Dorsoventral decoupling of Hox gene expressionunderpins the diversification of molluscsPin Huana,b,c,1

, Qian Wanga,c,1, Sujian Tana, and Baozhong Liua,b,c,2

aKey Laboratory of Experimental Marine Biology, Center for Ocean Mega-Science, Institute of Oceanology, Chinese Academy of Sciences, 266071 Qingdao,China; bLaboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, 266000 Qingdao, China;and cCollege of Advanced Agricultural Sciences, University of Chinese Academy of Sciences, 100039 Beijing, China

Edited by Sean B. Carroll, Howard Hughes Medical Institute, College Park, MD, and approved November 27, 2019 (received for review May 1, 2019)

In contrast to the Hox genes in arthropods and vertebrates, thosein molluscs show diverse expression patterns with differencesreported among lineages. Here, we investigate 2 phylogeneticallydistant molluscs, a gastropod and a polyplacophoran, and showthat the Hox expression in both species can be divided into2 categories. The Hox expression in the ventral ectoderm generallyshows a canonical staggered pattern comparable to the patternsof other bilaterians and likely contributes to ventral patterning,such as neurogenesis. The other category of Hox expression on thedorsal side is strongly correlated with shell formation and exhibitslineage-specific characteristics in each class of mollusc. This generalizedmodel of decoupled dorsoventral Hox expression is compatible withknown Hox expression data from other molluscan lineages and mayrepresent a key characteristic of molluscan Hox expression. Theseresults support the concept of widespread staggered Hox expressionin Mollusca and reveal aspects that may be related to the evolutionarydiversification of molluscs. We propose that dorsoventral decouplingof Hox expression allowed lineage-specific dorsal and ventral pattern-ing, which may have facilitated the evolution of diverse body plans indifferent molluscan lineages.

Hox | mollusc | dorsoventral decoupling | staggered expression | shell

The conserved role of Hox genes in body patterning acrossbilaterian animals has been extensively discussed (1–3) and

even extended somewhat to cnidarians (4, 5). However, conserva-tion has limits, and there is considerable variation among animals inthe composition and expression patterns of Hox genes (6–12).These differences are particularly evident in Spiralia, which,together with Ecdysozoa and Deuterostomia, forms the thirdmajor clade of Bilateria (13). Staggered Hox expression alongthe anterior–posterior (AP) axis (similar to arthropods and ver-tebrates) is observed in Annelida (14–16) and Mollusca (17–19).In other spiralians, however, this pattern has been observed muchless frequently (10, 11, 20, 21).Mollusca is the most species-rich phylum of Spiralia and com-

prises 8 class-grade clades (22–24), each with a unique body plan(Fig. 1A). Early studies focusing on molluscan Hox genes revealedquite diverse expression (e.g., in the shell gland, foot, velum, andcephalopod brachial crown), with inconsistencies among lineages(25–28). Evidence of staggered expression has been indicated in1 gastropod (25) but not in another gastropod or a cephalopod (26–28). The lack of staggered Hox expression, however, was sub-sequently challenged by the unexpected staggered expression of Hoxgenes in a polyplacophoran (chiton) (17, 18), a bivalve (29). and ascaphopod (tusk-shell) species (19). More importantly, the latterstudy discovered previously unrecognized remnants of staggeredpatterns by reexamining the known Hox expression data of a gas-tropod and a cephalopod, suggesting the occurrence of widespreadstaggered Hox expression in molluscs (19) (monoplacophorans andaplacophorans have not been observed yet).However, notably, the states of staggered Hox expression vary

across molluscan lineages. The staggered pattern comparable tothat of arthropods or annelids (hereafter called a “canonicalstaggered pattern”), which is characterized by the involvement of

a majority of Hox members and a clearly staggered arrangementof gene expression domains, seems restricted to polyplacophoranand scaphopod molluscs (17–19). Other cases of staggered ex-pression (hereafter called a “partial staggered pattern”) involve alimited number of Hox genes (a bivalve) (29) or show a relativelyambiguous staggered arrangement of gene expression domains(gastropods and a cephalopod) (19, 25–28). It remains unclearwhy a canonical staggered pattern is evident in some molluscanlineages, while only a partial staggered pattern is observed inothers. In fact, the inconsistency of staggered expression is partof a broader open question, which is, why previous studies haverevealed diverse patterns of Hox expression in various types oftissues, with little consistency among lineages. For instance, thecentral class Hox gene lox5 is expressed in distinct patterns in abivalve (in the shell field) (29), a gastropod (in pretrochal cells,the apical organ, the velum, and the cerebral ganglia) (28), and ascaphopod (in the foot, the hindgut, tissues between the pedaland the cerebral ganglia, and the visceral mass) (19).A recent hypothesis suggests that the common ancestor of

molluscs has predominantly ectodermal Hox expression along

Significance

How animal bodies became diversified is a key concern inevolutionary study. As the second most species-rich phylum,Mollusca possesses a vast diversity of body plans, ranging fromthose of clams to octopuses, but the underlying mechanisms ofmollusc diversification remain unknown. Our study shows thatdorsoventrally decoupled Hox expression may have facilitatedthe diversification of molluscs by permitting lineage-specificdorsal and ventral patterning. We further reveal evidencethat the model is applicable to a broad range of animals andthus may have contributed to animal diversification eventssuch as the Cambrian explosion. By demonstrating conservedand lineage-specific Hox expression in ventral and dorsaltissues, respectively, our results would also contribute tounderstanding the exceptional diversity of molluscan Hoxexpression.

Author contributions: P.H. and B.L. designed research; P.H., Q.W., and S.T. performedresearch; P.H., Q.W., and B.L. analyzed data; P.H. and B.L. wrote the paper; and S.T.contributed to the experiment design by speculating very quick changes ofHox expression.

The authors declare no competing interest.

This article is a PNAS Direct Submission.

Published under the PNAS license.

Data deposition: The transcriptomic data of the 2 species are deposited in the NationalCenter for Biotechnology Information’s (NCBI) Sequence Read Archive, https://www.ncbi.nlm.nih.gov/sra (accession nos. SRX3353365, SRX5249811, and SRX5249812).The gene sequence data are deposited in GenBank, https://www.ncbi.nlm.nih.gov/genbank(accession nos. MN326438, MN326439, and MK637053–MK637075).1P.H. and Q.W. contributed equally to this work.2To whom correspondence may be addressed. Email: bzliu@qdio.ac.cn.

This article contains supporting information online at https://www.pnas.org/lookup/suppl/doi:10.1073/pnas.1907328117/-/DCSupplemental.

First published December 23, 2019.

www.pnas.org/cgi/doi/10.1073/pnas.1907328117 PNAS | January 7, 2020 | vol. 117 | no. 1 | 503–512

EVOLU

TION

Dow

nloa

ded

by g

uest

on

Aug

ust 1

3, 2

021

the AP axis and that some Hox genes are coopted to patternother structures in specific lineages (19). This hypothesis provides anexplanation for the great diversity of molluscan Hox expression andis supported by current results in general. For example, suchcooptions might underpin the roles of Hox genes in the develop-ment of the brachial crown in cephalopods (26). However, given thatall molluscs share a highly similar early development that includesspiral cleavage and the highly conserved primary larva (trochophore;exceptions include cephalopods, which are direct developers, andsome lineages with pericalymma larvae [e.g., Solenogastres]) (30–33), other categories of conserved Hox expression patterns areexpected in addition to staggered expression. We proposed thatthere might be “cryptic” similarities in Hox expression that remainunrevealed, possibly caused by the dynamic Hox expression duringdevelopment as revealed in various species (17–19, 25, 28). Indeed,in reports that address relatively few developmental stages, the ex-pression of particular Hox genes exhibited no obvious similaritybetween adjacent developmental stages that were investigated [e.g.,the hox2-5 expression in Haliotis trochophore and veliger larvae(25)]. These results indicate that some transitory (and potentiallynovel) states of Hox expression might have been omitted. Thisspeculation is supported by a study in a scaphopod that examinedthe most developmental stages to date. As revealed by the study,although Hox expression changes continuously, similarities could berecognized between adjacent stages (19). It is possible that the in-vestigation of additional developmental stages, especially by in-creasing the density of sampling time points, may reveal previouslyunknown Hox expression patterns and cryptic interlineage similari-ties in Hox expression. For instance, a hidden canonical staggeredpattern in particular lineages (e.g., gastropod) or additional cate-gories of conserved Hox expression patterns (in addition to stag-gered expression) may be identified.To test our hypothesis, it is necessary to investigate Hox gene

expression at multiple developmental stages in individual mol-luscan species and then compare this gene expression among dif-ferent clades. Here, we performed a comprehensive investigation ofvarious developmental stages of a gastropod mollusc (the limpetLottia goshimai) (Fig. 1B). We paid special attention to a gastropodspecies because previous studies on gastropod Hox expressionrevealed the most diverse results and only a partial staggered pat-tern (25, 27, 28). For comparison, we included in this study a poly-placophoran, the chiton Acanthochitona rubrolineata (Fig. 1C). Thespecies is an aculiferan mollusc that is phylogenetically distant fromL. goshimai (Fig. 1A), and staggered Hox expression was reported inits close relative Acanthochitona crinita (17, 18). By investigating theHox expression data of the 2 species, we deduced a dorsoventral

decoupling Hox expression model in molluscs and proposed ahypothesis regarding the evolution of the vast diversity of bodyplans in this phylum.

