFHR-1 or 10-V-1 (Calbiochem) for plasminogen.

Immunofluorescence analysis

Spirochetes were grown to mid-log phase, harvested by centrifugation at5000 � g for 10 min, washed, and resuspended in 300 �l of 30 mM Tris,60 mM NaCl (pH 7.4). Cells (2 � 108) were incubated for 1 h with a mAbdirected either against BhCRASP-1 (BH-1) or the periplasmic flagellinprotein (LA21). After incubation with the Abs, spirochetes were gentlywashed three times in Tris buffer containing 0.2% BSA and collected bycentrifugation at 5000 � g for 10 min. Pellets were then resuspended in100 �l of Tris buffer containing 0.2% BSA. Aliquots (10 �l) were spottedon coverslips and allowed to air dry for 3 h. After fixation with acetone,samples were dried for 15 min at room temperature and incubated for 60min in a humidified chamber with a 1/200 dilution of Cy3-conjugatedrabbit anti-mouse IgG (Dianova) and a 1/1000 dilution of the DNA-bindingdye 4�,6�-diamidino-2-phenylindole (Roth) for counterstaining. Slideswere then washes four times with 0.2% BSA in Tris buffer before beingsealed with Mowiol mounting medium (Calbiochem) and covered withglass slides. Organisms were visualized at a magnification of �1000 usinga Nikon Eclipse 90i microscope.

SDS-PAGE, ligand affinity blot, Western and slot blot analyses,and ELISA

Borrelial whole cell lysates (15 �g) or purified recombinant proteins (500ng) were subjected to 10% Tris/Tricine SDS-PAGE under reducing con-ditions and transferred to nitrocellulose as previously described (24). Al-ternatively, recombinant proteins (1 �g/lane) were transferred onto nitro-cellulose membranes using the Bio-DOT SF blotting apparatus (Bio-Rad).After the transfer of proteins onto nitrocellulose, nonspecific binding sideswere blocked using 5% (w/v) dried milk in TBS (50 mM Tris-HCl 200 mMNaCl, and 0.1% Tween 20) (pH 7.4), for 6 h at room temperature. Subse-quently, membranes were rinsed four times in TBS and incubated at 4°Covernight with NHS, recombinant proteins, or human plasminogen (CellSystems). After four washings with 50 mM Tris-HCl 150 mM NaCl, and0.2% Tween 20 (TBST) (pH 7.5), membranes were incubated for 3 h witha polyclonal rabbit antiserum recognizing the N terminus (anti-SCR1–4),the mAb B22 directed against the SCR5 of FH and FHL-1, the mAb VIG8

directed against the C terminus of FH and FHR-1, or the plasminogen-specific mAb 10-V-1. Following four washes with TBST, blot strips wereincubated with a secondary peroxidase-conjugated anti-rabbit IgG Ab oranti-mouse IgG Ab (DakoCytomation) for 60 min at room temperature.Detection of bound Abs was performed using 3,3�,5,5�-tetramethylbenzi-dine as the substrate.

For Western blot analysis, membranes were incubated for 60 min atroom temperature with either mAb or immune sera. Following four washeswith TBST, membranes were incubated with a secondary peroxidase-con-jugated anti-mouse IgG Ab (DakoCytomation) for 60 min at room tem-perature and bound Abs were detected using 3,3�,5,5�-tetramethylbenzidineas substrate.

For ELISA using nondenatured recombinant proteins, the wells of mi-crotiter plates (Maxisorp; Nunc) were coated for 2 h at room temperaturewith BhCRASP-1 or the deletion mutants thereof (100 �l; 1 �g/ml). Thewells were washed three times with PBS and blocked by incubation withPBS plus 0.1% gelatin. FH (1 �g/ml) or plasminogen (10 �g/ml) wasadded to the wells and after a 2-h incubation and three washes with PBSa 5000-fold dilution of goat anti-FH (Calbiochem) or a 3000-fold di-lution of goat anti-plasminogen (Acris) serum was added, respectively.For the detection of specific Abs, peroxidase-labeled rabbit anti-goatIgG (Dianova) Abs (1/2000) were used as conjugates. Substrate reac-tion was performed with o-phenyldiamine dihydrochloride (Sigma-Al-drich) at room temperature. For competition binding tests with FH andplasminogen, BhCRASP-1-coated microtiter plates were used. To analyzethe ability of plasminogen to inhibit the binding of FH to immobilizedBhCRASP-1 (1 �g/ml), FH (0.1 �g/ml) was mixed with different amountsof plasminogen (0.001–100 �g/ml) and these mixtures were added tothe wells coated with BhCRASP-1. Bound FH was detected as de-scribed above. The ability of different amounts of FH (0.001–100 �g/ml) to inhibit the binding of plasminogen (5 �g/ml) to immobilizedBhCRASP-1 was analyzed accordingly.

In situ protease treatment of spirochetes

Whole cells of B. hermsii strain HS1 were treated with proteases by mod-ification of a method described previously (43). Briefly, freshly harvestedcells were washed twice with PBS-MgCl and, after centrifugation at 5000rpm for 10 min, the sedimented spirochetes were resuspended in 100 �l ofthis buffer. To 5 � 106 intact borrelial cells (final volume of 0.5 ml),proteinase K in distilled water (Sigma-Aldrich) was added to a final con-centration of 12.5–100 �g/ml. Following incubation for 1 or 2 h at roomtemperature, proteinase K was inhibited by adding 5 �l of PMSF (Sigma-Aldrich) (50 mg/ml in isopropanol). The cells were then washed twice withPBS-magnesium, resuspended in 20 �l of the same buffer, and lysed bysonication five times using a Branson B-12 sonifier (Heinemann). Wholecell protein preparations (10 �l) were separated by using Tris/TricineSDS-PAGE via 4% stacking and 10% separating gels as described pre-viously (23).

Surface plasmon resonance analysis

Protein-protein interactions were analyzed by surface plasmon resonancetechnique using a Biacore 3000 instrument as described earlier (22, 44).Briefly, the borrelial recombinant protein BhCRASP-1 (20 �g/ml; dialyzedagainst 10 mM acetate buffer (pH 5.5)) was coupled via a standard amine-coupling procedure to the flow cell of a sensor chip (CM5; Biacore) untila level of resonance units �4000 was reached. A control cell was preparedin the same way but without injecting a protein. FH, FHL-1, and the deletionconstruct FH1–6 were dialyzed against running buffer (75 mM PBS (pH 7.4)).Each ligand (FH, 333 nM; FHL-1, FH8–20, and FH15–20, 1 �M each) wasinjected separately into the flow cell coupled with BhCRASP-1 or the deletionmutants and into a control cell using a flow rate of 5 �l/min at 25°C. Eachinteraction was analyzed at least three times.

The binding kinetics were determined by using a lower density of theimmobilized ligand (�1000 resonance units) at 22°C in 75 mM PBS (pH7.4) and by using a natural logarithmic Langmuir 1:1 binding model andthe simultaneous Ka/Kd fitting routine of the BIAevaluation 3.1 software(Biacore). The equilibrium constants were calculated from the rateconstants.

