DNA-induced conformational changes in bacteriophage 434 repressor

Article No. jmbi.1999.3269 available online at http://www.idealibrary.com on J. Mol. Biol. (1999) 294, 859±873

DNA-induced Conformational Changes inBacteriophage 434 Repressor

Mihai Ciubotaru1, Frank V. Bright2, Christine M. Ingersoll2

and Gerald B. Koudelka1*

1Department of BiologicalSciences2Department of Chemistry StateUniversity of New York atBuffalo, Buffalo, NY 14260-1300, USA

E-mail address of the [email protected]

0022-2836/99/490859±15 $30.00/0

Although bacteriophage 434 repressor binds to its speci®c DNA sitesonly as a dimer, formation of the dimers in solution occurs at concen-trations three orders of magnitude higher than those needed to bind the434 operator DNA. Our results suggest that both speci®c and non-speci®cDNA induce conformational changes in repressor that lead to formationof repressor dimers. The repressor conformational changes induced byDNA occur at concentrations much lower than those needed for bindingof repressor, suggesting that the alternative conformations of repressorpersist even if the protein is not in direct contact with DNA. Hence,DNA acts in a ``catalytic'' fashion to induce a steady-state amount of analternative repressor conformation that has an enhanced af®nity for itsspeci®c binding site. These ®ndings suggest that the repressor conformerinduced by non-speci®c DNA is the form of the repressor that is opti-mized for searching for DNA binding sites along non-speci®c DNA.Upon ®nding a binding site, the repressor protein undergoes anadditional conformational change that allows it to ``lock-on'' to itsspeci®c site.

# 1999 Academic Press

Keywords: oligomerization; dimerization; DNA binding; bacteriophage;protein conformation
*Corresponding author
Introduction

The repressor protein of bacteriophage 434 regu-lates gene expression by binding as a dimer tospeci®c sequences in the phage chromosome (for areview, see Ptashne, 1986). Repressor dimer for-mation is a prerequisite for its speci®c DNA bind-ing (Carlson & Koudelka, 1994). Thus, the stabilityof the sequence-speci®c repressor-DNA complex isenergetically coupled to assembly of the high-af®-nity dimeric species. Moreover, in the case of the434 repressor, the overall structure of the dimerinterface in¯uences the ability of repressor to dis-criminate between binding sites that differ slightlyin sequence (Donner & Koudelka, 1998; Koudelka,1998). The capacity to distinguish between thesesequence-similar sites is fundamental to the role ofthe repressor in determining the developmentalfate of the bacteriophage. An understanding of themolecular mechanism of gene regulation by repres-sor therefore requires knowledge of how the

ing author:

protein-DNA complex is assembled on the bindingsite.

Bacteriophage 434 is a member of the lambdoidclass of temperate bacteriophages. Thus, the func-tions of the 434 repressor are similar to that of thewell-studied l repressor. In order to perform itsfunction in regulating bacteriophage development,the repressor must bind to the six naturally occur-ring binding sites on the phage chromosome witha hierarchy of af®nities (Bell & Koudelka, 1993;Wharton et al., 1985). The sequences of these sixsites are partially conserved and are rotationallysymmetric about their centers. On the bacterio-phage chromosome, these six sites are arrangedinto two operator regions, OR and OL, with eachoperator region containing three of the 14 bp longsites separated by ®ve or six base-pairs.

An example of the role of protein-protein con-tacts in mediating repressor function is illustratedby considering repressor's differential af®nities forthe sites in OR. If each of the OR binding sites ispresent on separate DNA fragments, repressorbinds with highest af®nity to OR1, then to OR3,and binds OR2 with lowest af®nity (Bell &Koudelka, 1993). By contrast, in the context of

# 1999 Academic Press

mailto:[email protected]

http://www.idealibrary.com

860 Conformational Changes in 434 Repressor

OR, where all the sites are present on a single DNAfragment, repressor dimer binds with highest af®-nity to OR1. Repressor next occupies the adjacent,weak OR2 site by cooperative interactions with anOR1-bound repressor dimer (Wharton et al., 1985).Under these conditions, repressor binds OR3 withlowest af®nity. Thus, repressor dimers bind theindividual sites with an intrinsic af®nity, whileadditional binding free energy is provided bycooperative interactions between adjacently bounddimers.

Each repressor binds to operator as a dimer ofidentical subunits. Each monomer can be function-ally divided into two domains (Sauer et al., 1982;Anderson et al., 1984). In 434 repressor, the smalleramino (N)-terminal domain comprises the ®rstthird of the 209 amino acid residue protein. Theamino-terminal domain of the repressor contains ahelix-turn-helix structural motif (Anderson et al.,1987; Aggarwal et al., 1988; Mondragon et al.,1989). This motif is responsible for mediating vir-tually all speci®c and non-speci®c contacts betweenprotein and DNA (Anderson et al., 1987; Aggarwalet al., 1988; Wharton & Ptashne, 1985).

The carboxyl (C)-terminal domain encompassesapproximately the last 115 amino acid residues ofthe 434 repressor polypeptide (Sauer et al., 1982;Carlson & Koudelka, 1994). This domain stabilizesthe formation of repressor dimers (Carlson &Koudelka, 1994; Donner et al., 1997). The carboxyl-terminal domain is also responsible for mediatingthe formation of repressor tetramers, which arerequired for the cooperative binding of repressorto two adjacent sites on DNA (M.C. & G.B.K.,unpublished results; Johnson et al., 1979; Whippleet al., 1994).

Despite a wealth of knowledge about the bind-ing speci®city determinants of repressor and thefunctional roles of the individual domains in med-iating speci®c binding, the exact assembly pathwayof the repressor-operator complex is poorly under-stood. One puzzling aspect of 434 repressor-oper-ator complex formation is that although theprotein binds DNA speci®cally only as a dimer,formation of dimers in solution occurs at concen-trations three orders of magnitude higher than theconcentrations needed to bind the 434 operatorDNA (Bell & Koudelka, 1993; Donner & Koudelka,1998). In solution, all forms of the repressor (mono-mers, unbound and DNA-bound dimers) are indynamic equilibrium. Hence it is unclear how atthe low repressor concentrations needed forbinding site occupancy, repressor dimers form insuf®cient quantities to occupy the OR1 binding site.Similar questions also exist regarding the mechan-ism for formation of repressor tetramers in thecooperatively bound repressor complex. Resolutionof these questions will provide insight into themechanism of how the protein searches for itsDNA binding site in the bacterial chromosome.Solution of these paradoxes should also provideinsight into how this process occurs in otherproteins.

An understanding of the pathway of repressor-DNA complex formation will also help us to com-prehend how the structure of the dimer interfacegoverns the DNA binding speci®city of the repres-sor. Mutations in the C-terminal domain of repres-sor alter repressor's ability to differentiate betweenvarious strength operators (Donner & Koudelka,1998). Previous results suggest that the N-terminaland C-terminal dimer interfaces contribute torepressor's DNA binding speci®city by altering thegeometry of the repressor-induced DNA defor-mations (Koudelka & Carlson, 1992; Koudelka,1991; Koudelka et al., 1988).

To begin to address these questions, we haveused steady-state ¯uorescence and ¯uorescenceanisotropy measurements to study the structure ofwild-type and mutant repressors in the absenceand presence of various DNA sequences. Theresults of these investigations suggest that non-speci®c DNA induces a conformational change inrepressor, leading to formation of repressor dimers.Apparently the conformation of this species differsfrom that of a concentration-induced dimer or thedimer speci®cally bound or induced by the OR1site. These ®ndings suggest an assembly pathwayconsisting of a non-speci®c-DNA induced repres-sor conformer that searches for its DNA bindingsite along non-speci®c DNA. Upon ®nding its site,it undergoes an additional conformational change,``locking-on'' to its speci®c site.

Results

DNAs of different sequence differentially affectthe fluorescence emission of 434 repressor

In the absence of added DNA, the intrinsic ¯uor-escence emission spectrum of 75 nM 434 repressorshows a peak at 346 nm (Figure 1(a)). Addinga double-stranded oligonucleotide bearing thesequence of 434 OR1 to this protein solutionchanges the ¯uorescence spectrum of the repressor.At low concentrations of added DNA (0 to 1.5 nM)the intrinsic emission protein ¯uorescence isquenched by �20 %. Upon adding higher concen-trations of the OR1 oligonucleotide (5-80 nM), thiseffect is masked by an increase in emission ¯uor-escence intensity to levels that almost double theinitial intensity of the protein spectrum obtained inthe absence of OR1. This increase in intensityreaches saturation at or near 20 nM OR1 oligo-nucleotide, which corresponds to a DNA to proteinratio of �1:5 (Figure 1(b)).

