DNA analyses of wild boar remains from archaeological sites in Guangxi, China

lable at ScienceDirect

Quaternary International xxx (2014) 1e7

Contents lists avai

Quaternary International

journal homepage: www.elsevier .com/locate/quaint

DNA analyses of wild boar remains from archaeological sites inGuangxi, China

Xin-Dong Hou a, Gui-Lian Sheng a,*, Shuai Yin a, Min Zhu b, Ming Du a, Chang-Zhu Jin b,Xu-Long Lai a

a State Key Laboratory of Biogeology and Environmental Geology, China University of Geosciences, 388 Lumo Road, Hongshan District, Wuhan,Hubei 430074, ChinabKey Laboratory of Vertebrate Evolution and Human Origins of Chinese Academy of Sciences, Institute of Vertebrate Paleontology and Paleoanthropology,Chinese Academy of Sciences, Beijing 100044, China

a r t i c l e i n f o

Article history:Available online xxx

Keywords:Wild boarAncient DNASouthern ChinaLate PleistocenePig domestication

* Corresponding author.E-mail address: [email protected] (G.-L. Sheng)

http://dx.doi.org/10.1016/j.quaint.2014.02.0271040-6182/� 2014 Elsevier Ltd and INQUA. All rights

Please cite this article in press as: Hou, X.-D.International (2014), http://dx.doi.org/10.10

a b s t r a c t

The shift from hunting and gathering to farming is one of the most important transitions in humanhistory. Pig domestication has long been an issue of interest in archaeology and genetics. As the real-timecarrier of the genetic information for dead or extinct animals, ancient DNA provides continuous mo-lecular evidence for tracing the history of domestication. We collected 30 Late Pleistocene wild boarfossils from three caves in Guangxi Zhuang Autonomous Region (Guangxi ZAR), Southern China. Throughthe use of the fragmented ancient DNA sequences and the homologous sequences of both domestic pigsand wild boars across Asia and Europe, we reconstructed phylogenetic trees of the pig family. The resultsshow that most wild boar individuals from Guangxi have a closer phylogenetic relationship to Asian pigsthan European ones. The data provide additional geographic and temporal evidence for a genetic con-tinuity between ancient Chinese wild boars and the domestic pigs. Moreover, we obtained preliminaryevidence for genetic similarity between the ancient wild boar in Guangxi and the European pigs. Wesuggest that further ancient DNA investigation of the Chinese wild boar samples is essential for revealingthe historical process of pig domestication.

� 2014 Elsevier Ltd and INQUA. All rights reserved.

1. Introduction

The transition from hunting and gathering to farming is aninteresting subject among geneticists, archaeologists, and anthro-pologists. Archaeological remains of animals and plants can provideessential documentation for reconstructing the transition in humanprehistory. As sedentary replaced nomadic life after the develop-ment of plant and animal domestication, human beings experi-enced a dramatic expansion of population size, followed by ademographic migration outward from centers of agricultural origin(Bellwood, 2005). To understand the domestication processes thataccompanied the expansion and migration, therefore, is a key toexploring early activities of modern human society.

As one of the earliest domestic livestock, pig (Sus scrofa) hasshared a close relationship with human beings from at least 8500BP and thus is an important proxy of human dispersal. Both

.

reserved.

, et al., DNA analyses of wild b16/j.quaint.2014.02.027

archaeological (Yuan and Flad, 2002; Flad et al., 2007; Fuller et al.,2008; Barton et al., 2009) and molecular (Giuffra et al., 2000;Larson et al., 2005, 2007a, 2007b, 2010; Megens et al., 2008;Larson, 2011; Barnett et al., 2013) approaches have transformedthe study of pig domestication in the past several decades. Based onfossil records from southeastern Anatolia, Ervynck et al. (2001)demonstrated the disproportionate decrease in pig molar toothsize over several millennia as the evidence of in situ domesticationprocess, which representing the earliest independent pig domes-tication event w9000 years ago in the Near East (Conolly et al.,2011). Meanwhile, more recent genetic analysis of both modernand ancient specimens revealed multiple centers of pig domesti-cation across Eurasia (Larson, 2011; Ishigura et al., 2012; Larson andBurger, 2013; Ottoni et al., 2013). Although the phylogenetic treeconstructed by Larson et al. (2005) based on mitochondrial controlregion sequences indicates that wild boar originated from westernisland Southeast Asia (ISEA), the relationship between the domesticpigs and wild boar populations across the Old World suggests thatthere were five more independent pig domestication events incentral Europe, East Asia, India, Southeast Asia, and the Italian

oar remains from archaeological sites in Guangxi, China, Quaternary

mailto:[email protected]

www.sciencedirect.com/science/journal/10406182

http://www.elsevier.com/locate/quaint

http://dx.doi.org/10.1016/j.quaint.2014.02.027



Table 1Sampling information.