Functional assay for cofactor activity of FH

The cofactor activity of FH was analyzed on immobilized recombinantBhCRASP-1 by measuring the factor I-mediated conversion of C3b toiC3b. Briefly, recombinant BhCRASP-1 (20 �g/ml) immobilized on a mi-crotiter plate was incubated with an excess of purified FH. After washing,purified C3b (Calbiochem) and purified factor I (Sigma-Aldrich) wereadded and the mixture was incubated for 15 min at 37°C. iC3b generationwas quantified by ELISA applying a neoepitope-specific mouse monoclonal

7294 FACTOR H AND PLASMINOGEN INTERACTIONS WITH BhCRASP-1

by guest on January 6, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

anti-iC3b IgG (Quidel) as the capture Ab and biotinylated rabbit anti-C3c IgG(DakoCytomation) as the detector Ab. The reaction was visualized by theaddition of streptavidin-peroxidase followed by o-phenylenediamine withH2O2 as the substrate. Purified iC3b (Calbiochem) was used as a standard.Control experiments included BbCRASP-1, BbCRASP-3, or buffer insteadof BhCRASP-1 as well as soluble and immobilized FH, respectively, in theidentical system.

Chromogenic substrate assays for plasmin and plasminogenactivators

Intact B. hermsii spirochetes were incubated with 10 �l of plasminogen (1mg/ml; Chromogenix) with or without 50 mM tranexamic acid for 30 minat 34oC in Eppendorf tubes if not otherwise indicated. Following twowashes, B. hermsii was resuspended in 50 �l of assay buffer (30 mM Tris,60 mM NaCl (pH 7.4)) and transferred to microtiter plates, and 50 �l ofuPA (2,5 �g/ml; Chemicon International) as well as 50 �l of the plas-min substrate D-Val-Leu-Lys 4-nitroanilide dihydrochloride (S-2251;Sigma-Aldrich) was added (0.4 mg/ml). Control reactions without B.hermsii consisted of buffer alone (followed by uPA) and a sham prepa-ration to control for possible residual unbound plasminogen not subse-quently removed by washing (this reaction received plasminogen in bufferat the same concentration as that used in tubes with B. hermsii, followed byuPA). Control reactions with B. hermsii consisted of plasminogen alone(no uPA) and uPA alone (no previous plasminogen incubation) at thesame concentrations as in the experimental reaction mixture. All sam-ples received the chromogenic substrate S-2251 and were subjected tothe same manipulations. The absorbance change at 405 nm was fol-lowed for several hours directly in the plates and the backgroundactivity of OD450 � 0.1 (B. hermsii plus substrate) was subtracted.Similarly, BhCRASP-1 (0.2 �g/ml) was coated to microtiter plates and,after blocking, 10 �l of plasminogen (1 mg/ml) with or without 50 mMtranexamic acid was added and incubated for 10 min at 37°C. Followingthree washes with 200 �l of buffer, 50 �l of uPA (2.5 �g/ml) and 50 �l ofsubstrate S-2251 were added (0.4 mg/ml). The absorbance change at 405nm was followed as indicated above.

Nucleotide sequence deposition

The cspA gene sequence reported in this paper has been deposited in theEMBL/GenBank databases under the accession number AM408562.

Statistical analysis

To determine the statistical significance of the observed absorbance values,BIAS version 8.1 software was used. Values of p � 0.05 were consideredto be statistically significant.

ResultsCloning and characterization of BhCRASP-1

To identify the FH binding proteins of B. hermsii, a genomic DNAexpression library derived from B. hermsii strain HS1 wasscreened for FH binding clones. The sequence of one clone thatstrongly bound FH revealed an open reading frame of 555 bp en-coding a putative lipoprotein with a calculated molecular mass of21.5 kDa. The encoding gene was designated cspA. Pulse-field gelelectrophoresis and hybridization analysis revealed that the cspAgene encoding BhCRASP-1 represents a single genetic locus thatmaps to a plasmid of 200 kb. Hybridization analyses using acspA PCR-generated probe with HaeIII- and BamHI-digestedDNA yielded fragments of 3 and 8 kb, respectively (data notshown). After cleavage of the leader peptide, the predicted mo-lecular mass of BhCRASP-1 is 19.5 kDa. The N terminus ofBhCRASP-1 shows significant homology to the signal peptides ofother bacterial lipoproteins (45, 46). This motif includes two lysineresidues near the N terminus, a hydrophobic region, and a se-quence with significant similarity to the consensus signal peptidaseII cleavage sequence Leu(Ala, Ser)�4-Leu(Val, Phe, Ile)�3-Ile(Val, Gly)�2-Ala(Ser, Gly)�1-Cys�1. Using LipoP for predic-tion of the lipoproteins of Gram-negative bacteria (47), a uniquecleavage side for signal peptidase II was found between aa 19 and20, suggesting lipidation at cysteine residue 20 of BhCRASP-1.The amino acid sequence exhibited 83% identity with the recently

identified FHBP19/FhbA protein of B. hermsii YOR (18). A mAb,BH-1, with specificity for BhCRASP-1 was shown to be nonreac-tive with FHBP-19/FhbA and with the deletion mutant BhCRASP-176–185, suggesting that the specific epitope recognized by mAbBH-1 includes amino acids residing in the N-terminal domain ofBhCRASP-1 (data not shown).

Surface exposure and protease sensitivity of BhCRASP-1

To determine whether BhCRASP-1 is surface exposed, an immu-nofluorescence assay was performed using the mAb BH-1, specificfor BhCRASP-1. B. hermsii was incubated sequentially with mAbBH-1 and the rabbit anti-mouse Cy3-conjugated Ab (Fig. 1A, up-per panels). Epifluorescence microscopy revealed that B. hermsiiexpressed BhCRASP-1 on its outer surface in a patch-like manner.The mouse mAb LA21 directed against the periplasmic FlaB pro-tein was used in these experiments as an internal control to confirmthat the fragile spirochetal outer membrane was not damaged (Fig.1A, lower panels). Controls incubated with the secondary Ab alonewere negative (not shown).

To further define the surface localization of BhCRASP-1, B.hermsii organisms were treated with proteinase K and subjected toWestern blot analysis. As shown in Fig. 1B, a significant reductionwas observed for BhCRASP-1 after 2 h of incubation with pro-teinase K at concentrations �12.5 �g/ml. The band intensity ob-served for FlaB was not changed, indicating that periplasmic fla-gella are not affected by proteolytic digestion. Thus, thesusceptibility of BhCRASP-1 to proteolytic digestion indicatesthat this protein is exposed at the outer surface of B. hermsii.

FIGURE 1. Surface exposition of BhCRASP-1. A, B. hermsii after in-cubation with the BhCRASP-1-specific mAb BH-1 (upper panel) and theflagellin-specific mAb LA21 (lower panel) followed by rabbit anti-mouseCy3-conjugated IgG. The images were obtained by epifluorescence mi-croscopy using a Nikon Eclipse 90i upright automated microscope and aNikon DS-1 QM sensitive black and white charge-coupled device cameraat a resolution of 0.133 �m/pixel (right); for counterstaining, the DNA-binding 4�,6�-diamidino-2-phenylindole was used (middle), and a differ-ential interference contrast image is also shown (left). B, Proteinase Ktreatment affects the surface expression of native BhCRASP-1. B. hermsiicells were incubated with the indicated concentration of proteinase K, lysedby sonication, immunoblotted, and screened with anti-BhCRASP-1 (BH-1)and anti-FlaB (LA21) mAb.