ResultsDynamic Expression of Molluscan Hox Genes. We identified 11 and 10Hox genes from the developmental transcriptomes of L. goshimaiand Ac. rubrolineata, respectively (SI Appendix, Figs. S17 and S18).The 2 species both possessed complete anterior (hox1-3) and cen-tral (hox4-5, lox5, antp, lox4, and lox2) classes of Hox genes. Twogenes of the posterior class, post2 and post1, were identified inL. goshimai, whereas only post2 was observed in Ac. rubrolineata. Nopost1 gene was retrieved in a further search against an adult tran-scriptome. Given that post1 is also not found in the chiton Ac. crinita(18), this gene may have been lost in this lineage.In L. goshimai, we sampled 5 developmental stages (2 gastrula

stages, 2 trochophore stages, and 1 veliger stage, see Fig. 1B) inshort time intervals (as short as every 2 h) and revealed that itsHox expression changed rapidly. Several representative genesshowing this dynamic expression are presented in Fig. 2, and alldata are presented in SI Appendix, Figs. S3–S7. The changes inHox expression can generally be divided into 2 types. The firsttype represents changes correlated with cell movement duringgastrulation or organogenesis. For instance, the merging ofdorsal hox5 expression into 1 expression domain at 8 h post-fertilization (hpf) (Fig. 2 G and H) likely resulted from the de-velopment of the shell field (the tissue responsible for shellformation), and the change in ventral lox2 expression from 10 to12 hpf correlated with the foot anlage formation (Fig. 2 V andW)(see SI Appendix, Supplementary Text for the criteria to de-termine dorsal and ventral Hox expression). The second type ofHox expression change refers to the switching on or off of geneexpression. Examples of this type of change include the activa-tion of ventral hox5 expression at 12 hpf (Fig. 2 J and K) and theloss of dorsal lox2 expression at 10 hpf (Fig. 2 T and U). On someoccasions, both types of expression changes occurred at the sametime (e.g., for lox5, see Fig. 2 M–O). Although dynamic Hoxexpression during gastropod development has been reported (25,27, 28), the occurrence of such quick changes in as little as 2 h wassomewhat unexpected. This finding supports our speculation that arelatively high density of sampling time points would be necessarywhen studying Hox expression in particular molluscan lineages.In Ac. rubrolineata, we sampled 2 larval stages and detected

minor changes in Hox expression. Although other developmentalstages (e.g., the embryos and very early larvae) may exhibit dif-ferent Hox expression patterns, we believe that the 2 studied

dorsal ventral

Lottia goshimai

dorsal ventral

Acanthochitona rubrolineata

Aculifera

Conchifera

CaudofoveataAplacophora

Solenogastres

Polyplacophora

Cephalopoda

Monoplacophora

Scaphopoda

Gastropoda

Bivalvia

GastrulaCleavage Trochophore Veliger Juvenile

Fertilization Metamorphosis

~15 hpf~9 hpf ~110 hpf3 hpf

Fertilization Metamorphosis

Trochophore JuvenileEmbryo

Hatch

~60 hpf~8-10 hpf

24 hpf 48 hpf

28 hpf12 hpf10 hpf8 hpf6 hpf

A B

C

Fig. 1. The 2 phylogenetically distant molluscan species used in the current study. (A) Phylogenetic tree of Mollusca (data from ref. 22). The phylogeneticpositions of the 2 species are highlighted. (B and C) The gastropod L. goshimai and the polyplacophoran Ac. rubrolineata. The morphology of adults and thetiming of development (length not to scale) are shown. Asterisks indicate the time points at which samples were collected for gene expression analysis.

504 | www.pnas.org/cgi/doi/10.1073/pnas.1907328117 Huan et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

3, 2

021

stages were sufficiently representative because they showed Hoxexpression patterns comparable to those of L. goshimai (see detailsbelow), and thus we did not investigate other development stages.Other noticeable Hox expression patterns included asymmet-

rical left–right expression in L. goshimai [e.g., hox1 at 6 hpf (SIAppendix, Fig. S3B″), see others in SI Appendix, Figs. S3–S5] andpotential mesodermal expression in both species (e.g., L. goshi-mai hox2 at 10 hpf and Ac. rubrolineata lox2, see SI Appendix,Figs. S5C′, S8J′, and S10J′). In late larvae, extensive expressionwas observed in the larval foot and showed a strong correlationwith neural tissues (almost exclusively in L. goshimai, with addi-tional expression in the shell field of Ac. rubrolineata). Nevertheless,because this study focused on an interspecies comparison, we willnot describe the details of each Hox expression pattern here; in-stead, this information is provided in SI Appendix, Figs. S3–S11.

The Key Characteristic of Molluscan Hox Expression: DorsoventralDecoupling. After analyzing the complex Hox expression atmultiple developmental stages, we concluded that a key char-acteristic of molluscan Hox expression is the decoupling ofdorsal and ventral expression (see examples in Fig. 3). This rulewas deduced based on the observation that Hox expression wasgenerally associated with 2 groups of ectodermal tissues in theposttrochal region, the majority of which developed into ventral(foot) and dorsal (shell field) structures. We therefore designatedthe 2 categories of Hox expression “dorsal” and “ventral” expres-sion for simplicity (the minor Hox expression in other unidentifiedectodermal tissues and the potential mesodermal expression are notdiscussed in this study; see SI Appendix, Supplementary Text). Such

dorsal and ventral expression could generally be determined byvisual inspection. Nevertheless, since Hox expression observationsmay be influenced by the extensive cell movement and morpho-logical changes during development, we identified dorsal and ven-tral Hox expression based on their association with the expression ofmarker genes (soxb and engrailed). In brief, after confirming thatsoxb and engrailed expression marked the ventral and dorsal ecto-derm in both molluscan species (SI Appendix, Figs. S3–S6 and S8–S11), respectively, we determined ventral Hox expression to be theregion of Hox expression that overlaps with the soxb-expressingregion and dorsal Hox expression to be that showing tight corre-lation with engrailed expression (except for minor exceptions such asL. goshimai post genes). A detailed description of the criteria isprovided in SI Appendix, Supplementary Text. Due to the complexityof morphogenesis (e.g., gastrulation), the deduced lines dis-tinguishing dorsal and ventral Hox expression were slanted in somecases (Fig. 3 B–N and SI Appendix, Figs. S3–S6). In subsequentsections, we use the term “ventral plate” to refer to the soxb ex-pression region, a term that has been used in a polychaete annelidresearch (34), and use the term “shell field” to refer to the wholearea of the dorsal ectoderm that contributes to shell development(i.e., those tissues showing correlation to the engrailed expressionregion), although the term may have had more specific meanings inthe previous literature (35).Based on the division of Hox expression into dorsal and ven-

tral categories, the decoupling of dorsoventral expression wasevident for most genes. At a given time point, a Hox gene can beexpressed solely in dorsal or ventral tissues (e.g., L. goshimaihox5 and lox4 at 10 hpf, see Fig. 3 H and K) or in both tissues

