DNADNA

DNA stands for deoxyribonucleic acidDNA stands for deoxyribonucleic acid

Basically it is the blueprints or genetic code Basically it is the blueprints or genetic code that tells the cell what to do and how to do itthat tells the cell what to do and how to do it

Def: DNA Def: DNA is the nucleic acid that stores and is the nucleic acid that stores and transmits the genetic information from one transmits the genetic information from one generation of an organism to the next. generation of an organism to the next.

What evidence supports the What evidence supports the presence of some sort of presence of some sort of genetic code? genetic code?

Organisms have offspring that look like Organisms have offspring that look like themselvesthemselves

Who discovered DNA?Who discovered DNA?

Gregor Mendel, discovered the idea of a Gregor Mendel, discovered the idea of a passing on of traits from one generation passing on of traits from one generation to the next.to the next.

But is was James Watson and Francis But is was James Watson and Francis Crick who figured out the structure of Crick who figured out the structure of DNA in the 1950’s. DNA in the 1950’s.

DNA Functions: DNA Functions:

1.1. Store informationStore information: which controls the : which controls the development and activities of development and activities of cells/organismscells/organisms

2.2. ReplicationReplication: transmits information to the : transmits information to the next cell/generationnext cell/generation

3.3. MutationsMutations: provides raw material for : provides raw material for evolution.evolution.

What are the components What are the components that make up DNA?that make up DNA?

The parts of a DNA nucleotide are: The parts of a DNA nucleotide are: a 5 carbon sugar -deoxyribosea 5 carbon sugar -deoxyribose a phosphate groupa phosphate group nitrogenous basenitrogenous base

The different nitrogenous bases are:The different nitrogenous bases are: Adenine (A) Adenine (A) Thymine (T)Thymine (T) Guanine (G)Guanine (G) Cytosine (C) Cytosine (C)

Certain Bases go Certain Bases go TogetherTogether This is known as complementary base This is known as complementary base

pairing:pairing: Guanine (G) and Cytosine (C) (three bonds)Guanine (G) and Cytosine (C) (three bonds) Adenine (A) and Thymine (T) (two bonds)Adenine (A) and Thymine (T) (two bonds)

They are held together by HYDROGEN They are held together by HYDROGEN bondsbonds

Only these combination of pairs of bases are Only these combination of pairs of bases are capable of forming bondscapable of forming bonds

Nitrogenous bases:Nitrogenous bases:

The purines: double ringsThe purines: double rings Adenine (A) Adenine (A) Guanine (G)Guanine (G)

The pyrimidines: single ringThe pyrimidines: single ring Thymine (T)Thymine (T) Cytosine (C)Cytosine (C)

Sugar phosphate Sugar phosphate backbone:backbone:

Nucleotides are linked together by Nucleotides are linked together by covalent bonds joining the 3’ carbon of covalent bonds joining the 3’ carbon of one sugar to the 5’ phosphate of the one sugar to the 5’ phosphate of the adjacent sugar.adjacent sugar.

Draw diagram Draw diagram

Each DNA molecule is made Each DNA molecule is made up of two polynucleotide up of two polynucleotide strands arranged in a coiled strands arranged in a coiled double helix.double helix.

What do the structures of What do the structures of DNA look like?DNA look like?

Once the nitrogen Once the nitrogen bases have joined bases have joined together the two together the two strands of DNA are strands of DNA are twisted like two twisted like two strands of rope –strands of rope –forming a forming a Double Double Helix.Helix.

What would the other side What would the other side of this DNA strand look like?of this DNA strand look like?

ATTGTGCCTATGATCAATTGTGCCTATGATCA TAACACGGATACTAGTTAACACGGATACTAGT

GGCTAATGCATGTACGGCTAATGCATGTAC CCGATTACGTACATGCCGATTACGTACATG

DNA REPLICATION:DNA REPLICATION:

Is complexIs complex Extremely rapidExtremely rapid Very accurate, only one in a billion are Very accurate, only one in a billion are

incorrectly paired.incorrectly paired. Requires the cooperation of over a dozen Requires the cooperation of over a dozen

different enzymes.different enzymes.