7295The Journal of Immunology

by guest on January 6, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

Interaction of BhCRASP-1 with serum proteins

To test the binding of recombinant BhCRASP-1 to the serum pro-teins FH, FHL-1, and FHR-1 or to plasminogen, slot blot analysiswas used. Of the three members of the factor H family analyzed,FH and FHR-1 bound to BhCRASP-1 whereas no binding wasobserved for FHL-1 (Fig. 2A). Using BbCRASP-1 derived from B.burgdorferi as a control, binding to FHL-1 and FH but not toFHR-1 could be detected. OspA, OspB, and BSA did not bind toany of the three proteins. Furthermore, plasminogen bound to re-combinant BhCRASP-1 and OspA, whereas no binding was ob-served for the control proteins OspB and BSA (Fig. 2B).

To assess the binding of serum proteins to the surface of bor-relial cells in a more physiologic assay, intact spirochetes wereincubated with NHS, a natural source for FH, FHL-1, FHR-1, andplasminogen that was supplemented with EDTA to prevent com-plement activation. Serum proteins were adsorbed to spirochetesand subsequently eluted by using a pH shift assay. The eluted

fractions were separated by SDS-PAGE and tested for FH, FHL-1,FHR-1, and plasminogen by Western blotting. FH and FHR-1were detected in the eluted fractions of B. hermsii. In contrast,FHL-1 was not found in the eluate of B. hermsii, indicating that theB. hermsii strain HS1 does not bind FHL-1 on its surface. In ad-dition, plasminogen was also present in the eluate fractions of B.hermsii (Fig. 2C).

Localization of the FH/FHR-1 and the plasminogen-bindingdomains of BhCRASP-1

To localize the binding sites for FH/FHR-1 and plasminogen onBhCRASP-1, a number of BhCRASP-1 deletion mutants with N-and C-terminal truncations were constructed (Fig. 3). Proteinexpression was confirmed by using Coomassie blue staining,and all of the recombinant proteins exhibited the predicted sizeand reacted with the BhCRASP-1 immune serum (data notshown). Screening for FH/FHR-1 binding, using ELISA re-vealed that, of the protein preparations tested, only the full-length form of BhCRASP-1 bound to FH and FHR-1 (Fig. 4A).No binding to FH was detected with any of the other deletionmutants of BhCRASP-1. Thus, the binding of FH/FHR-1 requireddeterminants located in both the C- and N-terminal domains ofBhCRASP-1, suggesting that long-range intramolecular interac-tions are involved in the formation and presentation of the FH/FHR-1 binding pocket.

The different BhCRASP-1 mutants were also analyzed for theability to bind plasminogen. Full-length BhCRASP-1 (residues 21to 185) and the truncated versions retained plasminogen bindingactivity (Fig. 4B), indicating that the binding site for plasminogenis localized to the central domain of BhCRASP-1. Assuming thatBhCRASP-1 contains one unique plasminogen binding site, theincreased binding capacity of the truncated mutants vs the com-plete BhCRASP-1 for plasminogen correlates with the relative mo-lar amounts of the respective proteins used in this assay. Together,these data suggest that FH and plasminogen bind to distinct, non-overlapping domains of the BbCRASP-1 molecule. To test thisassumption, increasing amounts of plasminogen or FH (up to 100�g/ml) together with constant amounts of FH (0.1 �g/ml) or plas-minogen (5 �g/ml), respectively, were added to immobilizedBhCRASP-1. As seen in Fig. 4, plasminogen did not compete withthe binding of FH to BhCRASP-1 even at a 1000-fold excess and,vice versa, high amounts of FH did not inhibit the binding ofplasminogen to BhCRASP-1.

Activation of bound plasminogen by host-derived plasminogenactivators

To determine whether plasminogen bound to the outer surface ofB. hermsii was converted to its enzymatically active form, plasmin,

FIGURE 2. Binding of serum proteins FH, FHL-1, FHR-1, and plas-minogen to BhCRASP-1 and native B. hermsii spirochetes. A, Purifiedrecombinant BhCRASP-1, BbCRASP-1, OspA, OspB, and BSA weretransferred to nitrocellulose membranes using Bio-Dot SF blotting appa-ratus. The reversible protein detection kit (Sigma-Aldrich) was applied toshow equal loading of the proteins. Nitrocellulose membranes were incu-bated with FHL-1, FHR-1, or FH and bound proteins were visualized usingantisera specific for SCR1–7 or for SCR19–20 (mAb VIG8). B, Nitrocel-lulose membranes containing BhCRASP-1, OspA, OspB, and BSA wereeither stained by using the reversible protein detection kit to confirm evenlyapplied samples or incubated with plasminogen and the specific mAb 10-V-1. C, B. hermsii cells incubated in NHS-EDTA were extensively washedwith PBSA-Tween 20 and bound proteins were eluted using 0.1 M glycine(pH 2). Both the last wash (w) and the eluate (e) fractions obtained wereseparated by 10% Tris/Tricine SDS-PAGE under nonreducing conditions,transferred to nitrocellulose, and probed with rabbit serum anti-SCR1–4for FHL-1 and FH, anti-SCR19–20 for FHR-1, and mAb 10-V-1 for de-tection of plasminogen (PLG).

FIGURE 3. Diagrammatic representation of native and expressed re-combinant BhCRASP-1 proteins. The numbers refer to amino acid resi-dues, and nd is “not determined.” Binding of the complete and the trun-cated versions of BhCRASP-1 to serum proteins FH, FHL-1, and FHR-1and to plasminogen was determined by slot blot analysis and/or ELISA.

7296 FACTOR H AND PLASMINOGEN INTERACTIONS WITH BhCRASP-1

by guest on January 6, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

by either endogenously or exogenously supplied plasminogen ac-tivator(s), B. hermsii spirochetes were incubated with plasmino-gen. After the transfer of extensively washed spirochetes to mi-crotiter plates, human uPA and the chromogenic plasmin substrateS-2251 were added. As shown in Fig. 5A, degradation of the chro-mogenic substrate demonstrates that plasminogen bound to thesurface of B. hermsii is converted to enzymatically active plasminin the presence of exogenous uPA. No or only marginal plasminactivity was seen in the presence of tranexamic acid, indicatingthat the previous binding of plasmin(ogen) to the spirochete is aprerequisite for optimal cleavage by plasminogen activators. Spi-rochetes treated with plasminogen alone (without subsequent ac-tivation with uPA) or with uPA alone (without previous incubationwith plasminogen) showed only marginal, if any, degradation ofS-2251. No plasmin was formed in the absence of plasminogen ac-tivators, indicating that spirochetes do not express endogenous plas-minogen activators. Similar findings were observed using BhCRASP-1-coated microtiter plates. In contrast to intact spirochetes, plasminactivity bound to BhCRASP-1 was reduced by 50% in the presenceof tranexamic acid (Fig. 5B).