dorsal

2-hour intervals6 hpf 8 hpf 10 hpf 12 hpf 28 hpf

dorsal dorsal ventral ventral ventral

lox5

hox5

lox2

hox2

A

G

M

S

B

H

N

T

C

I

O

U

D

J

P

V

E

K

Q

W

F

L

R

X

1 1 1

333333

2 2

2

sf

pt

sf sf footanlage

vpfoot

shell

pt pt pt pt

Fig. 2. Hox expression in L. goshimai changes rapidly in early development. Four genes are presented here as examples, and information on other genes isprovided in SI Appendix, Figs. S3–S7. A schematic diagram of the embryo/larva is shown at the Top of each column. A dorsal view is shown for 6 to 8 hpf, and aventral view is shown for 12 to 28 hpf, as these views demonstrate the greatest Hox expression. Both the dorsal and ventral views are shown for 10 hpf. Thecomplex changes in lox5 expression from 6 to 10 hpf are highlighted (indicated by the letters 1–3 inM–P). At 6 hpf, lox5was expressed in 2 rows of cells (1 and2 in M). Two hours later (8 hpf), expression 1 transited into a round region, while expression 2 became bent (1 and 2 in N); additional lox5 expression wasactivated on the opposite side of the embryo (3 in N). After an additional 2 h (10 hpf), expression 2 vanished, while expressions 1 and 3 were sustained (1 and3 in O). Note that expressions 2 and 3 are superimposed in N (2 and 3 in N) but are actually on the dorsal and ventral sides, respectively. For clarity, expression3 is highlighted in P (3 in P) since it is unclear in N and O, showing dorsal views (3 in N and O). pt, prototroch; sf, shell field; vp, ventral plate. (Scale bar, 50 μm.)

Huan et al. PNAS | January 7, 2020 | vol. 117 | no. 1 | 505

EVOLU

TION

Dow

nloa

ded

by g

uest

on

Aug

ust 1

3, 2

021

while showing distinct expression patterns (e.g., L. goshimai hox4at 10 hpf and most Ac. rubrolineata Hox genes at 24 hpf, see Fig.3 G and R–AA). Notably, we use the term “decoupling” to in-dicate the distinct dorsal and ventral expression patterns (in-dicating potential decoupled regulatory mechanisms); however,this does not suggest a gap between the 2 expression categories.In fact, while discontinuous dorsal and ventral expression wasobserved for most L. goshimai genes, continuous expression wasdetected for many Ac. rubrolineata Hox genes. In these cases, thedorsal and ventral ectodermal expression were connected byminor “medial” ectodermal expression and/or potential meso-dermal expression and still showed distinct patterns (SI Appen-dix, Figs. S8–S11 and Table S4).There were minor exceptions to this rule, i.e., coupled dor-

soventral expression, including the 2 post genes of L. goshimai(before 12 hpf, see SI Appendix, Figs. S3–S5) and lox4 of Ac.

rubrolineata (at 48 hpf, see SI Appendix, Fig. S10I and Table S4).Nevertheless, since dorsoventrally decoupled expression wasobserved for most Hox genes, we propose that it is a majorcharacteristic of Hox expression in these 2 mollusc species. As wedescribe in detail below (Figs. 4 and 5), ventral Hox expressionmay contribute to ventral patterning, such as neurogenesis andfoot development, and dorsal expression correlates with dorsalpatterning, mainly shell formation.In addition to spatial decoupling, Hox expression in L. goshimai

also showed temporal dorsoventral decoupling; that is, theswitching on and off of dorsal and ventral expression showed noobvious correlation (Fig. 3AB). In general, there was a tendencyfor earlier dorsal expression than ventral expression in this spe-cies. For most Hox genes, dorsal expression was observed tobegin at early developmental stages (6 to 8 hpf), and ventralexpression became detectable only later (after 10 hpf) (Fig. 3AB

dorsal expressionventral expression

7 9 8

2

9 10

4 67

99 11 10 10

0

2

4

6

8

10

12

6 hpf 8 hpf 10 hpf 12 hpf 28 hpf 24 hpf 48 hpf

L. goshimai

L. goshimai

Hox

num

ber

Ac. rubrolineata

Ac. rubrolineata

sf

sf

vp

vp

* * * *

* *****

**

*

*** * * *

* *****

ptptpt pt pt pt

ptptpt

ptptpt

ptptpt pt pt pt

pt ptptptptpt

pt

DVDVDVDV DV DV DV

DV DV DV DV DV DV DV

DVDVDV DV DV DV

DVDV DV DV DVDV

V D

hox1soxb engrailed

soxb engrailed

hox2 hox3 hox4

hox5 lox5

hox1

lox5

antp lox4 lox2 post2

antp lox4 lox2 post2

post1

hox2 hox3 hox4

hox5

10 hpf

24 hpf

A

V W X Y Z AA

AB

O P Q R S T U

H I J K L M N

B C D E F G

Fig. 3. Dorsoventral decoupling of molluscan Hox expression. All panels except for AB are lateral views. Asterisks indicate the larval mouth. A and O showthe schematics of the trochophore larvae of the 2 species (lateral view). The dashed lines separate the dorsal (D) and ventral (V) parts in B–N and P–AA andwere plotted based on the expression of the marker genes soxb and engrailed (B, C, P, and Q). Spatial decoupling can be observed for most Hox genes in bothspecies (D–N: L. goshimai; R–AA: Ac. rubrolineata), while temporal decoupling can be observed in L. goshimai but not in Ac. rubrolineata (AB, see moreinformation in SI Appendix, Tables S3 and S4). Coupled dorsoventral expression is observed in a few exceptions (post2 and post1 in L. goshimai,M and N). Thewhite triangles in E, Y, and Z indicate potential mesodermal expression, which is not discussed in this study (see SI Appendix, Figs. S5 and S8 for more in-formation). White crosses in Q indicate engrailed expression in ventral tissues, which was not considered when analyzing Hox expression (SI Appendix,Supplementary Text). pt, prototroch; vp, ventral plate; sf, shell field. (Scale bars, 50 μm.) Here, 2 representative stages (1 for each species) are provided asexamples, and all data are provided in SI Appendix, Figs. S3–S11.

506 | www.pnas.org/cgi/doi/10.1073/pnas.1907328117 Huan et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

3, 2

021

and SI Appendix, Figs. S3–S7). Minor exceptions included antp,which showed only ventral expression (in the veliger larva), and2 other genes that showed earlier ventral expression (hox3 andlox4) (SI Appendix, Figs. S3–S7). The dorsal and ventral Hoxexpression in Ac. rubrolineata did not show temporal decouplingin the 2 developmental stages that were investigated (Fig. 3ABand SI Appendix, Figs. S8–S11).

Ventral Hox Expression: Conserved Staggered Expression. We ob-served canonical staggered ventral Hox expression in both spe-cies. The staggered ventral Hox expression in Ac. rubrolineata(Fig. 4A) was similar to that in its close relative (Ac. crinita)reported previously (17, 18). In L. goshimai, despite the quickchanges in Hox expression, we recognized a stage during whichstaggered Hox expression was detected in ventral tissues (earlytrochophore 10 hpf, Fig. 4A). Compared to the partial staggeredpattern reported in veliger larvae of other gastropods (19, 25, 27,28), the expression we detected in L. goshimai was a canonicalstaggered pattern and emerged in an earlier stage. In both Ac.rubrolineata and L. goshimai, the staggered ventral Hox expres-sion along the AP axis was consistent with the sequence of apresumptive Hox cluster (spatial collinearity) (Fig. 4 B and C),although determining the exact interrelationships between thegene expression domains will require higher-resolution ap-proaches such as double-color in situ hybridization (ISH). Giventhat the ventral ectoderm showing the most Hox expressionexpressed soxb (Fig. 4D) in the 2 species and that SoxB plays anessential role in early neurogenesis (36), Hox genes are expectedto have roles in neurogenesis. In Ac. rubrolineata, although aproportion of ventral signals were observed in subepidermal cells(Fig. 3 R–AA), these tissues are likely also neural tissues becausethe corresponding tissues of its close relative Ac. crinita expressthe neural marker elav (18).However, the L. goshimai ventral Hox expression lost its stag-

gered pattern in as little as 2 h and exhibited no obvious relationshipwith the AP axis in later larvae (from 10 to 12 hpf, see Fig. 2 and SI

Appendix, Figs. S5 and S6). This finding demonstrates that canonicalstaggered Hox expression is restricted to particular developmentalstages in L. goshimai. In Ac. rubrolineata, the staggered expression inventral tissues was stable at the 2 stages examined (SI Appendix,Figs. S8–S11).

