Thesis for the degree

Doctor of Philosophy

By Galia Oberkovitz

א" בתגובה לנזקים בדנBIDתפקיד הזרחון על החלבון

חבור לשם קבלת התואר דוקטור לפילוסופיה

מאת גליה אוברקוביץ

The role of ATM–mediated BID phosphorylation

in the DNA damage response

Advisor Prof. Atan Gross

May, 2010

Submitted to the Scientific Council of the Weizmann Institute of Science

Rehovot, Israel

ע"תש, יירא

מוגש למועצה המדעית של מכון ויצמן למדע

ישראל,רחובות

מנחה איתן גרוס 'פרופ

2

Table of contents

Table of contents ..........................................................................................................2

List of figures................................................................................................................4

Abbreviations ...............................................................................................................6

Abstract.........................................................................................................................7

Introduction..................................................................................................................9 Apoptosis ...................................................................................................................9

BCL-2 family ...........................................................................................................10

BID...........................................................................................................................13

The responses of cells to double-strand break DNA damage ..................................14

BCL-2 family members and the response to double-strand break DNA damage....14

BID and the DNA damage response........................................................................15

The objective of the research ....................................................................................18

Material and Methods ...............................................................................................19 Constructs ................................................................................................................19

List or primers: ....................................................................................................19

Tissue culture ...........................................................................................................20 hTERT transformation of primary MEFs ............................................................20 Generation of hTERT BID-/- stable clones expressing wtBID, NLS-BID or BID-ER.........................................................................................................................20 Preparation of activated B and T cells ................................................................21 Human cell lines and transient transfection ........................................................21 HeLa BID KD cells ..............................................................................................21

Cellular assays .........................................................................................................22 Radio-resistant DNA Synthesis assay (RDS) .......................................................22 Metaphase spreads assay.....................................................................................22 BrdU labeling and analysis .................................................................................22 Cell viability assay...............................................................................................23 Cell cycle assay....................................................................................................23 Apoptosis assay....................................................................................................23

Proteins analysis.......................................................................................................23 Formaldehyde treatment and subcellular fractionation......................................23 Western blot and antibodies ................................................................................24 Viewing the cellular location of GFP fusion proteins .........................................24 Immunofluorescence ............................................................................................24 Immunohistochemistry .........................................................................................25

Chapter I - The functional connection between BID and the nucleus ..................26 Cellular BID partially localizes to the nucleus ........................................................26

DNA damage results in the nuclear export of BID..................................................27

Fusing BID to a strong nuclear localization signal inhibits its nuclear export ........30

3

Introduction of NLS–BID into BID-/- MEFs fails to restore susceptibility to Etop-induced cell death ....................................................................................................31

BID-/- MEFs expressing NLS–BID fail to arrest in the S phase of the cell cycle following Etop treatment .........................................................................................33

Caspases are not involved in the nucleocytoplasmic shuttling of BID...................35

BID phosphoryaltion occurs in the nucleus .............................................................37

Chapter II - BID phosphorylation at the mitochondria .........................................39 DNA damage induces phosphorylation of exogenous BID at the mitochondria.....39

The phospho-form of BID-TM is localized at the mitochondria.............................40

BID phosphorylation at the mitochondria is partially mediated by ATM ...............41

BID-TM expression does not result in the phosphorylation of other ATM substrates..................................................................................................................................42

Mutating the phosphorylation sites of BID-TM does not affect its ability to induce cell death ..................................................................................................................42

Mutating in the BH3 domain of BID-TM does not change its phosphorylation status..................................................................................................................................43

tBID is phosphorylated on S78 in the absence of DNA damage and this phosphorylation is mediated by ATM .....................................................................44

tBID is phosphorylated in-vitro by a mitochondria-associated kinase ....................45

Chapter III - The role of ATM-mediated BID phosphorylation in-vivo ..............46 Generation of BIDS61A/S78A knock-in mice, in which endogenous BID is no longer capable of being phosphorylated on serines 61 and 78............................................46

BIDAA primary activated B and T cells demonstrate increased chromosomal damage in response to DNA damaging reagents .....................................................47

BIDAA primary B and T cells fail to arrest in the S phase in response to DNA damage .....................................................................................................................48

BIDAA primary B and T cells are more susceptible to DNA damage-induced apoptosis ..................................................................................................................50

ATM-mediated phosphorylation of Chk2 and SMC1 is reduced in the BIDAA cells following DNA damage...........................................................................................52

BIDAA knock-in mice are hypersensitive to whole-body irradiation .......................54

Discussion....................................................................................................................57 The functional connection between BID and the nucleus .......................................57

BID phosphorylation at the mitochondria................................................................60

The role of ATM-mediated BID phosphorylation in vivo.......................................62

References...................................................................................................................66

Publications ................................................................................................................71

4

List of figures

Figure 1. Schematic of the extrinsic and the intrinsic apoptotic pathways..................10

Figure 2. Schema of the BCL-2 family........................................................................11

Figure 3. A model summarizing the role of BID in the DNA damage response. ........17

Figure 4. Mouse BID is partially localized to the nucleus...........................................27

Figure 5. DNA damage results in the nuclear export of BID. .....................................29

Figure 5. DNA damage results in the nuclear export of BID. .....................................30

Figure 6. Fusing BID to a strong NLS inhibits its nuclear export. ..............................31

Figure 7. Introduction of NLS–BID into BID-/- MEFs fails to restore susceptibility to

Etop-induced cell death................................................................................................32

Figure 8. BID-/- MEFs expressing NLS–BID fail to arrest in the S phase of the cell

cycle following etoposide treatment. ...........................................................................34

Figure 9. Caspases are not involve in the nucleocytoplasmic shuttling of BID. .........36

Figure 10. BID phosphoryaltion occurs in the nucleus................................................38

Figure 11. DNA damage induces phosphorylation of BID at the mitochondria. ........40

Figure 12. The phospho-form of BID-TM is localized at the mitochondria. ..............41

Figure 13. BID phosphorylation at the mitochondria is mediated by ATM................42

Figure 14. BID-TM expression does not result in the phosphorylation of other ATM

substrates......................................................................................................................42

Figure 15. Mutations in the phosphorylation site of BID do not affect on its ability to

kill. ...............................................................................................................................43

Figure 16. Mutation in the BH3 domain of BID-TM does not change its

phosphorylation status. ................................................................................................44

Figure 17. tBID is phosphorylated on S78 in the absence of DNA damage and this

phosphorylation is mediated by ATM. ........................................................................45

Figure 18. tBID is phosphorylated in-vitro by a mitochondria-associated kinase.......45

Figure 19. BID is expressed but is not phosphorylated following whole body

irradiation in homozygous BIDAA mice. ....................................................................46

Figure 20. BIDAA primary B and T cells demonstrate increased chromosomal damage

in response to DNA damaging reagents.......................................................................48

Figure 21. BIDAA primary B and T cells fail to arrest in the S phase in response to

DNA damage. ..............................................................................................................50

5

Figure 22. BIDAA primary B and T cells are more susceptible to DNA damage-

induced apoptosis.........................................................................................................51

Figure 23. ATM-mediated phosphorylation of Chk2 and SMC1 is reduced in the

BIDAA cells following DNA damage............................................................................53

Figure 24. BIDAA knock-in mice are hypersensitive to whole-body irradiation .........55

6

Abbreviations

Ab Antibody

A-T Ataxia-Telangiectasia

ATM Ataxia-Telangiectasia Mutated

BH Bcl-2 Homology

BrdU Bromodeoxyuridine (5-bromo-2-deoxyuridine)

Cyt c Cytochrome c

DDR DNA Damage Response

DRs Death Receptors

DSB Double-Strand Break

Etop Etoposide

FACS Fluorescence-activated cell sorter

GFP Green Fluorescence Protein

IB Immune Blot

IF Immunofluoresence

IHC Immunohistochemistry

IR Ionizing Radiation

LMB Leptomycin B

MEFs Mouse Embryonic Fibroblasts

MMC Mitomycin c

MPCs Myeloid Progenitor Cells

NES Nuclear Export Signal

NLS Nuclear localization Signal

PCD Programmed Cell Death

PI Propidium Iodide

RDS Radio-Resistant DNA Synthesis

SDS-PAGE Sodium dedocyl sulphate-Polyacrylamid gel electrophoresis

TM Trans-Membrane

4-HOT 4-hydroxy-tamoxifen

7

Abstract

The BH3-only BID protein acts as a sentinel to interconnect specific death signals to

the core apoptotic pathway. Our previous data demonstrated that BID is important for

both S-phase arrest and cell death following DNA damage, and that the cell cycle

arrest function is regulated by its phosphorylation by the ATM kinase.

In the first part of my thesis we showed that as expected from the previous data, a

portion of cellular BID localizes to the nucleus. Interestingly, we demonstrated that

etoposide and ionizing radiation induce the exit of BID from the nucleus and that

leptomycin B, a specific inhibitor of the nuclear export receptor CRM1, prevents the

nuclear exit of BID. BID carries a nuclear export signal (NES) consensus motif;

however, it does not seem to be functional. To examine the importance of BID

nuclear export, we targeted BID to the nucleus by fusing it to a strong nuclear

localization signal (NLS). NLS–BID is phosphorylated in a similar time course as

wild-type BID, but does not exit the nucleus following etoposide treatment.

Importantly, introducing NLS–BID into BID-/- cells failed to restore S-phase arrest

and cell death in response to etoposide. The results in this part implicate BID as a

nuclear protein and raise the possibility that nucleocytoplasmic shuttling of BID is

involved in regulating its activities in the DNA damage response.

In the second part of my thesis we were able to show that although BID is a

nuclear substrate of ATM it can also be phopshorylated outside the nucleus.

Surprisingly, we found that a BID-TM chimeric molecule [a BID molecule fused to

the trans-membrane (TM) domain of BCL-2, and therefore is constituently targeted to

the mitochondria] over-expressed in cells was phosphorylated in an ATM-dependent

manner, and this phosphorylation occurred in the mitochondria in the absence of

DNA damage. These results may indicate on additional regulatory role of BID in the

DNA damage response, which is different from its role in the DNA damage response

in the nucleus.

Finally, in the 3rd part of the work we defined the importance of ATM-mediated

BID phosphorylation in vivo. We generated a BID knock-in mouse, in which the

endogenous BID gene has been replaced with a gene that drives the expression of a

non-phosphorylatable BID protein (BIDAA). Using cells from these mice we found

that BIDAA knock-in primary T and B cells demonstrate a defect in the intra S phase

8

DNA damage response, increased chromosomal damage, and increased apoptosis in

response to DNA damage. Importantly, the BIDAA mice were hypersensitive to

whole-body irradiation and showed increased levels of apoptosis in the spleen. Taken

together, these results establish the role of BID as an ATM effector in the DNA

damage response in vivo.

9

Introduction

Apoptosis

Apoptosis, or programmed cell death (PCD), plays a central role in the development

and homeostasis of all multi-cellular organisms [1]. In humans, both excessive and

insufficient apoptosis can lead to severe pathological consequences. Suppression of

the apoptotic machinery causes autoimmune diseases and is a hallmark of cancer [2],

while abnormal upregulation of apoptosis contributes to neurological disorder [3].

Cells undergoing PCD assume morphological features, which include membrane

blabbing, chromatin condensation, and nuclear fragmentation [4]. The genetic

pathway that regulates apoptosis has been characterized, and it appears to be

conserved from the nematode C. elegans to mammals. BCL-2 proteins are the major

regulators of the apoptotic pathways [5], and caspase proteases are the major

executioners of this process [6].

Two major apoptotic pathways have been identified in mammals: the extrinsic and

the intrinsic pathways. The extrinsic pathway involves the initiation of apoptosis

through ligation of plasma membrane death receptors (DRs). These receptors belong

to the tumor necrosis factor receptor (TNFR) superfamily. They transmit their

apoptotic signals following binding of death ligands. These receptor-ligand complexes

initiate the apoptotic cascade within seconds of ligand binding and can result in

apoptotic cell death within hours. The best characterized family members include

FAS and TNFR1 [7-9]. Once engaged by ligand, these receptors initiate the formation

of the death inducing signaling complex (DISC), which leads to activation of caspase-

8 which then activates the downstream caspase-3 [10]. The intrinsic pathway is

activated by various developmental causes or cytotoxic insults, such as viral infection,

DNA damage and growth-factor deprivation. These stimuli trigger the release of

Cytochrome c (Cyt c) and other intermembrane space proteins from the mitochondria

to the cytosol. Cyt c is then free to bind Apaf-1 and caspase-9 to form the apoptosome

complex. The apoptosome complex is where caspase-9 is activated leading to

caspase-3 activation, which leads to apoptotic cell death [11]. Under certain

circumstances, the extrinsic pathway uses the mitochondrial pathway to amplify

caspase activation. This connection is done trough BID, which is cleaved by caspase-

8 (Fig 1).

10

Figure 1. Schematic of the extrinsic and the intrinsic apoptotic pathways. In the extrinsic pathway, activation of the TNF/Fas death receptor induces DISC formation that results in direct activation of caspases. In the intrinsic pathway, the BCL-2 family members are the major players. At the mitochondria, these proteins induce the release of Cyt c, resulting in the formation of the apoptosome and caspase activation. The extrinsic and intrinsic pathways are connected by BID.

BCL-2 family

Members of the BCL-2 family are essential mediators of cell survival and apoptosis.

The founder of this family is the BCL-2-proto-oncogene, that was discovered at the

choromosomal breakpoint of t(14;18) bearing human B cell lymphomas [12]. The

BCL-2 family of proteins has expanded significantly since the discovery of BCL-2. In

mammals, there are at least 12 core BCL-2 family proteins, including BCL-2 itself

and proteins that have either three-dimensional structural similarity or a predicated

secondary structure that is similar to BCL-2. These proteins display a range of

bioactivities, from inhibition to promotion of apoptosis [13].

The cell death regulatory mechanism of the BCL-2 family members is largely

unknown, although it is thought that their function depends mostly on their ability to

modulate the release of proteins from the inter-membrane space of mitochondria. The

BCL-2 family can be divided into two subclasses, defined in part by the homology

shared within four conserved regions termed BCL-2 homology (BH) 1-4 domains

(Fig. 2). The first subclass includes the anti-apoptotic members (e.g., BCL-2) that

display conservation in all four BH1-4 domains. The second subclass includes the

11

“multidomain” pro-apoptotic members (e.g., BAX, BAK) that possess the BH1-3

domains. A subset of the pro-apoptotic proteins are the BH3-only proteins that

possess only the BH3 domain (e.g.,BID)[14-16].

Figure 2. Schema of the BCL-2 family. Three subfamilies are indicated. BCL-2 homology region (BH1-4) are denoted as is the carboxy-terminal hydrophobic (TM) domain.

One of the major characteristics of the BCL-2 family members is their tendency to

form homo- as well as heterodimers. Mutagenesis studies have revealed that the BH

domains are important for these interactions. The BH1, BH2 and BH3 domains of the

anti-apoptotic members are required to heterodimerize with the pro-apoptotic

members to repress cell death [17]. On the other hand, only the BH3 domain of pro-

apoptotic members is required to heterodimerize with the anti-apoptotic molecules,

and to promote cell death. Early findings support the notion that the ratio of pro-

apoptotic to anti-apoptotic molecules dictates the susceptibility of cells to a death

signal [18]. It seems that the multidomain pro- apoptotic proteins possess two

potentially independent mechanisms for promoting cell death. One mechanism relies

upon their ability to suppress the function of anti-apoptotic proteins through

heterodimerization. The other is a heterodimerization-independent function. For

example, BAX can induce cell death independent of its interaction with BCL-2 [19].