Under the conditions used in Figure 1(a), thedissociation constant of the repressor-OR1 complexis 5 nM (Bell & Koudelka, 1993). Since the repres-sor concentration used in this experiment exceedsthis value, repressor and DNA should interactquantitatively to form a dimeric repressor-DNAcomplex. The observation that the ¯uorescenceemission intensity changes saturate at a less than1:1 repressor to OR1 ratio (Figure 1(b)) suggeststhat the observed ¯uorescence emission intensity

Figure 1. Effect of added DNAon the ¯uorescence emission inten-sity of 434 repressor. Increasingconcentrations of (a) and (e)speci®c (OR1) or (c) non-speci®cDNA were added to (a) and(c) 75 nM or (e) 7.5 mM 434 repres-sor. The excitation wavelength was280 nm. Intensities are reportedrelative to the emission intensity ofa rhodamine standard. TheDNA concentrations in (a) are 0(Ð), 1 nM (± ± ±), 5 nM ( � � � � � � ),15 nM (± � ± � ±), 50 nM (~~~),75 nM (***), in (c) are 0 (Ð),1 nM ( � � � � � � ), 5 nM (± ± ±), 15 nM(± � ± � ±), 50 nM (~~~), 75 nM(***); and in (e) are 0 (Ð),5 nM (± ± ±), 50 nM ( � � � � � � ),100 nM (± � ± � ±), 1 mM (~~~),2.5 mM (***). Ratios of ¯uor-escence intensities obtained at346 nm of each spectrum dividedby the intensity of the spectrum ofprotein alone from (a), (c) and (e)were plotted as a function of DNAconcentration in (b), (d) and (f),respectively.

Conformational Changes in 434 Repressor 861

changes do not exclusively re¯ect formation of arepressor-OR1 complex. To test this idea, wetitrated repressor with a DNA oligonucleotideencoding a sequence to which 434 repressor doesnot bind speci®cally. Adding this non-speci®cdouble-stranded DNA to 75 nM repressor alsocauses an increase in the ¯uorescence emissionintensity of the wild-type repressor (Figure 1(c)).Similar to the effects of adding OR1 DNA, the non-speci®c DNA-induced increase in repressor ¯uor-escence intensity is also saturable. However, theeffect of adding non-speci®c DNA on repressor's¯uorescence emission is 20 % smaller than thatseen with OR1 addition, increasing by only 1.5-fold(Figure 1(d)). Saturation of the increase in intensityis reached at 75 nM DNA concentration, whichcorresponds to a ratio of protein to DNA of 1:1.Binding experiments show that under these con-ditions, 434 repressor is not forming a detectablecomplex with the non-speci®c DNA (data notshown, see below) Additionally, repressor mono-mers are also incapable of forming detectable com-plexes with either speci®c or non-speci®c DNA(data not shown). The results shown in Figure 1(a)-(d) suggest that the ¯uorescence intensity increaseresulting from adding either speci®c or non-

speci®c DNA results from a DNA-induced confor-mational change in the structure of 434 repressorand not by formation of a protein-DNA complex.

The DNA-induced changes in repressor's ¯uor-escence emission spectrum may be caused eitherby repressor DNA binding or DNA-induceddimerization of repressor at concentrations whereit is normally monomeric. To begin to distinguishbetween these possibilities, we examined the effectof adding DNA to a 7.5 mM solution of repressor.Under these conditions, repressor exists predomi-nately in solution as a dimer. Hence, changes inrepressor's ¯uorescence spectrum should onlyre¯ect changes resulting from speci®c DNA bind-ing by repressor. The results presented inFigure 1(e) and (f) show that adding DNA to a sol-ution of repressor dimers decreases in the intensityof the ¯uorescence emission of protein. Thedecrease in emission plateaus at 80 % of the initialintensity, and there is a slight red shift of maxi-mum intensity from 346 nm to 350 nm (Figure 1(e)and (f)). This result contrasts with the increase in¯uorescence emission intensity seen upon DNAaddition to a solution of repressor monomers (com-pare Figures 1(a)-(d) with (e) and (f)). These ®nd-ings show that pre-forming repressor dimers


eliminates the DNA-induced repressor increase in¯uorescence emission. Consequently, we suggestthat the DNA-induced repressor ¯uorescence emis-sion increase seen in Figure 1(a)-(d) results from aconformational change associated with repressordimer formation, not DNA binding.

The fractional decrease in ¯uorescence intensityshown in Figure 1(e) and (f) is similar to thatobserved when low concentrations of OR1 areadded to 75 nM repressor solutions. Thus, thedecrease in repressor ¯uorescence resulting fromadding OR1 presumably results from a confor-mational change that accompanies repressor DNAbinding.

Tryptophan 119 reports the OR1-inducedchanges in repressor conformation

The data in Figure 1 are consistent with thehypothesis that in the presence of DNA, 434repressor undergoes a conformational change thatplaces one or more ¯uorophores into a morehydrophobic environment(s). The observed lem

maximum at 346 nm indicates that repressor'sintrinsic emission is dominated by a tryptophanresidue(s). Repressor contains ®ve tryptophan resi-dues. W58 forms part of the hydrophobic core ofthe N-terminal domain (Mondragon et al., 1989;Neri et al., 1992) and W91 and W106 are in the lin-ker region that joins the N and C-terminal domain(Sauer et al., 1982). We have recently reported amolecular model of the 434 repressor C-terminaldomain fragment (Donner & Koudelka, 1998). Thishomology-based model was constructed using thefunctional and sequence homology of the C-term-inal domain fragment with UmuD0 protein, whosestructure is known (Peat et al., 1996). Our bio-

chemical studies that de®ned the 434 C-terminaldomain dimerization af®nity and speci®city deter-minants are completely consistent with this model.In the model-built structure, W186 is buried inthe hydrophobic core of the protein (Donner &Koudelka, 1998). This model also indicates thatTrp-119 is located at the edge of the dimer interfacein the C-terminal domain. It is positioned so that itwould be exposed to the solvent in the monomericrepressor, but should become buried in a hydro-phobic environment upon dimer formation. Wetested the idea that W119 is responsible for report-ing the DNA-induced changes in repressor confor-mation by examining the ¯uorescence propertiesof mutant repressor that bears a Trp119! Alachange (W119A repressor). This protein dimerizesand binds OR1 with near wild-type af®nity(Donner & Koudelka, 1998). Figure 2 shows thatthe overall emission intensity of 75 nM W119Arepressor in the absence of DNA is about 60 % ofthe wild-type repressor. In addition, the emissionmaximum of the W119A repressor is blue-shiftedwith respect to that of wild-type repressor, occur-ring at 340 nm. These observations indicate thatW119 dominates the ¯uorescence emission of thewild-type repressor under these conditions. Incontrast to the results with wild-type repressor, the¯uorescence emission of W119 repressor does notchange when OR1 DNA is added to the proteinsolution (Figure 2). Similar results are observedwith addition of non-speci®c DNA (data notshown). Together with the results shown inFigure 1, these ®ndings indicate that the increasein ¯uorescence emission of the wild-type repressorthat is observed upon addition of DNA derivesfrom W119.

Figure 2. Effect of added DNAon the ¯uorescence emission inten-sity of W119A repressor. Increasingconcentrations of speci®c (OR1)DNA were added to 75 nM W119Amutant 434 repressor. The exci-tation wavelength was 280 nm.Intensity is scaled relative to wild-type repressor and can be com-pared directly with those inFigure 1. The DNA concentrationsare 0 (Ð), 1 nM (± ± ±), 2 nM( � � � � � � ), 10 nM (± � ± � ±), 25 nM(~~~), 50 nM (***), inset.Ratios of ¯uorescence intensitiesobtained at 346 nm of each spec-trum divided by the ¯uorescenceintensity of protein alone areplotted as a function of OR1 DNAconcentration.


To better characterize the role of W119 in repres-sor conformational changes induced either byspeci®c or non-speci®c DNA and to gain insightinto any DNA-dependent changes in repressorstructure, we compared the integrated ¯uorescenceemission intensity of wild-type repressor with thatof W119A repressor under identical conditions (seealso Experimental Procedures). Since OR1 additiondoes not substantially increase the emission inten-sity of the W119A protein, virtually all the inten-sity increase seen with 75 nM repressor is due toW119. The quantitative analysis shows that adding15 nM OR1 DNA increases Trp119's contributionfrom 40 % of the total emission in the absence ofDNA to 52 % (data not shown). By contrast, add-ing 15 nM non-speci®c DNA decreases the contri-bution of W119 to the total emission to about 18 %.Since the overall intensity of the W119A protein isunchanged by DNA addition, this indicates that inthe presence of DNA the other tryptophan residuesincrease their contributions to repressor ¯uor-escence. W119 also contributes about 18 % of thetotal emission intensity of a solution of 7.5 mMrepressor in the absence of DNA. These data indi-cate that the environments of W119 and the othertryptophans in repressor are in¯uenced by boththe presence of DNA and by concentration-induced changes in oligomerization state.