Dorsal Hox Expression: Strong Correlation with the Shell Field. De-spite the highly conserved staggered ventral expression, dorsalHox expression showed few common characteristics. Neverthe-less, by recognizing its association with engrailed expression (SIAppendix, Figs. S3–S6 and S8–S11), we noticed that dorsal Hoxexpression correlated with shell development in a lineage-specific manner. In L. goshimai, the trochophore larva (10 hpf)possessed a single round shell plate (Fig. 5A). Accordingly, hox1-3 were expressed in a circular (or partially circular) pattern thatsurrounded the shell field (Fig. 5 D–F). The other 3 genes,namely, hox4, hox5, and lox5, were expressed in the central re-gions of the shell field (Fig. 5 G–I). An association between theshell field and the expression of more Hox genes was detected inother developmental stages. In earlier stages (6- and 8-hpf gas-trulae), the expression of lox2 was detected in the dorsal ecto-derm adjacent to the engrailed expression region and thus mayplay a role in shell-field patterning (SI Appendix, Figs. S3J″ andS4J″). In later trochophore larvae (12 hpf), although the hox3expression in the shell field had vanished, the expression of lox4,lox2, and post2 in the leading edge of the shell field was evident(SI Appendix, Fig. S6 I′–K′ and I″–K″). Together, most Hoxgenes of L. goshimai showed a correlation with the shell field onthe dorsal side at particular developmental stages.In Ac. rubrolineata, in accordance with the composition of the

larval shell field by 7 repeated shell plates/pseudosegments (Fig.5 B and C), hox1-5 and lox2 were expressed in particular bands inthe dorsal ectoderm (Fig. 5 J–O and J′–O′). The expression of allof the other Hox genes covered a continuous region of the dorsalectoderm, and a specific correlation between the gene expressionand shell field was difficult to determine (SI Appendix, Figs.

L. g

oshi

mai

1

0 hp

fA

c. ru

brol

inea

ta

2

4 hp

f

L. goshimai Ac. rubrolineataL. goshimai

L. goshimai

Ac. rubrolineata

Ac. rubrolineata

C D

hox2 hox3 hox4 hox5 lox5 lox4 lox2antp post2hox1

hox2 hox3 hox4 hox5 lox5 lox4 lox2antp post2hox1 post1soxb soxb

lox5 antp lox4 lox2 post1post2hox1 hox2 hox3 hox4 hox5

ptpt

A

B

Fig. 4. Conserved staggered ventral Hox expression. The larvae are at the same stages as in Fig. 3 A–AA, and all panels show ventral views. A shows the Hoxexpression in the trochophores of L. goshimai and Ac. rubrolineata. In B, schematic diagrams show the staggered Hox expression along the AP axis accordingto a presumptive Hox cluster (C). Note that expression of hox1, hox2, and hox5 of L. goshimai (black triangles in A) is not on the ventral side, and antpexpression is not detectable (see details in SI Appendix, Fig. S5). D shows the soxb expression in the 2 species. In L. goshimai, the soxb expression does notcover the most posterior ectoderm that expresses post2 and post1 (see details in SI Appendix, Supplementary Text). pt, prototroch. (Scale bars, 50 μm.)

Huan et al. PNAS | January 7, 2020 | vol. 117 | no. 1 | 507

EVOLU

TION

Dow

nloa

ded

by g

uest

on

Aug

ust 1

3, 2

021

S8 and S10). In summary, similar to the expression of Hox genesin L. goshimai, dorsal Hox expression in Ac. rubrolineata showed atight correlation to the shell field, while the correlation was morespecific for hox1-5 and lox2 and less specific for the other Hox genes.The high differences in Hox expression patterns, which are

related to the lineage-specific shell structures, hamper furtherinterspecies comparisons. However, consistency of hox1-5 ex-pression is suggested in the 2 species. As shown in Fig. 5, irre-spective of the shape or internal organization of the shell field, inboth species, the expression of hox1-3 was distributed in peripheralregions [surrounding the shell field in L. goshimai (Fig. 5 D–F) andin most pseudosegments in Ac. rubrolineata (Fig. 5 J–L and J′–L′)],and hox4-5 expression was situated centrally [in the central regionof the shell field in L. goshimai (Fig. 5 G and H) and in the severalmiddle pseudosegments in Ac. rubrolineata (Fig. 5M,M′, and N′)].

DiscussionA Dorsoventral Decoupling Model of Molluscan Hox Expression. Fromour results, we deduce a model of molluscan Hox expression basedon decoupled dorsal and ventral expression. First, ventral Hox ex-

pression shows a conserved staggered pattern at particular de-velopmental stages. Second, dorsal Hox expression correlates withthe shell field and is highly lineage specific. Last, in the later larvalstages of conchiferans, Hox genes are extensively expressed in thefoot (highly correlating with neural tissues, yet no longer in astaggered manner). We then examined previous reports to explorewhether this model is compatible with the reported data. Althoughwe could not determine dorsal or ventral expression from thesestudies using the same criteria as in this study (based on the ex-pression of marker genes), they were approximately estimatedthrough visual inspection and based on the association of Hox geneexpression with particular tissues (the shell field, foot, etc.). Weconcluded that our model is compatible with known Hox expressiondata from various molluscan lineages. This compatibility is partic-ularly evident in the scaphopod Antalis entalis, for which the Hoxexpression at most developmental stages has been reported (19).Hox expression in this species matches our model, including clearexpression in the shell field at early stages, the staggered ventralexpression in early larvae (midstage trochophore), and extensivenonstaggered neural expression in later larvae (19). In particular,the dorsoventral decoupling in the Hox expression of An. entalis isreflected by the different expression patterns of the genes in thedorsal and ventral ectoderm (19). In the polyplacophoran Ac. cri-nita, ventral expression in neural tissues and dorsal expression in theshell field have also been described separately, although the dor-soventral decoupling was not emphasized (17, 18). Other re-ports described particular aspects of Hox expression that wespeculate to be snapshots of our model, including the expres-sion of Hox genes in the brachial crown (the modified foot) andthe nervous system in the embryos of the cephalopod Euprymnascolopes (26), the dorsal Hox expression in the shell field of thegastrula in the bivalve Patinopecten yessoensis (29), and thesolely dorsal or ventral Hox expression in early larvae (hox1 inthe shell field and hox2-4 in the foot rudiment), and extensiveneural expression in late larvae in the gastropod Haliotis asinina(25). In summary, we propose that the previous studiesobtained evidence of the dorsoventral decoupling of molluscanHox expression, while the researchers did not emphasize thischaracteristic. The only species with Hox expression that signif-icantly conflicts with the model is the gastropod Gibbula varia(27, 28), whose Hox expression shows very uncommon charac-teristics [e.g., extensive expression in the prototroch or velum(28), which is never observed in other molluscs]. This differencemay represent variations among species; further investigation ofmore developmental stages of G. varia (e.g., more sampling timepoints within or outside the current developmental stages in-vestigated) and additional gastropod species are needed to ex-plain these unusual Hox expression patterns.Notably, although our model addresses only the Hox expres-

sion in the posttrochal ectoderm (confined to the shell field andventral plate), we are not denying the importance of Hox ex-pression in other tissues. We include only this part of Hox ex-pression in the model because it comprises the majority of Hoxexpression in the species we investigated. However, although cur-rent data show relatively low interlineage similarities, Hox expres-sion in other tissues, such as the pretrochal ectoderm, the ciliatedcells of the prototroch, and the mesodermal and endodermal tis-sues, have been reported (refs. 17–19 and 28, this study). Thesecategories of Hox expression may result from independent cooptionsof Hox genes, which thus reflect innovations during evolution, orrepresent other types of conserved Hox expression that are not fullyrevealed yet. Additional data are required to assess whether thereare other categories of conserved Hox expression patterns amongmolluscs, in addition to our model.