Several BH3 mutants of BAX that fail to bind BCL-2 are nevertheless still capable of

inducing apoptosis [20]. Furthermore, activation of BAX appears to involve its

homodimerization [21]. A proposed theory suggests that the BCL-2 family members

form channels in the mitochondrial membrane. This model originated from the

structural similarity between the BCL-XL structure and structure of the pore forming

The BCL-2 family

BH4 BH3 BH1 BH2 TM

Anti-apoptoticBCL-2(BCL-XL, BCL-W, MCL-1,…)

BH3 BH1 BH2 TM

Pro-apoptotic

BAX(BAK, BOK,…)

BH3BID(BIK, BAD, BIM, PUMA, …)

BH3-only

The BCL-2 family

BH4 BH3 BH1 BH2 TM

Anti-apoptoticBCL-2(BCL-XL, BCL-W, MCL-1,…)

BH3 BH1 BH2 TM

Pro-apoptotic

BAX(BAK, BOK,…)

BH3BID(BIK, BAD, BIM, PUMA, …)

BH3-only

12

region of bacterial toxins [22]. Moreover, it was demonstrated that recombinant BAX

forms channels in artificial membranes allowing the passage of large macromolecules

[23-25]. The BH3-only proteins are known to be pro-apoptotic but there is a big

debate regarding their function. Recent evidence indicates that BH3-only proteins de-

repress BAX and BAK by direct binding and inhibition of BCL-2 and other anti-

apoptotic family members [26]. By contrast, an opposing model postulates direct

activation of BAX and BAK by some BH3-only proteins [27].

The BCL-2 family members are localized at multiple subcellular localizations, i.e.,

in the cytosol, nuclear outer membrane, endoplasmic reticulum membrane and

mitochondrial membranes. Most of the family members (excluding part of the BH3-

only proteins) contain a C-terminal hydrophobic domain that enables their targeting to

intracellular membranes [14]. In healthy cells, anti-apoptotic BCL-2 family members

are mostly found associated with internal membranes, whereas the pro-apoptotic ones

are predominantly found in the cytosol. In response to an apoptotic signal, the pro-

apoptotic proteins translocate to mitochondria, to trigger apoptosis [5]. Mitochondria

are not the only site for targeting of pro-apoptotic proteins, since it was only

previously demonstrated that pro-apoptotic proteins such as BAX and BOK

translocate to the nucleus [28,29]. Redistribution of BCL-2 family members to

internal membranes does not seem to be related only to apoptosis, since some studies

demonstrated accumulation of BCL-2 family members in the nucleus that might affect

cell cycle progression [28,30]. These studies, in addition to others suggest that

proteins of the BCL-2 family have different roles executed in different cellular

compartments.

BCL-2 family members have essential roles in the mouse from early

embryogenesis through to adult tissue homeostasis. The nervous system,

haematopoietic tissues and spermatogenesis are particularly dependent on BCL-2

family protein regulation [13]. Several members of the pro- and the anti-apoptotic

classes have been knocked out in mice to reveal their physiological roles, redundancy

and interactions in vivo. In many cases there are phenotypes of abnormal cell death,

like in the case of knockout of the anti-apoptotic proteins BCL-2, BCL-XL and

BCL-W, or hyperplasia and increase in cell resistance to apoptotic stimuli, like in the

case of BAX, BIM, BID and NOXA knockouts [13].

13

BID

BID was cloned in 1996 in a screen of cDNA library from a T cell hybridoma line

[31]. The library was screened using recombinant BCL-2 and recombinant BAX and

in both cases BID was identified. BID is phylogenetically conserved; human BID

shows 72.3% homology to murine BID at the amino acid level. BID is widely

expressed in various tissues, with the highest level being in the kidney [31] and in

organs of the hematopoetic system (Unpublished data, Gross lab).

The p22 BID protein connects between the extrinsic and the intrinsic pathways of

apoptosis; Ligation of DRs activates caspase-8, which processes the cytosolic form of

BID at Asp59 into truncated BID (p15 tBID) that translocates to the mitochondria [20

,32 ,33]. At the mitochondria, tBID induces the oligomerization of BAX and BAK,

resulting in the release of Cyt c and the activation of casapases [34,35]. Interestingly,

it was previously shown that caspase-8-mediated cleavage of BID is regulated by

phosphorylation, since this cleavage is attenuated by casein kinase I- or II-mediated

phosphorylation on serine 61 and serine 64 [36].

The apoptotic pathways in which BID plays a role are not fully characterized,

however studies with BID-/- mice have demonstrated a requirement for BID during

Fas-induced apoptosis [37]. In addition, it was demonstrated that BID-/- mouse

embryonic fibroblasts (MEFs) are less susceptible than are wild-type fibroblasts to the

DNA damage reagent adriamycin and the nucleotide analogue 5-fluorouracil [38].

Thus, BID seems to be important for both the death receptor and DNA damage

apoptotic pathways. Finally, it was recently demonstrated that BID-/- mice, as they

age, spontaneously develop a clonal malignancy closely resembling chronic

myelomonocytic leukemia (CMML), which demonstrates consistent chromosomal

abnormalities [39]. These results suggested that BID might play an unanticipated role

in regulating genomic stability.

A positive regulator of BID expression is p53; Functional p53-binding elements

have been found in both human and mouse BID genomic loci. Over-expression of p53

could induce the upregulation of BID mRNA level both in cell lines and in mice. This

upregulation of BID might be important to p53-mediated apoptosis following the

administration of DNA damaging agent such as adriamycin [38]. In general, BID is a

long-lived protein, but tBID has a half-life of less than 90 minutes. The degradation of

tBID is mediated by the ubiquitination proteasome system [40].

14

The responses of cells to double-strand break DNA damage

In eukaryotes, each cell’s genetic material is constantly subjected to DNA damage.

While a double-strand break (DSB) is not the major DNA lesion, it is certainly among

the most harmful. Following DSBs, the cell may activate a survival system that

enables repair and continuation of its normal life cycle, or it may activate its apoptotic

machinery in the face of extensive or irreparable damage [41]. One of the major

responses associated with the cell survival network is the temporary arrest of cell

cycle progression, which reflects the activation of cell cycle checkpoints [42]. The

best-documented, damage-induced cell cycle checkpoints operate in the G1/S

boundary, and at the S and G2 phases. The very early events that take place at the site

of a DNA double-strand break and precede activation of the response network involve

several proteins that are rapidly recruited to the damaged site; there, they act as DSB

sensors. They then convey a damage signal to transducers, which in turn deliver it to

numerous downstream effectors.

A prototype transducer of the DSB response is ataxia-telangiectasia mutated

(ATM), a nuclear serine-threonine protein kinase which is absent or inactivated in

patients with the genomic instability syndrome ataxia-telangiectasia (A-T) [43]. Cells

from A-T patients exhibit genomic instability, radiosensitivity, and defective

activation of the entire DSB response, most notably, the cell cycle checkpoints. ATM

is a member of a group of conserved large proteins, several of which are protein

kinases involved in mediating DNA damage responses. Activated ATM

phosphorylates a wide spectrum of substrates, many of them at the sites of damage,

and the functional consequences of some of ATM phosphorylation events have been

associated with the activation of the cell cycle checkpoints. However, not all of the

phenotypic abnormalities in A-T patients and their cells can be explained by a lack of

these phosphorylation events, implying that additional ATM targets exist, which have

not yet been identified.

BCL-2 family members and the response to double-strand break DNA damage

There are several reports that connect BCL-2 family members to the non-apoptotic

response of cells to DSBs. For example, homology-directed repair of DSBs is

enhanced by the anti-apoptotic BCL-XL protein [44], while overexpression of pro-

apoptotic BAX and BID, was found to inhibit homologous-recombination DNA repair

[45]. In addition, a protein essential for DSB repair, Ku70, was demonstrated to hold

15

BAX in an inactive state [46]. BAX and BCL-2 were previously reported to be

localized to the nucleus in certain cells [28,47]; however their roles in this organelle

remain unknown. Recently it was published that exposure of cells to IR increases the

expression of BCL-2 in the nucleus, which interacts and inhibits both Ku70 and Ku86

via its BH1 and BH4 domains [48]. Removal of the BH1 or BH4 domain abrogated its

inhibitory effect, which results in the failure to block DSB repair as well as V(D)J

recombination. Finally, it was found that BCL-XL colocalizes and binds to cdk1(cdc2)

during the G2/M cell cycle checkpoint, and its overexpression stabilizes a G2/M

arrest/senescence program in surviving cells after DNA damage [49].

BID and the DNA damage response

Although most studies in the field emphasize the importance of BID cleavage to

activate it, there are several studies that demonstrate an active role for full-length BID

[34,50-52]. One of these studies was conducted in our lab and demonstrated that a

caspase-8 non-cleavable BID mutant (BID-D59A) is a potent inducer of apoptosis in

MEFs [51]. In addition, this study showed that the non-cleavable BID mutant can

sensitize BID-/- MEFs to apoptosis induced by a variety of DNA damaging reagents,

suggesting that BID plays a role in the response of cells to DNA damage.

In search for BID’s role and mechanism of activation in the DNA damage

response (DDR), we found that DNA damage reagents that cause DSB [such as the

topoisomerase II poison etoposide (Etop) and ionizing radiation (IR)], led to its rapid

phosphorylation by the ATM kinase on serines 61 and 78 in a variety of cell types

[53]. We also found that Etop induced accumulation of BID+/+ MEFs in the S and G2

phases of the cell cycle, whereas such an accumulation was not observed in the BID-/-

MEFs. Reintroducing wild-type BID into BID-/- cells restored their ability to

accumulate in the S and G2 phases, whereas introducing a non-phosphorylatable BID

mutant (BID-S61A/S78A) restored accumulation in the G2 phase but not in the S

phase. Moreover, in response to Etop, the mutant BID cells entered apoptosis more

readily than the wild-type BID cells. We also demonstrated that BID is localized to

the nucleus ([53] and see Results section below). A collaborating group reported

similar results using a myloid progenitor cell line (MPCs) [54]. Taken together, these

results implicate BID as an ATM effector, and indicate that BID, a molecule that was

previously considered to be active only as a pro-apoptotic factor in the TNFα/Fas

16

death receptor pathway, also plays a pro-survival role important for the S phase

checkpoint in the DDR (Fig.3) [53-56]. Our results implicating BID as a nuclear

protein involved in cell cycle regulation in the DDR have been recently challenged,

and this criticism together with our response were published [57,58].

Previously it has been shown that BID-/- mice accumulate chromosomal

aberrations and develop a fatal myeloproliferative disorder resembling chronic

myelomonocytic leukemia (CMML; [39]). Spectral karyotype (SKY) analysis of the

BID-/- leukemias revealed chromosomal translocations and duplications. More

recently, it has been demonstrated that doses of Mitomycin c [a DNA interstrand

crosslinking agent (MMC)] that had little effect on BID+/+ MPCs and activated T cells

displayed a marked increase in chromosomal instability in BID-/- MPCs and activated

T cells [54]. Of note, metaphase spreads from MMC-treated BID-/- MPCs and

activated T cells displayed tri- and quadriradial chromosomal figures, quantifiable by

an increase in the number of breaks per cell. These abnormal chromosomal structures

represent “chromatid type” errors resulting from improperly repaired DNA damage

accrued during S phase of the cell cycle [59] and are characteristic of cells with a

defect in DNA repair, such as those in Fanconi anemia [60], Bloom’s syndrome [61],

and the hereditary breast and ovarian cancer syndromes involving BRCA1 [59]. Thus,

increased chromosomal instability seems to be a general feature of BID deficiency,

and phosphorylation of BID might be important for its ability to preserve genome

stability.

17

Figure 3. A model summarizing the role of BID in the DNA damage response. Following DNA damage, ATM and ATR are activated and, through p53, can cause either cell-cycle arrest at the G1 stage or apoptosis. ATM and ATR also activate several other protein targets, causing the cell cycle to stall in the S phase. Pro-apoptotic BID, known to play a role in the death receptor pathway, can be added to this list of ATM/ATR targets (model taken from [55]).

18

The objective of the research To define the role of ATM-mediated BID phosphorylation in the DNA damage

response.

The results of the research are presented in three chapters:

Chapter I - The functional connection between BID and the nucleus.

Chapter II - BID phosphorylation at the mitochondria.

Chapter III - The role of ATM-mediated BID phosphorylation in-vivo.

19

Material and Methods Constructs

For the construction of the NLS–BID expression vector, BID was PCR amplified,

using a 5' primer consisting of a BamHI restriction site followed by the SV40-LT-

NLS, and BID’s first 26 bases, and a 3' primer consisting of an EcoRI restriction site,

followed by BID’s C terminus antisense strand (list of primers will follow). To

introduce point mutations into the NES consensus motif of BID (BID-3L/A) or a

point mutations in BID-TM, we have used the QuickChanget site directed

mutagenesis kit (Stratagene). The fragments were digested and ligated into the

pcDNAIII vector (Invitrogen). To delete the NES consensus motif of BID, we have

used the QuickChanget site directed mutagenesis kit (Stratagene) followed by

phosphorylation and ligation into the pcDNAIII vector (Invitrogen). For the

construction of BID–GFP, BID-3L/A-GFP, BID-dNES-GFP BID-D59A-GFP and

BID-S61A/S78A-GFP, BID was PCR amplified using a 5' primer consisting of a

XhoI restriction site, followed by BID’s N terminus sense strand and a 3' primer

consisting of an EcoRI restriction site, followed by BID’s C terminus antisense strand.

For the construction of NLS–BID–GFP, BID was PCR amplified, using a 5' primer

consisting of an XhoI restriction site, followed by the SV40-LT-NLS and a 3' primer

consisting of an EcoRI restriction site, followed by BID’s C terminus antisense strand.

The fragments were digested and ligated into the pEGFP-N1 vector (Clontech).

For the construction of BID-ER we used the construct c-MycER [62] and replaced c-

Myc with BID in the BamH1 site.

List or primers:

NLS-BID: 5' primer: GCAGGATCCATGCCGAAGAAGAAGCGCAAGGTAGAC

TCTGAGGTCAGCAACGGTTCCGGC. 3' primer: GCGAATTCGTCAGTCCATCT

CGTTTCTAACCAAGTTCCT.

BID-3L/A: 5' primer:CTGTACTCGCCAAGAGGCGGAGGTGGCGGGTCGGGA

AGCGCCTGTGCAAGCTTAC. 3' primer: GTAAGCTTGCACAGGCGCTTCCCG

ACCCGCCACCTCCGCCTCTTGGCGAGTACAG.

BID-dNES: 5' primer: CAAGCTTACTGGGAGGCAGACCTCGAAGACGAG.

3' primer: CTCTTGGCGAGTACAGCCAGAGCTTTGGAGAAAGCCG

20

BID–GFP, BID-3L/A-GFP, BID-dNES-GFP BID-D59A-GFP and BID-

S61A/S78A-GFP: 5' primer: CCGCTCGAGATGGACTCTGAGGTCAGCAACG.

3' primer: GCGAATTCGGTCCATCTCGTTTC.

Tissue culture

hTERT transformation of primary MEFs

All the studies with BID+/+ and BID-/- MEFs described in this research were

performed with hTERT-immortalized MEFs. Immortalization of primary MEFs was

performed by transformation with hTERT (the catalytic subunit of human

telomerase). PA317 packaging cells stably producing pBABE-puro hTERT viral

particles (a generous gift from Tej Pandita, Washington University) were grown to

80% confluence, rinsed and the medium was then replaced with complete MEF

medium. The cells were incubated for 16 hrs and the medium was collected and

filtered through a 0.45 µm filter. The infecting media were stored at -80˚C until use.