DNA-induced changes in the oligomerizationstate of 434 repressor

Together, the data in Figures 1 and 2 suggestthat adding either speci®c or non-speci®c DNA towild-type 434 repressor induces a conformationalchange in repressor, consistent with formation of arepressor dimer. This idea was tested by measur-ing the ¯uorescence anisotropy of 750 nM wild-type repressor and the 434RP22E oligomerization-de®cient mutant in the absence and presence ofspeci®c or non-speci®c DNA at several tempera-tures in solutions of various viscosities. The434RP22E protein, which consists of the ®rst 163residues of 434 repressor and the last 45 residuesof P22 repressor, is incapable of dimerizing, except

Table 1. Relative rotating volumes of wild-type repressor verspeci®c DNA

DNA DNA Concentr

Line 1 None 02 OR1 153 O21 1504 Non-specific 155 Non-specific 1506 OR1 157 OR1 1508 Non-specific 159 Non-specific 150

The limiting anisotropies of wild-type and 434RP22E mutant repreconducted at the conditions indicated (see Experimental Procedurestimes of the two proteins have similar values. See Experimental Proc

when bound to a 434 operator site (Donner et al.,1997). As a result of its dimerization defect, the434RP22E protein binds to OR1 with a 60-fold loweraf®nity than does wild-type repressor. Using thelimiting anisotropy values derived from isothermalpolarization plots (see Experimental Procedures),we calculated the ratios between relative rotatingvolumes of the two protein species under identicalconditions. The ratio of these volumes provides anaccurate measure of the difference in their relativesizes.

In the absence of any DNA, both wild-typerepressor and the 434RP22E mutant protein shouldbe predominantly monomeric under the conditionsof these experiments. Consistent with this asser-tion, the data in Table 1 shows that the ratio oftheir rotating volumes is equal to 1, showing thatthe rotating volumes of the two proteins are almostidentical (Table 1, line 1). Adding a sub-stoichio-metric amount (15 nM) of OR1 to solutions of eachprotein results in an �twofold increase in the rotat-ing anisotropy (expressed as an increase in relativerotating volume) of the wild-type repressor ascompared to the 434RP22E protein (Table 1, lines 2and 6, and data not shown). Under these con-ditions, a dimer of wild-type repressor shouldform a complex stoichiometrically with OR1. As aresult of its weaker dimerization af®nity, the434RP22E protein cannot form a dimeric species insolution, nor can it form a DNA-bound dimer atthese protein concentrations. Hence, the increase inthe relative volume of wild-type versus 434RP22E

repressor is due to dimerization of the wild-typeprotein. At higher OR1 concentrations, both pro-teins are capable of forming speci®c protein-DNAcomplexes. In agreement with this ®nding, the rela-tive rotating volumes of the two proteins observedat 150 nM OR1 are nearly equal (Table 1, lines 3and 7).

Inspection of the data in Table 1 shows that at15 �C, adding either 15 or 150 nM non-speci®cDNA increases the rotating volume of wild-typerepressor, relative to the non-dimerizing mutant434RP22E protein (Table 1, lines 4 and 5). Similarresults were obtained at 5 �C (data not shown).

sus 434RP22E in the absence and presence of OR1 or non-

ation (nM) Temperature (�C)Volume (wild-type/

mutant)

15 0.9815 1.9715 0.9115 1.6315 1.425 1.725 1.0725 1.4325 0.92

ssor were obtained from isothermal polarization measurements,). These calculations assume that the average ¯uorescence life-edures for details.


These data suggest that the presence of non-speci®c DNA induces wild-type repressor to ahigher molecular mass species. The most likelyform of this species is a repressor dimer.

Similar to the observations made at lower tem-peratures, at 25 �C in the presence of 15 nM non-speci®c DNA, the relative rotating volume of wild-type repressor is greater than that of the non-dimerizing mutant 434RP22E repressor. In contrastwith the results obtained at lower temperature, we®nd that in the presence of 150 nM non-speci®cDNA at 25 �C, the relative rotating volumes of thewild-type and mutant repressors are identical(Table 1, line 9). Similar results are obtained at37 �C (data not shown). The similarity in thevolumes of the two wild-type and 434RP22E repres-sor species seen at high temperature and non-speci®c DNA concentration could be due either toan increase in the amount of a larger 434RP22E pro-tein species or to a decrease in the amount of thelarger wild-type 434 repressor species. In eithercase, temperature does not effect formation of thespecies induced by OR1 (Table 1, lines 2 and 6).The different temperature dependencies of thespeci®c and non-speci®c DNA-induced speciesindicates that stability of the species induced byOR1 differs from that induced by non-speci®cDNA. This ®nding is consistent with the sugges-tion that conformations of these two species differ(see Figure 1(a) and (c)).

Non-specific DNA does not form a protein-DNAcomplex with 434 repressor

To verify that the species induced by non-speci®c DNA is not bound to that DNA under theconditions of our experiments, we measured thetime-resolved anisotropy of ¯uorescently labeledDNA in the absence and presence of low concen-trations of repressor. This protocol examines themotion of DNA and permits monitoring of pro-tein-DNA complex formation from the perspectiveof DNA. In these experiments, an increase in themass of the DNA (e.g. during formation of a com-plex with protein) is re¯ected as an increasedrotational correlation time (f). Table 2 shows thatadding repressor to ¯uorescein-labeled OR1increases the global rotational correlation time(fGlobal) of the DNA, indicating that repressor is

Table 2. Time-resolved anisotropy of ¯uorescein-labeled Dmutant 434 repressors

[Repressor] DNA t (ns

0 OR1 4.22150 nM wild-type OR1 4.23150 nM 434RP22E OR1 4.240 Non-specific 4.51150 nM wild-type Non-specific 4.49

Measurements were made under conditions where the repressorwere determined by frequency-domain ¯uorescence spectroscopy an

forming a complex with this DNA under theseconditions. By contrast, adding repressor does notaffect the fGlobal of the ¯uorescein-labeled non-speci®c DNA, suggesting that under these con-ditions, repressor is not forming a protein-DNAcomplex with non-speci®c DNA. However asshown in Table 1, non-speci®c DNA increases theanisotropy of the repressor. Therefore, non-speci®cDNA may induce repressor dimer formationwithout formation of a long-lived protein-DNAcomplex.

The failure of repressor to increase the fGlobal ofnon-speci®c DNA does not result from uncorre-lated motions of the DNA-attached ¯uorescein dyeand a putative repressor-non-speci®c DNA com-plex. It is theoretically possible that the ¯exibilityof the C5 chain that links the dye to the DNAcould uncouple the rotational correlation times ofthe putative complex and ¯uorescein. In order forthis hypothesis to be correct, the dye attached tonon-speci®c DNA must be in a substantially differ-ent environment than that attached to speci®cDNA in the presence of repressor. Several lines ofevidence indicate that this suggestion is incorrect.First, the absorption spectrum of the ¯uoresceindye attached to either speci®c or non-speci®c DNAdoes not change upon addition of protein (data notshown). This observation indicates that theenvironment of the ¯uorescein group attached toeither speci®c or non-speci®c DNA is not changingupon protein addition under conditions wherefGlobal either does (speci®c DNA) or does not (non-speci®c DNA) indicate complex formation. Second,the measured ¯uorescence lifetime (t) of a ¯uor-escent group is highly sensitive to changes inenvironment. As shown in Table 2, t does notchange and indeed is the same under all con-ditions, independent of the identity of DNA or thepresence of protein. Third, the time-resolved aniso-tropy measurements allows us to assess the local,high-frequency motions of the DNA-attached ¯uor-escein (fLocal). As shown in Table 2, fLocal does notchange with DNA sequence or protein addition.This observation indicates that the motion of theDNA-attached ¯uorescein is similarly correlatedwith the motion of both speci®c and non-speci®cDNAs, regardless of the presence or absence ofrepressor.

NA in the absence and presence of wild-type dimer

) fLocal (ns) fGlobal (ns)

0.15 3.400.14 5.060.14 2.80.14 3.560.14 3.60

concentrations exceeded ten times those of labeled DNA. Datad analyzed as described in Experimental Procedures.


DNA-induced changes in repressorconformation are mediated by non-specificcontacts with DNA

Our data suggest that DNA-induced changes in434 repressor conformation occur without the for-mation of speci®c protein-DNA contacts. Thisinterpretation implies that non-speci®c contactsbetween protein and DNA are necessary and suf®-cient to cause the conformational changes. Thisidea was tested by examining the ability of DNAto induce conformational changes in two 434repressor mutants, one bearing a change in a resi-due that prevents repressor from forming a speci®ccomplex with DNA and another that disrupts animportant non-speci®c repressor-DNA interaction.