Potential Relationships between the Interspecies Expression Variationsand the Genomic Organization of Hox Genes. Hox genes are arrangedin genomic clusters in many taxa, and in some cases, the clustered

trochophore (10 hpf)

Ac. rubrolineata

L. goshimai

trochophore (24 hpf)

trochophore (48 hpf)

hox1

hox2

hox4

hox3

hox5

lox5

hox1

hox2

hox4

hox3

hox5

lox2

hox1

hox2

hox4

hox3

hox5

lox2

No dorsal expression

48 hpf24 hpf

48 hpf24 hpf

48 hpf24 hpf

48 hpf24 hpf

48 hpf24 hpf

48 hpf24 hpf

D A

B

C

E

F

G

I

H

J

K

L

M

O

N

J’

K’

L’

M’

O’

N’

Fig. 5. Dorsal Hox expression correlated with the lineage-specific shell fieldin L. goshimai and Ac. rubrolineata. Most larvae are at the same de-velopmental stage as the larvae in Fig. 3 A–AA (except J′–O′), and all panelsshow dorsal views. A–C show scanning electron microscope images of thelarvae of the 2 species. The round shell plate in L. goshimai (A) and thepseudosegments where the shell plates will form in Ac. rubrolineata (B andC) are easily distinguished. D–I show Hox expression in L. goshimai larvae,in which the dashed circles indicate the shell field, and J–O (for 24 hpflarvae) and J′–O′ (for 48 hpf larvae) show Hox expression in Ac. rubroli-neata. In some panels (F, I, M, and N ), the dorsal and ventral expression areindicated by black arrowheads and gray triangles, respectively, since theventral expression is very high and may interfere with the discriminationbetween dorsal and ventral expression. See the text and SI Appendix, Figs.S3–S11 for the dorsal expression of other Hox genes. (Scale bars, 50 μm.)

508 | www.pnas.org/cgi/doi/10.1073/pnas.1907328117 Huan et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

3, 2

021

arrangement plays a role in regulating gene expression (1, 37).Given that our model suggests that lineage-specific expression (e.g.,that in the shell field) would be a fixed component of Hox ex-pression in molluscs, it would be interesting to explore whethervariations in molluscan Hox expression are related to differences ingenomic organization. However, such an attempt is hampered bythe fact that the genomic organization of Hox genes is unknown formost molluscan species with known Hox expression data (except thecephalopod E. scolopes). Nevertheless, we note that the genomicorganization of Hox genes varies considerably across molluscs; forexample, there is an intact cluster of Hox genes in the bivalveP. yessoensis and the gastropod Lottia gigantea, 2 or 4 partial clustersof Hox genes in the bivalve Crassostrea gigas and the cephalopodE. scolopes, and a likely scattered organization of Hox genes in thecephalopod Octopus bimaculoides (29, 38–41). There are also otherspecies-specific characters, such as the loss of particular orthologs(in C. gigas, E. scolopes, and O. bimaculoides) (39–41) or the pos-session of long intergenic spacers (in E. scolopes) (41), which mayalso contribute to variations in Hox expression. The potential cor-relation between the genomic organization and expression of mol-luscan Hox genes can be explored once more molluscan genomesare sequenced and the Hox expression in more species is analyzed,which would help elucidate the regulatory mechanisms underlyingmolluscan Hox expression.

Molluscan Hox Genes: Roles in Neurogenesis and Shell Formation.The molluscan dorsal and ventral Hox expression patterns, de-spite their decoupling, indicate that Hox genes have roles inneurogenesis and shell formation. The staggered expression ofthese genes in the ventral ectoderm, a great proportion of whichdevelops into neural tissues, is reminiscent of the conservedstaggered Hox expression in the nervous system of other bilaterianclades (9, 42, 43). The potential roles of Hox genes in molluscanneurogenesis are consistent with a conserved mechanism of earlyneural patterning involving Hox genes in a wide range of animals(36, 44). Moreover, because the ventral ectoderm also contributesto foot development, Hox genes are also indicated to participatein molluscan foot development.On the dorsal side, Hox expression in the molluscan shell field

has been reported frequently, and the potential roles of Hoxgenes in shell development have been appreciated in variousmolluscs (17–19, 25, 27, 29). However, the particular genesshowing this expression pattern vary greatly among differentlineages (17–19, 25, 27, 29). The expression of most Hox genes canbe detected in the shell field of the polyplacophoran Ac. crinita (17,18), but shell-field Hox expression was limited to a small number ofHox genes in conchiferan molluscs (gastropod, bivalve, and sca-phopod) (19, 25, 27, 29). Here, we show that, similar to poly-placophorans, the expression of most Hox genes can be detected inthe gastropod shell field at particular developmental stages. Thisresult indicates that the involvement of Hox genes in shell-fieldpatterning is far greater than previously believed and thus suggestsa deep integration of Hox functions in molluscan shell develop-ment. The expression of more Hox genes in the shell field of otherconchiferans is expected to be revealed as more developmentalstages are investigated. Nevertheless, we do not deny the possibilitythat only particular members of Hox genes show shell-field ex-pression in particular lineages due to lineage variations.The common, deep integration of Hox genes in the shell de-

velopment of 2 distantly related molluscan species suggests thepresence of an ancestral shell gland program in molluscs. In thiscontext, it would be interesting to ask whether Hox expression inthis ancient program is more related to position (like Hox genesin other animals and other processes) or to cell lineage (con-sidering the highly conserved spiral cleavage in molluscs). Thecommon central-to-peripheral hox1-5 expression in the 2 species[i.e., generally peripheral hox1-3 expression and central hox4-5expression (Fig. 5)] supports that there is position-related Hox

expression in the shell field. This speculation is consistent withprevious studies that revealed regional specializations in thegastropod larval mantle (45) and positional regulations of mantlegrowth [e.g., a gradient of cell proliferation in the bivalve mantle(46) and the regulation of mantle cell proliferation by a growthfactor (47, 48)]. Nevertheless, an alternative explanation for theposition-related hox1-5 expression is that the different regions ofthe shell field contain distinct cell lineages (which express dif-ferent Hox genes). The effects of cell lineage are indicated by thefact that dorsal lox4 and lox2 expression in L. goshimai at 12 hpfshows a correlation with the descendants of 2d [SI Appendix, Fig.S6 I′, J′, I″, and J″, based on the fate map of Patella (49)]. In-formation on the cell lineages in different regions of the shellfield is necessary to explore their effect on shell-field Hox ex-pression. Nevertheless, this information remains relatively elu-sive because previous studies revealed only limited details aboutthe organization of cell lineages inside the shell field [2a-2d inthe patellogastropod Patella (49) and mainly 2d, 3c, and 3d in thepolyplacophoran Chaetopleura (50)]. Higher-resolution analysestracing the fates of daughter cells or even later descendants of 2qand 3q [e.g., 2q21/2q22, 3q1/3q2, as has been performed in Crep-idula (51)] would provide useful information. Nevertheless, itseems clear that the arrangement of Hox expression in the pol-yplacophoran shell field (perpendicular to the AP axis) (refs. 17and 18; this study) is very different from that of cell lineages(generally parallel to the AP axis) (50), indicating that celllineage may have little effect on shell-field Hox expression inpolyplacophorans. Together, both cell-lineage and noncell-lineage effects are suggested in the ancient shell formationprogram, and further investigations are required to elucidate the2 categories of effects on Hox expression.