Primary BID-/- and BID+/+ MEFs were grown for 3 passages and then infected at

~50% confluence with 3 ml infecting media mixed with 3 ml MEF media and 4 µg/ml

polybrene (Sigma). The cells were then incubated for 16 hrs, rinsed and incubated in

fresh medium for an additional 8 hrs. The cells were infected again as described

above, rinsed and incubated in fresh medium for an additional 48 hrs. The cells were

then split 1:3 and grown for 4 days in a selection medium containing 1 µg/ml

puromycin. After selection, the cells were washed once and incubated with MEF

medium (without puromycin). Stable clones were collected 14 to 18 days post-

infection, and their propagation took 3-to-4 months.

Generation of hTERT BID-/- stable clones expressing wtBID, NLS-BID or BID-ER

ψNX cells (a 293T cell line carrying an ecotropic packaging plasmid) were seeded in

a 100 mm plate at 60% confluence. The next day, the medium was replaced and cells

were incubated with a transfection cocktail containing 15 µg retroviral vector

(pBABE-wtBID, pBABE-NLS-BID or pBABE-BID-ER) prepared using a calcium

phosphate kit (Promega). Cells were incubated for 5 hrs with the cocktail and rinsed;

the medium was then replaced, and the cells reincubated in fresh medium. The

following day, the conditioned medium containing the retroviruses was collected and

filtered through a 0.45 µm filter. The viruses were divided into aliquots and frozen at -

21

80˚C. For infection of MEFs, cells were grown in a 60mm plate and incubated for 4

hrs at 37˚C in 2 ml of retroviral supernatant, supplemented with 16 µg/ml polybrene.

After that, 2 ml of DMEM containing 10% FCS was added and 24 hrs later, the

medium was replaced with fresh medium containing 10% FCS and 1 µg/ml

puromycin. Puromycin was replaced every day for three days. On the fourth day, cells

were seeded (100 cells per 10cm dish) and grown until single clones appeared.

Preparation of activated B and T cells

The spleens from either BID+/+, BID-/- or BIDA/A 8-10-wk old mice were pressed

through stainless steel mesh to make a cell suspension in PBS. The cells were

centrifuged at 1500 rpm for 5 min, resuspend in 1mL ACK lysis buffer for 1 min to

separate between erythrocytes and splenocytes and washed twice with PBS. B and T

cells were isolated from the total splenocytes by immune-magnetic depletion with

anti-B220 for B cells or anti-CD90.2 for T cells (BD Bioscience). B cells were

stimulated with 25µg/ml lipopolysaccharide (LPS; Sigma) and 10ng/ml interleukin 4

(IL-4; PeproTech Asia) for 2 days. T cells were stimulated with 2µg/ml Concanavalin

A (Con A; Sigma) and 10ng/ml interleukin 2 (IL-2; PeproTech Asia) for 2 days. The

cells were resuspended (1x106 cells/ml) in RPMI 1640 medium supplemented with

10% FCS, 50 U/ml penicillin, 50 mg/ml streptomycin, 1 mM Sodium pyruvate, 0.1

mM β-mercaptoethanol, 2 mM glutamine, 0.1 mM non-essential amino acids.

Human cell lines and transient transfection

293, a human embryonic kidney cell line, and HeLa, a human cervical

adenocarcinoma cell line were maintained in 10% fetal bovine serum. Transient

transfections were performed by using a calcium phosphate kit (Promega) or with

lipofectamine 2000 (Gibco BRL).

HeLa BID KD cells

Human cervical adenocarcinoma cell line (HeLa) was stably transfected with BID

SiRNA or scrambled SiRNA as a control. These cells were generated in the lab of Dr.

Jochen Prehn, Dublin.

22

Cellular assays

Radio-resistant DNA Synthesis assay (RDS)

For the intra-s-phase checkpoint analysis, T and B cells were activated for 48 hr and

than split into 6 wells dishes 150,000 cells per well. 2 hr later samples were either left

untreated or treated with 2 µM MMC or 10 Gy IR. 2 hr post MMC treatment and 1 hr

post IR treatment cells were labeled with 3H-thymidine for 30 min. Cells were fixed

in ice-cold TCA, the fixed cells were bound to glass fiber filters (Whatman GF/C) and 3H-thymidine incorporation was determined. The 3H-thymidine incorporation in

unirradiated cells was set at 100%, and percent incorporation was calculated.

Metaphase spreads assay

BID+/+, BID−/− or BIDAA T or B cells were treated with 100 nM MMC or with 2Gy

IR. After 24 hrs cells were mitotic arrested (2 h in 0.1mg/mL Colcemid, Invitrogen

Life Technologies). Then cells were incubated 8 min in 0.075M KCl (37°C), and 2

mL fixative (3:1 absolute methanol : acetic acid) was added dropwise. Cells were

mixed, centrifuged, and resuspended in fresh fixative; the fixative step was repeated

3–6 times, and air-dried slides stained with Gimesa were prepared. Metaphases from

BID+/+, BID−/− or BIDAA cells were scored for chromosomal damage per metaphase as

follows: each chromosome break was given a score of +1, and each triradial or

quadriradial form was given a score of +2.

BrdU labeling and analysis

The cells were labeled with 10 µM BrdU (Sigma; added to the medium) for 45 min,

washed with PBS and treated with MMC (1µM) for 2 hrs. Cells were then washed,

incubated in fresh medium for the indicated time points, and fixed with cold 70%

ethanol and incubated overnight at -20˚C. The next day, cells were collected and

resuspended in 2N HCl with 0.5% Triton X-100 for 30 min at room temperature

followed by neutralization with 0.1 M Na2B4O7. Cells were then collected and

incubated with anti-BrdU Abs (Becton-Dickinson) for 30 min in the dark at room

temperature. The cells were washed with PBS, and stained with FITC labeled goat

anti-mouse Abs (Jackson) for 30 min at room temperature in the dark. The cells were

then resuspended in PBS containing PI (5 µg/ml) and analyzed by FACScan.

23

Cell viability assay

Cell viability was determined by propidium iodide (PI) dye exclusion. PI (25 µg/ml)

was added to the cells immediately prior to analysis by FACScan (Beckton

Dickinson).

Cell cycle assay

Cells were treated with 10 µM Etop for 8 hrs, rinsed, and then collected for fixation in

methanol. Following fixation, cells were washed and resuspended in PBS with 25

µg/ml propidium-iodide (PI) and 50 µg/ml RNAse a half hour before FACScan

analysis. Analysis of the cell cycle results was performed using the ModFit LT

program [63].

Apoptosis assay

Cells were treated for the indicated times, harvested and stained as above. The percent

of cells displaying sub-G1 DNA content was determined by FACScan analysis.

Proteins analysis

Formaldehyde treatment and subcellular fractionation

Formaldehyde was added directly to the tissue culture media to a final concentration

of 1% and the cells were incubated for 10 min at room temperature. The cross-linking

reaction was stopped by adding glycine to a final concentration of 0.125 M and

incubation at room temperature for 5 min. Cells were then subfractionated as

previously described [64]. Cells were rinsed with wash buffer (125 mM KCl, 5 mM

magnesium acetate, 5 mM EGTA, 1 mM β−mercaptoethanol, 30 mM Tris-HCl, pH

7.5) at 4˚C, scraped from the plates, washed twice with the same buffer and allowed

to swell for 10 min in 0.5 ml swelling buffer [same as wash buffer except that the KCl

concentration was 10 mM and protease (set III; Calbiochem) and phosphatase (set I

and II; Sigma) inhibitor cocktails were added]. The cells were then lysed in a 2-ml

Wheaton Dounce glass homogenizer using 30 complete up and down cycles of a glass

“B”-type pestle. The homogenate obtained was overlaid on an equal volume of

swelling buffer containing 25% glycerol and centrifuged (600 x g at 4˚C for 5 min).

The upper layer of the supernatant was designated the cytosolic fraction. It should be

noted that all organelle membranes (besides the nuclear membrane) and the plasma

24

membrane are contained in this fraction. The nuclear pellet was washed once with

swelling buffer containing 25% glycerol and 0.1% Triton X-100. Nuclei were

resuspended in sonication buffer (100 mM NaCl, 2 mM MgCl2, 5 mM EGTA, 1 mM

β−mercaptoethanol, 10 mM Tris, pH 9.0). At this stage both the cytosolic and nuclear

samples were incubated at 65˚C for 4-5 hrs to reverse formaldehyde cross-links.

Nuclei were then disrupted by brief sonication. Aliquots of nuclear and cytosolic

fractions were separated by 12% or 15% SDS-PAGE and transferred to PVDF

membrane (Immun-blotTM, Bio-Rad).

Western blot and antibodies

Proteins were size-fractionated by SDS-PAGE and then transferred to PVDF

membranes (BioRad). Western blots were developed by use of the enhanced

chemiluminescence reagent (Amersham Bioscience, Inc). Protein A purified anti-

murineBID Ab, anti-MEK Ab (Sigma), anti-BAX and anti-lamin B Abs (Santa Cruz),

anti-p78-BID and anti-p61-BID abs (Bethyl laboratories), anti-human Chk-2, anti-

pP53, anti-cleaved caspase-3, anti-pSMC1 and anti-SMC1 abs (cell signaling), anti-

mouse Chk-2 ab (Upstate), anti-pATM ab (Rockland) and anti-ATM ab (a gift from

Yossi Shilo's lab) were used for Western blotting. Densitometry was done using

Quantity one program.

Viewing the cellular location of GFP fusion proteins

HeLa cells were grown on glass coverslips, transfected with either of the GFP

constructs, treated as indicated and fixed with 4% paraformaldehyde in PBS for 10

min. The coverslips were mounted and confocal microscopy was performed by using

an Axiovert 100 TV microscope (Zeiss, Oberkochen, Germany) attached to the Bio-

Rad Radiance 2000 laser scanning system (Bio-Rad) and operated by LaserSharp

software.

Immunofluorescence

For immunofluorescence experiments, cells were grown on glass coverslips and fixed

with 4% paraformaldehyde in PBS for 10 min and permeabilized with 0.2% Triton X-

100 in PBS for 5 min. For blocking, the cells were incubated in PBS containing 0.1%

Triton and 3% BSA for 1 h at room temperature. For immunostaining, cells were

25

incubated for 2 h at room temperature with anti-murine BID or anti-p78 Abs in

blocking solution. After three washes with PBS containing 0.1% Triton, the cells were

stained for 1 h at room temperature with Cyt2-conjugated AffiniPure donkey anti-

rabbit Abs (dilution 1: 300, Jackson ImmunoResearch). After three additional washes

with PBS containing 0.1% Triton, the coverslips were mounted and confocal

microscopy was performed as described above.

Immunohistochemistry

Mouse spleen tissues were fixed and sectioned at 4 µm and paraffin sections were

deparaffinized by using standard method. After deparaffinization, dehydration, and

blocking of endogenous peroxidases with 3% H2O2 in methanol, sections were

incubated with 10% goat serum for 1 h, followed by incubation with the anti-cleaved

caspase-3 antibody (Cell Signaling; dilution of 1:50) to detect the cleavage products

of caspase-3. The sections were then washed and incubated with the biotinylated

secondary antibody (Jackson ImmunoResearch 1:200), followed by incubation with

horseradish streptavidin-peroxidase conjugate. After washing, sections were incubated

with the chromogen substrate and counterstained with hematoxylin.

26

Chapter I - The functional connection between BID and the nucleus

Cellular BID partially localizes to the nucleus

This part of the results was published in [53].

The involvement of BID in the DNA damage pathway has prompted us to assess

whether BID localizes to the nucleus. Immunofluoresence (IF) studies with BID+/+

MEFs using anti-BID antibodies has revealed positive staining of BID in the nucleus

(Fig. 4A). To confirm these results, we performed subcellular fractionations followed

by Western blot analysis using anti-BID antibodies. In these experiments, cellular

BID was detected only in the soluble/cytoplasmic fraction (Fig. 4B, left top panel).

MEK and BAX (cytosolic proteins) and lamin B (a nuclear protein) were used as

markers to confirm the purity of the fractions. These results together with the IF

results, suggested that BID might be loosely associated with the nuclear fraction. To

examine this possibility, cells were treated with formaldehyde as a cross linker prior

to cellular disruption. These experiments demonstrated that a small fraction of cellular

BID was localized to the nuclear fraction (Fig. 4B, right top panel). These results

suggested that BID is loosely associated with the nuclear fraction by interaction with

another protein(s) or with DNA and that crosslinking is required to preserve this

interaction.

27

Figure 4. Mouse BID is partially localized to the nucleus. (A) Positive staining of BID in the nucleus of healthy MEFs. BID+/+ MEFs grown on glass coverslips and immunostained with anti-BID Abs (green). (B) A small fraction of cellular BID is detected in the nuclear fraction. BID+/+ MEFs were either left untreated (-) or treated with formaldehyde (+) and subfractionated. Aliquots of the cytosolic (C) and nuclear (N) fractions were subjected to SDS-PAGE followed by Western blot analysis using anti-BID (top), anti-MEK (middle top), anti-BAX (middle bottom) and anti-lamin B (botton) Abs.

DNA damage results in the nuclear export of BID

This part of the results up until figure 7 was published in [65].

The fact that BID partially localizes to the nucleus and that all currently identified

substrates of ATM are nuclear proteins, suggested that BID is phosphorylated in the

nucleus. Since BID is known to act at the mitochondria, we suspected that its

phosphorylation might trigger its release from the nucleus. To examine this point, we

performed IF studies with cells treated with Etop but could not detect any change in

the cellular location of BID. Since the IF studies using the anti-BID antibodies were

not conclusive, we took an alternative approach and generated a BID-GFP chimeric

construct, transfected HeLa cells with this construct, and determined the cellular

location of the chimeric protein in untreated cells and in cells treated with Etop. In

untreated cells, most of the BID–GFP fluorescence appeared in the nucleus (Fig. 5A,

top left panel). Forty-five minutes after Etop treatment, there was an increase in the

cytosolic fluorescence of BID–GFP, and at 90 min after treatment there was a further

increase in this fluorescence (Fig. 5A, top panels and bottom left panel). This pattern

of fluoresence remained untill 150 min after Etop treatment. Similar results were

obtained with cells treated with IR (Fig. 5A, bottom right panel), indicating that BID

nuclear exit is a general feature of the DDR.

The exit of proteins from the nucleus is mostly regulated via the nuclear export

receptor CRM1, and therefore, we tested whether leptomycin B (LMB), a specific

inhibitor of the CRM1, will prevent the nuclear exit of BID. Strikingly, treatment with

LMB prevented the nuclear exit of BID–GFP following Etop treatment (Fig. 5B).

These results suggest that DNA damage results in the nuclear export of BID, and that

this export is mediated via the export receptor CRM1. The nuclear export of proteins

by CRM1 is mediated via nuclear export signals (NESs) [66]. The fact that LMB

inhibited the nuclear exit of BID suggests that BID carries an NES. Examination of

the mouse BID sequence for an NES consensus motif revealed that it carries such a

28

motif (amino acid residues 35–44; Fig. 5C). The REV type NES consensus motif (the

one found in BID) is comprised of an 8–12 amino-acid stretch, and mutations of the

conserved leucines abolishes the nuclear export of proteins carrying this sequence

[66]. To assess whether the nuclear export of BID is regulated by this motif, we

mutated all three of the conserved leucines in this motif to alanines

{L35A/L38A/L42A-(3L/A)} or completely deleted this motif (delNES). wtBID, BID-

3L/A and BID-delNES were fused to GFP and expressed in HeLa cells and their

cellular locations were assessed in the absence or presence of Etop. These studies

showed that mutating/deleting this motif did not affect the nuclear exit of BID (Fig.

5D). Thus, the 35–44 amino acid stretch in BID does not seem to function as an NES,

and therefore, BID nuclear export is probably mediated by another NES-carrying

protein. Finally, it is tempting to speculate that ATM-mediated phosphorylation of

BID regulates its nuclear export. However, this does not seem to be the case, as DNA

damage resulted in the nuclear exit of the non-phosphorylatable BID mutant (BID-

S61A/S78A-GFP; data not shown).