Glutamine 28 contacts the ®rst base-pair of theconsensus 434 binding site (Aggarwal et al., 1988).Binding experiments show that the Q28A mutationdecreases the af®nity of repressor for 434 OR1 by5100-fold (data not shown; Wharton et al., 1987).Adding a double-stranded oligonucleotide bearingthe sequence of 434 OR1 to a 75 nM solution ofQ28A repressor increases the ¯uorescence emissionintensity of the protein to levels that are nearlydouble the initial intensity of the protein spectrumobtained in absence of DNA (Figure 3). Theincrease in intensity reaches saturation at or near50 nM OR1 oligonucleotide, which correspondsto a DNA to protein ratio of 0.66:1. Under theseconditions, the ¯uorescence emission intensity ofthe Q28A 434 repressor increases, despite the factthat this protein is not forming a detectable,speci®c complex with OR1. This observation is con-sistent with the idea that speci®c complex for-mation with DNA is not necessary to cause theDNA-induced ¯uorescence increase and that non-

Figure 3. Effect of added DNA on the ¯uorescenceemission intensity of mutant 434 repressors. Increasingconcentrations of speci®c (OR1) DNA were added to75 nM Q28A repressor (*) or R43A repressor (&).Ratio of ¯uorescence intensities obtained at 346 nm (lex

280 nm) of each protein's emission spectrum wasdivided by the intensity of the spectrum of proteinalone and plotted as a function of DNA concentration.

speci®c interactions are suf®cient for mediatingthis effect.

Arginine 43 makes non-speci®c contacts with theDNA phosphate backbone at the center of the 434repressor binding site (Aggarwal et al., 1988).Changing this residue to alanine decreases the af®-nity of repressor for DNA by �1000-fold, which isdue to elimination of an energetically importantcontact between the protein and the DNA phos-phate backbone. Figure 3 shows that titrating75 nM R43A repressor with increasing concen-trations of OR1 DNA has no effect on the protein's¯uorescence emission intensity. This ®nding showsthat severely compromising 434 repressor's abilityto make non-speci®c interactions with DNA pre-vents the DNA-induced ¯uorescence changes. This®nding is consistent with the suggestion that non-speci®c interaction of repressor with DNA isnecessary to cause the DNA-induced ¯uorescenceincrease.

Specific and non-specific DNA differentiallyaffect the ability of acrylamide to quench theintrinsic fluorescence of 434 repressor

To con®rm that the repressor species induced byOR1 differs from that formed in the presence ofnon-speci®c DNA, we compared the concentrationdependence of acrylamide quenching of 434repressor in the absence and presence of non-speci®c and speci®c DNA. Figure 4 shows thatthe intrinsic tryptophan ¯uorescence of a 75 nM434 repressor solution decreases linearly withincreasing acrylamide concentration. Since 434

Figure 4. Acrylamide quenching of 434 repressor ¯u-orescence in the absence and presence of DNA. Emis-sion spectra were recorded as described in ExperimentalProcedures. Each spectrum was background correctedand further subjected to photobleaching and dilutioncorrections relative to a control sample. To quantify theeffects of acrylamide on ¯uorescence, the area under-neath each corrected spectrum was calculated usingnumerical integration. The Fo/F values determined fromthis calculation were plotted against acrylamide concen-tration. (*) 75 nM repressor, (&) 75 nM repressor and15 nM OR1, (~) 75 nM repressor and 15 nM non-speci®c DNA, (^) 7.5 mM repressor.


repressor contains ®ve tryptophan residues, this®nding indicates that under these conditions,where repressor is predominantly monomeric, all¯uorescent tryptophan residues are almost equallyaccessible to acrylamide. The acrylamide quench-ing curve of a 7.5 mM repressor solution is slightlyconcave upward. At this concentration, repressor ispredominantly dimeric. Hence, this result suggeststhat under these conditions, the ¯uorescence of therepressor is dominated by a single tryptophan resi-due or that the quenching mechanism involvesboth dynamic and static components. Although wehave not performed a rigorous analysis of thequenching mechanism, the contributions of mul-tiple tryptophan residues to the ¯uorescence of therepressor (Figure 2) leads us to favor the latteralternative. Comparing this curve with thatobtained with 75 nM repressor indicates thatacrylamide is a slightly less ef®cient quencher oftryptophan ¯uorescence at the higher repressorconcentration (Table 3). This observation suggeststhat at high concentration, the ¯uorescent group(s)are sequestered away from the solution. Thissequestration may be due to dimerization of therepressor at high concentration. Together, thedifferential sensitivity to acrylamide quenchingand the differing shapes of the acrylamide quench-ing curves obtained at low and high repressorconcentration indicate that the environment(s) ofthe quenched tryptophan residues differs betweenthe two different repressor con®gurations. Thisconclusion is independent of issues surroundingthe quenching mechanisms operating under thetwo conditions.

The results in Figure 4 also show that adding15 nM OR1 to 75 nM 434 repressor increases theamount of acrylamide needed to quench the ¯uor-escence of the repressor. The decrease in acryl-amide quenching ef®ciency obtained by addingOR1 is similar to that resulting from increasingrepressor concentration (Table 3). The shapes ofthese quenching curves are similar, suggesting thateither increasing repressor concentration or addingOR1 similarly affect the environment(s) of thequenched tryptophan, as might be expected, bothconditions will result in formation of repressor

Table 3. Acrylamide quenching constants (KQ) of wild-type a

[Protein] (nM)

Wild-type repressor 757575

7.5a

W119A repressor 757575

7.5a

Quenching constants were determined by linear least-squares ®tdescribed (Eftink & Ghiron, 1976) Values are given as 103 M � standthe ®tting.

a Concentration is mM for this value.

dimers. However, other evidence suggests thatsimilarity in shapes of these curves is fortuitous inthat the population of ¯uorescent groups quenchedby acrylamide differs between the two conditions(see Figure 5 and below).

In contrast to the effects of OR1 and increasingrepressor concentration on acrylamide quenchingef®ciency, adding 15 nM non-speci®c DNA to75 nM repressor increases the acrylamide quench-ing ef®ciency (Table 3). The ®nding shows that inthe presence of non-speci®c DNA, the ¯uorescentgroup(s) in 434 repressor become more accessibleto the quencher. The quantitatively different effectof acrylamide on repressor ¯uorescence in the pre-sence of speci®c and non-speci®c DNA indicatesthat these two DNAs cause repressor to assumedifferent conformations.

Acrylamide quenching of W119A mutant 434repressor confirms that concentration andDNA addition alter repressor conformation

The results shown in Figure 2 indicate that W119reports the DNA-induced changes in repressorconformation. The data shown in Figure 4 indicatethat non-speci®c and speci®c DNA differentlyaffect repressor conformation. To better character-ize the conformational differences of repressorunder various conditions, we examined the abilityof acrylamide to quench the residual ¯uorescenceof the W119A mutant 434 repressor. Eliminatingthe contributions of W119 allows us to assess thecontributions of W119 to repressor ¯uorescenceand unmask the contributions of the other fourtryptophan residues in the repressor. The results inFigure 5 show that the relative ¯uorescence of75 nM W119A repressor mutant decreases linearlywith increasing acrylamide concentration. Theapparent acrylamide quenching ef®ciency at lowW119A concentration is indistinguishable fromthat obtained with the wild-type protein underidentical conditions (compare Figures 3 and 5, seealso Table 3). Since W119 is not contributing to the¯uorescence of the W119A mutant, this ®ndingsuggests that tryptophan residues other than W119make a large contribution to the ¯uorescence

nd W119A 434 repressors

DNA KQ (Mÿ1)

None 99 � 10OR1 84 � 6.9Non-specific 157 � 8.9None 93.2 � 3.2None 109 � 11.4OR1 179 � 13Non-specific 118 � 8.7None 78 � 3

s of the linear portions of the acrylamide quenching curve asard deviation. At least six points in each data set were used in

Figure 5. Acrylamide quenching of W119A 434repressor ¯uorescence in the absence and presence ofDNA. Data were acquired as discussed in the legendto Figure 4. (*) 75 nM repressor, (&) 75 nM repressorand 15 nM OR1, (~) 75 nM repressor and 15 nMnon-speci®c DNA, (^) 7.5 mM repressor.


quenching curve of the low concentration form ofthe wild-type protein.

As compared to its effect at low W119A repres-sor concentrations, acrylamide is a less ef®cientquencher at higher concentrations of W119A pro-tein (Figure 5 and Table 3), where this proteinexists mostly in the dimeric form. This ®nding isqualitatively similar to that observed with thewild-type repressor (Figure 4). Since W119 ¯uor-escence is not contributing to the ¯uorescence ofthe mutant protein, this observation suggests thatconcentration-induced dimerization does notchange the accessibility of this residue in the wild-type protein. If concentration-induced dimerizationof 434 repressor resulted in large changes in W119accessibility in the wild-type protein, the W119Amutation would be expected to have little or noeffect on the relative acrylamide quenching ef®-ciency in the two proteins. Therefore, tryptophanresidues other than W119 are monitored by acryl-amide quenching in this dimeric form of bothproteins.