The Decoupled Hox Expression in Molluscs: Evolutionary Implications.Given that Hox genes play important roles in body patterningand that molluscan Hox expression shows both conserved andlineage-specific characteristics, our generalized Hox expressionmodel provides useful information for inferring how diversebody plans evolved in molluscs. The expression data stronglysuggest that the Hox genes contributed to patterning the nervoussystem/foot ventrally and the shell field dorsally in the lastcommon ancestor of molluscs. Nevertheless, regardless of theparticular pattern (i.e., dorsal or ventral expression), we proposethat the most important part of the pattern is the decouplingitself because it allows potential lineage-specific dorsal or ventralpatterning, which may underlie the vast diversity of molluscanbody plans. For instance, as we propose in Fig. 6, dorsal pseu-dosegments may have formed in the lineage leading to poly-placophorans (assuming a nonsegmented molluscan ancestor),and the dorsal part may have rotated in the lineage leading togastropods. The unique shell shapes and structures in bivalves,scaphopods, and cephalopods, as well as the spicules (sclerites)in aplacophorans, represent other types of diversified dorsalstructures (Fig. 6). Similarly, the diverse foot types in bivalves,scaphopods, cephalopods, and aplacophorans might result fromthe lineage-specific patterning of the primitive ventral foot in thecommon molluscan ancestor that is likely still maintained inmonoplacophorans, gastropods, and polyplacophorans (Fig. 6).This lineage-specific ventral patterning does not contradict theconserved staggered Hox expression observed in early ventralectoderms because this pattern can disappear quickly (e.g., in L.goshimai), and ventral Hox expression exhibits lineage-specificcharacteristics later in development. Together, the decoupleddorsal and ventral Hox expression, in combination with the ro-bust involvement of Hox genes in morphogenesis, may underpinthe diversification of molluscan body plans.In addition to spatial decoupling, dorsal and ventral Hox ex-

pression also exhibited obvious temporal decoupling in L. goshimai(earlier dorsal expression). Similar earlier dorsal Hox expression

Huan et al. PNAS | January 7, 2020 | vol. 117 | no. 1 | 509

EVOLU

TION

Dow

nloa

ded

by g

uest

on

Aug

ust 1

3, 2

021

has also been observed in a scaphopod (19) and likely in a bivalve(solely dorsal expression at the early gastrula stage) (29). Consid-ering the speculated functions of Hox genes in the shell fielddorsally and the foot ventrally, the temporal decoupling of Hoxexpression also suggests temporally decoupled dorsal and ventralpatterning. Indeed, the earlier dorsal Hox expression in the3 molluscan clades coincides with the bias toward earlier dorsaldevelopment, in which the dorsal structure (shell field) developsearlier than the ventral structure (foot) (Fig. 6, Insets iii–v). In L.goshimai, this bias is reflected by post1 expression, which separatesthe dorsal and ventral tissues. When the shell field on the dorsalside expands quickly and encloses the larval body during the periodfrom the gastrula to early veliger larva, the ventral tissue/foot an-lage remains small (SI Appendix, Fig. S12). This earlier dorsaldevelopmental strategy may provide survival advantages because itresults in the quick formation of a large larval shell that can protectthe larva from external threats. This developmental strategy seemsto be common in indirectly developed conchiferans but not inaculiferans (compare Insets iii–v and i and ii in Fig. 6). The temporaldecoupling of dorsal and ventral patterning represents a type ofheterochrony and may contribute to the plasticity of developmentalstrategies in molluscan evolution.Lastly, our dorsoventral decoupling model provides insight

into the evolution of molluscan novelties. This model generallysupports the recent hypothesis arguing that the common ances-tor of molluscs has conserved staggered Hox expression and thatHox genes are coopted to patterning processes of other structures inparticular lineages (19). Moreover, our model extends the hypoth-esis by suggesting that, unlike the cooption of Hox genes in otherprocesses that could be lineage specific [e.g., in the apical organ (19,28)], the cooption of Hox genes in shell formation seem to be sharedby most molluscan lineages and thus may have occurred in thecommon ancestor of molluscs. Furthermore, given the extensivecooptions of molluscan Hox genes in various processes (17–19, 25–29), we propose that although the underlying mechanisms remain

elusive, the dorsoventral decoupling of Hox expression (in the ec-toderm) may facilitate differentiated Hox expression in differentregions, which then promoted the cooptions of Hox genes and theevolution of molluscan novelties. This speculation may contribute tounderstanding the fact that the molluscan novelties involving Hoxgenes are predominantly ectoderm-derived tissues [e.g., the cepha-lopod stellate ganglia, metabrachial vesicles, buccal crown and lightorgan (26), and the gastropod operculum (correlated withGibbula hox4 expression) (27)]. Our results also indicate acorrelation between post expression and operculum development inL. goshimai (SI Appendix, Fig. S7 K and L). Together, our dorso-ventral decoupling model supports the recent hypothesis regardingthe conservation and variation of molluscan Hox expression(19), suggests the ancestral cooption of Hox genes in shell forma-tion, and indicates a correlation between dorsoventral decouplingand the evolution of molluscan novelties.

Common Staggered Hox Expression in Other Spiralians. Hox ex-pression in nonmollusc spiralians (except annelids) also showsdiverse patterns and generally lacks a staggered pattern (10, 11,20, 21, 53). The demonstration of decoupled Hox expression indorsal and ventral tissues in molluscs provides a perspective foranalyzing spiralian Hox expression. Therefore, we reanalyzedpublished data with the aim of recovering potential commoncharacteristics (e.g., staggered expression) of spiralian Hox ex-pression. Since Hox expression could not be compared with theexpression of marker genes (the latter was not reported in mostof these reports), we focused on Hox expression on the ventral ordorsal side and analyzed ventral and dorsal Hox expressionseparately. Even without the assistance of marker genes, westrikingly recognized common staggered ventral Hox expressionat particular developmental stages in various spiralians, such asa rotifer (11), nemertean (53), and brachiopod (20) (Fig. 7 andSI Appendix, Figs. S13–S15). As in molluscs, a correlation be-tween the ventral tissues showing staggered Hox expression and

dorsal

ventral

iii iv vi ii

last molluscan ancestor

decoupling

direct development*

spicule

Aplacophora

Aculifera Conchifera

Polyplacophora Monoplacophora GastropodaBivalvia ScaphopodaCephalopoda

Fig. 6. Evolutionary implications of decoupled dorsal and ventral patterning in molluscs. Diagrams of the speculated last molluscan ancestor and currentmolluscan lineages are shown. Insets i–iv indicate the early development of the lineages with indirect development. Spatially decoupled dorsal and ventralpatterning may contribute to the diversity of the body plan characteristics of lineage-specific dorsal tissues (blue) and ventral tissues (orange). The ventralnervous system (red) is mainly derived from the embryonic ventral ectoderm. Notably, we show this part of the nervous system to facilitate the interlineagecomparison of body plans, and this image is not intended to represent accurate organization of the corresponding tissues or to suggest a particular emphasison the roles of Hox genes in neural patterning. Unlike aculiferans (i and ii), temporally decoupled dorsal and ventral patterning may allow earlier dorsaldevelopment and generate early larvae with large shells that can enclose the whole body in conchiferans (iii–v). The diagrams of the aplacophoran (Sol-enogastres) and scaphopod larvae were derived from previous studies (19, 52). The larval shell field of aplacophoran (Solenogastres) is different from that ofother lineages and is determined based on the superficial depressions at the stage before the spicule emerges (52). The asterisk indicates that it is not knownwhether monoplacophorans exhibit only direct development.

510 | www.pnas.org/cgi/doi/10.1073/pnas.1907328117 Huan et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

3, 2

021

neurogenesis is suggested (11, 53) [in brachiopods, this idea wassubsequently supported by showing the expression of neuralpatterning genes (54)]. For annelids, staggered Hox expressionis largely confined to neural tissue on the ventral side of the lateembryo of the leech Helobdella (42). In polychaete annelids, thecorrelation between Hox expression and ventral tissue or neu-rogenesis is not specific, since it is detected in a staggeredpattern in both dorsal and ventral tissues and not confined toneural progenitors (14, 15, 55). Nevertheless, notably, the Hoxexpression of Capitella teleta is detected mainly in ventral tissues inearly embryos (stages 5 to 6) and largely restricted to neural tis-sues in juveniles (15), showing (limited) similarities with thespiralians mentioned above. To the best of our knowledge, theonly 2 exceptions without staggered ventral Hox expression arethe platyhelminth Schmidtea (10) and the nemertean Micrura(21), which may be due to the very unusual development of theanimals (asexual reproduction in Schmidtea and the highlymodified larval type in Micrura). This result indicates thatstaggered Hox expression is largely maintained in various spi-ralians, which has long been debated. Similar to chordates (56),combined Hox expression patterns, including the conservedstaggered expression of the AP patterning of neural tissues andextra expression in clade-specific features, seem to be widespreadin spiralians, indicating the roles of Hox genes in the evolution ofthe diverse spiralian body plans. The expression of Hox genes inclade-specific structures (e.g., the molluscan shell), which are likelyunder relatively low selective pressure, may facilitate animal di-versification in evolution. This mechanism may underpin animaldiversification events such as the Cambrian explosion.