Sample number Ages Location

LSD-01e15 13e24 ka Loushan Cave, WumingCMLST-0911-205-01e06 Late Pleistocene Shuangtan Cave, ChongzuoCMLST-0911-304-01, 02 Late Pleistocene Shuangtan Cave, ChongzuoCMLST-0911-328 Late Pleistocene Shuangtan Cave, ChongzuoCMLST-0911-321 Late Pleistocene Shuangtan Cave, ChongzuoCMLST-0911-385-01, 02 Late Pleistocene Shuangtan Cave, ChongzuoCSN-0811-015 30e50 ka Nongbashan Cave, ChongzuoCSN-0811-137 30e50 ka Nongbashan Cave, ChongzuoCSN-0811-201 30e50 ka Nongbashan Cave, Chongzuo

Fig. 1. Geographic sampling localities. The sampling sites in this study are indicated byfilled triangles along the Pearl River. Two areas of early agricultural and domesticevents along the Yellow River (Barton et al., 2009) and Yangtze River (Wu et al., 2007)are indicated by shadow-filled circles.

X.-D. Hou et al. / Quaternary International xxx (2014) 1e72

mainland (Larson et al., 2005). Taking central Europe as an example,although pigs with Near Eastern signatures were found as far westas Paris, all domestic pigs in Europe possessed haplotypes originallyonly found in European wild boar by 3900 B.C. (Ottoni et al., 2013).Moreover, recent analysis of the draft genome sequence of a do-mestic pig revealed a deep phylogenetic split between Europeanand Asian wild boars about 1 million years ago (Groenen et al.,2012), which significantly predates evidence for pig domestica-tion. These results strongly suggest that European pigs were eitherdomesticated independently or more possibly as a result of intro-gression between introduced pigs and indigenous wild boar pop-ulations (Larson et al., 2007a). As to other possible pigdomestication centers outside Near East and Central Europe, eitherno historical evidence for introduction of ISEA wild boar has beenfound, or phylogenetic analysis for indigenous domestic pig pop-ulations identifies a genetic turnover soon after the import ofextraneous domestic stocks (Larson et al., 2007a).

In China, archaeological finds have been used to indicate thatdomestic pigs were prevalent in both northern and southern Chinaat least 8000 BP (Yuan and Flad, 2002; Flad et al., 2007; Luo andZhang, 2008). In Northern China, early agricultural activities ofplanting millet have been established along the Yellow River andInner Mongolia by 8000 BP (Barton et al., 2009; Liu et al., 2009;Bettinger et al., 2010) and animal domestication may have begun2000 years earlier than plant farming (Lu et al., 2009); In SouthernChina, it is interpreted that the beginning of rice cultivation alongthe Yangtze was initiated around 9000e8000 BP (Fuller et al.,2009). Although it is believed that modern Chinese domestic pigsare the direct descendants of the first domestic pigs in this region(Larson et al., 2010), it has been pointed out that a subclade ofcentral Chinese wild boar has not contributed to any of the modernAsian domestic breeds sampled (Larson et al., 2005), which raisesissues concerning the extent to which pig domestication in eachregion of China was independent or connected by dispersal from asingle origin.

Guangxi ZAR is a significant area for tracing the emerging andmigration events of human beings. Fragmentary human remains(two molars and an anterior mandible) over 100 ka have beenexcavated from Zhiren Cave in this region, and identified as theoldest modern human records in East Asia (Jin et al., 2009; Liu et al.,2010). These findings together with other early modern humanremains found in central China have been used to explain theprocesses involved in the establishment of modern humans inEastern Eurasia. For animal domestication, Guangxi is also animportant transitional area between Central China and SoutheastAsia. Modern pig DNA data has demonstrated that the most com-mon modern domestic haplotypes found in Central China are alsothemost common Asian haplotypes found across East Asia. Modernand ancient Central Chinese domestic pigs and wild boars share nogenetic affinities (Larson et al., 2005), indicating very limited geneflow between the domestic stock and the wild populations.

In this study, we used an ancient DNA approach to obtainmitochondrial cytochrome b (cyt b) sequences from the LatePleistocene wild boar specimens of Guangxi to explore the geneticconnection between the wild boar and domestic pig present acrossEurasia, and thus provide additional insights into the process of pigdomestication in Southern China.

2. Material and methods

2.1. Ancient samples

We collected 30 tooth samples of fossil wild boars from threeLate Pleistocene caves in Guangxi ZAR, southern China: 15 samplesfrom Loushan Cave, Wuming County, Nanning municipality

Please cite this article in press as: Hou, X.-D., et al., DNA analyses of wild bInternational (2014), http://dx.doi.org/10.1016/j.quaint.2014.02.027

(23�1405300N, 108�2205100E); 3 samples from Nongbashan Cave inChongzuo municipality (22�1501400N, 107�3102200E); and 12 samplesfrom Shuangtan Cave, Mulan Mountain in Chongzuo (22�1702200N,107�3004900E) (Fig. 1, Table 1). Uranium-Series-Nonequilibriumdates on samples in Loushan Cave and Nongbashan Cave are 13e24 ka and 30e50 ka, respectively. Samples in Shuangtan Cave wereassociated with Homo sapiens, Elephas maximus, Megatapirusaugustus, and Gigantopithecus blacki, which indicated that thespecimens are Late Pleistocene. Prior to DNA analyses, the sampleshad been stored in closed, dry containers at room temperaturewithout any chemical treatment.