29

30

Figure 5. DNA damage results in the nuclear export of BID. (A) DNA damage results in the nuclear exit of BID–GFP. HeLa cells were grown on coverslips and transfected with a BID–GFP construct. At 16 h post–transfection, the cells were either left untreated (N/T) or treated with Etop (100 µM) or IR (50 Gy). At the indicated times post Etop or -IR treatment, the cells were fixed and pictures were taken using a confocal microscope (top panels show only Etop-treated cells). Bottom: the histograms represent the percentage of cells out of transfected cells that show a prevalence of BID–GFP in the nucleus (N>C) or an equal distribution of BID–GFP between nucleus and cytoplasm (N=C). The data are expressed as the mean ±S.E.M. of three independent experiments in which 100 cells were analyzed each time. The left panel represents cells treated with Etop, and the right panel represents cells treated with IR. (B) LMB prevents the nuclear exit of BID–GFP. HeLa cells were treated as above. At 16 h post–transfection, the cells were pre-treated for 1 h with LMB (5 ng/ml), and then either left untreated (N/T) or treated with 100 µM Etop. At the indicated times after Etop treatment, the cells were fixed and pictures were taken using a confocal microscope (top panels). The histograms shown in the bottom panel were generated as described in (A). (C) Mouse BID carries an NES consensus motif. The NES consensus motif found in BID is shown in the top line, and in the bottom line appears the general NES consensus motif that contains four closely spaced leucines, which can be substituted by other large hydrophobic residues (Isoleucines/Valines). (D) The nuclear export of BID is not regulated by its NES motif or its phosphorylation. HeLa cells were grown on coverslips and transfected with BID-3L/A–GFP or BID-delNES-GFP constructs and treated as above. At the indicated times after Etop treatment, the cells were fixed and pictures were taken using a confocal microscope. The histograms shown were generated as described in (A).

Fusing BID to a strong nuclear localization signal inhibits its nuclear export

To examine the functional importance of BID nuclear export, we attempted to trap it

in the nucleus using a strong nuclear localization signal (NLS) ([67]; notably, mouse

BID does not carry a classical NLS). We found that fusing BID–GFP to the NLS of

the SV40 large-T antigen [68] further drove BID–GFP to the nucleus (Fig. 6A, left

panel). Importantly, Etop treatment did not result in the nuclear exit of NLS–BID–

GFP (Fig. 6A, middle panels), suggesting that this chimeric BID protein is trapped in

the nucleus. As mentioned above, we demonstrated by subcellular fractionation that

the endogenous BID in MEFs is loosely associated with the nuclear fraction, and that

crosslinking (using formaldehyde) is required to preserve this localization. To confirm

that NLS–BID–GFP is localized to the nucleus, we performed subcellular

fractionations in the presence of formaldehyde. Indeed, we found that BID–GFP was

mostly localized to the cytoplasmic fraction, whereas NLS–BID–GFP partitions

equally between the cytoplasmic and nuclear fractions (Fig. 6B). The fact that a

significant portion of NLS–BID–GFP appears in the cytoplasmic fraction (in contrast

to the results we obtained in the fluorescence studies) suggests that it leaks out of the

nucleus during preparation.

31

Figure 6. Fusing BID to a strong NLS inhibits its nuclear export. (A) NLS–BID–GFP does not exit the nucleus in response to Etop. HeLa cells were transfected with NLS–BID–GFP, and 16 h post–transfection, the cells were either left untreated (N/T) or treated with 100 µM Etop. At the indicated times after Etop treatment, the cells were fixed and pictures were taken using a confocal microscope (left and middle panels). Right panel: a schematic representation of the NLS–BID–GFP protein. (B) NLS–BID–GFP is localized to the nucleus. HeLa cells were transfected with either BID-GFP or NLS–BID–GFP, and 16 h post–transfection, the cells were treated with formaldehyde and subfractionated. Aliquots of the cytoplasmic (C) and nuclear (N) fractions were subjected to SDS–PAGE followed by Western blot analysis using anti-BID Abs (top). The blot was stripped and reprobed with anti-lamin B Abs to mark the nuclear fraction (bottom).

Introduction of NLS–BID into BID-/- MEFs fails to restore susceptibility to Etop-

induced cell death

Previously, we demonstrated that BID-/- MEFs are less susceptible than BID +/+ MEFs

to DNA damage-induced cell death, and that reintroduction of wtBID restored

susceptibility to DNA damage [51,53]. To explore the ability of NLS–BID to restore

susceptibility to DNA damage, we generated single stable clones of BID-/- MEFs that

express either wtBID or NLS–BID, or carry an empty vector. Initially, we confirmed

the cellular location of wtBID and NLS–BID in these clones, and showed by both

subcellular fractionation and by IF that wtBID was mostly cytosolic, whereas NLS–

BID partitions equally between the cytoplasmic and nuclear compartments (Fig. 7A).

Next, we assessed the levels of Etop-induced cell death in the wtBID, NLS–BID and

empty vector stable clones. We found that the wtBID clones showed a 2-to-3 fold

32

higher level of cell death compared to the empty vector clones, whereas there was no

significant difference in the levels of cell death between the NLS–BID clones and the

empty vector clones (Fig. 7B; only two clones from each are shown). Western blot

analysis using anti-BID antibodies indicated that the decreased levels of cell death

seen in the NLS–BID clones in response to Etop was not due to lower levels of

expression of NLS–BID (Fig. 7C). Thus, trapping BID in the nucleus impairs its cell

death activity in response to DNA damage.

Figure 7. Introduction of NLS–BID into BID-/- MEFs fails to restore susceptibility to Etop-induced cell death. (A) NLS–BID is localized to the nucleus in the MEFs stable clones. Left panel: BID-/- MEFs stably expressing either wtBID or NLS–BID (one clone from each) were treated with formaldehyde and subfractionated. Aliquots of the cytoplasmic (C) and nuclear (N) fractions were subjected to SDS–PAGE followed by Western blot analysis using anti-BID Abs (top). The blot was stripped and reprobed with anti-lamin B Abs to mark the nuclear fraction (bottom). Right panels: BID-/- MEFs stably expressing either wtBID or NLS–BID (one clone from each) were fixed and stained with anti-BID Abs, and pictures were taken using a confocal microscope. (B) BID/-/ MEFs stably expressing either wtBID or NLS–BID, or carrying an empty vector (two clones from each) were treated with 50 µM Etop for 24 h, and cell death was monitored by FACScan using PI dye exclusion. The data represent the means ±S.E.M. of pooled results from three independent experiments. (C) The decreased death

33

obtained with the NLS–BID clones is not due to lower levels of expression of NLS–BID. The two wtBID and two NLS–BID clones were lysed, and equal amounts of protein (20 µg per lane) were subjected to SDS–PAGE, followed by Western blot analysis using anti-BID Abs (top). The blot was stripped and reprobed with β-actin Abs to control for loading (bottom).

BID-/- MEFs expressing NLS–BID fail to arrest in the S phase of the cell cycle

following Etop treatment

Previously, we demonstrated that BID is important for S-phase arrest following DNA

damage, and that this novel activity of BID is regulated by its phosphorylation by

ATM [53]. To explore the effect of NLS–BID on S-phase arrest, we performed cell

cycle analysis on wtBID and on NLS–BID stable clones either untreated or treated

with Etop. Surprisingly, Etop treatment did not induce S-phase arrest in the NLS–BID

clones and cells from these clones rapidly accumulated in the G2 phase, whereas cells

from the wtBID clones accumulated in the S phase (Fig. 8A; only two clones from

each are shown). To exclude the possibility that the stable clones expressing NLS–

BID may have developed a compensating genetic or extragenetic change that is

responsible for the observed effects, we performed cell cycle experiments with BID-/-

MEFs 3 days post-infection with either wtBID or NLS–BID. We found that BID-/-

cells infected with wtBID showed an 10% increase in S phase following Etop

treatment, whereas BID-/- cells infected with NLS–BID did not (Fig. 8B). These

results confirm that NLS–BID is indeed impaired in its ability to induce S-phase

arrest, as it is unlikely that 3 days post-infection the NLS–BID cells developed a

compensating genetic change that is responsible for the observed effects. To assess

whether the impaired ability to arrest in S phase was due to an inability of NLS–BID

to be phosphorylated in response to Etop treatment, wtBID and NLS–BID cells were

treated with Etop and Western blot analyzed using the phospho-specific antibodies to

phosphoserine 78 [53]. Fig. 8C shows that NLS–BID is phosphorylated in a similar

time course as wtBID, suggesting that the inability of NLS–BID to induce S-phase

arrest is not due to impaired phosphorylation. Taken together, these results suggest

that nuclear export of BID is important for its S-phase arrest function in the DNA-

damage response.

34

B

35

Figure 8. BID-/- MEFs expressing NLS–BID fail to arrest in the S phase of the cell cycle following etoposide treatment. (A) BID-/- MEFs stably expressing either wtBID or NLS–BID (the same four clones shown in Figure 7B) were either left untreated (N/T) or treated with 10 µM Etop, and 8 h post–treatment, the DNA content was analyzed by flow cytometry. The actual raw data from a representative experiment together with multiline plots generated by the ModFit LT computer software program are show in the top panel. The dark histograms represent the percent of cells in the G1 and G2/M phases, and the hatched histograms represent the percent of cells in S phase. The exact percentage of cells in each phase of the cell cycle (in each of the four clones) is shown in the bottom three panels. The data represent the means ±S.E.M. of pooled results from three independent experiments. (B) BID-/- MEFs three days post infection with NLS-BID fail to arrest in the S phase of the cell cycle following Etop treatment. BID-/- MEFs were infected with retroviruses carrying either wtBID or NLS-BID. Three days post infection and selection with 1 µg/ml puromycin, the cells were either left untreated (N/T) or treated with 10 µM Etop, and 8 hrs post treatment the DNA content was analyzed by flow cytometry. The exact percentage of cells in each phase of the cell cycle is shown. The data represent the means ± SEM of pooled results from three independent experiments. (C) NLS–BID is phosphorylated on S78 in a similar time course as wtBID. BID-/- MEFs stably expressing either wtBID or NLS–BID (one clone from each) were either left untreated (N/T) or treated with 50 µM etoposide. At the indicated time points, the cells were lysed and equal amounts of protein (20 µg per lane) were subjected to SDS–PAGE, followed by Western blot analysis using either anti-pS78 Abs (top) or antibodies to regular BID (bottom).

Caspases are not involved in the nucleocytoplasmic shuttling of BID

To assess whether caspases are involved in the nucleocytoplasmic shuttling of BID,

we monitored the cellular location of BID–GFP in HeLa cells in the presence of the

broad caspase inhibitor zVAD-fmk, and found that inhibition of caspases had no

affect on the nuclear export of BID following DNA damage (data not shown).

Moreover, we performed similar studies with the caspase-8 non-cleavable mutant of

BID (BID D59A-GFP), and found that DNA damage resulted in the nuclear exit of

this mutant (Fig. 9A). We also used zVAD-fmk to test whether the S-phase arrest

might be an indirect consequence of cell death rather than a direct effect of BID

nuclear exit. We found that inhibition of caspases did not affect the ability of the

wtBID cells to arrest in the S phase and did not change the differences in the cell

cycle distribution between the wtBID and the NLS–BID cells (Fig. 9B). Thus,

caspases do not seem to be involved in the nuclear exit of BID or in the ability of BID

to induce S-phase arrest.

36

Figure 9. Caspases are not involved in the nucleocytoplasmic shuttling of BID. (A) The nuclear export of BID isn't regulated by caspase activity. HeLa cells were grown on coverslips and transfected with BID-D59A–GFP construct and treated with Etop (100 µM). At the indicated times after Etop treatment, the cells were fixed and pictures were taken using a confocal microscope. The histograms shown were generated as described in (5A). (B) The differences in the cell cycle distribution between the wtBID and the NLS–BID cells are not affected by caspases. BID-/- MEFs stably expressing either wtBID or NLS–BID (the same four clones shown in Figure 7B) were either left untreated (N/T) or treated with 10 µM Etop, in the presence or the absent of zVAD (50µM) and 8 h post–treatment, the DNA content was analyzed by flow cytometry. The data represent the means ±S.E.M. of pooled results from three independent experiments.

37

BID phosphoryaltion occurs in the nucleus

To assess whether BID phosphorylation occur in the nucleus and whether nuclear

localization of BID is essential to execute its function in the DDR, we created a BID-

estrogen receptor chimera (BID-ER) [62]. In this model, proteins that are artificially

fused to a portion of the estrogen receptor are held in the cytosol (excluded from the

nucleus) until the addition of 4-hydroxy-tamoxifen (4-HOT), which results in a

conformational change and translocation to the nucleus. We generated a BID-ER

chimeric protein by fusing a portion of the estrogen receptor to the C-terminus of

BID, and generated several BID-/- MEF stable clones that express this chimeric

protein (Fig. 10A). Of note, the stable clones expressed extremely low levels of BID-

ER, and treatment with 4-OHT significantly increased its expression level. We

initially assessed the cellular location of BID-ER by IF staining using αBID

antibodies and showed that while the BID-ER protein is localized in the cytosol,

addition of 4-OHT resulted in its translocation to the nucleus (Fig. 10B). Western blot

analysis using the pS78 antibody demonstrated that DNA damage-induced

phosphorylation of BID-ER occurs only in the presence of 4-OHT (Fig. 10C top

panel). Thus, ATM-mediated BID phosphorylation in the DDR occurs in the nucleus.

As noted above, treatment with 4-OHT increases the expression levels of BID-ER

(Fig. 10C, bottom panel) suggesting that BID translocation to the nucleus might

stabilize the protein. Functional assays using these lines demonstrated that the

addition of 4-OHT had no significant affect on DNA damage-induced S phase arrest

and apoptosis (data not shown). These results are probably due to the low levels of

BID-ER in the stable clones examined.

38

Figure 10. BID phosphoryaltion occurs in the nucleus. (A) Left panel: A schematic model of the BID-ER chimeric protein. Right panel: Expression of BID-ER in 3 stable clones. BID-/- MEFs stably expressing BID-ER were either left untreated (-) or treated (+) with 100nM 4-OHT for 24 hrs. Cells were then lyzed and equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis using anti-BID Abs. (B) Addition of 4-OHT results in BID-ER translocation to the nucleus. BID-/- MEFs stably expressing BID-ER were either left untreated (N/T) or treated with 100nM 4-OHT for 24 hrs, fixed and stained with anti-BID Abs and DAPI. (C) BID phosphorylation on serine 78 occurs only in the presence of 4-OHT. BID-/- MEFs stably expressing BID-ER were either left untreated (-) or treated (+) with 100nM 4-OHT for either 3 or 24 hrs, and then were either left untreated (-) or treated (+) with 50µM Etop for an additional 1 hr. The cells were then lyzed and equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis using either anti-pS78 (top) or anti- BID (bottom) Abs. * marks a crossreactive band.

Mr(kD)

55

55

43

72

43

72

Etop: +

IB:αpS78

P-BID-ER

IB:αBID

BID-ER

+- -4-OHT: - 3h

+-24h

*

Mr(kD)

55

55

43

72

43

72

Etop: +

IB:αpS78

P-BID-ER

IB:αBID

BID-ER

+- -4-OHT: - 3h

+-24h

*

39

Chapter II - BID phosphorylation at the mitochondria

The results that appear in this chapter have not been published yet

DNA damage induces phosphorylation of exogenous BID at the mitochondria

As shown above, generation of BID-ER that results in trapping of BID outside the

nucleus prevents its phosphorylation in response to DNA damage. DNA damage-

induced phosphorylation of BID-ER occurs only in the presence of 4-OHT, indicating

that ATM-mediated BID phosphorylation in the DDR occurs in the nucleus. Thus, in

accordance with our hypothesis, BID is most likely phosphorylated in the nucleus. If

this hypothesis is correct then targeting BID to the mitochondria should prevent its

phosphorylation. To examine this issue, we targeted BID to the mitochondria by

fusing the trans-membrane (TM) domain of BCL-2 to the C-terminus of wtBID. We

first confirmed by IF that BID-TM was localized to the mitochondria (Fig. 11A).