DNA replicationDNA replication

Is semi-conservative: each double strand Is semi-conservative: each double strand contains an “old strand and a newly contains an “old strand and a newly synthesized strand. synthesized strand.

Result: two DNA double helicies, each Result: two DNA double helicies, each identical to the original one and each identical to the original one and each having one original strand from the having one original strand from the parent DNA and one newly made parent DNA and one newly made complementary strand.complementary strand.

Three steps of DNA Three steps of DNA replication:replication:

P467 in text bookP467 in text book

The three steps of the semi-The three steps of the semi-conservative replication of conservative replication of DNA:DNA:

1.1. UnzippingUnzipping: the DNA double helix : the DNA double helix unwinds, and the two strands of DNA unwinds, and the two strands of DNA separate. DNA helicase helps the separate. DNA helicase helps the Hydrogen bonds to break.Hydrogen bonds to break.

2. 2. Complimentary Base PairingComplimentary Base Pairing: new : new nucleotides move in or pair up with bases nucleotides move in or pair up with bases of each template strand of DNA. These of each template strand of DNA. These new nucleotides are always floating new nucleotides are always floating around within the nucleoplasm. around within the nucleoplasm. DNA polymerase helps with thisDNA polymerase helps with this

The three steps of the semi-The three steps of the semi-conservative replication of conservative replication of DNA:DNA:

3.3. Joining of adjacent nucleotidesJoining of adjacent nucleotides: after : after DNA polymerase has checked for DNA polymerase has checked for errors, sugar-phosphate bonds form errors, sugar-phosphate bonds form between adjacent nucleotides of the between adjacent nucleotides of the new strand. The new molecule winds new strand. The new molecule winds into a doubles helix.into a doubles helix.

The three steps of the semi-The three steps of the semi-conservative replication of conservative replication of DNA:DNA:

Differentiate between the Differentiate between the roles of helicase and DNA roles of helicase and DNA polymerase in DNA polymerase in DNA replication.replication.

Why does DNA replication Why does DNA replication happen?happen?

So that when a cell divides the resulting So that when a cell divides the resulting daughter cells will both have all of the daughter cells will both have all of the necessary instructions for proper necessary instructions for proper functioning.functioning.

What is the site of DNA What is the site of DNA replication with in the cell?replication with in the cell?

Inside the nucleus.Inside the nucleus.

Rate of DNA repliction:Rate of DNA repliction: 400 bases/sec with 1 error per 109 bases400 bases/sec with 1 error per 109 bases

                                                                   

Check out this amazing video of a Check out this amazing video of a website:website:

http://www.dnai.org/lesson/go/19436

Protein SynthesisProtein Synthesis Can be broken down into the following basics:Can be broken down into the following basics:

DNA DNA → mRNA → mRNA → Protein→ ProteinTranscription Translation

Protein SynthesisProtein Synthesis1.1. UnzippingUnzipping: The DNA double helix unwinds to expose a sequence of : The DNA double helix unwinds to expose a sequence of

nitrogenous bases.nitrogenous bases.

2. 2. Transcription:Transcription: A copy of one of the strands is made. The copy is made of A copy of one of the strands is made. The copy is made of messenger ribonucleic acid (mRNA) which, following transcription, travels out messenger ribonucleic acid (mRNA) which, following transcription, travels out of the nucleus into the main body of the cell, where protein synthesis occurs.of the nucleus into the main body of the cell, where protein synthesis occurs.

3. 3. Translation:Translation: The mRNA couples with the protein synthesis apparatus (the The mRNA couples with the protein synthesis apparatus (the ribosome). Then another type of RNA, known as transfer RNA (tRNA), brings ribosome). Then another type of RNA, known as transfer RNA (tRNA), brings free amino acids to the ribosome (free amino acids to the ribosome (initiationinitiation).).

4.4. The anticodon present on the tRNA recognises the codon present on the The anticodon present on the tRNA recognises the codon present on the mRNA, and the ribosome adds the amino acid to the growing chain of mRNA, and the ribosome adds the amino acid to the growing chain of linked amino acids (polypeptides), cleaving it away from the tRNA linked amino acids (polypeptides), cleaving it away from the tRNA ((elongationelongation). ).