2.2. Ancient DNA extraction and amplification

Ancient DNA extractions and PCR reactions were carried out inWuhan in a laboratory dedicated to ancient DNA research usingstandard contamination precautions (Gilbert et al., 2005). Weextracted ancient DNA from 250 to 345 mg of teeth powderfollowing the methods of Rohland and Hofreiter (2007). We


X.-D. Hou et al. / Quaternary International xxx (2014) 1e7 3

designed 10 overlapping primer pairs, aiming to generate an 1140bp long fragment of cyt b gene in the mitochondrial genome(Table 2). PCR amplifications were set up in 20 mL volumes using atwo-step multiplex approach (Rompler et al., 2006). Reagent con-centrations and cycling conditions were as described in Rompleret al. (2006). We separated the 10 primer pairs into two non-overlapping sets (indicated in Table 2). Each set including multi-ple primer pairs was used for multiplex PCR in the first step. Then,each primer pair was used individually in singleplex PCRs with thecorresponding multiplex PCR product as a template in the secondstep. The annealing temperatures were set at 51 �C in both steps.

Table 2PCR primers for wild boar mitochondrial cytochrome b gene.

Primer name Primer sequence Amplicon size (in/excluding primers) Multiplex set Positive PCR results in specimens

PF1 GGAGCTACGGTCATCACAAA 135/95 bp 1 /PR1 TGGCAGGATAAAGTGAAAGGPF2 ACGATTCTTCGCCTTTCACT 108/68 bp 2 /PR2 GAGATTCCGGTAGGGTTGTTPF4 GAAACATGAAACATTGGAGTAGTCC 145/97 bp 1 /PR4 CTGTTCCGATATAAGGGATAGCTPF5 TCGCTACCTACATGCAAACGG 145/99 bp 2 CMLST-0911-205-01PR5 GGCTGTTGCTATAACGGTAAATAGTPC1 GCTACGGTCATCACAAATCTAC 132/90 bp 1 /PC2 TGGCAGGATAAAGTGAAAGGPC3 ATTCTTCGCCTTTCACTTTATC 100/61 bp 2 /PC4 TCCGGTAGGGTTGTTGGPC5 GCATCTGCCTAATCTTGCA 130/90 bp 1 LSD-05, 07; CSN-0811-137, 201; CMLST-0911-321PC6 TAGCGAATAACTCATCCGTAAPC7 GAGACCCAGACAACTACACCC 103/61 bp 2 /PC8 GGAATTGAACGTAGGATAGCGPC9 TATCGGAACAGACCTCGTAGA 109/70 bp 1 CSN-0811-015PC10 GGCGGTAATGATGAATGGPC17 TTACCGTTATAGCAACAGCCTTCAT 119/69 bp 2 LSD-07; CSN-0811-015, 201PC18 GAGGTCTGTTCCGATATAAGGGATA

PCR products were purified using the QIAEX II Gel Extraction Kit(Qiagen, Germany) and cloned into the pMD18-T vector (Takara,Japan) following the supplier’s instructions. The recombinantplasmids were transformed into competent Escherichia coli DH5a.White transformants obtained from LB plates containing Amp(0.1 mg/mL), X-Gal (0.04 mg/mL) and IPTG (0.024 mg/mL) werescreened by PCR with the M13 primer pair. For each fragment, aminimum of eight clones, four from each of two independent pri-mary amplifications, were sequenced at GenScript (Nanjing) Co.,Ltd. using an ABI 3700 sequencer following the manufacturer’sinstructions. When consistent differences were found between thetwo independent amplifications, due to sequence errors resultingfrom template damage, a third amplification was performed todetermine which sequence was reproducible (Hofreiter et al.,2001). All newly obtained fragments were independently repli-cated by different persons under blind testing (Yang et al., 1997).

2.3. Sequence alignments and phylogenetic analyses

Sequence alignments were carried out using the softwarepackage Geneious 6.1.6 (Drummond et al., 2013) and the assemblieswere checked manually. A total number of 64 cyt b homologoussequences, which includes 25 wild boar and 39 domestic pig se-quences from China, Japan, and Europe were drawn from GenBank(Shown in Table S1) for phylogenetic analyses.

As only short fragments of mitochondrial genomewere amplifiedfrom the specimens, homologous DNA sequences drawn from Gen-Bank were truncated to obtain equivalent sequence lengths. Conse-quently, we initiated phylogenetic analyses using different truncatedfragments of the 64 homologous sequences according to the


following 4 datasets: i) a first dataset of 90 bp sequences obtainedfrom 5 specimens (LSD-05, 07; CSN-0811-137, 201; CMLST-0911-321), for which the primer pair PC5/6 has been successfully applied;ii) a second dataset of 159 bp that includes one Loushan Cave sample(LSD-07) and one Nongbashan Cave specimens (CSN-0811-201) inwhich the primer pairs PC5/6 and PC17/18 both worked; iii) a thirddataset of 139 bp that includes 1 specimens from Nongbashan Cave(CSN-0811-015), inwhich theprimerpairs of PC9/10andPC17/18bothhave yielded positive amplification results; and iv) a fourth dataset of99bpthat includes a sample fromShuangtanCave (CMLST-0911-205-01), in which the primer pair of PF5/R6 worked. We performed

phylogenetic analyses based on these datasets to investigate the re-lationships between the ancientwild boar specimens in Guangxi andthe extant wild boar and domestic pigs in other Eurasian sites.

We first compared the sequence variation within each datasetsto investigate sequence variation among different individuals. Wethen constructed phylogenetic trees using different datasets toestablish the position of the ancient wild boar specimens collectedin Guangxi in all wild boar and domestic pig populations, usingGeneious Tree Builder to build the trees with HKY as the geneticdistance model and Neighbor-Joining as the tree build method(Drummond et al., 2013).