Acrylamide is a more ef®cient quencher ofW119A repressor ¯uorescence in the presence ofOR1 than in its absence (Figure 5 and Table 3). This®nding suggests that one or more of the fourremaining tryptophan residues in the W119Arepressor become more accessible to acrylamideupon binding OR1. The decreased ef®ciency of ¯u-orescence quenching of the wild-type repressor inthe presence of OR1 (Figure 4 and Table 3), there-fore results from a decrease in the accessibility ofW119, that overshadows the increases in the acces-sibility of the other ¯uorescent tryptophan resi-dues. This conclusion is buttressed by theobservation that W119 contributes 52 % of theemission spectrum of the repressor in the presenceof OR1. This result is also consistent with a majorchange in the environment of W119, which

accounts for the results presented in Figure 1(a)and (b).

Adding non-speci®c DNA to W119A repressordoes not signi®cantly change the ef®ciency ofacrylamide quenching of this protein. This result isin sharp contrast to the large increase in quenchingef®ciency observed upon adding non-speci®c DNAto wild-type repressor. This observation indicatesthat quenching of W119 dominates the observedeffect of acrylamide on the ¯uorescence of wild-type repressor in the presence of non-speci®cDNA. More importantly, this observation suggeststhat adding non-speci®c DNA to wild-type repres-sor causes a conformational change in repressorthat increases the exposure of W119 to the solvent.This effect is the opposite of that observed uponOR1 addition. Hence, the conformation of repressorin the presence of speci®c DNA appears to bedifferent from that found in the presence of non-speci®c DNA.

DNA addition enhances the affinity of 434repressor for operator

The evidence presented above suggests that bothspeci®c and non-speci®c DNA induce a confor-mational change in repressor consistent with theformation of a repressor dimer. Moreover, our dataindicate that the repressor structures induced bythe two types of DNA are different. Since dimeri-zation is a prerequisite for DNA binding, we testedwhether the DNA-induced repressor conformation-al changes affect the af®nity of repressor foroperator. As detected by gel mobility shift assay,1 mM 434 repressor forms a complex with 25 nMlabeled OR1 at 37 �C (Figure 6(a), compare lanes 1and 2). However, the amount of speci®c repressor:OR1 complex formed is increased when the totalOR1 concentration is raised by adding unlabeledOR1 oligonucleotide (Figure 6(a), lanes 3-7, and(c)). Maximum stimulation of DNA binding occursat 75 nM total OR1. At higher total DNA concen-trations, the amount of labeled OR1 to repressorcomplex observed decreases, presumably as aresult of competition between labeled andunlabeled DNA for binding to repressor(Figure 6(a) and (c)). These data show that addedspeci®c DNA is able to stimulate repressor bindingto operator DNA.

We also examined the effect of adding non-speci®c DNA on repressor af®nity for its speci®cDNA binding sites. In these experiments, 1 mM 434repressor was incubated at 37 �C with 25 nM OR1and unlabeled non-speci®c DNA was added. Asseen in Figure 6(b) and (d), adding 0.5-200 nMconcentrations of ``competitor'' non-speci®c DNAstimulates repressor binding to OR1. At concen-trations greater than 300 nM, non-speci®c DNAbegins to compete with repressor binding to OR1(Figure 6(b) and (c), lanes 5-7). These observationsshow that similar to the effect of added speci®cDNA, added non-speci®c DNA is able to stimulaterepressor binding to operator DNA.

Figure 6. Effect of added DNAon the af®nity of 434 repressor forOR1. Gel mobility shift assays wereperformed as described in Exper-imental Procedures. In these exper-iments, a ®xed concentration of 434repressor, 1 mM, was incubatedwith 25 nM labeled OR1, andincreasing concentrations of (a)unlabeled OR1, or (b) non-speci®cDNA was added. The fraction oflabeled DNA retained in complex(amount of labeled DNA in com-plex/total labeled DNA) formedwas normalized to the amount ofcomplex in the absence ofunlabeled DNA and plotted as afunction of total (c) unlabeled DNAconcentration for OR1 or (d) non-speci®c DNA.


Discussion

Here, we show that adding DNA to 434 repres-sor induces the protein to undergo a conformation-al change that is accompanied by the formation ofrepressor dimers. The ability of a DNA sequence toinduce dimer formation is independent of its abil-ity to speci®cally bind to 434 repressor. However,the conformation of the repressor dimer that isinduced by speci®c DNA is distinct from thatinduced by non-speci®c DNA. We have alsoobserved a third conformation of the repressordimer, distinct from the DNA-induced forms,which is formed only at high repressor concen-trations. Hence, the repressor dimer appears toexist in three structurally distinct forms, a repres-sor concentration-induced dimer and two distinctDNA-induced repressor conformations.

One question raised by our ®ndings concerns theputative functions of the two different DNA-induced conformations. Our data clearly show thatthe two DNA-induced repressor conformations

have increased ability to bind speci®c DNA. Tobegin to answer this question, we will consider therelative abundance of the various repressor speciesat the critical steps in the phage life-cycle. Duringthe establishment of lysogeny, the concentrationsof both 434 repressor and its speci®c binding sitesin an infected cell are very low (Bushman, 1993).Hence neither the repressor concentration-inducedconformation nor the conformation of repressorinduced by speci®c DNA binding can be formed insubstantial amounts. Nonetheless, in order to pro-mote lysogenic growth, repressor must rapidlyrecognize and distinguish between the six highlysimilar binding sites on the bacteriophage chromo-some. Only the dimeric form of repressor iscapable of speci®c DNA binding (G.B.K., unpub-lished results; Simoncsits et al., 1997). The low con-centration of repressor and binding sites precludesthe formation of either the concentration-inducedor speci®c DNA-induced dimeric species. Theabsence of these species would result in a signi®-


cant kinetic obstacle to binding site occupancy.Since the concentration of non-speci®c DNA in thecell is 10 mM (Ptashne, 1986), virtually all therepressor will exist in the dimeric conformationinduced by non-speci®c DNA. Our results indicatethat this repressor species has enhanced ability tooccupy a speci®c binding site (Figure 6), thereforewe suggest that the role of the repressor inducedby non-speci®c DNA is to catalyze speci®c DNAbinding by repressor during establishment of lyso-geny. The experiments we have described herecannot distinguish whether the stimulation ofDNA binding by non-speci®c DNA results fromincreases in rate of binding of repressor to speci®cDNA or from an increase in the total concentrationof ``active'' DNA binding (repressor dimer) species.However, our unpublished results indicate thatlike many other proteins (Winter et al., 1981; Jeltschet al., 1994, 1996; Terry et al., 1985; Park et al., 1982;Nardone et al., 1986), 434 repressor scans DNA forits speci®c binding site using a reduced dimension-ality search through facilitated diffusion (M.C. &G.B.K., unpublished results). We envision that thenon-speci®c DNA-induced repressor dimer speciesis a conformation optimized for scanning DNA.

We envision that 434 repressor is not unique inhaving a ``search mode'' conformation. Many ofthe DNA-binding proteins that utilize facilitateddiffusion in their site selection mechanism alsoundergo conformational changes in the presence ofDNA. For example, BamHI (Newman et al., 1995)and EcoRI endonucleases (Jen-Jacobson et al., 1986),lac repressor (Friedman et al., 1995; Lewis et al.,1996) and RNA polymerase (Polyakov et al., 1995)undergo structural transitions in which portions ofprotein are unfolded in the absence of DNA, butassume the folded state or are refolded when com-plexed with their speci®c DNA binding sites.These folding transitions often occur within theDNA binding domains of the proteins and thefavorable energetics of these transitions contributeto formation of a stable protein-DNA complex(Spolar & Record, 1994). In several other cases thefolding is accompanied by alterations in the oligo-meric state and/or rearrangement of the oligomerinterface. For example, in l cro protein the dimerinterface that exists in the absence of DNA wouldprohibit site recognition (Albright & Matthews,1998; Brennan et al., 1990; Anderson et al., 1981).Hence in this and other cases, oligomerization orrearrangement of the oligomer interface is requiredfor sequence-speci®c binding by the protein. It isplausible to assume that some or all of these struc-tural rearrangements occur upon interaction of theprotein with non-speci®c DNA sequences.