Identification of the short consensus repeat(s) of FH that bind toBhCRASP-1

To precisely map the binding domain of FH that binds to the re-combinant BhCRASP-1 of B. hermsii, various deletion constructsof FH and FHL-1 were used for ligand affinity assays. As shownin Fig. 6A, BhCRASP-1 strongly bound to FH (lane 7 from left) aswell as to the deletion constructs FH8–20 (lane 8), FH15–20 (lane9), and FH19–20 (lane 10), but not to the deletion constructsSCR1–2, SCR1–3, SCR1–4, SCR1–5, SCR1–6, FHL-1 (SCR1–7)(lanes 1– 6), and deletion construct FH15–19 (lane 11). Thesedata indicate that SCR20 of FH is critical for interaction withBhCRASP-1. In addition, FHR-1 but not FHL-1 bound to im-mobilized BhCRASP-1 using ligand affinity blotting (Fig. 2A),supporting the notion that the SCR20 of FH is primarily in-volved in binding BhCRASP-1. As indicated in the schematicrepresentation of FH, FHL-1, and FHR-1 (Fig. 6B), domain

FIGURE 4. Dose-dependent bind-ing of FH and plasminogen byBhCRASP-1. A, Different concen-trations of FH were incubatedwith BhCRASP-1 or the indicatedBhCRASP-1 mutants and bindingwas detected using goat anti-FH asthe detection Ab. B, Similarly, thesame plates were incubated with plas-minogen and binding was detectedusing goat anti-plasminogen as the de-tection Ab. C and D, Competition inhi-bition test with FH and plasminogen.Different amounts of plasminogen(dotted line) or FH (solid line) wereused to inhibit the binding of 0.1 �g/mlFH (C) or 5 �g/ml plasminogen (D) toBhCRASP-1 immobilized on microti-ter plates.

FIGURE 5. Effect of B. hermsii on the activation of serum-derived plas-minogen by uPA. B. hermsii organisms (1.2 � 108) (A) or recombinantBhCRASP-1 (0.2 �g/ml) (B) were mixed with plasminogen. Plasminogenwas converted into plasmin by the addition of uPA and plasmin activitywas determined by using the chromogenic substrate D-Val-Leu-Lys 4-ni-troanilide dihydrochloride (S-2251). Enhanced plasmin activity was seenwhen plasminogen and uPA were incubated with spirochetes (f). uPA-mediated plasminogen activation was inhibited by 50 mM tranexamic acid(�). When spirochetes were incubated in the absence of either uPA (‚) orplasminogen (E), only weak plasmin activity was seen. This experimentwas repeated three times with consistent results.

7297The Journal of Immunology

by guest on January 6, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

SCR20 of FH displays 97% sequence similarity to the SCR5of FHR-1 (48).

Applying surface plasmon resonance analyses, a more physio-logical assay system, FH and the deletion constructs FH8–20 andFH15–20 bound to immobilized BhCRASP-1 with similar highaffinities. Furthermore, quantitative analysis revealed a high bind-ing affinity of FH to BhCRASP-1 as demonstrated by a calculatedKd value of 17 nM (Table II). However, FHL-1, consisting ofSCR1–7, failed to bind BhCRASP-1 indicating that the C-terminaldomain of FH is required for BhCRASP-1 binding (Fig. 7A). Thisassumption was verified by showing that the mAb C18 (49) di-rected against the most C-terminal domain SCR20, completeblocked the interaction of FH with BhCRASP-1 (Fig. 7B).

FH retains cofactor activity when bound to BhCRASP-1

The cofactor activity of FH was analyzed on immobilized recom-binant BhCRASP-1 protein by measuring factor I-mediated con-version of C3b to iC3b (21). Recombinant BhCRASP-1 immobi-lized on a microtiter plate was incubated with excess of purifiedFH or buffer alone. As controls, functional activity of FH bound toB. burgdorferi BbCRASP-1 or BbCRASP-3 was tested for C3b-inactivating capacity (21, 22). BhCRASP-1-bound FH was more

efficient in mediating C3b conversion than FH bound to eitherBbCRASP-1 or BbCRASP-3 under similar conditions (Fig. 8). Aspreviously shown, FH bound to BbCRASP-1 is up to 10-fold moreefficient in factor I-mediated C3b conversion as compared withBbCRASP-3 (21, 22). Incubation of immobilized proteins in the

FIGURE 6. Complement-regulatory functions and binding domains ofFH, FHL-1 and FHR-1. A, Purified recombinant BhCRASP-1 proteins(lanes 1–11, counting from the left) were separated by 10% Tris/TricineSDS-PAGE and transferred to nitrocellulose. Membranes were incubatedwith either recombinant FHL-1 (FH1–7) or several deletion constructs ofFH (FH1–2, FH1–3, FH1–4, FH1–5, FH1–6, FH8–20, FH15–20,FH19–20 and FH19–20), or with human serum (FH). Bound proteins werevisualized using antisera specific for SCR1–7 (�SCR1–4), SCR19–20(�FH), and the mAb (VIG8). B, Schematic representation of the FH,FHL-1, and FHR-1 proteins. The complement regulatory domains are lo-calized to the N-terminal four domains SCR1–4 (shaded). The interactiondomains for other microbial surface proteins are mainly localized toSCR6–7 and SCR19–20 (gray). SCR domains are aligned vertically ac-cording to their observed amino acid sequence similarities (%).

Table II. Quantitative analysis of the interaction between FH andimmobilized BhCRASP-1 proteina

Equilibrium AssociationConstant (M�1)

Equilibrium DissociationConstant (M)

FH 1.7 � 107 1.7 � 10�8

a The equilibrium constants were calculated from the association and dissociationrate constants.

FIGURE 7. Analysis of BhCRASP-1 for binding to FH and deletionmutants by surface plasmon resonance. A, FH, FHL-1, or the various FHmutants in the fluid phase were injected into a flow cell precoupled withBhCRASP-1 and to a control flow cell without protein (PBS). The controlwas subtracted from the displayed binding curves. Binding of FH, FH8–20, FH15–20, and FHL-1 to BhCRASP-1 was measured. As comparedwith the intact FH, the binding of FH15–20 was slightly increased whereasthe binding of FH8–20 was reduced and no binding was observed withFHL-1. B, Using mAb C18 directed against SCR20 completely abolishedthe binding of FH15–20 to BhCRASP-1.

FIGURE 8. Analysis of cofactor activity of FH bound to BhCRASP-1.Recombinant BhCRASP-1 immobilized to microtiter plates was used tocapture FH. After sequential addition of C3b and factor I, bound FH en-abled factor I-mediated cleavage of C3b to iC3b. iC3b was quantified byELISA using a neoepitope-specific anti-iC3b IgG. BbCRASP-1 andBbCRASP-3 derived from B. burgdorferi strain ZS7 served as controls.Data are given as mean � SD of three independent experiments.

7298 FACTOR H AND PLASMINOGEN INTERACTIONS WITH BhCRASP-1

by guest on January 6, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

absence of FH served as negative controls and had no effect onC3b conversion (data not shown).