3. Results

3.1. PCR amplifications

Two of 15 Loushan Cave samples, 3 Nongbashan Cave samples,and 2 of 12 Shuangtan Cave samples yielded positive and repro-ducible amplification results, with a total of 7 ancient DNA con-taining samples (Table 2, Fig. 2). The size range of the fragments is69e99 bp, excluding primers. However, the sequences were toohighly fragmented to generate any overlapped fragments in anysamples. As a result, we reconstructed three longer contigs withgaps: one 139 bp contig from one sample collected from Non-gbashan Cave (CSN-0811-015), which contains fragments fromnucleotide position 387e455 (69 bp) and 486e555 (70 bp); twohomolougs 159 bp contigs from different samples: a samplecollected from Nongbashan Cave (CSN-0811-201) and a samplefrom Loushan Cave (LSD-07), which contains fragments fromnucleotide position 132e221 (90 bp) and 387e455 (69 bp).


Fig. 2. Successful Amplified PCR fragments of the Late Pleistocene wild boar samples. The complete cyt b gene is 1140 bp. Figures above the dotted line indicate beginning andending nucleotide position in the 1140 bp sequence. Figures below the dotted line show the length of each fragments.


3.2. Sequence variations in Pleistocene wild boar and extant pigs

It might not be appropriate to compare the sequence variationsof the ancient wild boar to the extant pigs based on the highlyfragmented and discontinuous ancient DNA sequences. However,the attempt gave us the opportunity to look for the differences inbase components in all datasets. Concentrating on the 64 complete1140 bp cyt b sequences drawn from GenBank, a total number of 40polymorphic sites have been detected. The difference betweendifferent geographic sites (i.e., European or Asian) is more obviousthan the difference between different species (i.e., wild boar ordomestic pig). When taking the newly obtained ancient wild boarsequences into account, there are 10 polymorphic sites across thefour fragments shown in Fig. 2.

3.3. Phylogenetic trees of Eurasia wild boar and domestic pig

We reconstructed four phylogenetic trees using the fourdifferent datasets (Fig. 3). The general structure of the trees aresimilar to that derived from previous studies (Larson et al., 2005,2007a), where the pigs form a geographic pattern rather thankeening on species difference. In three out of four trees (i, ii, and ivin Fig. 3), the specimens fromGuangxi show a closer relationship tothe extant Chinese/Japanese wild boar/domestic pigs than to theEuropean ones, with bootstrap probabilities of 63%e84%. However,another tree (iii in Fig. 3) is not conformable with this result, as theGuangxi individual and the European pigs cluster together as amonophyletic clade, with bootstrap probabilities of 63%, sister to aclade with both extant Chinese and Japanese pigs.

4. Discussion

4.1. Authenticity of the ancient Chinese wild boar

Contamination and DNA damage are both unlikely to haveaffected the results of this study for the following reasons. Firstly,we carried out both extraction and PCR blanks throughout thestudy, and the results were consistently negative, which meansthere was no contamination from the reagents or environment.Secondly, we amplified the fragments by several overlapping PCRs.No mosaic haplotypes occurred in the sequences, which suggeststhere was no cross-contamination. Thirdly, the sequences wereobtained from multiple extractions, amplifications, and colonysequencing. For those amino acid positions that differ betweendifferent amplifications, a third amplification was performed todetermine which sequence was reproducible, further supportingtheir authenticity. Lastly, all of the fragments were independently


replicated by different persons under blind testing, yielding thesame sequencing results.

4.2. Ancient DNA preservation in Southern China

In this study, due to the poor preservation of the molecules, theretrieval of ancient DNA sequences by PCR was progressivelydifficult in terms of multiple attempts of extraction and amplifi-cation. We targeted the complete cyt b gene by 10 overlappingprimer pairs, but only 4 pairs were amplified for the sampledspecimens, despite multiple attempts. Moreover, we obtainedpositive and reproducible amplification results from only 7 out of30 samples, and the sequences were highly fragmented (Fig. 2).

Additionally, we performed ancient DNA extract of spotted hy-ena specimens, which were associated with the wild boar samplescollected from Loushan Cave, together with the spotted hyenasamples collected from northern China (AMS-dated at35.52� 0.23 ka BP). The results show that no ancient DNA has beenamplified from Guangxi spotted hyena remains, whereas 713 bp ofcyt b sequencewas obtained from several northern Chinese spottedhyena samples (Sheng et al., 2013). We assume that the relativelywarm and humid climate and acidic soil environment in southernChina are the main reasons for the poor preservation of ancientDNA in these wild boar specimens (Mitchell et al., 2005). However,highly fragmented as these obtained sequences and low bootstrapvalues (63%e84%) are for the phylogenetic branches, the phyloge-netic trees reconstructed in this study reflected a similar structureof the pig family as previous studies based on longer sequences,which indicates the phylogenetic significance of our newly ob-tained ancient sequences.