Our data show that 434 repressor undergoesadditional rearrangements upon binding to itsspeci®c DNA sites. The potential role of the repres-sor conformation induced by binding speci®c DNAis inferred by the realization that displacement ofrepressor from DNA would result in immediateinduction of the lysogen. Preservation of the lyso-genic state both demands and results in a precisely

®xed, low amount of repressor which would eitherbe bound to speci®c DNA or be in equilibriumwith the form that is induced by speci®c binding.Our data show that this form of repressor has anincreased af®nity for speci®c DNA, and wouldthereby facilitate maintenance of the lysogen. Inaddition to speci®c site occupancy, lysogeny alsorequires precise distribution of repressor moleculeson the six repressor binding sites on the phagechromosome. The distribution is governed, in part,by cooperative interactions. Unpublished obser-vations indicate that the conformation of repressorthat is induced by binding speci®c DNA facilitatesthese tetrameric interactions. We suggest that othersystems that require protein-protein contacts arealso eased by formation of a particular protein con-formation.

The inferences regarding the functional roles ofthe various DNA-induced repressor conformationsassume that these species persist in the absence ofthe stimulating DNA. Consistent with this require-ment, we ®nd that the effect of adding speci®c ornon-speci®c DNA on 434 repressor conformationplateaus at sub-stoichiometric DNA to proteinratios (Figure 1(a)-(d)). Although we are unable todetermine what fraction of the repressor is con-verted to the alternative conformation at theseDNA concentrations, this ®nding suggests that thealternative conformations of repressor persist evenif the protein is not in direct contact with DNA.Hence even brief collisions between 434 repressorand DNA appear to induce these conformationalchanges. This ®nding also helps to explain whyDNA to which repressor does not appear to bindspeci®cally, has an effect on repressor confor-mation. Although we have not yet determined thelifetime of the DNA-induced conformations, thetime-resolved anisotropy measurements show thatin the case of the non-speci®c DNA, the protein-DNA contact that affects repressor structure has alifetime of <�3 ns. Hence our data indicate thatDNA acts in a ``catalytic'' fashion to induce asteady-state amount of an alternative repressorconformation.

Although the DNA-induced changes in the con-formation and oligomerization state of 434 repres-sor do increase protein-DNA complex stability,there is no evidence that its DNA binding domainis either completely or partially unfolded in theabsence of DNA, when present either as a frag-ment or in the intact protein (Carlson & Koudelka,1994; Mondragon et al., 1989). Hence the confor-mational changes in 434 repressor that we observeupon DNA addition are likely to be occurring else-where in the protein. This suggestion does notimply that a rearrangement of the N-terminaldimer interface does not occur upon repressordimer formation or DNA binding. In fact, altera-tions of the structure of the N-terminal dimer inter-face play a role in determining the DNA bindingspeci®city of 434 repressor. Similar observationshave been made in the case of the related l repres-sor (Huang et al., 1997).


Several studies of the related l repressor suggestthat the C-terminal domain of that protein under-goes conformational changes upon concentration-induced oligomer formation and/or DNA binding(Sada et al., 1992). Nonetheless, we suggest thatmuch of the DNA-induced conformational changesseen in the case of 434 repressor, occurs in the seg-ment of the repressor polypeptide chain that linksthe N-terminal and C-terminal domains. Severallines of evidence support this suggestion. In theabsence of DNA, this region is highly susceptibleto proteolytic attack, indicating that this region isexposed to solvent and ¯exible under these con-ditions (Anderson et al., 1984). However, sincechanges in the C-terminal domain dimer interfaceaffect protein-DNA interactions mediated by theN-terminal domain (Donner & Koudelka, 1998),the linker region that transmits this information islikely to be folded against both domains in pro-tein-DNA complexes to facilitate this communi-cation. Second, the overall helical content of 434repressor increases in the presence of speci®c DNA(G.B.K. & M.C., unpublished results). Since theN-terminal and C-terminal domains are indepen-dently and stably folded in the absence of DNA(Carlson & Koudelka, 1994; Neri et al., 1992), wesuggest that this increased helicity in 434 repressoroccurs in the linker. Finally, we have observed thatupon OR1 addition, tryptophan residues other thanW119 undergo changes, becoming accessible toquencher. Two of these tryptophan residues (W58and W186) are buried deep within the hydro-phobic core of the repressor and therefore are unli-kely to change their accessibility to quencher. Theremaining two tryptophan residues (W91 andW106) reside in the linker region.

We are unsure as to the mechanism by whichnon-speci®c and/or speci®c DNA stimulate 434repressor dimerization and DNA binding. How-ever, it is interesting to note that intramolecularrearrangements of protein domains to regulateDNA binding activity and/or transcriptional acti-vation is a recurring theme in both prokaryotesand eukaryotes. For example, both the DNA bind-ing and ability of the c-Myb protein to interactwith the cellular transcriptional machinery is con-troled by intramolecular interactions that mask thepotential c-myb-DNA and c-myb-transcriptionalregulatory regions. Point mutations that eliminatethese intramolecular contacts enhance myb's onco-genic activity via increased DNA binding and tran-scriptional activation abilities (Dash et al., 1996;Leverson & Ness, 1998). The ability of s70, thespeci®city enhancing factor of E. coli RNA poly-merase, is inhibited by an intramolecular inter-action that masks the binding domain of theprotein (Dombroski et al., 1993). This inhibition canbe relieved by association of the s70 subunit withcore RNA polymerase or deletion of the ``masking''domain. Hence an attractive mechanism by whichDNA may enhance the activity of 434 repressor isthe release of an inhibitory intramolecular contact.

Virtually all the studies of the effects of DNA onprotein conformational state have concentrated onconformational changes that occur as the proteingoes from the free to the bound state on speci®cDNA. However, in many cases these proteins arethought to be able to interact with non-speci®cDNA both in vivo and in vitro. The results we showhere indicate that interaction with non-speci®cDNA causes 434 repressor to undergo a confor-mational change. More importantly, this non-speci®c-DNA induced state alters repressor'sfunctional characteristics by increasing its DNAbinding af®nity. We expect that 434 repressor isnot unique in having its conformation affected bynon-speci®c DNA and that these effects may havean important role in mediating site-speci®c recog-nition by these other proteins.

Experimental Procedures

Materials

Acrylamide, ammonium sulfate, phenylmethyl sul-fonyl ¯uoride (PMSF), isopropyl-b-D-thiogalactoside(IPTG), polyethylenimine (PEI), yeast tRNA and heparinwere purchased from Sigma Chemical Co. (St. Louis,MO). Puri®ed aldolase was obtained from Pharmacia(Sweden). Protein puri®cation was performed using pre-packed ion-exchange carboxymethyl Econo-Pac Car-tridges (Bio-Rad, Hercules, CA). Unlabeled and ¯uores-cently labeled oligonucleotides were synthesized andHPLC puri®ed by Integrated DNA Technologies, Inc.(Coralville, IA.). The sequences of the 20 bp oligonucleo-tide OR1 used are 50TATACAAGAAAGTTTGTACT30 forthe top strand and 50AAGTACAAACTTTCTTGTAT30for the bottom strand. For OR2 oligonucleotide thesequences are 50TATACAAGATACATTGTATG30 forthe top strand and 50CATACAATGTATCTTGTATA30for the bottom strand. For non-speci®c DNA we haveused the 18 base-pair self-complementary sequence50ATTTAAGATATCTTAAAT30. In the experimentsutilizing ¯uorescein-labeled oligonucleotides, the ¯uor-escein group was introduced at the 50 end of the bottomstrand using a 50-¯uorescein phosphoramidite thatattaches the dye 6-carboxy¯uorescein derivative via a C6straight chain linker. In all cases, double-stranded DNAwas formed by heating equimolar mixtures of the twostrands in buffer A (10 mM Tris-HCl (pH 7.5), 50 mMNaCl, 1 mM EDTA) at 85 �C for ten minutes followed byslow cooling to room temperature.

Isolation of wild-type and mutant 434 repressor

The proteins were expressed in E. coli strain X90that bears one of the plasmids pGEM434Rwt,pGEM434P22E or pGEM434RAla119 (Donner et al., 1997;Carlson & Koudelka, 1994). The proteins were puri®edas described (Donner et al., 1997; Carlson & Koudelka,1994).

Steady-state fluorescence measurements

The protein intrinsic ¯uorescence emission spectrawere obtained at the SUNY-Buffalo Chemistry SmallInstrument Facility using an SLM-8100 spectro¯uorom-eter equipped with a Xenon arc lamp. Unless speci®ed,all measurements were performed at 25 �C, maintained


by a circulating temperature bath. The excitation wave-length was 280 nm, using a monochromator band passof 8 nm. Emission spectra were recorded between 300and 400 nm using 1 nm steps and two second inte-gration times. For emission, the spectral band pass was32 nm with a 310 nm long pass ®lter to minimize waterRaman peak. Protein samples were diluted into ice-coldbuffer A that had been ®ltered through 0.45 mM sterile®lter ten minutes prior to recording of spectra. Incu-bations with DNA, yeast tRNA, heparin or acrylamidewere done in 0.750 ml quartz cuvettes for ®ve minutes at25 �C with mixing. Each spectrum was background cor-rected using a buffer blank and further subjected tophotobleaching (5-15 %), absorbance and dilution correc-tions relative to a control sample. Photobleaching wasreversible, indicating an absence of photoproducts. Spec-tra were corrected and ¯uorescence emission intensityvalues were standardized to the emission of a rhodaminestandard (Freifelder, 1982). If sample absorption at theexcitation wavelength exceeded 0.001, inner ®lter correc-tions were also applied according to Lakowicz 1986).