Next, we determined whether BID-TM is phosphorylated in response to Etop, and to

our surprise it was (Fig. 11B; in these experiments cells were treated with the broad

caspase inhibitor zVAD-fmk to block apoptosis since BID-TM is a potent inducer of

apoptosis). Even more surprising was the fact that BID-TM was phosphorylated in

cells that were not treated with Etop (Fig. 11B; of note, throughout this chapter only

results with the anti-pS78 antibodies are presented but similar results were obtained

with the anti-pS61 antibodies).

40

Figure 11. DNA damage induces phosphorylation of BID at the mitochondria. (A) BID-TM is localized to the mitochondria. HeLa cells were transfected with BID-TM construct (in the presence of zVAD-fmk to inhibit apoptosis). 16 hrs post transfection, cells were fixed and stained with anti-BID Abs. Pictures were taken using confocal microscope. (B) BID-TM is phosphorylated on S78 in non-treated cells and Etop increases its phosphorylation. HeLa cells were transfected with an empty vector, a wtBID or a BID-TM construct (in the presence of zVAD-fmk to inhibit apoptosis) and 16 hrs post transfection treated with 100µM Etop. At the indicated times following Etop treatment the cells were lysed and equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis using either anti-pS78 Abs (top) or antibodies to regular BID (bottom). * mark crossreactive bands. The phospho-form of BID-TM is localized at the mitochondria

To confirm that the phosphorylated form of BID-TM (BID-TM-P) is localized to the

mitochondria, we co-transfected BID-TM with Tom5-GFP (a mitochondrial outer

membrane protein), and performed IF studies with our αpS78 antibody. These studies

indicated that BID-TM-P is indeed localized to the mitochondria (Fig. 12A). It is

important to note that our αpS78 antibody gives non-specific staining in cells treated

with DNA damage reagents (data not shown), but in the studies presented here cells

were left untreated.

We next asked whether BID-TM is initially phosphorylated in the nucleus and later

translocates to the mitochondria. Based on the fact that ATM is a nuclear kinase we

assumed that BID-TM is initially phosphorylated in the nucleus. To test this

possibility we performed similar studies in the presence of LMB, which should block

the translocation of BID-TM-P to the mitochondria. Surprisingly, the presence of

LMB did not eliminate the positive staining of BID-TM-P at the mitochondria (Fig.

12B). These results suggested that BID-TM is phosphorylated at the mitochondria.

41

Figure 12. The phospho-form of BID-TM is localized at the mitochondria. (A) The phospho-form of BID-TM is localized at the mitochondria. HeLa cells were co-transfected with BID-TM and TOM5-GFP (mitochondrial marker, in the presence of zVAD-fmk to inhibit apoptosis). 16 hrs post transfection, cells were fixed and stained with anti-pS78 Abs (left panel). The right panel is a merge of the left and middle panel. Pictures were taken using confocal microscope. (B) BID-TM is phosphorylated at the mitochondria. HeLa cells were co-transfected as above with addition of 5ng/ml LMB. 16 hrs post transfection, cells were fixed and stained with anti-pS78 Abs (left panel). The right panel is a merge of the left and middle panel. Pictures were taken using confocal microscope.

BID phosphorylation at the mitochondria is partially mediated by ATM

To test whether phosphorylation of BID-TM was ATM-dependent, we took advantage

of a stable HeLa cell line in which ATM was knocked down by siRNA (in these cells,

the level of ATM was reduced by ~95% [69]. Both these cells and the control cells,

which carry a siRNA against lacZ, were transfected with either wtBID or BID-TM

and either left untreated or treated with Etop. Interestingly, phosphorylation of BID-

TM was significantly reduced in the ATM knock down cells but was not blocked as in

the case of the wtBID cells (Fig. 13). Thus, DNA damage results in phosphorylation

of an exogenously expressed BID protein at the mitochondria, and this

phosphorylation is partially mediated by ATM.

42

Figure 13. BID phosphorylation at the mitochondria is mediated by ATM. A stable HeLa cell line in which ATM is knocked down by siRNA or a control line, which carries a siRNA against lacZ, were transfected with a wtBID or a BID-TM constructs (in the presence of zVAD-fmk to inhibit apoptosis) and 16 hrs post transfection treated with 100 µM Etop. At the indicated time points following Etop treatment, the cells were lyzed and equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis using either anti-pS78 Abs (top) or antibodies to regular BID (bottom). * marks a crossreactive band.

BID-TM expression does not result in the phosphorylation of other ATM substrates

The results above show that phosphorylation of BID-TM occurs in the absence of

DNA damage and is partially dependent on ATM. Thus, over-expression of BID-TM

might activate ATM, which in turn phosphorylates BID-TM. If over-expression of

BID-TM results in the activation of ATM, then additional ATM substrates should be

phosphorylated. Interestingly, Chk2 and p53, nuclear substrates of ATM, were not

phosphorylated in the absence of DNA damage in cells expressing BID-TM as

compared to cells expressing wtBID (Fig. 14). These results suggest that over-

expression of BID-TM might activate ATM outside the nucleus.

Figure 14. BID-TM expression does not result in the phosphorylation of other ATM substrates. Chk2 and p53, nuclear substrates of ATM, are not phosphorylated in cells expressing BID-TM. HeLa cells were transfected with an empty vector, wtBID or BID-TM, (in the presence of zVAD-fmk to inhibit apoptosis) and 16 hrs post transfection treated with 50µM Etop. 2 hours post Etop treatment the cells were lysed and equal amounts of protein were subjected to SDS-PAGE followed by Western blot analysis using anti-pChk2 and anti-p-p53 Abs.

Mutating the phosphorylation sites of BID-TM does not affect its ability to induce

cell death

BID-TM, which is targeted to the mitochondria, is a potent inducer of apoptosis (Fig.

15). To test whether the phosphorylation of BID-TM on serines 61 and 78 regulates

43

its cell death activity, we assessed the ability of the mutated form (BID-S61A/S78A-

TM; BIDAA-TM) to induce cell death. Our results show that BIDAA-TM induces cell

death to the same levels as BID-TM and tBID, suggesting that in this setting BID-TM

phophorylation does not regulate its ability to induce cell death (Fig. 15).

Figure 15. Mutations in the phosphorylation site of BID do not affect on its ability to kill. HeLa cells were either left un-transfected or transfected with an empty vector, wtBID, BID-TM, BID-TM mutated in ser78 (S78A), BID-TM mutated in ser61 (S61A), BIDAA-TM and tBID constructs and 24 hrs post transfection cell death was measured by PI exclusion. The data represent the means ±S.E.M. of pooled results from three independent experiments.

Mutating in the BH3 domain of BID-TM does not change its phosphorylation

status

A G94E point mutation in the conserved BH3 domain of BID has previously been

shown to abolish its interaction with both BAX and BCL-2, and to significantly

decrease its Cyt c releasing activity [20,31]. Next, we tested the effect of this mutation

on BID-TM phosphorylation. We transfected HeLa cells with either wtBID, BID-TM

or BID(G94E)-TM constructs and cells were either left untreated or treated with Etop.

Our results show that BID(G94E)-TM is phosphorylated in a similar manner as BID-

TM, indicating that BID-TM’s interaction with BCL-2 family members and its pro-

apoptotic activity do not affect its phosphorylation (Fig. 16).

44

Figure 16. Mutation in the BH3 domain of BID-TM does not change its phosphorylation status. HeLa cells were transfected with a wtBID, BID-TM or BID(G94E)-TM constructs (in the presence of zVAD-fmk to inhibit apoptosis) and 16 hrs post transfection treated with 100µM Etop. 2 hrs following Etop treatment the cells were lysed and equal amounts of protein were subjected to SDS-PAGE, followed by Western blot analysis using either anti-pS78 Abs (top) or antibodies to regular BID (bottom).

tBID is phosphorylated on S78 in the absence of DNA damage and this

phosphorylation is mediated by ATM

BID-TM is an artificial molecule and therefore might not necessarily represent a

physiological situation. To test whether BID can indeed be phosphorylated at the

mitochondria, we determined whether over-expression of tBID also results in its

phosphorylation in an ATM-dependent manner in the absence of DNA damage.

Similar to the results we obtained with BID-TM, over-expression of tBID resulted in

its phosphorylation in the absence of DNA damage, and this phosphorylation was

ATM-dependent since it was significantly reduced in ATM knock down cells (Fig.

17, left panels), and in cells treated with the ATM inhibitor KU55933 (Fig. 17, right

panels).

45

Figure 17. tBID is phosphorylated on S78 in the absence of DNA damage and this phosphorylation is mediated by ATM. Left panel: A stable ATM knockdown HeLa cell line and a control line, were transfected with tBID and 16 hrs post transfection treated with 50µM Etop. 2 hours post Etop treatment the cells were lysed and equal amounts of protein were subjected to SDS-PAGE followed by Western blot analysis using anti-pS78 Abs. Right panel: HeLa cells were transfected with tBID and 16 hrs post transfection treated with KU55933 (10µM). 1 hr after KU addition the cells were treated with 50µM Etop. 2 hours post Etop treatment the cells were lysed and equal amounts of protein were subjected to SDS-PAGE followed by Western blot analysis using either anti-pS78 Abs (top) or anti-BID Abs (bottom). tBID is phosphorylated in-vitro by a mitochondria-associated kinase

To assess whether the mitochondria contains a kinase that phosphorylates BID, we

performed an in-vitro kinase assay using purified mitochondria and recombinant

tBID. Targeting recombinant tBID to mitochondria resulted in its phosphorylation on

S78 (Fig. 18, left panels). Interestingly, ATM seems to be required for this

phosphorylation in-vitro since when we targeted tBID to mitochondria that were

purified from ATM-/- MEFs there was a significant reduction in tBID phosphorylation

relative to the control (Fig. 18, right panels).

Figure 18. tBID is phosphorylated in-vitro by a mitochondria-associated kinase. Left panel: Recombinant tBID was either left untreated or incubated with purified mitochondria (prepare from HeLa cells) in the presence of a kinase buffer for 30 min at 37˚C. Phosphorylated tBID was evaluated using anti-pS78 Abs. Right panel: Mitochondria purified from ATM wild-type (+/+) or ATM knockout (-/-) MEFs were incubated with recombinant tBID in the presence of a kinase buffer for 30 min in 37˚C, and phosphorylated tBID was evaluated using anti-pS78 Abs.

46

Chapter III - The role of ATM-mediated BID phosphorylation in-vivo

The results presented in this chapter are being prepared for publication

Generation of BIDS61A/S78A knock-in mice, in which endogenous BID is no longer

capable of being phosphorylated on serines 61 and 78

To determine the role and importance of ATM-mediated BID phosphorylation in-vivo

BIDS61A/S78A (BIDAA) knock-in mice were generated in our lab. These mice are born

at a normal Mendelian frequency and with no gross abnormalities. To confirm that

endogenous BID in the BIDAA mice is no longer capable of being phosphorylated on

serines 61 and 78, BID+/+, heterozygous BID+/AA, and homozygous BIDAA animals

were exposed to a sub-lethal dose of γ-radiation and the phosphorylation status of

BID and its level of expression in thymus, spleen, and kidney were examined.

Western blot analysis using the anti-phospho BID antibodies detected phosphorylated

BID in wild-type and heterozygous tissues, but failed to detect phosphorylated BID in

tissues obtained from the homozygous BIDAA mice (Fig. 19, top and middle panels).

Western blot analysis using antibodies to unmodified BID revealed that the amounts

of BID protein expressed in the three tissues from all three types of animals were

similar (Fig. 19, bottom panel). These results indicate that BID levels and patterns of

expression in the BIDAA mice are normal, but in these mice BID is no longer capable

of being phosphorylated at the ATM regulatory sites.

Figure 19. BID is expressed but is not phosphorylated following whole body irradiation in homozygous BIDAA mice. Six-week old BID+/+, heterozygous BID+/AA, and homozygous BIDAA female mice were either left untreated (-) or subjected to whole body irradiation [+; 3Gy of IR]. The mice were sacrificed 1 hr later by cervical dislocation and the indicated organs were removed, immediately homogenized and equal amounts of protein were subjected to SDS-PAGE,

47

followed by Western blot analysis using either anti-pS78 (top), anti-pS61 (middle) or anti-BID (bottom) Abs.

BIDAA primary activated B and T cells demonstrate increased chromosomal

damage in response to DNA damaging reagents

A characteristic defect in the ATM pathway is chromosomal instability. Previously it

has been demonstrated that MMC induces the phosphorylation of BID on serines 61

and 78, and that BID-/- primary activated T cells show increased chromosomal

damage in response to MMC [54]. We repeated these studies and confirmed that BID-

/- primary activated T cells show a ~2-fold larger increase in chromosomal breaks as

compared to BID+/+ primary activated T cells when treated with MMC (Fig. 20A,B).

To assess whether ATM is involved in regulating BID's activity in preserving

genome stability, we determined the affect of MMC on BID+/+ and BIDAA primary

activated T cells. We found that BIDAA cells also showed a ~2-fold larger increase in

chromosomal damage as compared to BID+/+ cells when treated with MMC (Fig.

20C, D). Similar results were obtained when BID+/+ and BIDAA primary activated T

cells were treated with IR (Fig. 20E). We have also analyzed the chromosomal

damage in primary activated B cells in response to MMC, and scored the frequency

of each chromosome aberration. We found that the BIDAA cells demonstrate

significantly higher frequencies of chromosome and chromatid breaks in response to

MMC treatment as compared to BID+/+ cells (Fig. 20F). Frequencies of tri- and

quadriradial chromosomal figures and translocations were also significantly higher in

the BIDAA cells. Of note, the amount of chromosomal damage in the BIDAA cells was

higher than in the BID+/+ cells even in the absence of MMC treatment (Fig. 20F),

suggesting that the basal phosphorylation of BID also plays a role in preserving

genomic stability.

48

Figure 20. BIDAA primary B and T cells demonstrate increased chromosomal damage in response to DNA damaging reagents. (A) Metaphase spreads of BID+/+ and BID-/- primary activated T cells after 24 hrs of treatment with MMC (100 nM). Cells were arrested in metaphase with 0.1 mg/ml of colcemide, fixed, and visualized by Giemsa staing. The black arrows designate chromosomal breaks. (B) Quantification of the number of chromosomal breaks per cell evaluated in 100 metaphase spreads. (C) Metaphase spreads of BID+/+ and BIDAA primary activated T cells after 24 hrs of treatment with MMC (100 nM). Cells and chromosomes were prepared as in (A). The black arrow designates a quadriradial. (D) Quantification of the number of chromosomal breaks per cell evaluated in 100 metaphase spreads. (E) BIDAA primary activated T cells demonstrate increased metaphase aberrations in response to IR. Metaphase spreads were prepared as in (A). (F) BIDAA primary activated B cells demonstrate increased chromosomal damage in response to MMC treatment. Metaphase prepared has indicated in A, the table shows the chromosome aberration frequencies scored from 100 metaphases of each cell type/treatment in triplicates. The data presented is the mean of the three scorings from different metaphases, and * represent significant differences (P<0.05) based on Student's t test.