4.3. Pig domestication in Southern China

Archaeologists prefer to describe the pig domestication area inChina as two main regions, corresponding to the Yellow Riverdrainage basin of northern China and the Yangtze River drainagebasin of southern China (Fig.1) (Wu et al., 2007; Barton et al., 2009).Domestic pig remains have been found in both regions, at theearliest Jiahu archaeological site (9.0e7.8 ka BP) in the north andKuahuqiao archaeological site (8.0e7.0 ka BP) in the south (Luo andZhang, 2008). Besides this archaeological evidence, Larson et al.(2010) and Wang et al. (2012) provided molecular evidence of pigdomestication events by analysing ancient domestic pig samples(9.0e3.1 ka BP) collected from the Yellow River Valley. However,definitive conclusions have not been drawn regarding the specificgeographic origins of pig domestication in China. More molecularstudies on ancient wild boar specimens earlier than 10 ka BP, i.e.,


Fig. 3. Phylogenetic UPGMA trees for the Late Pleistocene wild boar and the extant pigs. i) 90 bp dataset; ii) 159 bp dataset; iii) 139 bp dataset; iv) 99 bp dataset. Numbers oninternal branches are bootstrap values derived from 1000 replications.


dates before the domestication events, are essential for recon-structing connections between wild boars and domestic pigs.

Here, we present the ancient DNA analyses of the wild boarspecimens from the middle Pearl River drainage basin, where is atransition zone area of the two suggested centers (D2 for East Asiaand D5 for Southeast Asia) of pig domestication (Larson et al.,2005). As the Uranium-Series-Nonequilibrium dating results andthe associated mammal fossils show, the dates of specimens in thisstudy (older than 13 ka) were at least 3000 years earlier than thesuggested date of pig domestication (Giuffra et al., 2000; Yuan andFlad, 2002). Importantly, the oldest modern human fossils havebeen found at Zhiren Cave in South China (Liu et al., 2010), whichmeans a long human evolutionary and living history in this region.It was possible for the ancient human beings in the Pearl Riverdrainage basin to master the skills of animal domestication andspread them into nearby areas. The phylogenetic trees (Fig. 3)demonstrate that most of the ancient wild boar individuals fromGuangxi are genetically similar to those of the domestic pigs fromAsia in terms of partial mitochondrial sequences. We assume thatthe similarity might be an indication of genetic continuity betweenancient wild boars in this geographic area and Asian domestic pigs.We suggest more ancient wild boar individuals and longer ancientDNA sequences should be explored in this region for tracing pig


domestication history, to provide more evidence for humanevolutionary history in East Asia.

4.4. Cryptic dispersal of Asian wild boar to Europe

One tree in Fig. 3 (iii) shows that the individual from Non-gbashan Cave in Chongzuo municipality is in a clade of wild anddomestic pigs from Europe.We assume that it is an indication of: 1)either introduction of Asian domestic pigs, which are descendantsof the indigenous wild boars, to Europe accompanying humanmigration; 2) or the post-glacial range expansion of the wild boaritself across Asia Minor and then to western Europe.

A conclusion has not been reached as to whether European pigswere domesticated independently or as a result of introgressionbetween introduced pigs and indigenous wild boar populations.However, independent domestication events in Asia have beenconfirmed (Larson et al., 2005, 2010; Luo and Zhang, 2008; Bartonet al., 2009). The likelihood of the first assumption lies in thepossibility for some individuals in particular populations of do-mestic pigs in Asia carrying the genetic information of theirascendent, the indigenous wild boar, were introduced to Europewhen the significant demographic input from the Near East toEurope occurred around 11 ka BP (Dupanloup et al., 2004;



Balaresque et al., 2010). We support the second assumption basedon the following reasons: i) Previous studies indicate that thesteppe ecosystem stretched from central to western Eurasia in themid-Early Pleistocene and provided a habitat for both ungulatesand other carnivores, such as cave lion (Barnett et al., 2009) andspotted hyenas (Sheng et al., 2013); ii) The Balkan region and theAsia Minor were connected by a land bridge during the last glaci-ation (Aksu et al., 1999). Combining these two factors, it is likelythat the ancient Asian wild boar moved westward from centralEurasia and reached the Balkan peninsula, which was a glacialrefugium for many European taxa.

At present, due to the limited sequence number and length, thegenetic contribution of the ancient wild boar from Guangxi to theEuropean pigs seems far short of confirmation. However, the resultprovides a powerful alternative to more traditional morphologicalapproaches to capturing the historical process of domestication inarchaeological remains.

5. Conclusions

Mitochondrial cyt b sequences from Guangxi Late Pleistocenewild boar specimens confirm that there is a genetic continuitybetween ancient wild boars in southern China and Asian domesticpigs. The genetic similarity between ancient Guangxi wild boar andEuropean pigs suggests historic gene flow from southern China toEurope.

Acknowledgements

We thank Prof. Zhonghe Zhou for his suggestion of samplecollection for this study. We are grateful for discussion on samplepreservationwith Dr. YuanWang and chronological assistance fromDr. Yanjun Cai. We appreciate the two reviewers for giving veryhelpful suggestion of improving this manuscript. This research wassupported by 973 Program (No. 2011CB808800), the Program ofChinese Academy of Sciences (KZZD-EW-03), the National NaturalScience Foundation of China (Nos. 40902008, 40972013, 41202017),the Program of China Geological Survey (1212011220519), and theNatural Science Foundation of Hubei (No. 2013045064).

Appendix A. Supplementary data

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.quaint.2014.02.027.

References

Aksu, A.E., Hiscott, R.N., Yasar, D., 1999. Oscillating Quaternary water levels of theMarmara Sea and vigorous outflow into the Aegean Sea from the Marmara SeaeBlack Sea drainage corridor. Marine Geology 153, 275e302.