Measurement of DNA and proteinfluorescence anisotropy

To determine the relative ratios of the rotatingvolumes of wild-type versus mutant repressor 434RP22E,protein ¯uorescence anisotropy measurements weremade at 5 �C, 15 �C, 25 �C and 37 �C, in buffer A alone orsupplemented with glycerol at ®nal concentrations of5 %, 10 % and 20 % (v/v). These measurements weredone with the excitation wavelength set at either 280 nmor 295 nm and the emission wavelength at 350 nm. Thedata obtained from ten determinations at each of the twoexcitation wavelengths were weight averaged with thevalues obtained for speci®c excitation of tryptophan(295 nm) being weighted 2:1 over the value obtained at280 nm. For experiments that measured the effect ofDNA on repressor anisotropy, the excitation wavelengthwas set either at 295 nm measuring tryptophan anisotro-py and emission wavelength at 350 nm, or in the case ofthe ¯uorescein-labeled oligonucleotides, the excitationwavelength was 492 nm and emission wavelength wasset at 520 nm. All ¯uorescence anisotropy measurementswere background corrected for each component, withdata collected at two second integration time.

Analysis of fluorescence data

The values of relative emission intensities at 346 nmobtained from corrected spectra during DNA titrationswere divided by the corresponding value of the spec-trum of protein before titration. The obtained fractionalvalues were plotted against DNA concentration. Thenumerical values were further analyzed by ®tting to anequation describing a hyperbola using a non-linear least-squares statistical ®t.

To quantify the participation of the W119 residue inthe spectrum of wild-type 434 repressor in the presenceor absence of DNA, we compared the integrated area ofthe emission spectra of wild-type 434 repressor with thatof the W119A mutant under same conditions. Since thesevalues account for the total emission intensity of themeasured protein intrinsic ¯uorescence, the contributionof W119 to the wild-type repressor's emission spectrumcan be calculated from the difference between theseareas divided by the integrated area of the emissionspectra of wild-type 434 repressor.

To quantify the effects of acrylamide on ¯uorescence,the area underneath each corrected spectrum was calcu-lated using numerical integration. The Fo/F values deter-mined from these calculations were plotted againstacrylamide concentration and the quenching constantswere extracted from these data by either linear extrapol-ation or the Stern-Volmer equation as described byEftink and Ghiron (1976).

To calculate the ratios of relative volumes of the rotat-ing units of wild-type versus 434RP22E mutant repressor,the limiting anisotropies were obtained from isothermalpolarization plots. In these plots, the experimentallydetermined inverse anisotropy values (1/r) were plottedagainst T/Z (the ratio between temperature andviscosity) and ®tted to a linear function using a least-squares statistical ®t. The ratios have been calculatedcombining the relation de®ning the rotational correlationtime (Lakowicz, 1986) with the Perrin equation (Perrin,1926). The relation used to calculate the ratios betweenthe two relative volumes corresponding to the wild-type(V1) and mutant (V2) repressor is:

V1=V2 � r1�ro2 ÿ r2�r2�ro1 ÿ r1� �1�

where ro1 and ro2 are the limiting anisotropy values ofthe wild-type and mutant repressor, r1 and r2 are theexperimentally determined anisotropy of wild-type andmutant repressor, respectively. This calculation assumesthat the average excited-state ¯uorescence lifetimes ofthe two proteins have similar values.

Time-resolved fluorescence measurements offluorescein-labeled DNA using frequencydomain spectroscopy

All measurements were performed using a SLM 48000MHF spectro¯uorometer with an argon-ion laser (Coher-ent, Innova, Model 400) as the excitation source. Time-resolved intensity and anisotropy decay data wereacquired by exciting at 476 nm. An interference ®lter(Oriel) was placed in the excitation beam path to elimin-ate extraneous laser plasma discharge from reaching theemission detector. Emission was monitored in the tra-ditional 90 � geometry through a 515 nm long pass ®lter(Oriel). Magic angle polarization was used for allexcited-state intensity decay experiments (Spencer &Weber, 1970). Fluorescein in an aqueous NaOH solution(pH 11.0) served as the reference lifetime standard; itslifetime is 4.00 ns. For all experiments, the Pockels cellwas operated at a repetition rate of 5 MHz. Individualdata sets were collected for 60 to 90 s over a frequencyrange of 5 to 200 MHz (40 frequencies) on each sample.Between ten and 30 individual data sets were averagedfor each sample. All multi-frequency phase-modulationdata were analyzed using a global analysis method(Globals Unlimited) (Beechem et al., 1991) with truefrequency-weighted uncertainties. The contribution fromsample blanks to the total emission was always less than0.5 %. The sample temperature was controlled to within0.1 deg. C with a temperature circulator (Lauda modelRL-6).

Gel mobility shift assays

The effect of total DNA concentration on repressoraf®nity was measured by gel mobility shift assay. Theseexperiments were performed essentially as described


(Donner & Koudelka, 1998). A pUC18 vector bearing the434 OR1 site (Bell & Koudelka, 1993) was digested withEcoRI and HindIII restriction endonucleases and the76 bp fragment containing the binding site was isolatedfrom agarose gels. Following puri®cation from DEAEpaper (Schleicher and Schuell, Keene, NH), the frag-ments were labeled at the 30 ends by incubating with2 ml of [a-32P]dATP (3000Ci/mmol) (New EnglandNuclear Boston, MA) in the presence of Klenow frag-ment (Epicentre, Inc. Madison, WI). A ®xed concen-tration of the labeled DNA was incubated with theindicated concentrations of repressor protein and variousconcentrations of unlabeled oligonucleotide in buffer Asupplemented with 10 mM IPTG and 5 % (v/v) glycerolfor ten minutes at 37 �C. The reaction products wereresolved on 5 % (w/v) polyacrylamide gels in 0.5 � TBE(45 mM Tris (pH 8.9), 45 mM borate, 0.5 mM EDTA) atroom temperature. The dried gels were analyzed using aPhosphor-Imager (Molecular Dynamics).

Acknowledgments

The authors thank the members of their laboratoriesfor helpful discussions during the course of this investi-gation. We also acknowledge discussions with Dr ScottNess. We thank the referees who suggested experimentsthat validated our conclusions. This work was supportedby PHS grant GM42138 to G.B.K.

References

Aggarwal, A., Rodgers, D. W., Drottar, M., Ptashne, M.& Harrison, S. C. (1988). Recognition of a DNAoperator by the repressor of phage 434: a view athigh resolution. Science, 242, 899-907.

Albright, R. A. & Matthews, B. W. (1998). Crystal struc-ture of lambda-Cro bound to a consensus operatorat 3.0 AÊ resolution. J. Mol. Biol. 280, 137-151.

Anderson, J. E., Ptashne, M. & Harrison, S. C. (1984).Co-crystals of the DNA-binding domain of phage434 repressor and a synthetic 434 operator. Proc.Natl Acad. Sci. USA, 81, 1307-1311.

Anderson, J. E., Harrison, S. C. & Ptashne, M. (1987).A phage repressor-operator complex at 7 AÊ

resolution. Nature, 326, 888-891.Anderson, W. F., Ohlendorf, D. H., Takeda, Y. &

Matthews, B. W. (1981). Structure of the cro repres-sor from bacteriophage lambda and its interactionwith DNA. Nature, 290, 754-758.

Beechem, J. M., Gratton, E., Ameelot, M., Knudsen, J. R.& Brand, L. (1991). In Topics in Fluorescence Spec-troscopy (Lakowicz, J. R., ed.), Plenum Press, NewYork.

Bell, A. C. & Koudelka, G. B. (1993). Operator sequencecontext in¯uences amino acid-base-pair interactionsin 434 repressor-operator complexes. J. Mol. Biol.234, 542-553.

Brennan, R. G., Roderick, S. L., Takeda, Y. & Matthews,B. W. (1990). Protein-DNA conformational changesin the crystal structure of a lambda Cro-operatorcomplex. Proc. Natl Acad. Sci. USA, 87, 8165-8169.

Bushman, F. D. (1993). The bacteriophage 434 rightoperator. Roles of OR1, OR2 and OR3. J. Mol. Biol.230, 28-40.