Materials and MethodsAnimal and Larva Collection. Adults of L. goshimai Nakayama, Sasaki &Nakano, 2017 and Ac. rubrolineata (Lischke, 1873) were collected from in-tertidal rocks in Qingdao, China. Spawning occurred after the animals weretransferred to the laboratory. For L. goshimai, which spawned relativelyquickly after collection, each adult was placed in a single 100-mL cup forgamete collection. Artificial fertilization was conducted by mixing spermand oocyte suspensions, and the fertilized eggs were cultured at 25 °C in anincubator. This procedure ensured the precise description of the de-velopmental stages of these animals by referring to hours postfertilization.The developmental stages of L. goshimai were determined mainly based onmorphological characteristics (SI Appendix, Supplementary Text and Fig. S1).Notably, the samples at 6 and 8 hpf, which were determined to be gastrulaein this study, may be considered trochophores based on different morpho-logical criteria (see details in SI Appendix, Supplementary Text). For Ac.rubrolineata, whose spawning was unpredictable, multiple individuals wereput into the same container (20 °C to 25 °C), and the embryos or larvae werecollected on the second day. The developmental stages of the larvae were es-

timated based on their morphological characteristics. Trochophore larvae at2 stages, which corresponded to ∼24 hpf and ∼48 hpf larvae when cultured at25 °C (metamorphosis occurred 60 to 72 hpf), were used. Specimens at thedesignated developmental stages of the 2 species (asterisks in Fig. 1 B and C)were fixed in 4% paraformaldehyde in PBS containing 100 mM EDTA and 0.1%Tween-20 (pH 7.4). The veliger larvae of L. goshimai were anesthetized by theaddition of 1 M magnesium chloride solution before fixation.

Genes. Hox and developmental marker genes (soxb and engrailed) wereretrieved from the developmental transcriptomes of the 2 species by aBLAST search. Gene orthologies were verified by phylogenetic analysis (SIAppendix, Figs. S17, S19, and S20). For the Hox genes, the characteristicresidues of each ortholog were examined to confirm their orthologies aspreviously described (57, 58) (SI Appendix, Fig. S18).

In Situ Hybridization. Gene-specific primers containing a T7 promoter se-quence (taatacgactcactataggg) were used to amplify the cDNA fragment ofeach gene. The resultant PCR products were used as templates when in vitrotranscription was subsequently used to synthesize the digoxigenin-labeledprobes. In situ hybridization was performed as previously described (29),except that after specimen rehydration, an additional protease K treatmentwas performed (20 min at room temperature with continuous shaking) be-fore incubation in 1% triethanolamine. Different concentrations of proteaseK (diluted in PBS containing 0.1% Tween-20) were used for different spec-imens: 25 μg/mL for L. goshimai embryos (8 hpf and before) and early larva(10 hpf), 50 μg/mL for L. goshimai midlarvae (12 and 14 hpf) and all Ac.rubrolineata larvae, and 75 μg/mL for L. goshimai late larvae (17 and 28 hpf).

Scanning Electron Microscopy. The specimens were fixed in 2.5% glutaral-dehyde at 4 °C overnight and then dehydrated in 100% ethanol. Drying,coating, and observations under a scanning electron microscope were per-formed as described previously (59).

Data Availability. The transcriptomic data of the 2 species are deposited in theNCBI SRA database (accession nos. SRX3353365, SRX5249811, and SRX5249812).The gene sequence data are deposited in GenBank (primary accession nos.MN326438, MN326439, and MK637053–MK637075).

ACKNOWLEDGMENTS. We thank Peter W. H. Holland for his thoughtfuldiscussions and critical revisions of the manuscript. Sincere thanks are extendedto Andreas Hejnol, Gregory A. Wray, Fei Xu, and Lingyu Wang for theirsuggestions on the manuscript. We thank Junlong Zhang for the assistance insample collection and species identification, and for providing some of theimages of molluscs included in the manuscript. We thank Weihong Yang forperforming some of the in situ hybridization experiments. This study was fundedby the National Key Research & Development Program of China (2018YFD0900104)grant to P.H., theMarine Science & Technology Fund of Shandong Province for PilotNational Laboratory for Marine Science and Technology (Qingdao) (2018SDKJ0302-1) grant to B.L., the China Agriculture Research System (CARS-49) grant to B.L., andthe National Natural Science Foundation of China (41776157) grant to P.H.

NemerteaRotifera Brachiopoda Mollusca

Acanthochitona rubrolineata

Lottia goshimai

Terebratalia transversa

Annelida

Capitellateleta

Pantinonemertes californiensis

Brachionusmanjavacas

hox2hox1

hox3hox4hox5lox5

lox4lox2

antp

post2post1

medpost

Fig. 7. Staggered Hox expression in speculated ventral neural tissues in spiralians. A closer look at previous reports revealed similar staggered Hox expressionpatterns in various spiralians, which were confined to ventral tissues at particular developmental stages. The schematic diagrams of the rotifer, nemertean,brachiopod, and annelid species were derived from published data (details are provided in SI Appendix, Figs. S13–S16).

Huan et al. PNAS | January 7, 2020 | vol. 117 | no. 1 | 511

EVOLU

TION

Dow

nloa

ded

by g

uest

on

Aug

ust 1

3, 2

021

1. J. Garcia-Fernàndez, The genesis and evolution of homeobox gene clusters. Nat. Rev.Genet. 6, 881–892 (2005).

2. J. C. Pearson, D. Lemons, W. McGinnis, Modulating Hox gene functions during animalbody patterning. Nat. Rev. Genet. 6, 893–904 (2005).

3. P. W. H. Holland, Evolution of homeobox genes. Wiley Interdiscip. Rev. Dev. Biol. 2,31–45 (2013).

4. T. Q. DuBuc, T. B. Stephenson, A. Q. Rock, M. Q. Martindale, Hox and Wnt pattern theprimary body axis of an anthozoan cnidarian before gastrulation. Nat. Commun. 9,2007 (2018).

5. S. He et al., An axial Hox code controls tissue segmentation and body patterning inNematostella vectensis. Science 361, 1377–1380 (2018).

6. C. J. Kenyon et al., The dance of the Hox genes: Patterning the anteroposterior bodyaxis of Caenorhabditis elegans. Cold Spring Harb. Symp. Quant. Biol. 62, 293–305(1997).

7. J. Aronowicz, C. J. Lowe, Hox gene expression in the hemichordate Saccoglossus ko-walevskii and the evolution of deuterostome nervous systems. Integr. Comp. Biol. 46,890–901 (2006).

8. J. Tsuchimoto, M. Yamaguchi, Hox expression in the direct-type developing sanddollar Peronella japonica. Dev. Dyn. 243, 1020–1029 (2014).

9. A. Hejnol, M. Q. Martindale, Coordinated spatial and temporal expression of Hoxgenes during embryogenesis in the acoel Convolutriloba longifissura. BMC Biol. 7, 65(2009).

10. K. W. Currie et al., HOX gene complement and expression in the planarian Schmidteamediterranea. Evodevo 7, 7 (2016).

11. A. C. Fröbius, P. Funch, Rotiferan Hox genes give new insights into the evolution ofmetazoan bodyplans. Nat. Commun. 8, 9 (2017).

12. D. Papillon, Y. Perez, L. Fasano, Y. Le Parco, X. Caubit, Hox gene survey in thechaetognath Spadella cephaloptera: Evolutionary implications. Dev. Genes Evol. 213,142–148 (2003).

13. F. Marlétaz, K. T. C. A. Peijnenburg, T. Goto, N. Satoh, D. S. Rokhsar, A new spiralianphylogeny places the enigmatic arrow worms among Gnathiferans. Curr. Biol. 29,312–318.e3 (2019).

14. M. Kulakova et al., Hox gene expression in larval development of the polychaetesNereis virens and Platynereis dumerilii (Annelida, Lophotrochozoa). Dev. Genes Evol.217, 39–54 (2007).

15. A. C. Fröbius, D. Q. Matus, E. C. Seaver, Genomic organization and expression dem-onstrate spatial and temporal Hox gene colinearity in the lophotrochozoan Capitellasp. I. PLoS One 3, e4004 (2008).

16. S. Q. Irvine, M. Q. Martindale, Expression patterns of anterior Hox genes in thepolychaete Chaetopterus: Correlation with morphological boundaries. Dev. Biol. 217,333–351 (2000).

17. M. Fritsch, T. Wollesen, A. L. de Oliveira, A. Wanninger, Unexpected co-linearity ofHox gene expression in an aculiferan mollusk. BMC Evol. Biol. 15, 151 (2015).