BhCRASP-1 increases resistance to complement-mediated killing

Preliminary experiments indicated that the B. hermsii strain HS1was not suitable for genetic manipulation. We thus transformed theserum-sensitive B. burgdorferi mutant strain B313 lacking the FH/FHL-1 binding proteins BbCRASP-1 to BbCRASP-4 with theshuttle vector pBH containing the entire cspA gene to assess therole of BhCRASP-1 for complement resistance. Transformantswere selected by limiting dilution and characterized for the pres-ence of the cspA gene of B. hermsii by PCR analysis (Fig. 9A).B313/pBH, but not parental strain B313, showed the expected am-plicon product. Lack of plasmids lp54, lp28-3, and cp32-9 harbor-ing ospA and cspA (BbCRASP-1), cspZ (BbCRASP-2), and erpP(BbCRASP-3) in B313 was confirmed by PCR, respectively (Fig.9A). Next, the expression of BhCRASP-1 was determined by

Western blotting with the specific mAb (BH-1). As shown in Fig.9B, B. hermsii HS1 and the transformant B313/pBH, but not themutant strain B313, showed a specific band. Furthermore, a growthinhibition assay (42) was used to compare the susceptibility of B.hermsii HS1, B313, and B313/pBH to human serum. Resistance tocomplement-mediated killing was indicated by a continuousgrowth of spirochetes in the presence of human serum and a subse-quent reduction of A562/A630 ratios, whereas the inhibition of sen-sitive cells was indicated by lack of changes in absorbance. As shownin Fig. 9C, the growth of B. burgdorferi mutant B313 was signifi-cantly inhibited as compared with growth of B313/pBH in the pres-ence of 25% NHS ( p � 0.05). B313 containing the shuttle vectoralone showed similar growth properties as the nontransformed B.burgdorferi mutant B313 (data not shown). This finding indicatesthat complement resistance can be increased when BhCRASP-1 isexpressed in a heterologous B. burgdorferi strain. Heat inactiva-tion of human serum before assaying the borrelial cells did notinfluence the growth of any strain (data not shown).

DiscussionIn this study we have identified and characterized BhCRASP-1, anovel member of the CRASP family in B. hermsii. BhCRASP-1binds human FH, FHR-1, and, in addition, plasminogen/plasminvia distinct, nonoverlapping domains. Both FH and plasminretain their biological activities when bound to B. hermsii orBhCRASP-1, suggesting that BhCRASP-1 is a critical virulencefactor of the pathogen.

The previous findings that the relapsing fever spirochete B.hermsii expresses a receptor for FH, FhbA, and that surface-boundFH facilitates factor I-mediated cleavage of C3b suggest a suitablestrategy of the pathogen to evade the first-line host defense via thecomplement system (18). FH binding has been reported for a num-ber of bacterial species such as S. pyogenes (group A streptococ-cus) (50), Neisseria gonorrhoeae (10, 51), S. pneumoniae (11, 13,52), B. burgdorferi (24), Borrelia afzelii (25), Borrelia recurrentis(53), Borrelia duttonii (53), Borrelia parkeri (17), and B. hermsii(18, 19). Moreover, for B. hermsii YOR it was found that it spe-cifically binds both FH and FHL-1 via FhbA and that FH andFHL-1 interact with FhbA through the SCR domains 1–7 andSCR16–20 (19). In contrast, the presented plasma adsorption ex-periments and surface plasmon resonance analyses clearly showedthat FH binding to BhCRASP-1 of B. hermsii HS1 is exclusivelyassociated with SCR20. This is further substantiated by the factthat BhCRASP-1 also bound FHR-1, another member of the factorH family, exhibiting a C-terminal domain that is almost identicalto the C terminus of FH but different to FHL-1, which consists ofSCR1–7 (48). Thus, BhCRASP-1 and FhbA clearly express dis-tinct biological activities in that both show similar binding potentialfor FH but different capacities to interact with FHL-1 and FHR-1.Although the actual function of FHR-1 is yet to be disclosed, it wassuggested to be involved in the adhesion processes of the pathogen toneutrophils (54). The interaction of BhCRASP-1 with FH may be animportant mechanism by which B. hermsii spirochetes control C3bdeposition on their surface and escape opsonophagocytosis. In ad-dition, FH may function in adherence due to its binding to surfaceglycosaminoglycans and host cell membrane receptors. In this con-text it is noteworthy that the C-terminal part of FH has previouslybeen implicated in the binding to other bacterial surface structures,e.g., the sialylated lipooligosaccharide of N. gonorrhoeae and sev-eral lipoproteins of B. burgdorferi, including CRASP-3, -4, and -5(10, 21, 22, 44).

Our results show that FH associated with BhCRASP-1 maintainsits regulatory activity and controls C3b deposition and C3-convertaseactivity. Thus, the acquisition of FH molecules to surface-exposed

FIGURE 9. Characterization and serum susceptibility analysis of B.hermsii and B. burgdorferi strains. A, B. burgdorferi B31, mutant B313,and B313/pBH were characterized by PCR amplification of the cspA, cspZ,erpP, erpA, ospA, and flaB genes using the primers listed in Table I. B,Expression of B. hermsii BhCRASP-1 by recombinant B. burgdorferi B313was assessed using Western blot. Whole cell lysates of the indicated bor-reliae (1 � 108) were separated by SDS-PAGE and transferred to nitro-cellulose. BhCRASP-1 was detected using mAb BH-1. M, Marker pro-teins; lane 1, B. hermsii; lane 2, B313; lane 3, B313/pBH. C, Growthinhibition assay. B. burgdorferi B313 and B313/pBH cells were examinedfor sensitivity to human serum. Spirochetes were seeded in microtiterplates and incubated in NHS over a cultivation period of 3 days at 33°C.Data are shown as mean � SD of three independent experiments. Colorchanges were monitored by measurement of the absorbance at 562/630 nm.

7299The Journal of Immunology

by guest on January 6, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

BhCRASP-1 results in enhanced complement-regulatory activity, aprocess that would allow relapsing fever spirochetes to evade clear-ance by the innate immune system. The biological significance ofBhCRASP-1 interaction with FH was further examined by using aB. burgdorferi strain as an amenable host to express a heterologousouter surface lipoprotein for studying complement resistance. Infact, B. burgdorferi was shown previously to successfully displaysurface-exposed lipoproteins, e.g., Vsp1 and Vsp2 of relapsingfever borreliae (55). In addition, the complementation ofBbCRASP-1 or BbCRASP-2 expression in serum-sensitive borre-lial cells imparts resistance to human serum (27, 29). Here wedemonstrate that expression of the BhCRASP-1 of relapsing feverborreliae in the serum-sensitive Lyme disease spirochete B. burg-dorferi B313 results in an increased resistance of the mutant strainto complement-mediated killing, suggesting the involvement ofBhCRASP-1 in the immune evasion of B. hermsii.