Carlson, P. A. & Koudelka, G. B. (1994). Expression,puri®cation, and functional characterization of the

carboxyl-terminal domain fragment of bacterio-phage 434 repressor. J. Bacteriol. 176, 6907-6914.

Dash, A. B., Orrico, F. C. & Ness, S. A. (1996). TheEVES motif mediates both intermolecular and intra-molecular regulation of c-Myb. Genes Dev. 10, 1858-1869.

Dombroski, A. J., Walter, W. A. & Gross, C. A. (1993).Amino-terminal amino acids modulate s-factorDNA-binding activity. Genes Dev. 7, 2446-2455.

Donner, A. L. & Koudelka, G. B. (1998). Carboxyl-term-inal domain dimer interface mutant 434 repressorshave altered dimerization and DNA binding speci®-cities. J. Mol. Biol. 283, 931-946.

Donner, A. L., Carlson, P. A. & Koudelka, G. B. (1997).Dimerization speci®city of P22 and 434 repressors isdetermined by multiple polypeptide segments.J. Bacteriol. 179, 1253-1261.

Eftink, M. R. & Ghiron, C. A. (1976). Exposure oftryptophanyl residues in proteins. Quantitativedetermination by ¯uorescence quenching studies.Biochemistry, 15, 672-680.

Freifelder, D. (1982). Fluorescence spectroscopy. InPhysical Biochemistry, pp. 537-572, W. H. Freeman,San Francisco.

Friedman, A. M., Fischmann, T. O. & Steitz, T. A.(1995). Crystal structure of lac repressor core tetra-mer and its implications for DNA looping. Science,268, 1721-1727.

Huang, Y. T., Rusinova, E., Ross, J. B. & Senear, D. F.(1997). An aromatic stacking interaction betweensubunits helps mediate DNA sequence speci®city:operator site discrimination by phage lambda cIrepressor. J. Mol. Biol. 267, 403-417.

Jeltsch, A., Alves, J., Wolfes, H., Maass, G. & Pingoud,A. (1994). Pausing of the restriction endonucleaseEcoRI during linear diffusion on DNA. Biochemistry,33, 10215-10219.

Jeltsch, A., Wenz, C., Stahl, F. & Pingoud, A. (1996). Lin-ear diffusion of the restriction endonuclease EcoRVon DNA is essential for the in vivo function of theenzyme. EMBO J. 15, 5104-5111.

Jen-Jacobson, L., Lesser, D. & Kurpiewski, M. (1986).The enfolding arms of EcoRI endonuclease: role inDNA binding and cleavage. Cell, 45, 619-629.

Johnson, A. D., Meyer, B. J. & Ptashne, M. (1979). Inter-action between DNA-bound repressors governregulation by the lambda repressor. Proc. Natl Acad.Sci. USA, 76, 5061-5065.

Koudelka, G. B. (1991). Bending of synthetic bacterio-phage 434 operators by bacteriophage 434 proteins.Nucl. Acids Res. 19, 4115-4119.

Koudelka, G. B. (1998). Recognition of DNA structureby 434 repressor. Nucl. Acids Res. 26, 669-675.

Koudelka, G. B. & Carlson, P. (1992). DNA twisting andthe effects of non-contacted bases on af®nity of 434operator for 434 repressor. Nature, 355, 89-91.

Koudelka, G. B., Harbury, P. H., Harrison, S. C. &Ptashne, M. (1988). DNA twisting and the af®nityof bacteriophage 434 operator for bacteriophage 434repressor. Proc. Natl Acad. Sci. USA, 85, 4633-4637.

Lakowicz, J. R. (1986). Fluorescence studies of structural¯uctuations in macromolecules as observed by ¯u-orescence spectroscopy in the time, lifetime, and fre-quency domains. Methods Enzymol. 131, 518-567.

Leverson, J. D. & Ness, S. A. (1998). Point mutations inv-Myb disrupt a cyclophilin-catalyzed negativeregulatory mechanism. Mol. Cell, 1, 203-211.

Lewis, M., Chang, G., Horton, N. C., Kercher, M. A.,Pace, H. C., Schumacher, M. A., Brennan, R. G. &


Lu, P. (1996). Crystal structure of the lactose operonrepressor and its complexes with DNA and inducer.Science, 271, 1247-1254.

Mondragon, A., Subbiah, S., Almo, S. C., Drottar, M.& Harrison, S. C. (1989). Structure of the amino-terminal domain of phage 434 repressor at 2.0 AÊ

resolution. J. Mol. Biol. 205, 189-200.Nardone, G., George, J. & Chirikjian, J. G. (1986). Differ-

ences in the kinetic properties of BamHI endo-nuclease and methylase with linear DNAsubstrates. J. Biol. Chem. 261, 12128-12133.

Neri, D., Billeter, M. & WuÈ thrich, K. (1992). Determi-nation of the nuclear magnetic resonance solutionstructure of the DNA-binding domain (residues 1to 69) of the 434 repressor and comparison with theX-ray crystal structure. J. Mol. Biol. 223, 743-767.

Newman, M., Strzelecka, T., Dorner, L. F., Schildkraut,I. & Aggarwal, A. K. (1995). Structure of BamHIendonuclease bound to DNA: partial folding andunfolding on DNA binding. Science, 269, 656-663.

Park, C. S., Wu, F. Y. & Wu, C. W. (1982). Molecularmechanism of promoter selection in gene transcrip-tion. II. Kinetic evidence for promoter search by aone-dimensional diffusion of RNA polymerase mol-ecule along the DNA template. J. Biol. Chem. 257,6950-6956.

Peat, T. S., Frank, E. G., McDonald, J. P., Levine, A. S.,Woodgate, R. & Hendrickson, W. A. (1996). Struc-ture of the UmuD0 protein and its regulation inresponse to DNA damage. Nature, 380, 727-730.

Perrin, F. (1926). The ¯uorescence of solutions. Ann.Phys. 12, 169-274.

Polyakov, A., Severinova, E. & Darst, S. A. (1995).Three-dimensional structure of E. coli core RNApolymerase: promoter binding and elongation con-formations of the enzyme. Cell, 83, 365-373.

Ptashne, M. (1986). A Genetic Switch, Blackwell Press,Palo Alto.

Sada, R., Banik, U., Bandopadhya, S., Mandal, N.,Bhattacharyya, B. & Roy, S. (1992). An operator-induced conformational change in the C-terminal

domain of the lambda repressor. J. Biol. Chem. 267,5862-5867.

Sauer, R. T., Yocum, R. R., Doolittle, R. F., Lewis, M. &Pabo, C. O. (1982). Homology among DNA-bindingproteins suggests use of a conserved supersecond-ary structure. Nature, 298, 447-451.

Simoncsits, A., Chen, J., Percipalle, P., Wang, S., Toro, I.& Pongor, S. (1997). Single-chain repressors contain-ing engineered DNA-binding domains of the phage434 repressor recognize symmetric or asymmetricDNA operators. J. Mol. Biol. 267, 118-131.

Spencer, R. D. & Weber, G. (1970). In¯uence of Brow-nian rotation and energy transfer upon themeasurement of ¯uorescence lifetime. J. Chem. Phys.52, 1654-1663.

Spolar, R. S. & Record, M. T., Jr (1994). Coupling oflocal folding to site-speci®c binding of proteins toDNA. Science, 263, 777-784.

Terry, B. J., Jack, W. E. & Modrich, P. (1985). Facilitateddiffusion during catalysis by EcoRI endonuclease.Non-speci®c interactions in EcoRI catalysis. J. Biol.Chem. 260, 13130-13137.

Wharton, R. P. & Ptashne, M. (1985). Changing thebinding speci®city of a repressor by redesigning ana-helix. Nature, 316, 601-605.

Wharton, R. P., Brown, E. L. & Ptashne, M. (1985). Sub-stituting an a-helix switches the sequence speci®cDNA interactions of a repressor. Cell, 38, 361-369.

Wharton, R. P., Harison, S. C. & Ptashne, M. (1987).A new-speci®city mutant of 434 Repressor thatde®nes an amino acid-base-pair contact. Nature,326, 888-891.

Whipple, F., Kuldell, N. H., Cheatham, L. A. &Hochschild, A. (1994). Speci®city determinants forthe interaction of lambda and P22 repressor dimers.Genes Dev. 8, 1212-1223.

Winter, R. B., Berg, O. G. & von Hippel, P. H. (1981).Diffusion-driven mechanisms of protein transloca-tion on nucleic acids. 3. The Escherichia coli lacrepressor-operator interaction: kinetic measurementsand conclusions. Biochemistry, 20, 6961-6977.

Edited by R. Ebright

(Received 8 June 1999; received in revised form 5 October 1999; accepted 5 October 1999)

Documents

DNA-induced conformational changes in bacteriophage 434 repressor