BIDAA primary B and T cells fail to arrest in the S phase in response to DNA

damage

Previously it was shown that BID-/- MEFs expressing BIDS61A/S78A fail to accumulate

in the S phase following DNA damage [53]. In addition the abnormal chromosomal

structures we observed in the BIDAA B and T cells represent “chromatid type” errors

resulting from improperly repaired DNA damage accrued during S phase of the cell

cycle [59] as previously demonstrated for BID-/- cells [54]. Based on these data it is

49

likely that the BIDAA cells have a defect in the S phase checkpoint. To test this

hypothesis we used two different methods; double-labeling experiments with BrdU

and PI and the radio-resistant DNA synthesis assay (RDS). Double-labeling

experiments with BrdU and PI enable us to follow the progress of cells through S

phase (see Fig. 21A for exact details of the experiment). We found that BIDAA T cells

are less delayed in the S phase following release from MMC as compared to BID+/+ T

cells (Fig. 21B; note the faster decrease in the % of BIDAA cells in S phase in the left

panel, and the faster decrease in the % of BIDAA cells in late S in the right panel). To

determine whether BIDAA cells are radio-resistant, BID+/+ and BIDAA cells were

treated with either MMC or IR, and labeled with 3H-thymidine to measure ongoing

DNA synthesis. MMC induced a significant reduction in DNA synthesis in the BID+/+

B and T cells (41% and 23%, respectively), whereas little reduction was observed in

the BIDAA B and T cells (14% and 0%, respectively; Fig. 21C, left panel). Similar

results were obtained with IR (Fig. 21C, right panel). Thus, BIDAA cells were found to

be impaired in their ability to temporarily arrest in S phase following DNA damage.

50

Figure 21. BIDAA primary B and T cells fail to arrest in the S phase in response to DNA damage. (A) Experimental design for the cell cycle experiments shown in B. Left panel: for the cell cycle experiments, BID+/+ and BIDAA activated T cells were labeled with BrdU (10µM) for 45 min, washed, and treated with MMC (1µM) for 2 hrs. Cells were then washed, and progression of BrdU-positive cells through the cell cycle was monitored at the indicated time points by flow cytometry. Right panel: The dot plot represent the distribution of cells through the cell cycle and the gates represent the % of cells in G1, early S, late S/G2 and G2/M phases. (B) Left panel: BIDAA T cells show a faster decrease in the % of cells in S phase after release from MMC. Right panel: BIDAA T cells show a faster decrease in the % of cells in late S phase (faster progression from the S to G2/M phase) after release from MMC. (C) BID+/+ and BIDAA primary activated B and T cells were either left untreated (N/T) or treated with MMC (2 µM; 2 hrs; left panel) or IR (10 Gy; right panel), followed by labeling with 3H-thymidine for 30 min. Columns represent the percent of 3H incorporation (mean ± SEM, n=3).

BIDAA primary B and T cells are more susceptible to DNA damage-induced

apoptosis

Based on the results presented above, the BIDAA cells should be more sensitive to

DNA damage-induced apoptosis. To test this we measured apoptosis of BIDAA

primary T cells in response to MMC, and confirmed that they are more susceptible to

MMC-induced apoptosis (Fig. 22A). Next we assessed the sensitivity of BIDAA

primary B cells to IR by monitoring the cleaved/activated form of caspase-3, and

found higher levels of this form in the BIDAA cells (Fig. 22B). Taken together, these

results indicate that the lack of BID phosphorylation weakens the intra-S phase

checkpoint leading to genomic instability and a decrease in cell survival

51

Figure 22. BIDAA primary B and T cells are more susceptible to DNA damage-induced apoptosis. (A) BIDAA primary T cells are more sensitive to MMC. BID+/+ and BIDAA primary activated T cells were treated with the indicated doses of MMC for 24 hrs and the percent of cells in sub-G1 (% Apoptosis) was monitored by flow cytometry. (B) BIDAA primary B cells are more sensitive to IR. Western blot analysis of cleaved caspase-3 in primary activated B cells at the indicated time points post 3 or 5 Gy IR. p17 marks the cleaved/active form of caspase-3. Bottom panel: Columns represent densitometry of the p17 bands in 3 different experiments.

52

ATM-mediated phosphorylation of Chk2 and SMC1 is reduced in the BIDAA cells

following DNA damage

The fact that BID is an ATM effector in the DDR and based on the results presented

above, we decided to search for alterations in cell cycle markers involved in the S

phase checkpoint, which are also localized in the ATM pathway that might give a clue

to BID's mechanism of action in the DDR.

Experimental evidence indicates that parallel branches of the ATM pathway

regulate the S phase checkpoint in mammalian cells. In response to DNA double-

strand breaks ATM activates both the Chk2 and NBS1/SMC1 pathways that

cooperate to inhibit replicative DNA synthesis [Fig. 23A; [70,71]]. Chk2 is activated

by ATM-mediated phosphorylation on T68, and upon activation it phosphorylates a

number of effectors which mediate S phase arrest and apoptosis [72]. In the parallel

cascade, the SMC1 protein is phosphorylated by ATM on S957 and S966 and this

phosphorylation is required for the checkpoint and for survival in response to IR

[71,73].

We initially assessed whether lack of BID phosphorylation affected the activation

of ATM by analyzing its phosphorylation on S1987 [74]. Primary activated B and T

cells were treated with 5 Gy IR and cells were harvested at several time points. Our

results showed that ATM was phosphorylated to the same extent in both the BID+/+

and BIDAA cells (Fig. 23B, and data not shown), suggesting that BID is acting

downstream of ATM. To analyze Chk2 phosphorylation, we treated BID+/+ and

BIDAA primary activated B and T cells with 5 Gy IR and harvested the cells at several

time points. Chk2 was phosphorylated (mobility shift) in both BID+/+ and BIDAA

cells; however there was significantly less accumulation of the

phosphorylated/mobility shifted form in the BIDAA cells (Fig. 23C, and data not

shown).

We have also assessed the activation of SMC1 by analyzing its phosphorylation on

S957. Figure 23D shows that SMC1 was significantly less phosphorylated in the

BIDAA cells. It is known that NBS1 phosphorylation by ATM is required for the

phosphorylation of SMC1, establishing a role for NBS1 as an adaptor in the

ATM/NBS1/SMC1 pathway [71]. Therefore we also examined the phosphorylation

status of NBS1 on Ser343 but due to a technical problem with the antibody we did not

obtain satisfying results (data not shown). Thus, BID acts downstream of ATM and

upstream of Chk2 and SMC1 to regulate the intra-S phase checkpoint.

53

Figure 23. ATM-mediated phosphorylation of Chk2 and SMC1 is reduced in the BIDAA cells following DNA damage. (A) Schematic model of the two parallel branches of the ATM-regulated S phase checkpoint in mammalian cells. (B) ATM activation/autophosphorylation on S1987 is similar in the BID+/+ and BIDAA cells. Western blot analysis of ATM phosphorylation in primary activated B cells at the indicated time points post 5 Gy IR. ATM-P marks the phosphorylated form of ATM. Bottom panel: Columns represent densitometry of the phosphorylated form indicated by ATM-P. (C) ATM-induced phosphorylation of Chk2 on T68 is reduced in the BIDAA cells. Western blot analysis of Chk2 mobility shift (hyperphosphorylation) in primary activated T cells at the indicated time points post 5 Gy IR. Chk2-P marks the phosphorylated/mobility shifted form of Chk2. Bottom panel: Columns represent densitometry of the phosphorylated/mobility shifted band indicated by Chk2-P. (D) ATM-induced phosphorylation of SMC1 on S957 is reduced in the BIDAA cells. Western blot analysis of SMC1 phosphorylation in primary activated B cells at the indicated time points post 5 Gy IR. SMC1-P marks the phosphorylated form of SMC1. Bottom panel: Columns represent densitometry of the phosphorylated form indicated by SMC1-P.

54

BIDAA knock-in mice are hypersensitive to whole-body irradiation

Next we determined the relevance of our findings to the whole animal setting. A

hallmark defect in the ATM pathway is increased radiation sensitivity. ATM-/-,

H2AX-/- and 53BP1-/- mice show a marked hypersensitivity to whole-body irradiation

[75-77]. To assess the radiation sensitivity of the BIDAA mice, BID+/+ and BIDAA mice

were exposed to a lethal dose of γ-irradiation (8 Gy) and their survival was monitored.

While all the BIDAA mice died within 11 days, only 14% of the BID+/+ mice died at

this time point, and the rest died between 11 and 15 days (Fig. 24A). Larger

differences between the BID+/+ and the BIDAA mice were observed when mice were

exposed to 7 Gy of γ-irradiation (Fig. 24B).

To assess whether the hypersensitivity observed in the BIDAA mice is accompanied

by increased apoptosis, we preformed immunohistochemistry staining of spleen

sections with the anti-cleaved caspase-3 antibody. We focused on the spleen because

in this tissue BID is highly expressed and phosphorylated and because most of our

results obtained with cells from the spleen. Mice were irradiated with 10Gy and 3 hrs

post irradiation the mice were sacrificed and the spleens were harvested. Next, we

counted the number of the caspase-3 positive cells in the white pulp (the area in the

spleen in which B and T cells are located) using the ImagePro software. As we

expected, the BIDAA spleens showed a 2-to-4 fold higher average number of apoptotic

cells in the white pulp (Fig. 24C). These results indicate that ATM-mediated BID

phosphorylation plays an important pro-survival role in the spleen in vivo.

55

56

Figure 24. BIDAA knock-in mice are hypersensitive to whole-body irradiation (A) Survival curves of BID+/+ mice (n=7) and BIDAA mice (n=6) after whole body irradiation with 8 Gy. The results are statistically significant, p=0.003 (B) Survival curves of BID+/+ mice (n=19) and BIDAA mice (n=15) after whole body irradiation with 7 Gy. The results are statistically significant, p=8.82*10-8. (C) White pulp in the spleen of BIDAA mice shows higher average number of apoptotic cells than BID+/+ mice. Top panel: representative pictures of IHC staining with caspase-3 antibody. The mice were irradiated with 10Gy and 3 hrs post irradiation the spleen was harvested, fixed with paraformaldehyde and stained with anti-cleaved caspase-3 antibody followed by light staining with hematoxylin. Bottom panel: Columns represent the average number of apoptotic cells in a white pulp. 1 animal from each genotype was left un-irradiated and 3 were irradiated and the number of the apoptotic cells was counted using the ImagePro software.

57

Discussion BID belongs to a subset of the pro-apoptotic proteins, the BH3-only proteins, which

are sentinels of intracellular damage. These proteins are held in check by diverse

mechanisms and seemingly at cellular locations in which they can sense or

communicate specific damage. In this work we studied the role of BID as a sentinel of

DNA damage and examined some of the mechanisms that regulate its activity in the

DDR; we demonstrated that BID is a nuclear protein that is exported from the nucleus

in response to DNA damage and that this export is important for its ability to induce

cell-cycle arrest. We also presented evidence that BID can be phosphorylated at the

mitochondria in the presence or the absence of DNA damage. Finally, in the 3rd part

of the work we explored the role of BID phosphorylation in vivo. Using cells from

the BIDAA mice we found that primary T and B cells demonstrate a defect in the intra

S-phase DNA damage checkpoint, increased chromosomal damage, and increased

apoptosis in response to DNA damage. According to that BIDAA mice were also

hypersensitive to whole-body irradiation and demonstrated rapid death.

The functional connection between BID and the nucleus

Up until now, BID has been considered a cytosolic protein. Since signaling proteins

involved in cell cycle checkpoints often function in the nucleus as well as proteins

that are phosphorylated by ATM, we examined the subcellular location of BID, and

found that it is partially localized to the nucleus. IF studies using anti-BID antibodies

and subcellular fractionations of MEFs after treatment with cross-linker showed that a

fraction of BID is localized to the nucleus (Fig 4). Since cellular disruption avoided

the detection of BID in the nucleus, we suggested that BID is loosely associated with

the nuclear fraction by interaction with another protein(s) or with DNA, and that

cross-linking is required to preserve this interaction.

Where in the cell is BID executing its function? Many of the ATM substrates are

phosphorylated at the damaged sites, and some of them are rapidly distributed to the

undamaged parts of the nucleus (and perhaps to other cellular locations) to reach their

physiological targets [78]. Here, we demonstrate that DNA damage results in the

nuclear export of BID (Fig. 5), and that trapping BID in the nucleus inhibits its

functions in the DNA-damage response (Figs. 7 and 8). Taken together, these results

58

suggest that BID is required to exit the nucleus to execute its functions in this

pathway. Thus, we suspect that BID is phosphorylated at the damaged sites and

rapidly distributed to another cellular location (outside of the nucleus) to execute its

functions. One attractive location is the mitochondria, as several BH3-only proteins

are known to communicate specific damage by translocating from the site of damage

to the mitochondria. Notably, a collaborating group has previously published that

DNA damage induces the translocation of cytoplasmic BID to the nucleus [54]. A

possible explanation for this discrepancy is that BID is moving both into and out of

the nucleus, and that in our setting, we are detecting its net exit. If DNA damage

indeed results in the translocation of cytoplasmic BID to the nucleus (translocation of

the nonphosphorylated form), it remains to be determined the functional importance

of this translocation.

Do our findings using BID–GFP apply to endogenous BID? In Fig.4 we demonstrated

that a portion of endogenous BID is localized to the nucleus. However, we did not

detect a change in the cellular location of endogenous BID following Etop treatment,

as we did using BID–GFP in this study. A possible explanation for these differences

is that it is more difficult to detect changes in the cellular location of proteins using

IF, as compared to using GFP fusion proteins. In the case of BID, it is even more

difficult as we detected only an ~20% increase in cytosolic BID–GFP following DNA

damage (Fig. 5). We also demonstrated that LMB prevents the nuclear exit of BID,

suggesting that this exit occurs via the nuclear export receptor CRM1. On the other

hand, mutating or deleting of the NES consensus motif found in BID had no effect on

its nuclear export, suggesting that this motif does not function as a NES. As the export

of nuclear proteins by CRM1 is mediated via NESs [66], it is likely that the nuclear

export of BID is mediated by another NES-carrying protein. Recently, such a

mechanism has been demonstrated by showing that nucleophosmin (NPM), which

utilizes a conserved CRM1-dependent NES to enable its nucleocytoplasmic shuttling,

provides a necessary chaperoning activity for the nuclear export of ribosomal protein

L5 (rpL5) [79]. Finally, it is tempting to speculate that ATM-mediated

phosphorylation of BID regulates its nuclear export. However, this does not seem to

be the case, as DNA damage resulted in the nuclear exit of the nonphosphorylatable

BID mutant (BIDAA-GFP; data not shown).

59

How does BID induce S-phase arrest? One possible mechanism for inducing cell

cycle arrest would be that phosphorylated BID directly interacts with a cell cycle

regulatory protein located in the nucleus to directly halt cell cycle progression at the

S-phase checkpoint. However, based on our current results, it is equally possible that

BID affects cell cycle progression indirectly by interacting with a ‘non-cell cycle’

protein that could be located outside of the nucleus. BID is also involved in promoting

cell death following DNA damage [53,54] and it is well established that BID initiates

death at the mitochondria. Thus, it is not surprising that trapping BID in the nucleus

inhibits its ability to sensitize cells to DNA damage-induced death (Fig. 7).

Finally, are caspases involved in the nucleocytoplasmic shuttling of BID? We

monitored the cellular location of BID–GFP in HeLa cells in the presence of the broad

caspase inhibitor zVAD-fmk, and found that inhibition of caspases had no affect on

the nuclear export of BID following DNA damage (data not shown). Moreover, we

performed similar studies with the caspase-8 noncleavable mutant of BID (BID-

D59A-GFP), and found that DNA damage resulted in the nuclear exit of this mutant

(Fig. 9). We also used zVAD-fmk to test whether the S-phase arrest might be an

indirect consequence of cell death rather than a direct effect of BID nuclear exit. We

found that inhibition of caspases did not affect the ability of the wtBID cells to arrest

in the S phase and did not change the differences in the cell cycle distribution between

the wtBID and the NLS–BID cells (Fig. 9). Thus, caspases do not seem to be involved

in the nuclear exit of BID or in the ability of BID to induce S-phase arrest.