18. M. Fritsch, T. Wollesen, A. Wanninger, Hox and ParaHox gene expression in earlybody plan patterning of polyplacophoran mollusks. J. Exp. Zoolog. B Mol. Dev. Evol.326, 89–104 (2016).

19. T. Wollesen, S. V. Rodríguez Monje, A. Luiz de Oliveira, A. Wanninger, Staggered Hoxexpression is more widespread among molluscs than previously appreciated. Proc.Biol. Sci. 285, 20181513 (2018).

20. S. M. Schiemann et al., Clustered brachiopod Hox genes are not expressed collinearlyand are associated with lophotrochozoan novelties. Proc. Natl. Acad. Sci. U.S.A. 114,E1913–E1922 (2017).

21. L. S. Hiebert, S. A. Maslakova, Hox genes pattern the anterior-posterior axis of thejuvenile but not the larva in a maximally indirect developing invertebrate, Micruraalaskensis (Nemertea). BMC Biol. 13, 23 (2015).

22. S. A. Smith et al., Resolving the evolutionary relationships of molluscs with phylo-genomic tools. Nature 480, 364–367 (2011).

23. G. Haszprunar, A. Wanninger, Molluscs. Curr. Biol. 22, R510–R514 (2012).24. A. Wanninger, T. Wollesen, The evolution of molluscs. Biol. Rev. Camb. Philos. Soc. 94,

102–115 (2018).25. V. F. Hinman, E. K. O’Brien, G. S. Richards, B. M. Degnan, Expression of anterior Hox

genes during larval development of the gastropod Haliotis asinina. Evol. Dev. 5, 508–521 (2003).

26. P. N. Lee, P. Callaerts, H. G. De Couet, M. Q. Martindale, Cephalopod Hox genes andthe origin of morphological novelties. Nature 424, 1061–1065 (2003).

27. L. Samadi, G. Steiner, Involvement of Hox genes in shell morphogenesis in the en-capsulated development of a top shell gastropod (Gibbula varia L.). Dev. Genes Evol.219, 523–530 (2009).

28. L. Samadi, G. Steiner, Expression of Hox genes during the larval development of thesnail, Gibbula varia (L.)-further evidence of non-colinearity in molluscs. Dev. GenesEvol. 220, 161–172 (2010).

29. S. Wang et al., Scallop genome provides insights into evolution of bilaterian karyo-type and development. Nat. Ecol. Evol. 1, 0120 (2017).

30. J. J. Henry, M. Q. Martindale, Conservation and innovation in spiralian development.Hydrobiologia 402, 255–265 (1999).

31. A. Hejnol, A twist in time–The evolution of spiral cleavage in the light of animalphylogeny. Integr. Comp. Biol. 50, 695–706 (2010).

32. J. D. Lambert, Developmental patterns in spiralian embryos. Curr. Biol. 20, R72–R77(2010).

33. C. Nielsen, Some aspects of spiralian development. Acta Zool. 91, 20–28 (2010).34. P. Kerner, E. Simionato, M. Le Gouar, M. Vervoort, Orthologs of key vertebrate neural

genes are expressed during neurogenesis in the annelid Platynereis dumerilii. Evol.Dev. 11, 513–524 (2009).

35. D. J. Jackson, B. M. Degnan, The importance of evo-devo to an integrated un-derstanding of molluscan biomineralisation. J. Struct. Biol. 196, 67–74 (2016).

36. V. Hartenstein, A. Stollewerk, The evolution of early neurogenesis. Dev. Cell 32, 390–407 (2015).

37. S. J. Gaunt, Hox cluster genes and collinearities throughout the tree of animal life. Int.J. Dev. Biol. 62, 673–683 (2018).

38. O. Simakov et al., Insights into bilaterian evolution from three spiralian genomes.Nature 493, 526–531 (2013).

39. G. Zhang et al., The oyster genome reveals stress adaptation and complexity of shellformation. Nature 490, 49–54 (2012).

40. C. B. Albertin et al., The octopus genome and the evolution of cephalopod neural andmorphological novelties. Nature 524, 220–224 (2015).

41. M. Belcaid et al., Symbiotic organs shaped by distinct modes of genome evolution incephalopods. Proc. Natl. Acad. Sci. U.S.A. 116, 3030–3035 (2019).

42. M. J. Kourakis et al., Conserved anterior boundaries of Hox gene expression in thecentral nervous system of the leech Helobdella. Dev. Biol. 190, 284–300 (1997).

43. J. M. Serano et al., Comprehensive analysis of Hox gene expression in the amphipodcrustacean Parhyale hawaiensis. Dev. Biol. 409, 297–309 (2016).

44. D. Arendt, M. A. Tosches, H. Marlow, From nerve net to nerve ring, nerve cord andbrain–Evolution of the nervous system. Nat. Rev. Neurosci. 17, 61–72 (2016).

45. A. B. Johnson, N. S. Fogel, J. D. Lambert, Growth and morphogenesis of the gastropodshell. Proc. Natl. Acad. Sci. U.S.A. 116, 6878–6883 (2019).

46. Z. Fang, Q. Feng, Y. Chi, L. Xie, R. Zhang, Investigation of cell proliferation and dif-ferentiation in the mantle of Pinctada fucata (Bivalve, Mollusca). Mar. Biol. 153, 745–754 (2008).

47. K. Shimizu et al., Left-right asymmetric expression of dpp in the mantle of gastropodscorrelates with asymmetric shell coiling. Evodevo 4, 15 (2013).

48. N. Hashimoto, Y. Kurita, H. Wada, Developmental role of dpp in the gastropod shellplate and co-option of the dpp signaling pathway in the evolution of the operculum.Dev. Biol. 366, 367–373 (2012).

49. W. J. Dictus, P. Damen, Cell-lineage and clonal-contribution map of the trochophorelarva of Patella vulgata (mollusca). Mech. Dev. 62, 213–226 (1997).

50. J. Q. Henry, A. Okusu, M. Q. Martindale, The cell lineage of the polyplacophoran,Chaetopleura apiculata: Variation in the spiralian program and implications formolluscan evolution. Dev. Biol. 272, 145–160 (2004).

51. D. C. Lyons, K. J. Perry, J. Q. Henry, Spiralian gastrulation: Germ layer formation,morphogenesis, and fate of the blastopore in the slipper snail Crepidula fornicata.Evodevo 6, 24 (2015).

52. C. Todt, A. Wanninger, Of tests, trochs, shells, and spicules: Development of the basalmollusk Wirenia argentea (Solenogastres) and its bearing on the evolution of tro-chozoan larval key features. Front. Zool. 7, 6 (2010).

53. L. S. Hiebert, S. A. Maslakova, Expression of Hox, Cdx, and Six3/6 genes in the hop-lonemertean Pantinonemertes californiensis offers insight into the evolution ofmaximally indirect development in the phylum Nemertea. Evodevo 6, 26 (2015).

54. J. M. Martín-Durán et al., Convergent evolution of bilaterian nerve cords. Nature 553,45–50 (2018).

55. S. Q. Irvine, M. Q. Martindale, Comparative analysis of hox gene expression in thepolychaete Chaetopterus. Library (Lond.) 651, 640–651 (2001).

56. T. R. J. Lappin, D. G. Grier, A. Thompson, H. L. Halliday, HOX genes: Seductive science,mysterious mechanisms. Ulster Med. J. 75, 23–31 (2006).

57. G. Balavoine, R. de Rosa, A. Adoutte, Hox clusters and bilaterian phylogeny. Mol.Phylogenet. Evol. 24, 366–373 (2002).

58. M. L. Pérez-Parallé, A. J. Pazos, C. Mesías-Gansbiller, J. L. Sánchez, Hox, parahox,ehgbox, and NK genes in bivalve molluscs: Evolutionary implications. J. Shellfish Res.35, 179–190 (2016).

59. S. Tan, P. Huan, B. Liu, Expression patterns indicate that BMP2/4 and Chordin, notBMP5-8 and Gremlin, mediate dorsal-ventral patterning in the mollusk Crassostreagigas. Dev. Genes Evol. 227, 75–84 (2017).

512 | www.pnas.org/cgi/doi/10.1073/pnas.1907328117 Huan et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

3, 2

021