Balaresque, P., Bowden, G.R., Adams, S.M., Leung, H.Y., King, T.E., Rosser, Z.H.,Goodwin, J., Moisan, J.P., Richard, C., Millward, A., Demaine, A.G., Barbujan, G.,Previdere, C., Wilson, I.J., Tyler-Smith, C., Jobling, M.A., 2010. A predominantlyNeolithic origin for European paternal lineages. PLoS Biology 8, e1000285.http://dx.doi.org/10.1371/journal.pbio.1000285.

Barnett, R., Peters, J., Decorte, R., Waelkens, M., Vanderheyden, N., Ricaut, F.X.,Cakirlar, C., Cevik, O., Hoelzel, A.R., Mashkour, M., Karimlu, A.F., Seno, S.S.,Daujat, J., Brock, F., Pinhasi, R., Hongo, H., Perez-Enciso, M., Rasmussen, M.,Frantz, L., Megens, H.J., Crooijmans, R., Groenen, M., Arbuckle, B., Benecke, N.,Vidarsdottir, U.S., Burger, J., Cucchi, T., Dobney, K., Larson, G., 2013. Pigdomestication and human-mediated dispersal in western Eurasia revealedthrough ancient DNA and geometric morphometrics. Molecular and BiologicalEvolution 30, 824e832.

Barnett, R., Shapiro, B., Barnes, I., Ho, S.Y.W., Burger, J., Yamaguchi, N., Higham, T.F.G.,Wheeler, H.T., Rosendahl, W., Sher, A.V., Sotnikova, M., Kuznetsova, T.,Baryshnikov, G.F., Martin, L.D., Harington, C.R., Burns, J.A., Cooper, A., 2009.Phylogeography of lions (Panthera leo ssp.) reveals three distinct taxa and a latePleistocene reduction in genetic diversity. Molecular Ecology 18, 1668e1677.


Barton, L., Newsome, S.D., Chen, F.-H., Wang, H., Guilderson, T.P., Bettinger, R., 2009.Agricultural origins and the isotopic identity of domestication in northernChina. Proceedings, National Academy of Science USA 106, 5523e5528.

Bellwood, P., 2005. First Farmers: the Origins of Agricultural Societies. Blackwell,Oxford.

Bettinger, R., Barton, L., Morgan, C., 2010. The origins of food production in NorthChina: a different kind of agricultural revolution. Evolutionary Anthropology 19,9e21.

Conolly, J., Colledge, S., Dobney, K., Vigne, J.-D., Peters, J., Stopp, B., Manning, K.,Shennan, S., 2011. Meta-analysis of zooarchaeological data from SWAsia and SEEurope provides insight into the origins and spread of animal husbandry.Journal of Archaeological Science 38, 538e545.

Drummond, A.J., Ashton, B., Buxton, S., Cheung, M., Cooper, A., Duran, C., Field, M.,Heled, J., Kearse, M., Markowitz, S., Moir, R., Stone-Havas, S., Sturrock, S.,Thierer, T., Wilson, A., 2013. Geneious v R6.1 Created by Biomatters. Availablefrom: http://www.geneious.com.

Dupanloup, I., Bertorelle, G., Chikhi, L., Barbujani, G., 2004. Estimating the impact ofprehistoric admixture on the genome of Europeans. Molecular and BiologicalEvolution 21, 1361e1372.

Ervynck, A., Dobney, K., Hongo, H., Meadow, R., 2001. Born free? New evidence forthe status of Sus scrofa at Neolithic Cayönü Tepesi (southeastern Anatolia,Turkey). Paleorient 27, 47e73.

Flad, R.K., Yuan, J., Li, S., 2007. Zooarchaeological evidence for animal domesticationin Northwest China. In: Madsen, D.B., Gao, X., Chen, F.H. (Eds.), Late QuaternaryClimate Change and Human Adaptation in Arid China. Elsevier, Amsterdam.

Fuller, D.Q., Qin, L., Harvey, E., 2008. Past human migrations in East Asia. In: San-chez-Mazas, A., Blench, R., Ross, M.D., Peiros, I., Lin, M. (Eds.), MatchingArchaeology, Linguistics and Genetics. Routledge, London, pp. 40e83.

Fuller, D.Q., Qin, L., Zheng, Y., Zhao, Z., Chen, X., Hosoya, L.A., Sun, G.-P., 2009. Thedomestication process and domestication rate in rice: Spikelet bases from thelower Yangtze. Science 323, 1607e1610.

Gilbert, M.T., Bandelt, H.J., Hofreiter, M., Barnes, I., 2005. Assessing ancient DNAstudies. Trends in Ecology and Evolution 20, 541e544.

Giuffra, E., Kijas, J.M.H., Amarger, V., Carlborg, O., Jeon, J.-T., Andersson, L., 2000. Theorigin of the domestic pig: independent domestication. Genetics 154,1785e1791.