In the results presented above we examined the role of BID in the DDR by trapping it

in the nucleus using NLS. We also performed an opposite experiment in which BID

was excluded from the nucleus by creating a BID-estrogen receptor chimera (BID-

ER) . In this model, proteins that are artificially fused to a portion of the estrogen

receptor are held in the cytosol until the addition of 4-hydroxy-tamoxifen (4-HOT),

which results in a conformational change and translocation to the nucleus. Using this

model we demonstrated that BID-ER is phosphorylated in response to Etop only in

the presence of 4-OHT, indicating that BID phopshorylaion occur in the nucleus (Fig.

10). Unfortunately we could not use this system to perform functional assays probably

due to the low expression of the chimeric protein.

60

In summary, this study raises the novel possibility that BID, a molecule that was

previously considered to be active only at the mitochondria, may also be active in the

nucleus and that its activity in the DNA-damage pathway requires nuclear export. If

BID is indeed acting in such a manner, then it is an excellent candidate to

communicate DNA damage/repair processes to other cellular compartments.

BID phosphorylation at the mitochondria

Based on the results presented above we concluded that BID phosphorylation in

response to DNA damage occurs in the nucleus. Therefore we were surprised that a

construct of BID which is targeted to the mitochondria, BID-TM, was also

phosphorylated in response to DNA damage (Fig. 11). Similar results were obtained

with a series of truncated BID proteins (deletion of 25 or 45 amino acids from the N-

terminus of BID) that are targeted to mitochondria upon expression in cells (data not

shown). It is important to note that this phosphorylation event occur even in the

absence of DNA damage. Using our phospho-specific antibody we were able to prove

that the phosphorylated BID-TM is localized at the mitochondria (Fig. 12). This may

indicate that BID phosphorylation in response to DNA damage occurs in the nucleus,

but additional phosphorylation events that do not involve DNA damage occur in the

mitochondria.

We detected the phosphorylation of BID-TM and of the truncated BID proteins using

our phospho-specific antibodies that recognize phopshorylation in the ATM

consensus sites; this may indicate that the phosphorylation is ATM-dependent. As

demonstrated in Fig. 13 the phosphorylation we detected was indeed mediated by

ATM. Since we observed that BID-TM phosphorylation is partially mediated by

ATM but occurs also in the absence of DNA damage, we suspected that BID-TM

expression results in ATM activation. If this was the case then other ATM substrates

should have been phosphorylated as well. To our surprise, when we tested the

phosphorylation of Chk2 and p53, nuclear substrates of ATM, they did not show

higher levels of phosphorylation in cells expressing BID-TM as compared to cells

expressing wtBID (Fig. 14). These results suggest that over-expression of BID-TM

might activate ATM outside the nucleus. It would be interesting to check whether

targeting of Chk2 or p53 to mitochondria (in the presence or absence of BID-TM)

would also result in their phosphorylation in the absence of DNA damage.

61

BID-TM which is targeted to the mitochondria by the fusion of the TM domain of

BCL-2 is a potent inducer of apoptosis. We found that mutating its phosphorylation

sites had no effect on its apoptotic activity (Fig. 15). We also found that mutating its

BH3 domain had no effect on its phosphorylation (Fig. 16). Thus, phosphorylation of

BID-TM does not seem to regulate its apoptotic activity, and its apoptotic activity

does not seem to regulate its phosphorylation.

BID-TM is an artificial molecule and therefore might not necessarily represent a

physiological situation. To test whether BID can indeed be phosphorylated at the

mitochondria, we determined whether over-expression of tBID also results in its

phosphorylation in an ATM-dependent manner in the absence of DNA damage.

Similar to the results we obtained with BID-TM, over-expression of tBID resulted in

its phosphorylation in the absence of DNA damage, and this phosphorylation was

ATM-dependent (Fig. 17). Our results may indicate that the mitochondria fraction

contains a kinase that phosphorylates BID. To test this, we performed in-vitro kinase

assays using purified mitochondria and recombinant tBID. Targeting recombinant

tBID to mitochondria resulted in its phosphorylation on S78, and interestingly, ATM

seems to be required for this phosphorylation in-vitro since when we targeted tBID to

mitochondria that were purified from ATM-/- MEFs there was a significance reduction

in tBID phosphorylation relative to the control (Fig. 18). Our results suggest that

ATM might also localize to mitochondria and directly phosphorylate BID. In the past,

several articles claimed that a portion of ATM is localized outside the nucleus,

especially in neuronal cells [80-82], but these claims are not well-established. We also

looked for ATM outside the nucleus using IF and subcellular fractionations but did

not obtain satisfying results (data not shown).

In this part we raised the possibility that ATM phosphorylates BID at the

mitochondria. We have used several approaches to assess whether ATM is localized

to the mitochondria but with no success. The other possibility is that a kinase, acting

downstream of ATM is involved in phosphorylating BID at the mitochondria. One of

our collaborators in Germany has recently found that TRAIL induces the

phosphorylation of tBID on S78, which seems to be ATM-independent. Future studies

(that will probably not involve me) will determine whether tBID-S78-P generated in

62

response to TRAIL, is localized to the mitochondria and whether phosphorylation

affects the pro-apoptotic function of tBID in this pathway. These studies will also

include an attempt to identify the kinase involved in this phosphorylation.

The role of ATM-mediated BID phosphorylation in vivo

Most of the BID phosphorylation studies in our lab in the past involved the use of

immortalized cells, and thus it remained to be established the relevance of these

findings to the in vivo setting. In addition, Our results implicating BID as a nuclear

protein involved in cell cycle regulation in the DDR have been previously challenged

[57] and thus it is important to settle this dispute.

To begin to assess the involvement of BID in the DDR in vivo, whole body

irradiation studies in mice were performed. In these studies it was found that BID is

phosphorylated in vivo in response to γ-irradiation, and that this phosphorylation

occurred mainly in lymphoid populations (populations in which BID is mainly

expressed). It was also found that BID phosphorylation in vivo occurs relatively early,

it is transient, and it increases in an IR dose-dependent manner. These features

suggested that BID plays a role in the early stages of the DDR in vivo. To explore the

role of phosphorylated BID in the DDR in vivo, BIDAA mice were generated in our

lab, in which the wild type BID gene was replaced with the non-phosphorylatable

BIDS61A/S78A mutant. We initially confirmed that endogenous BID in the BIDAA mice

is no longer capable of being phosphorylated on serines 61 and 78 (Fig. 19).

Next, we assessed the cytological consequences of DNA damage in the absence of

BID phosphorylation. Our analysis focused on hematopoietic cells since we found

that BID mainly expressed and phosphorylated in these cells. We initially analyzed

chromosome stability by examining metaphase spreads prepared from primary

activated T and B cells treated with DNA damaging reagents, and found that the

BIDAA cells demonstrated increased genome instability (Fig. 20). Similar results were

obtained with BID-/- primary activated T cells, as previously reported [54]. The

abnormal chromosome structures detected in BID-/- cells [54], and that we detected in

the BIDAA cells represent “chromatid type” errors resulting from improperly repaired

DNA damage accrued during S phase of the cell cycle. Based on these findings and

63

on our previous studies showing that BID is important for S phase arrest [53,54], it

was likely that BIDAA primary B and T cells have a defect in the intra-S phase

checkpoint. Indeed, double-labeling experiments with BrdU and PI together with the

RDS assay, the accepted assay for interrogating the intra-S phase checkpoint in

studies of DNA damage, showed a defect in the BIDAA primary B and T cells treated

with either MMC or IR (Fig. 21). Thus, phospohorylated BID plays an important role

in the DDR in lymphoid populations to induce S phase arrest and preserve genomic

stability. In agreement with these results we also observed increased sensitivity of the

BIDAA cells to DNA damage (Fig. 22). Taken together, our results demonstrate that

the lack of cell cycle arrest and accumulation of unrepaired DNA damage eventually

leads to death.

Where is BID positioned in the ATM pathway? Experimental evidence indicates that

parallel branches of the ATM pathway regulate the S phase checkpoint, the Chk2 and

NBS1/SMC1 pathways [70,71]. We examined the two parallel branches and found

that there is a defect in the activation of both cascades as demonstrated by reduced

phosphorylation of Chk2 and SMC1 in response to DNA damage (Fig. 23). On the

other hand, the lack of BID phosphorylation did not affect the phosphorylation of

ATM, arguing that BID acts downstream of ATM and upstream of Chk2 and SMC1.

These results may provide a molecular explanation for the defects we observed in the

BIDAA mice and cells. Chk2 is directly phosphorylated/activated by ATM, and upon

its activation it relays the checkpoint activation signal to a number of effector which

mediates many of the phenotypic characteristics provoked by DNA damage including

cell cycle arrest and apoptosis [72]. Similar to Chk2, SMC1 is also a target of ATM,

and in response to DNA damage it is phosphorylated on S957 and S966. Cells

carrying a non-phosphorylatable SMC1 exhibit a defective S-phase checkpoint,

decreased survival, and increased chromosomal aberrations post DNA damage [73].

The decreased phosphorylation of Chk2 and SMC1 in the BIDAA cells in response to

DNA damage indicates that these proteins are less active, and thus may explain the

defects in the intra-S phase checkpoint as well as the increased apoptosis and the

increased chromosomal aberrations observed in the BIDAA cells.

Finally we assessed the radiation sensitivity of the BIDAA mice since a hallmark

defect in the ATM pathway is increased radiation sensitivity [75-77]. Indeed we

64

found that the BIDAA mice were hypersensitive to whole-body irradiation and died 3-

to-4 days earlier than the BID+/+ mice in response to a lethal and a sub-lethal dose of

γ-irradiation (Fig. 24). ATM-/- mice display a rapid death in response to irradiation

due to acute radiation toxicity to the gastrointestinal tract. These mice display

characteristic toxicity indicated by severe epithelial crypt degeneration and loss of

villi [75]. Based on that we histologically examined intestinal tissues of BIDAA mice

but did not observe similar defect (data not shown). However, the hypersensitivity

observed in the BIDAA mice was accompanied by increased apoptosis, as

demonstrated by the immunohistochemistry staining of spleen sections with the anti-

cleaved caspase-3 antibody (fig. 24). Interestingly, Maria Maryanovich, a Ph.D

student in our lab, found that hematopoietic progenitors prepared from the bone

marrow of BIDAA mice formed less colonies under stressed conditions such as

limiting cytokines or recovery from whole-body irradiation. Moreover, competitive

bone marrow repopulation assays demonstrated that the BIDAA bone marrow

progenitors were significantly less competitive than the BID+/+ progenitors and

exhibited poor repopulation of both myeloid and lymphoid lineages in vivo,

suggesting a defect in hematopoiesis.

Recently, it was reported that Apaf-1 and Aven, two apoptosis regulators acting at the

mitochondria, also possess non-apoptotic functions in the DDR related to cell cycle

regulation. Apaf-1 was demonstrated to regulate S phase arrest in response to DNA

damage by acting downstream of ATM/ATR and upstream of Chk1 [83]. It was

reported that this new role can be separated from its apoptotic activity since Apaf-1

lacking the proapoptotic CARD domain (unable to activate caspase-9) induces S

phase arrest and Chk1 phosphorylation. BID's cell cycle role in the DDR can also be

separated from its pro-apoptotic activity since BID lacking its BH3 death domain is

capable of inducing S phase arrest [54]. Aven, on the other hand, which was

previously demonstrated to act as an anti-apoptotic protein at the mitochondria, was

now found to function as an ATM activator to inhibit G2/M progression [84]. Aven

was found to bind ATM and overexpression of Aven in cycling Xenopus egg extracts

prevented mitotic entry and induced phosphorylation of ATM and its substrates.

There are also similarities regarding protein localization: Aven and BID were found

to localize to the nucleus in healthy cells, whereas Apaf-1 was found to translocate to

65

the nucleus upon DNA damage. Thus BID, along with Apaf-1 and Aven demonstrate

the ability of proteins to act as double agents – in regulating apoptosis on one hand,

and cell cycle progression on the other hand. It is yet to be determined how these

proteins function in this “life versus death” decision.

66

References 1. Jacobson MD, Weil M, Raff MC. Programmed cell death in animal

development. Cell 1997;88(3):347-354. 2. Hanahan D, and Weinberg, R.A. The hallmarks of cancer. cell 2000;

100:57-70 3. Yuan J, and Yankner, B.A. Apoptosis in the nervous system. Nature

2000;407:802-809. 4. Lockshin RAaZ, Z. Programmed cell death: early changes in metamorphosing

cells. Biochem Cell Biol 1994;72:589-596. 5. Gross A, McDonnell JM, Korsmeyer SJ. BCL-2 family members and the

mitochondria in apoptosis. Genes Dev 1999;13(15):1899-1911. 6. Thornberry NA, Lazebnik Y. Caspases: enemies within. Science

1998;281(5381):1312-1316. 7. Ashkenazi A, Dixit VM. Death receptors: signaling and modulation. Science

1998;281(5381):1305-1308. 8. Chen G, Goeddel, D. V. TNF-R1 signaling: a beautiful pathway. Science

2002;296:1634-1635. 9. Wajant H. The Fas signaling pathway: more than a paradigm. Science

2002;296:1635-1636. 10. Medema JP, Scaffidi C, Kischkel FC et al. FLICE is activated by association

with the CD95 death-inducing signaling complex (DISC). Embo J 1997;16(10):2794-2804.

11. Wang X. The expanding role of mitochondria in apoptosis. Genes Dev 2001;15(22):2922-2933.

12. Bakhshi A, Jensen, J.P., Goldman, P., Wright, J.J., McBride, O.W., Epstein, A.L.,, and Korsmeyer SJ. Cloning the chromosomal breakpoint of t(14;18) human lymphomas: clustering around JH on chromosome 14 and near a transcriptional unit on 18. cell 1985;41:899-906.

13. Youle RJ, Strasser A. The BCL-2 protein family: opposing activities that mediate cell death. Nat Rev Mol Cell Biol 2008;9(1):47-59.

14. Adams JM, Cory S. The Bcl-2 protein family: arbiters of cell survival. Science 1998;281(5381):1322-1326.

15. Kelekar A, Thompson CB. Bcl-2-family proteins: the role of the BH3 domain in apoptosis. Trends Cell Biol 1998;8(8):324-330.

16. Reed JC. Bcl-2 family proteins. Oncogene 1998;17(25):3225-3236. 17. Yin XM, Oltvi, Z.N, and Korsmeyer, S.J. BH1 and BH2 domains of Bcl-2 are

required for inhibition of apoptosis and heterodimerization with BAX. Nature 1994;369:321-323.

18. Oltvai ZN, Milliman CL, Korsmeyer SJ. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 1993;74(4):609-619.

19. Knudson CM, Korsmeyer SJ. Bcl-2 and Bax function independently to regulate cell death. Nat Genet 1997;16(4):358-363.

20. Luo X, Budihardjo I, Zou H, Slaughter C, Wang X. Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell 1998;94(4):481-490.

21. Gross A, Jockel J, Wei MC, Korsmeyer SJ. Enforced dimerization of BAX results in its translocation, mitochondrial dysfunction and apoptosis. Embo J 1998;17(14):3878-3885.

67

22. Muchmore SW, Sattler M, Liang H et al. X-ray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death. Nature 1996;381(6580):335-341.