To localize the peptide binding domain(s) of BhCRASP-1 forFH binding, BhCRASP-1 proteins with N- and C-terminal trun-cations were generated and used for functional analyses. Dele-tions of either the N terminus (fragment spanning residues 51–185) or the C terminus (fragment spanning residues 21–173)portion of BhCRASP-1 completely abrogated FH binding, sug-gesting that the FH binding site of BhCRASP-1 consists of a con-formational rather than a contiguous linear peptide structure. Sim-ilar features have been previously reported for B. burgdorferiBbCRASP-1 and BbCRASP-3 (21, 22). However, Hovis and col-leagues proposed that although determinants of the C-terminal do-main of FhbA are important in FH/FHL-1 binding, the 10-aa C-terminal tail is dispensable (19). In this context the recentidentification of two genetically distinct groups of B. hermsii is ofinterest (56). Together with the proposition of two clusters of FHbinding proteins found in the B. hermsii genome, the combinedstudies thus suggest a differential association of FhbA andBhCRASP-1 with the two subgroups (57). However, furtherstudies are required to settle this issue.

Several independent investigations have proposed that the bind-ing of plasminogen to the surface of bacteria is of importance forthe invasive capacity of a number of Borrelia species (32, 33, 35,58–60). We have shown now that B. hermsii binds plasminogen toits outer surface and that bound plasminogen can, in turn, be con-verted to enzymatically active plasmin in the presence of exoge-nous human uPA as measured by the cleavage of the chromogenicplasmin substrate S-2251. The interaction of plasminogen withexponentially grown B. hermsii was first examined by the incuba-tion of intact spirochetes with NHS, a natural source for plasmin-ogen and FH, and both proteins, FH and plasminogen, were elutedfrom the spirochetal surface. To elucidate the putative plasminogen-binding capacity of the BhCRASP-1, ligand affinity blotting was used.As with FH, plasminogen binds to immobilized BhCRASP-1. Thus,plasmin-coated organisms could bind to the recently described plas-minogen receptors on endothelium cells as a means of initial anchor-ing (61) and may use their enhanced proteolytic capacity to breachtight junctions of endothelium, cross basement membranes, and ini-tiate pathophysiological processes in the affected organs (60). It is alsoknown that, similar to Lyme disease, Borrelia relapsing fever speciesdisseminate from the blood to many distant organs, including thebrain (57). Our results show that plasminogen does not competewith FH for binding of immobilized BhCRASP-1 and vice versa.The efficient simultaneous binding of FH and plasminogen sug-gests that the two host proteins are bound to BhCRASP-1 of B.hermsii via distinct domains. In line with this observation it wasfound that BhCRASP-1 proteins with N- or C-terminal truncationsexhibited a loss of binding to FH but not to plasminogen. Further-more, the acquired proteolytic activity may also protect spirochetes

against serum-derived nonspecific and specific antimicrobial com-pounds such as specific Abs. It has become evident that Staphy-lococcus aureus resists human innate immune defenses by activat-ing human plasminogen into plasmin at the bacterial surface andthat this in turn leads to degradation of surface-bound IgG and C3b(62). Similarly, BhCRASP-1-bound serine protease activity mayact in concert with FH and factor I to strengthen the resistance ofB. hermsii to human serum by promoting C3b inactivation. There-fore, BhCRASP-1 bound plasmin must be considered as anotherescape mechanism of B. hermsii during early infection.

To our knowledge, this is the first study showing the simul-taneous and noncompetitive binding of FH and plasminogen toan outer surface protein of B. hermsii. This finding is of generalimportance and deserves further investigations to better under-stand the molecular interactions of FH and plasminogen withBhCRASP-1 as well as their roles in the virulence and patho-genesis of B. hermsii in humans. Our findings may have broadimplications for the invasive potential of human pathogens andsupport the concept of their exploitation of host factors as asuitable survival strategy.

AcknowledgmentsWe thank Christiane Brenner, Steffi Halbich, Christa Hanssen-Hubner, andJuri Habicht for excellent technical assistance. We also thank D. ScottSamuels for providing pKFSS1.

DisclosuresThe authors have no financial conflict of interest.

References1. Barbour, A. G. 2005. Relapsing fever. In Tick-Borne Diseases of Humans.

L. Jesse, D. T. D. Goodman, and D. E. Sonenshine, eds. American Society forMicrobiology Press, Washington, D.C., p. 268–291.

2. Barbour, A. G., and B. I. Restrepo. 2000. Antigenic variation in vector-bornepathogens. Emerg. Infect. Dis. 6: 449–457.

3. Hornef, M. W., M. J. Wick, M. Rhen, and S. Normark. 2002. Bacterial strategiesfor overcoming host innate and adaptive immune responses. Nat. Immunol. 3:1033–1040.

4. Barbour, A. G. 1991. Molecular biology of antigenic variation in Lyme borre-liosis and relapsing fever: a comparative analysis. Scand. J. Infect. Dis.23(Suppl.) 77: 88–93.

5. Barbour, A. G., S. L. Tessier, and H. G. Stoenner. 1982. Variable major proteinsof Borrelia hermsii. J. Exp. Med. 156: 1312–1324.

6. Dai, Q., B. I. Restrepo, S. F. Porcella, S. J. Raffel, T. G. Schwan, andA. G. Barbour. 2006. Antigenic variation by Borrelia hermsii occurs throughrecombination between extragenic repetitive elements on linear plasmids. Mol.Microbiol. 60: 1329–1343.

7. Pangburn, M. K., R. D. Schreiber, and H. J. Muller-Eberhard. 1977. Humancomplement C3b inactivator: isolation, characterization, and demonstration of anabsolute requirement for the serum protein �1H for cleavage of C3b and C4b insolution. J. Exp. Med. 146: 257–270.

8. Kuhn, S., C. Skerka, and P. F. Zipfel. 1995. Mapping of the complement regu-latory domains in the human factor H-like protein 1 and in factor H1. J. Immunol.155: 5663–5670.

9. Meri, T., A. Hartmann, D. Lenk, R. Eck, R. Wurzner, J. Hellwage, S. Meri, andP. F. Zipfel. 2002. The yeast Candida albicans binds complement regulatorsfactor H and FHL-1. Infect. Immun. 70: 5185–5192.

10. Ram, S., D. P. McQuillen, S. Gulati, C. Elkins, M. K. Pangburn, and P. A. Rice.1998. Binding of complement factor H to loop 5 of porin protein 1A: a molecularmechanism of serum resistance of nonsialylated Neisseria gonorrhoeae. J. Exp.Med. 188: 671–680.

11. Janulczyk, R., F. Iannelli, A. G. Sjoholm, G. Pozzi, and L. Bjorck. 2000. Hic, anovel surface protein of Streptococcus pneumoniae that interferes with comple-ment function. J. Biol. Chem. 275: 37257–37263.

12. Jarva, H., R. Janulczyk, J. Hellwage, P. F. Zipfel, L. Bjorck, and S. Meri. 2002.Streptococcus pneumoniae evades complement attack and opsonophagocytosisby expressing the pspC locus-encoded Hic protein that binds to short consensusrepeats 8–11 of factor H. J. Immunol. 168: 1886–1894.

13. Dave, S., M. K. Pangburn, C. Pruitt, and L. S. McDaniel. 2004. Interaction ofhuman factor H with PspC of Streptococcus pneumoniae. Indian J. Med. Res. 119(Suppl): 66–73.