Groenen, M.A., Archibald, A.L., Uenishi, H., Tuggle, C.K., Takeuchi, Y., Rothschild, M.F.,Rogel-Gaillard, C., Park, C., Milan, D., Megens, H.J., Li, S., Larkin, D.M., Kim, H.,Frantz, L.A., Caccamo, M., Ahn, H., Aken, B.L., Anselmo, A., Anthon, C., Auvil, L.,Badaoui, B., Beattie, C.W., Bendixen, C., Berman, D., Blecha, F., Blomberg, J.,Bolund, L., Bosse, M., Botti, S., Bujie, Z., Bystrom, M., Capitanu, B., Carvalho-Silva, D., Chardon, P., Chen, C., Cheng, R., Choi, S.H., Chow, W., Clark, R.C., Clee, C.,Crooijmans, R.P., Dawson, H.D., Dehais, P., De Sapio, F., Dibbits, B., Drou, N.,Du, Z.Q., Eversole, K., Fadista, J., Fairley, S., Faraut, T., Faulkner, G.J., Fowler, K.E.,Fredholm, M., Fritz, E., Gilbert, J.G., Giuffra, E., Gorodkin, J., Griffin, D.K.,Harrow, J.L., Hayward, A., Howe, K., Hu, Z.L., Humphray, S.J., Hunt, T., Hornshoj, H.,Jeon, J.T., Jern, P., Jones,M., Jurka, J., Kanamori, H., Kapetanovic, R., Kim, J., Kim, J.H.,Kim, K.W., Kim, T.H., Larson, G., Lee, K., Lee, K.T., Leggett, R., Lewin, H.A., Li, Y.,Liu,W., Loveland, J.E., Lu, Y., Lunney, J.K.,Ma, J.,Madsen,O.,Mann, K.,Matthews, L.,McLaren, S., Morozumi, T., Murtaugh,M.P., Narayan, J., Nguyen, D.T., Ni, P., Oh, S.J.,Onteru, S., Panitz, F., Park, E.W., Park, H.S., Pascal, G., Paudel, Y., Perez-Enciso, M.,Ramirez-Gonzalez, R., Reecy, J.M., Rodriguez-Zas, S., Rohrer, G.A., Rund, L.,Sang, Y., Schachtschneider, K., Schraiber, J.G., Schwartz, J., Scobie, L., Scott, C.,Searle, S., Servin, B., Southey, B.R., Sperber, G., Stadler, P., Sweedler, J.V., Tafer, H.,Thomsen, B., Wali, R., Wang, J., White, S., Xu, X., Yerle, M., Zhang, G., Zhang, J.,Zhao, S., Rogers, J., Churcher, C., Schook, L.B., 2012. Analyses of pig genomesprovide insight into porcine demography and evolution. Nature 491, 393e398.

Hofreiter, M., Jaenicke, V., Serre, D., Haeseler, A.-von, Pääbo, S., 2001. DNA sequencesfrom multiple amplification reveal artifacts induced by cytocine deamination inancient DNA. Nucleic Acids Research 29 (23), 4793e4799.

Ishigura, N., Inoshima, Y., Sasaki, M., Matsui, A., Hongo, H., Takahashi, R.,Prasetyaningryas, W.E., Djuwita, I., Agungpriyono, S., Supratikno, Kusdiantoro,Labiro, E., Budipitojo, T., Wendo, W.D., Musana, D.K., Saili, T., 2012. mtDNAvariation and human-mediated introgression of indigenous Sus populations onseveral Indonesian islands. Mammal Study 37, 1e10.

Jin, C., Pan, W., Zhang, Y., Cai, Y., Xu, Q., Tang, Z., Wang, W., Wang, Y., Liu, J., Qin, D.,Lawrence Edwards, R., Cheng, H., 2009. The Homo sapiens Cave hominin site ofMulan Mountain, Jiangzhou District, Chongzuo, Guangxi with emphasis on itsage. Chinese Science Bulletin 54, 3848e3856.

Larson, G., 2011. Genetics and domestication. Current Anthropology 52, S485eS495.Larson, G., Albarella, U., Dobney, K., Rowley-Conwy, P., Schibler, J., Tresset, A.,

Vigne, J.D., Edwards, C.J., Schlumbaum, A., Dinu, A., Balacsescu, A., Dolman, G.,Tagliacozzo, A., Manaseryan, N., Miracle, P., Van Wijngaarden-Bakker, L.,Masseti, M., Bradley, D.G., Cooper, A., 2007a. Ancient DNA, pig domestication,and the spread of the Neolithic into Europe. Proceedings, National Academy ofScience USA 104, 15276e15281.

Larson, G., Burger, J., 2013. A population genetics view of animal domestication.Trends in Genetics 29, 197e205.

Larson, G., Cucchi, T., Fujita, M., Matisoo-Smith, E., Robins, J., Anderson, A., Rolett, B.,Spriggs, M., Dolman, G., Kim, T.H., Thuy, N.T., Randi, E., Doherty, M., Due, R.A.,Bollt, R., Djubiantono, T., Griffin, B., Intoh, M., Keane, E., Kirch, P., Li, K.T.,Morwood, M., Pedrina, L.M., Piper, P.J., Rabett, R.J., Shooter, P., Van den Bergh, G.,West, E., Wickler, S., Yuan, J., Cooper, A., Dobney, K., 2007b. Phylogeny andancient DNA of Sus provides insights into neolithic expansion in IslandSoutheast Asia and Oceania. Proceedings, National Academy of Science USA 104,4834e4839.




http://refhub.elsevier.com/S1040-6182(14)00128-1/sref1




http://dx.doi.org/10.1371/journal.pbio.1000285































http://www.geneious.com





















































































Larson, G., Dobney, K., Albarella, U., Fang, M., Matisoo-Smith, E., Robins, J.,Lowden, S., Finlayson, H., Brand, T., Willerslev, E., Rowley-Conwy, P.,Andersson, L., Cooper, A., 2005. Worldwide phylogeography of wild boar revealsmultiple centers of pig domestication. Science 307, 1618e1621.