23. Schendel SL, Montal M, Reed JC. Bcl-2 family proteins as ion-channels. Cell Death Differ 1998;5(5):372-380.

24. Saito M, Korsmeyer SJ, Schlesinger PH. BAX-dependent transport of cytochrome c reconstituted in pure liposomes. Nat Cell Biol 2000;2(8):553-555.

25. Kuwana T, Mackey MR, Perkins G et al. Bid, bax, and lipids cooperate to form supramolecular openings in the outer mitochondrial membrane. Cell 2002;111(3):331-342.

26. Willis SN FJ, Kaufmann T, van Delft MF, Chen L, Czabotar PE, Ierino H, Lee EF, Fairlie WD, Bouillet P, Strasser A, Kluck RM, Adams JM, Huang DC. Apoptosis initiated when BH3 ligands engage multiple Bcl-2 homologs, not Bax or Bak. Science 2007;315:856-859.

27. RJ. Y. Cell biology. Cellular demolition and the rules of engagement. Science 2007;315:776-777.

28. Hoetelmans R, van Slooten HJ, Keijzer R, Erkeland S, van de Velde CJ, Dierendonck JH. Bcl-2 and Bax proteins are present in interphase nuclei of mammalian cells. Cell Death Differ 2000;7(4):384-392.

29. Bartholomeusz G, Wu Y, Ali Seyed M et al. Nuclear translocation of the pro-apoptotic Bcl-2 family member Bok induces apoptosis. Mol Carcinog 2006;45(2):73-83.

30. Jamil S, Sobouti R, Hojabrpour P, Raj M, Kast J, Duronio V. A proteolytic fragment of Mcl-1 exhibits nuclear localization and regulates cell growth by interaction with Cdk1. Biochem J 2005;387(Pt 3):659-667.

31. Wang K, Yin XM, Chao DT, Milliman CL, Korsmeyer SJ. BID: a novel BH3 domain-only death agonist. Genes Dev 1996;10(22):2859-2869.

32. Li H, Zhu H, Xu CJ, Yuan J. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 1998;94(4):491-501.

33. Gross A, Yin XM, Wang K et al. Caspase cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-XL prevents this release but not tumor necrosis factor-R1/Fas death. J Biol Chem 1999;274(2):1156-1163.

34. Desagher S, Osen-Sand A, Nichols A et al. Bid-induced conformational change of Bax is responsible for mitochondrial cytochrome c release during apoptosis. J Cell Biol 1999;144(5):891-901.

35. Wei MC, Lindsten T, Mootha VK et al. tBID, a membrane-targeted death ligand, oligomerizes BAK to release cytochrome c. Genes Dev 2000;14(16):2060-2071.

36. Desagher S, Osen-Sand A, Montessuit S et al. Phosphorylation of bid by casein kinases I and II regulates its cleavage by caspase 8. Mol Cell 2001;8(3):601-611.

37. Yin XM, Wang K, Gross A et al. Bid-deficient mice are resistant to Fas-induced hepatocellular apoptosis. Nature 1999;400(6747):886-891.

38. Sax JK, Fei P, Murphy ME, Bernhard E, Korsmeyer SJ, El-Deiry WS. BID regulation by p53 contributes to chemosensitivity. Nat Cell Biol 2002;4(11):842-849.

68

39. Zinkel SS, Ong CC, Ferguson DO et al. Proapoptotic BID is required for myeloid homeostasis and tumor suppression. Genes Dev 2003;17(2):229-239.

40. Breitschopf K, Zeiher AM, Dimmeler S. Ubiquitin-mediated degradation of the proapoptotic active form of bid. A functional consequence on apoptosis induction. J Biol Chem 2000;275(28):21648-21652.

41. Kaina B. DNA damage-triggered apoptosis: critical role of DNA repair, double-strand breaks, cell proliferation and signaling. Biochem Pharmacol 2003;66(8):1547-1554.

42. Iliakis G, Wang Y, Guan J, Wang H. DNA damage checkpoint control in cells exposed to ionizing radiation. Oncogene 2003;22(37):5834-5847.

43. Shiloh Y. ATM and related protein kinases: safeguarding genome integrity. Nat Rev Cancer 2003;3(3):155-168.

44. Wiese C, Pierce AJ, Gauny SS, Jasin M, Kronenberg A. Gene conversion is strongly induced in human cells by double-strand breaks and is modulated by the expression of BCL-x(L). Cancer Res 2002;62(5):1279-1283.

45. Dumay A, Laulier, C., Bertrand, P., Saintigny, Y., Lebrun, F., Vayssiere, J.L., and Lopez, B.S. Bax and Bid, two proapototic Bcl-2 family members, inhibit homologous recombination, independently of apoptosis regulatio. Oncogene 2006;25:3196-3205.

46. Sawada M, Sun W, Hayes P, Leskov K, Boothman DA, Matsuyama S. Ku70 suppresses the apoptotic translocation of Bax to mitochondria. Nat Cell Biol 2003;5(4):320-329.

47. Krajewski S, Tanaka S, Takayama S, Schibler MJ, Fenton W, Reed JC. Investigation of the subcellular distribution of the bcl-2 oncoprotein: residence in the nuclear envelope, endoplasmic reticulum, and outer mitochondrial membranes. Cancer Res 1993;53(19):4701-4714.

48. Wang O, Gao, F., May, W.S., Zhang, Y., Flagg, T., and Deng, X. Bcl2 negatively regulates DNA double-strand-break repair through a nonhomologous end-joining pathway. Mol Cell 2008;29:488-498.

49. Schmitt E, Beauchemin M, Bertrand R. Nuclear colocalization and interaction between bcl-xL and cdk1(cdc2) during G2/M cell-cycle checkpoint. Oncogene 2007;26(40):5851-5865.

50. Tafani M, Karpinich NO, Hurster KA et al. Cytochrome c Release upon Fas Receptor Activation Depends on Translocation of Full-length Bid and the Induction of the Mitochondrial Permeability Transition. J Biol Chem 2002;277(12):10073-10082.

51. Sarig R, Zaltsman Y, Marcellus RC, Flavell R, Mak TW, Gross A. BID-D59A is a potent inducer of apoptosis in primary embryonic fibroblasts. J Biol Chem 2003;278(12):10707-10715.

52. Valentijn AJ, Gilmore AP. Translocation of full-length Bid to mitochondria during anoikis. J Biol Chem 2004;279(31):32848-32857.

53. Kamer I, Sarig R, Zaltsman Y et al. Proapoptotic BID is an ATM effector in the DNA-damage response. Cell 2005;122(4):593-603.

54. Zinkel SS, Hurov KE, Ong C, Abtahi FM, Gross A, Korsmeyer SJ. A Role for Proapoptotic BID in the DNA-Damage Response. Cell 2005;122(4):579-591.

55. Kastan MB. Cell biology: A BID for the pathway. Nature 2005;437(7062):1103.

56. Gross A. BID as a double agent in cell life and death. Cell Cycle 2006;5(6):582-584.

69

57. Kaufmann T, Tai L, Ekert PG et al. The BH3-only protein bid is dispensable for DNA damage- and replicative stress-induced apoptosis or cell-cycle arrest. Cell 2007;129(2):423-433.

58. Zinkel SS, Hurov KE, Gross A. Bid plays a role in the DNA damage response. Cell 2007;130(1):9-10; author reply 10-11.

59. Scully R, Puget N, Vlasakova K. DNA polymerase stalling, sister chromatid recombination and the BRCA genes. Oncogene 2000;19(53):6176-6183.

60. D'Andrea AD. The Fanconi road to cancer. Genes Dev 2003;17(16):1933-1936.

61. Langland G, Elliott J, Li Y, Creaney J, Dixon K, Groden J. The BLM helicase is necessary for normal DNA double-strand break repair. Cancer Res 2002;62(10):2766-2770.

62. Littlewood TD, Hancock DC, Danielian PS, Parker MG, Evan GI. A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins. Nucleic Acids Res 1995;23(10):1686-1690.

63. Tripathi AK, Chaturvedi R, Ahmad R et al. Flow cytometric analysis of aneuploidy and S-phase fraction in chronic myeloid leukemia patients: role in early detection of accelerated phase. Leuk Res 2003;27(10):899-902.

64. Eldar H, Ben-Chaim J, Livneh E. Deletions in the regulatory or kinase domains of protein kinase C-alpha cause association with the cell nucleus. Exp Cell Res 1992;202(2):259-266.

65. Oberkovitz G, Regev, L., and Gross, A. Nucleocytoplasmic shuttling of BID is involved in regulating its activities in the DNA-damage response. cell Death Differ 2007;14:1628-1634.

66. Henderson BR, Eleftheriou A. A comparison of the activity, sequence specificity, and CRM1-dependence of different nuclear export signals. Exp Cell Res 2000;256(1):213-224.

67. Nigg EA. Nucleocytoplasmic transport: signals, mechanisms and regulation. Nature 1997;386(6627):779-787.

68. Kalderon D, Richardson WD, Markham AF, Smith AE. Sequence requirements for nuclear location of simian virus 40 large-T antigen. Nature 1984;311(5981):33-38.

69. Elkon R, Rashi-Elkeles S, Lerenthal Y et al. Dissection of a DNA-damage-induced transcriptional network using a combination of microarrays, RNA interference and computational promoter analysis. Genome Biol 2005;6(5):R43.

70. Falck J, Petrini JH, Williams BR, Lukas J, Bartek J. The DNA damage-dependent intra-S phase checkpoint is regulated by parallel pathways. Nat Genet 2002;30(3):290-294.

71. Yazdi PT, Wang Y, Zhao S, Patel N, Lee EY, Qin J. SMC1 is a downstream effector in the ATM/NBS1 branch of the human S-phase checkpoint. Genes Dev 2002;16(5):571-582.

72. Ahn J, Urist M, Prives C. The Chk2 protein kinase. DNA Repair (Amst) 2004;3(8-9):1039-1047.

73. Kitagawa R, Bakkenist CJ, McKinnon PJ, Kastan MB. Phosphorylation of SMC1 is a critical downstream event in the ATM-NBS1-BRCA1 pathway. Genes Dev 2004;18(12):1423-1438.

70

74. Bakkenist CJ, Kastan MB. DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature 2003;421(6922):499-506.

75. Barlow C, Hirotsune S, Paylor R et al. Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell 1996;86(1):159-171.

76. Celeste A, Petersen S, Romanienko PJ et al. Genomic instability in mice lacking histone H2AX. Science 2002;296(5569):922-927.

77. Ward IM, Minn K, van Deursen J, Chen J. p53 Binding protein 53BP1 is required for DNA damage responses and tumor suppression in mice. Mol Cell Biol 2003;23(7):2556-2563.

78. Lukas C, Falck J, Bartkova J, Bartek J, Lukas J. Distinct spatiotemporal dynamics of mammalian checkpoint regulators induced by DNA damage. Nat Cell Biol 2003;5(3):255-260.

79. Yu Y, Maggi LB, Jr., Brady SN et al. Nucleophosmin is essential for ribosomal protein L5 nuclear export. Mol Cell Biol 2006;26(10):3798-3809.

80. Wu Z-H, Shi, Y., Tibbetts, R. S., Miyamoto, S. . Molecular linkage between the kinase ATM and NF-kB signaling in response to genotoxic stimuli. Science 2006;311:1141-1146.

81. Li. J. HYR, Plummer. M. R., and Herrup K. Cytoplasmic ATM in Neurons Modulates Synaptic Function. Curr Biol 2009;19:2091-2096.

82. Watters D KP, Spring K, Bjorkman J, Chen P, Gatei M, Birrell G, Garrone B, Srinivasa P, Crane DI, Lavin MF. Localization of a portion of extranuclear ATM to peroxisomes. J Biol Chem 1999;274:34277-34282.

83. Zermati Y, Mouhamad S, Stergiou L et al. Nonapoptotic role for Apaf-1 in the DNA damage checkpoint. Mol Cell 2007;28(4):624-637.

84. Guo JY, Yamada A, Kajino T et al. Aven-dependent activation of ATM following DNA damage. Curr Biol 2008;18(13):933-942.

71

Publications Oberkovitz G, Regev L, Gross A. (2007) Nucleocytoplasmic shuttling of BID is

involved in regulating its activities in the DNA-damage response. Cell Death

Differ. 14: 1628-34.

Kamer I, Sarig R, Zaltsman Y, Niv H, Oberkovitz G, Regev L, Haimovich G,

Lerenthal Y, Marcellus RC, Gross A. (2005) Proapoptotic BID is an ATM effector

in the DNA-damage response. Cell. 122: 593-603.

72

תקציר פועל כזקיף שתפקידו לקשר בין אותות בתא הנוצרים בתגובה לנזק לבין מנגנון המוות BIDהחלבון

י " עובר זירחון עBIDא "עבודות קודמות בקבוצתנו הראו שבתגובה לנזק בדנ. המתוכנן של התאים

. התאים לגרום לעצירה במחזור התא ולמוות של BIDוזרחון זה מבקר את יכולתו של , ATMהקינאז

א יכול לגרום "נזק לדנ. הוא בחלקו חלבון גרעיניBIDבחלק הראשון של מחקר זה אנו מראים שהחלבון

. מונע יציאה זוCRM1 מהגרעין אל הציטוזול ושימוש במעכב ספציפי של הרצפטור BIDליציאה של

. צף זה אינו פעילאך נראה כי ר, )NES( נושא רצף המכוון ליציאה של חלבונים מהגרעין BIDהחלבון

צימדנו לו רצף המכוון חלבונים אל הגרעין , מהגרעיןBIDכדי לבחון את החשיבות של היציאה של

)NLS( ,חלבון זה עובר זירחון בדומה לחלבון המקורי אך אינו יכול . ובכך יצרנו חלבון התקוע בגרעין

מצביעות על האפשרות שמעבר תוצאות אלו . א"לגרום לעצירה במחזור התא ולמוות בתגובה לנזק בדנ

. א הכרחי לבקרת פעילותו בתגובה לנזק זה" בין הגרעין לציטוזול בתגובה לנזק בדנBIDשל החלבון

ATM הוא סובסטרט גרעיני של הקינאז BIDבחלק השני של המחקר אנו מראים שלמרות שהחלבון

אנו יצרנו חלבון שבאופן מלאכותי ממוקם . רות שהוא יעבור זירחון גם מחוץ לגרעיןישנה אפש

חלבון זה , באופן מפתיע. BID-TM, י כך שהצמדנו לו רצף שמכוון למיטוכונדריה"במיטוכונדריה ע

תוצאות אלו מצביעות . א" וזירחון זה מתרחש גם לא בתגובה לנזק בדנATMי "עובר זירחון המתווך ע

מנגנון השונה ממנגנון , מעורב בוBIDא שייתכן והחלבון "ון בקרה נוסף בתגובה לנזק בדנעל מנגנ

. מעורב בגרעיןBIDהתגובה בו

במערכת ATMי " עBIDבחלק השלישי והאחרון של המחקר חקרנו את חשיבות הזירחון של , לבסוף

בעזרת . כול לעבור זירחון שאינו יBIDלשם כך יצרנו עכברים שנושאים חלבון מוטנטי של . של חיה

ATMי " עBIDלזירחון של , תאים שנלקחו מעכברים אלה אנו מראים כי גם בהקשר של החיה השלמה

החיות , בנוסף. א"עצירת מחזור התא ומוות בתגובה לנזק בדנ, א"יש תפקיד בבקרה על מניעת שברים בדנ

א ולכן מתות מוקדם "רמת לנזק בדנ המוטנטי מראות רגישות יתר לקרינה הגוBIDשנושאות את החלבון

ומראות כי גם במערכת של חיה לחלבון BID לחלבון ATM תוצאות אלה מחזקות את הקשר בין. יותר

BIDא" יש תפקיד חשוב בתגובה לנזק בדנ .