DNA profiling

Looking at DNA

In any situation where DNA may be used, a DNA profile must be created.

DNA profiling

DNA profiling is simply the collection, processing and analysis of VNTRs (variable number tandem repeats)

Most DNA sequences in diffe rent people look too similar to tell apart. After processing, however, VNTRs result in bands that are unique enough to be used for identification.

These differences were discovered in 1984 by Dr. Alec Jeffreys, while using DNA belonging to different family members of one of his lab technicians.

For example, you may have a stretch of DNA made up of the following base sequence:

ATCTTCTAACACATGACCGATCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGTTCCATGATAGCACAT

This sequence starts off looking random, but then has repeats of the sequence CATG towards the middle. It becomes random again near the end. The repetitive section of the sequence is what is referred to as an STR.

For a given STR, you will have inherited different numbers of the repeated sequence from each of your parents.

For example, you may have inherited 11 repeats of the CATG sequence, as shown, on a chromosome from your mother, and 3 repeats of this sequence within the STR on the matching chromosome from your father.

Different numbers of repeats = DNA of different lengths. Therefore, electrophoresis can show how many repeats you have.

Generating a DNA profile usually involves analyzing an individual's DNA for ten different STRs on different chromosomes.

Statistically, no two people (except identical twins) are likely to have the same numbers of repeats in all of these STRs.

FBI Crime database CODIS uses algorithms to

compare 13 different STR locations, plus one that determines the gender of the person in question.

The matching algorithms -- which must be confirmed by an analyst--can produce leads for law enforcement or even identify a potential assailant.

The downside of using CODIS is that it's only as strong as the number of profiles included, and there is a backlog of more one million profiles to be entered.

Paternity investigation A band present in the child must come either from

the mother or from the father Comparing male 1 with the child then male 2 with

the child. Interpretation: The bands on the child's fragments are either found

on the mother or the male1. Male 1 therefore is this father of this child. None of the Male 2 bands appear in the child

Forensic investigation A specimen of DNA is taken from the

victim or the crime scene. DNA samples are taken from the 3

suspects. The bands are compared to associate

the suspects to the crime scene Interpretation: Note that the bands on the specimen are

matched by the bands on the Suspect 1. This means that Suspect 1 was present

at the crime scene. The law will still require to prove a crime

was committed and then that Suspect 1 committed the crime

Forensic investigation

It is often difficult to identify victims after disasters such as bombing or fires. Forensic scientists are called in to identify the DNA obtained from body parts or teeth.

During the aftermath of the 2002 Bali bombing, relatives of victims were asked to arrange collection of DNA samples from personal items such as toothbrushes or combs. So far, of the 221 missing or deceased in Bali , 182 have been identified.

DNA profiling identified 115 people, while fingerprints, dental records and medical records were also used to identify victims.

http://www.biotechnologyonline.gov.au/human/dnaforensic.html

DNA profiling in genealogy

Family Tree DNA uses Y-SRT (Y chromosome testing) to determine paternal lineage and mtDNA (mitochondrial DNA testing) to determine maternal lineage.

The Human Genome Project

«The Human Genome Project (HGP) was the international, collaborative research program whose goal was the complete mapping and understanding of all the genes of human beings. All our genes together are known as our "genome."

In 1911, Alfred Sturtevant, an undergraduate researcher in the laboratory of Thomas Hunt Morgan, realized that he could - and had to, in order to manage his data - map the locations of the fruit fly (Drosophila melanogaster) genes whose mutations the Morgan laboratory was tracking over generations. Sturtevant's very first gene map can be likened to the Wright brothers' first flight at Kitty Hawk. In turn, the Human Genome Project can be compared to the Apollo program bringing humanity to the moon.»

http://www.genome.gov/

The Human Genome ProjectOutline three outcomes of the sequencing of the

complete human genome.

Begun formally in 1990 the international project’s aims where:› identify all the approximate 30,000 genes in human DNA. › determine the sequences of the 3 billion chemical base pairs that

make up human DNA. › store this information in database. › improve tools for data analysis. › transfer related technologies to the private sector. › address the ethical, legal, and social issues (ELSI) that may arise from

the project. To help achieve these goals, researchers also are studying the

genetic makeup of several nonhuman organisms. These include the common human gut bacterium Escherichia coli, the fruit fly, and the laboratory mouse.

Homework

Read about the Genographic Project:

https://genographic.nationalgeographic.com/genographic/index.html

Gene control mechanisms

Regulation of genes in prokaryotes

Most bacteria are unicellular and do not have the ability to turn genes on or off to produce different kinds of cells as more complex organisms do. However, a bacterium can change its functions in response to changes in its environment. For example, consider the E. coli living in the constantly changing chemical environment of your intestine. Suppose you've just had a glass of milk. One of the main nutrients in milk is the sugar lactose. When lactose is plentiful in the intestine, E. coli makes the three enzymes necessary to absorb and use this disaccharide. When lactose is not plentiful, E. coli does not waste energy producing those enzymes.

Before the genes, there are two short stretches of DNA called control sequences. Such a cluster of genes, along with its control sequences, is called an operon. The operon discussed here is the lac operon, for "lactose." The first control sequence, the promoter, is the site where RNA polymerase attaches to the DNA. (Recall that RNA polymerase transcribes genes by making mRNA.) Between the promoter and the enzyme genes is a second control sequence called the operator. The operator acts like a switch, determining whether or not RNA polymerase can attach to the promoter.