5. As the polypeptide chain grows, it folds to form a protein. This continues 5. As the polypeptide chain grows, it folds to form a protein. This continues until a stop codon is encountered and when this happens, the ribosome until a stop codon is encountered and when this happens, the ribosome releases the polypeptide (releases the polypeptide (terminationtermination).).

Determine the sequence of Determine the sequence of amino acids coded for by a amino acids coded for by a specific DNA sequencespecific DNA sequence

DNA: DNA: CGGTAATTCGACTCGCGGTAATTCGACTCG mRNA:mRNA: Amino Acids: Amino Acids:

mRNA codon vs tRNA anti-mRNA codon vs tRNA anti-codoncodon

An mRNA codon is three bases long An mRNA codon is three bases long An tRNA anti-codon is also three bases An tRNA anti-codon is also three bases

long and contains the complementary long and contains the complementary base pairs for the mRNA codon. base pairs for the mRNA codon.

So if the mRNA codon is AUG, what is the So if the mRNA codon is AUG, what is the tRNA anti-codon? tRNA anti-codon? UACUAC

But what amino acid is brought?But what amino acid is brought? Methionine (met)Methionine (met)

Codons vs anticodonsCodons vs anticodons

DNA: DNA: TACCGGTTAGCGTACCGGTTAGCG mRNA:mRNA:

(codon) (codon) tRNA: tRNA:

(anticodon)(anticodon) Amino acidsAmino acids

Mutations:Mutations:

The source of mutations is DNA.The source of mutations is DNA. Sometimes in the copying of DNA there Sometimes in the copying of DNA there

is a mistake made:is a mistake made: A nucleotide is omitted A nucleotide is omitted A nucleotide is incorrectly paired.A nucleotide is incorrectly paired.

Where the mistake happens determines Where the mistake happens determines the severity of the mutationthe severity of the mutation

Lets look at the following Lets look at the following sentence:sentence:

THECATSATALLDAYTHECATSATALLDAY

What happens if we change one letter?What happens if we change one letter? THEBATSATALLDAYTHEBATSATALLDAY

What happens if we remove one letter?What happens if we remove one letter? HECATSATALLDAYHECATSATALLDAY

IF we use the last DNA strand, but remove the IF we use the last DNA strand, but remove the first nucleotide, how does that effect the first nucleotide, how does that effect the aminoamino

acid sequence?acid sequence? DNA: DNA: GGTAATTCGACTCGGGTAATTCGACTCG mRNA: mRNA: Amino acids: Amino acids:

Recombinant DNA:Recombinant DNA:

Definition: a segment of DNA that is Definition: a segment of DNA that is constructed out of DNA from two constructed out of DNA from two sources.sources.

It allows scientists to insert segments of It allows scientists to insert segments of DNA from one organism into the DNA from one organism into the chromosomes of another.chromosomes of another.

This allows the cell to have a function This allows the cell to have a function that it did not have previously.that it did not have previously.

Examples of recombinant Examples of recombinant DNA in action:DNA in action:

1.1. Insulin, growth hormone, antibodies and Insulin, growth hormone, antibodies and proteins for cancer treatment are mass proteins for cancer treatment are mass produced using bacteria inserted with produced using bacteria inserted with the appropriate DNA.the appropriate DNA.

2.2. Bacteria with DNA inserted to Bacteria with DNA inserted to metabolize oil, to aid in the cleanup of metabolize oil, to aid in the cleanup of oil spills.oil spills.

Examples of recombinant Examples of recombinant DNA in action:DNA in action:

3. Cloning3. Cloning

4. Repairing of genetic errors in humans. 4. Repairing of genetic errors in humans. Removing their cells, repairing and Removing their cells, repairing and reinserting them. reinserting them.

5. Hybrid species of some food crops so 5. Hybrid species of some food crops so that they are resistant to certain diseases that they are resistant to certain diseases and more tolerant to extreme and more tolerant to extreme environment conditions.environment conditions.