Larson, G., Liu, R., Zhao, X., Yuan, J., Fuller, D., Barton, L., Dobney, K., Fan, Q., Gu, Z.,Liu, X.H., Luo, Y., Lv, P., Andersson, L., Li, N., 2010. Patterns of East Asian pigdomestication, migration, and turnover revealed by modern and ancient DNA.Proceedings, National Academy of Science USA 107, 7686e7691.

Liu, W., Jin, C.Z., Zhang, Y.Q., Cai, Y.J., Xing, S., Wu, X.J., Cheng, H., Edwards, R.L.,Pan, W.S., Qin, D.G., An, Z.S., Trinkaus, E., Wu, X.Z., 2010. Human remains fromZhirendong, South China, and modern human emergence in East Asia. Pro-ceedings, National Academy of Science USA 107, 19201e19206.

Liu, X.Y., Hunt, H.V., Jones, M.K., 2009. River valleys and foothills: changingarchaeological perceptions of North China’s earliest farms. Antiquity 83, 82e95.

Lu, H.Y., Zhang, J.P., Liu, K.-b., Li, Y.M., Zhou, K.S., Ye, M.L., Zhang, T.Y., Zhang, H.J.,Yang, X.Y., Shen, L.C., Xu, D.K., Li, Q., 2009. Earliest domestication of commonmillet (Panicum miliaceum) in East Asia extended to 10,000 years ago. Pro-ceedings, National Academy of Science USA 106, 7367e7372.

Luo, Y., Zhang, J., 2008. Restudy of the pigs’ bones from the Jiahu site in WuyangCounty, Henen. Kaogu 1, 90e96 (in Chinese).

Megens, H.J., Crooijmans, R.P.M.A., Cristobal, M.S., Hui, X., Li, N., Groenen, M.A.M.,2008. Biodiversity of pig breeds from China and Europe estimated from pooledDNA samples e differences in microsatellite variation between two areas ofdomestication. Genetics Selection Evolution 40, 103e128.

Mitchell, D., Willerslev, E., Hansen, A., 2005. Damage and repair of ancient DNA.Mutation Research 571, 265e276.

Ottoni, C., Flink, L.G., Evin, A., Georg, C., De Cupere, B., Van Neer, W., Bartosiewicz, L.,Linderholm, A., Barnett, R., Peters, J., Decorte, R.,Waelkens,M., Vanderheyden, N.,


Ricaut, F.X., Cakirlar, C., Cevik, O., Hoelzel, A.R., Mashkour, M., Karimlu, A.F.,Seno, S.S., Daujat, J., Brock, F., Pinhasi, R., Hongo, H., Perez-Enciso, M.,Rasmussen, M., Frantz, L., Megens, H.J., Crooijmans, R., Groenen, M., Arbuckle, B.,Benecke, N., Vidarsdottir, U.S., Burger, J., Cucchi, T., Dobney, K., Larson, G., 2013. Pigdomestication and human-mediated dispersal in western Eurasia revealedthrough ancient DNA and geometric morphometrics. Molecular Biological Evo-lution 30, 824e832.

Rohland, N., Hofreiter, M., 2007. Ancient DNA extraction from bones and teeth.Nature Protocols 2, 1756e1762.

Rompler, H., Dear, P.H., Krause, J., Meyer, M., Rohland, N., Schoneberg, T., Spriggs, H.,Stiller, M., Hofreiter, M., 2006. Multiplex amplification of ancient DNA. NatureProtocols 1, 720e728.

Sheng, G.L., Soubrier, J., Liu, J.Y., Werdelin, L., Llamas, B., Vicki, A.T., Tuke, J., Wu, L.J.,Hou, X.D., Chen, Q.J., Lai, X.L., Cooper, A., 2013. Pleistocene Chinese cave hyenasand the recent Eurasian history of the spotted hyena, Crocuta crocuta. MolecularEcology. http://dx.doi.org/10.1111/mec.12576.

Wang, Z., Xiang, H., Yuan, J., Luo, Y., Zhao, X., 2012. Exploring the origin ofdomesticated pigs in the Yellow River area using information from ancient DNA.Chinese Science Bulletin (Chinese Version) 57, 1011e1018.

Wu, G.S., Yao, Y.G., Qu, K.X., Ding, Z.L., Li, H., Palanichamy, M.G., Duan, Z.Y.,Chen, Y.S., Zhang, Y.P., 2007. Population phylogenomic analysis of mitochondrialDNA in wild boars and domestic pigs revealed multiple domestication events inEast Asia. Genome Biology 8, R245.

Yang, H., Glenberg, E.M., Shoshani, J., 1997. A blind testing design for authenticatingancient DNA sequences. Molecular Phylogenetics and Evolution 7, 261e265.

Yuan, J., Flad, R.K., 2002. Pig domestication in ancient China. Antiquity 76, 724e732.






















































http://dx.doi.org/10.1111/mec.12576














Documents

DNA analyses of wild boar remains from archaeological sites in Guangxi, China