14. Duthy, T. G., R. J. Ormsby, E. Giannakis, A. D. Ogunniyi, U. H. Stroeher,J. C. Paton, and D. L. Gordon. 2002. The human complement regulator factor Hbinds pneumococcal surface protein PspC via short consensus repeats 13 to 15.Infect. Immun. 70: 5604–5611.

7300 FACTOR H AND PLASMINOGEN INTERACTIONS WITH BhCRASP-1

by guest on January 6, 2019http://w

ww

.jimm

unol.org/D

ownloaded from

15. Zipfel, P. F., and C. Skerka. 1994. Complement factor H and related proteins:an expanding family of complement-regulatory proteins? Immunol. Today 15:121–126.

16. Skerka, C., R. D. Horstmann, and P. F. Zipfel. 1991. Molecular cloning of ahuman serum protein structurally related to complement factor H. J. Biol. Chem.266: 12015–12020.

17. McDowell, J. V., E. Tran, D. Hamilton, J. Wolfgang, K. Miller, andR. T. Marconi. 2003. Analysis of the ability of spirochete species associated withrelapsing Fever, avian borreliosis, and epizootic bovine abortion to bind factor Hand cleave c3b. J. Clin. Microbiol. 41: 3905–3910.

18. Hovis, K. M., J. V. McDowell, L. Griffin, and R. T. Marconi. 2004. Identificationand characterization of a linear-plasmid-encoded factor H-binding protein (FhbA)of the relapsing fever spirochete Borrelia hermsii. J. Bacteriol. 186: 2612–2618.

19. Hovis, K. M., J. P. Jones, T. Sadlon, G. Raval, D. L. Gordon, and R. T. Marconi.2006. Molecular analyses of the interaction of Borrelia hermsii FhbA with thecomplement regulatory proteins factor H and factor H-like protein 1. Infect. Im-mun. 74: 2007–2014.

20. Kraiczy, P., K. Hartmann, J. Hellwage, C. Skerka, M. Kirschfink, V. Brade,P. F. Zipfel, R. Wallich, and B. Stevenson. 2004. Immunological characterizationof the complement regulator factor H-binding CRASP and Erp proteins of Bor-relia burgdorferi. Int. J. Med. Microbiol. 293(Suppl. 37): 152–157.

21. Kraiczy, P., J. Hellwage, C. Skerka, H. Becker, M. Kirschfink, M. M. Simon,V. Brade, P. F. Zipfel, and R. Wallich. 2004. Complement resistance of Borreliaburgdorferi correlates with the expression of BbCRASP-1, a novel linear plas-mid-encoded surface protein that interacts with human factor H and FHL-1 andis unrelated to Erp proteins. J. Biol. Chem. 279: 2421–2429.

22. Kraiczy, P., J. Hellwage, C. Skerka, M. Kirschfink, V. Brade, P. F. Zipfel, andR. Wallich. 2003. Immune evasion of Borrelia burgdorferi: mapping of a com-plement-inhibitor factor H-binding site of BbCRASP-3, a novel member of theErp protein family. Eur. J. Immunol. 33: 697–707.

23. Kraiczy, P., C. Skerka, V. Brade, and P. F. Zipfel. 2001. Further characterizationof complement regulator-acquiring surface proteins of Borrelia burgdorferi. In-fect. Immun. 69: 7800–7809.

24. Kraiczy, P., C. Skerka, M. Kirschfink, V. Brade, and P. F. Zipfel. 2001. Immuneevasion of Borrelia burgdorferi by acquisition of human complement regulatorsFHL-1/reconectin and Factor H. Eur. J. Immunol. 31: 1674–1684.

25. Kraiczy, P., C. Skerka, M. Kirschfink, P. F. Zipfel, and V. Brade. 2001. Mech-anism of complement resistance of pathogenic Borrelia burgdorferi isolates. Int.Immunopharmacol. 1: 393–401.

26. Kraiczy, P., C. Skerka, P. F. Zipfel, and V. Brade. 2002. Complement regulator-acquiring surface proteins of Borrelia burgdorferi: a new protein family involvedin complement resistance. Wien. Klin. Wochenschr. 114: 568–573.

27. Hartmann, K., C. Corvey, C. Skerka, M. Kirschfink, M. Karas, V. Brade,J. C. Miller, B. Stevenson, R. Wallich, P. F. Zipfel, and P. Kraiczy. 2006. Func-tional characterization of BbCRASP-2, a distinct outer membrane protein of Bor-relia burgdorferi that binds host complement regulators factor H and FHL-1.Mol. Microbiol. 61: 1220–1236.

28. Wallich, R., J. Pattathu, V. Kitiratschky, C. Brenner, P. F. Zipfel, V. Brade,M. M. Simon, and P. Kraiczy. 2005. Identification and functional characterizationof complement regulator-acquiring surface protein 1 of the Lyme disease spiro-chetes Borrelia afzelii and Borrelia garinii. Infect. Immun. 73: 2351–2359.

29. Brooks, C. S., S. R. Vuppala, A. M. Jett, A. Alitalo, S. Meri, and D. R. Akins.2005. Complement regulator-acquiring surface protein 1 imparts resistance tohuman serum in Borrelia burgdorferi. J. Immunol. 175: 3299–3308.

30. Travis, J., J. Potempa, and H. Maeda. 1995. Are bacterial proteinases pathogenicfactors? Trends Microbiol. 3: 405–407.

31. Coleman, J. L., J. A. Gebbia, J. Piesman, J. L. Degen, T. H. Bugge, andJ. L. Benach. 1997. Plasminogen is required for efficient dissemination of B.burgdorferi in ticks and for enhancement of spirochetemia in mice. Cell 89:1111–1119.

32. Fuchs, H., M. M. Simon, R. Wallich, M. Bechtel, and M. D. Kramer. 1996.Borrelia burgdorferi induces secretion of pro-urokinase-type plasminogen acti-vator by human monocytes. Infect. Immun. 64: 4307–4312.

33. Fuchs, H., R. Wallich, M. M. Simon, and M. D. Kramer. 1994. The outer surfaceprotein A of the spirochete Borrelia burgdorferi is a plasmin(ogen) receptor.Proc. Natl. Acad. Sci. USA 91: 12594–12598.

34. Nordstrand, A., A. Shamaei-Tousi, A. Ny, and S. Bergstrom. 2001. Delayedinvasion of the kidney and brain by Borrelia crocidurae in plasminogen-deficientmice. Infect. Immun. 69: 5832–5839.

35. Coleman, J. L., T. J. Sellati, J. E. Testa, R. R. Kew, M. B. Furie, and J. L. Benach.1995. Borrelia burgdorferi binds plasminogen, resulting in enhanced penetrationof endothelial monolayers. Infect. Immun. 63: 2478–2484.

36. Klempner, M. S., R. Noring, M. P. Epstein, B. McCloud, R. Hu, S. A. Limentani,and R. A. Rogers. 1995. Binding of human plasminogen and urokinase-typeplasminogen activator to the Lyme disease spirochete, Borrelia burgdorferi.J. Infect. Dis. 171: 1258–1265.

37. Grab, D. J., G. Perides, J. S. Dumler, K. J. Kim, J. Park, Y. V. Kim,O. Nikolskaia, K. S. Choi, M. F. Stins, and K. S. Kim. 2005. Borrelia burgdor-feri, host-derived proteases, and the blood-brain barrier. Infect. Immun. 73:1014–1022.

38. Hu, L. T., G. Perides, R. Noring, and M. S. Klempner. 1995. Binding of humanplasminogen to Borrelia burgdorferi. Infect. Immun. 63: 3491–3496.

39. Lagal, V., D. Portnoi, G. Faure, D. Postic, and G. Baranton. 2006. Borreliaburgdorferi sensu stricto invasiveness is correlated with OspC-plasminogen af-finity. Microbes Infect. 8: 645–652.

40. Prodinger, W. M., J. Hellwage, M. Spruth, M. P. Dierich, and P. F. Zipfel. 1998.The C terminus of factor H: monoclonal antibodies inhibit heparin binding andidentify epitopes common to factor H and factor H-related proteins. Biochem. J.331: 41–47.

41. Kuhn, S., and P. F. Zipfel. 1995. The baculovirus expression vector pBSV-8Hisdirects secretion of histidine-tagged proteins. Gene 162: 225–229.

42. Kraiczy, P., K. P. Hunfeld, S. Breitner-Ruddock, R. Wurzner, G. Acker, andV. Brade. 2000. Comparison of two laboratory methods for the determination ofserum resistance in Borrelia burgdorferi isolates. Immunobiology 201: 406–419.

43. Bunikis, J., C. J. Luke, E. Bunikiene, S. Bergstrom, and A. G. Barbour. 1998. Asurface-exposed region of a novel outer membrane protein (P66) of Borrelia spp.is variable in size and sequence. J. Bacteriol. 180: 1618–1623.

44. Hellwage, J., T. Meri, T. Heikkila, A. Alitalo, J. Panelius, P. Lahdenne,I. J. Seppala, and S. Meri. 2001. The complement regulator factor H binds to thesurface protein OspE of Borrelia burgdorferi. J. Biol. Chem. 276: 8427–8435.

45. Haake, D. A. 2000. Spirochaetal lipoproteins and pathogenesis. Microbiology146: 1491–1504.

46. Schulze, R. J., and W. R. Zuckert. 2006. Borrelia burgdorferi lipoproteins aresecreted to the outer surface by default. Mol. Microbiol. 59: 1473–1484.

47. Juncker, A. S., H. Willenbrock, G. Von Heijne, S. Brunak, H. Nielsen, andA. Krogh. 2003. Prediction of lipoprotein signal peptides in Gram-negative bac-teria. Protein Sci. 12: 1652–1662.

48. Zipfel, P. F., C. Skerka, J. Hellwage, S. T. Jokiranta, S. Meri, V. Brade,P. Kraiczy, M. Noris, and G. Remuzzi. 2002. Factor H family proteins: on com-plement, microbes and human diseases. Biochem. Soc. Trans. 30: 971–978.

49. Oppermann, M., T. Manuelian, M. Jozsi, E. Brandt, T. S. Jokiranta, S. Heinen,S. Meri, C. Skerka, O. Gotze, and P. F. Zipfel. 2006. The C terminus of com-plement regulator Factor H mediates target recognition: evidence for a compactconformation of the native protein. Clin. Exp. Immunol. 144: 342–352.

50. Horstmann, R. D., H. J. Sievertsen, J. Knobloch, and V. A. Fischetti. 1988.Antiphagocytic activity of streptococcal M protein: selective binding of comple-ment control protein factor H. Proc. Natl. Acad. Sci. USA 85: 1657–1661.

51. Ram, S., F. G. Mackinnon, S. Gulati, D. P. McQuillen, U. Vogel, M. Frosch,C. Elkins, H. K. Guttormsen, L. M. Wetzler, M. Oppermann, et al. 1999. Thecontrasting mechanisms of serum resistance of Neisseria gonorrhoeae and groupB Neisseria meningitidis. Mol. Immunol. 36: 915–928.

52. Neeleman, C., S. P. Geelen, P. C. Aerts, M. R. Daha, T. E. Mollnes, J. J. Roord,G. Posthuma, H. van Dijk, and A. Fleer. 1999. Resistance to both complementactivation and phagocytosis in type 3 pneumococci is mediated by the binding ofcomplement regulatory protein factor H. Infect. Immun. 67: 4517–4524.

53. Meri, T., S. J. Cutler, A. M. Blom, S. Meri, and T. S. Jokiranta. 2006. Relapsingfever spirochetes Borrelia recurrentis and B. duttonii acquire complement reg-ulators C4b-binding protein and factor H. Infect. Immun. 74: 4157–4163.

54. Park, C. T., and S. D. Wright. 1996. Plasma lipopolysaccharide-binding proteinis found associated with a particle containing apolipoprotein A-I, phospholipid,and factor H-related proteins. J. Biol. Chem. 271: 18054–18060.

55. Zuckert, W. R., J. E. Lloyd, P. E. Stewart, P. A. Rosa, and A. G. Barbour. 2004.Cross-species surface display of functional spirochetal lipoproteins by recombi-nant Borrelia burgdorferi. Infect. Immun. 72: 1463–1469.

56. Porcella, S. F., S. J. Raffel, D. E. Anderson, Jr., S. D. Gilk, J. L. Bono,M. E. Schrumpf, and T. G. Schwan. 2005. Variable tick protein in two genomicgroups of the relapsing fever spirochete Borrelia hermsii in western North Amer-ica. Infect. Immun. 73: 6647–6658.

57. Hovis, K. M., M. E. Schriefer, S. Bahlani, and R. T. Marconi. 2006. Immuno-logical and molecular analyses of the Borrelia hermsii factor H and factor H-likeprotein 1 binding protein, FhbA: demonstration of its utility as a diagnosticmarker and epidemiological tool for tick-borne relapsing fever. Infect. Immun.74: 4519–4529.

58. Anda, P., P. B. Backenson, J. L. Coleman, and J. L. Benach. 1994. Epitopesshared by unrelated antigens of Borrelia burgdorferi. Infect. Immun. 62:1070–1078.

59. Klempner, M. S., R. Noring, M. P. Epstein, B. McCloud, and R. A. Rogers. 1996.Binding of human urokinase type plasminogen activator and plasminogen to Bor-relia species. J. Infect. Dis. 174: 97–104.

60. Gebbia, J. A., J. C. Monco, J. L. Degen, T. H. Bugge, and J. L. Benach. 1999. Theplasminogen activation system enhances brain and heart invasion in murine re-lapsing fever borreliosis. J. Clin. Invest. 103: 81–87.

61. Hajjar, K. A., A. T. Jacovina, and J. Chacko. 1994. An endothelial cell receptorfor plasminogen/tissue plasminogen activator. I. Identity with annexin II. J. Biol.Chem. 269: 21191–21197.

62. Rooijakkers, S. H. M., W. J. B. van Wamel, M. Ruyken, K. P. M. van Kessel, andJ. A. G. van Strijp. 2005. Anti-opsonic properties of staphylokinase. MicrobesInfect. 7: 476–484.

7301The Journal of Immunology

by guest on January 6, 2019http://w

ww

.jimm

unol.org/D

ownloaded from