Upload
alicia-atkinson
View
215
Download
0
Tags:
Embed Size (px)
Citation preview
Division of Emerging and Transfusion Transmitted Diseases
Bioterrorism Preparedness Initiatives
Hira L. Nakhasi, Ph.D.
Division of Emerging and Transfusion Transmitted Diseases (DETTD) Mission
• Plans and conducts basic and applied research – development, manufacture , pathogenesis and testing
• of Viral (HIV , HTLV, hepatitis), Parasitic , Bacterial , potential BT agents and Transmissible Spongiform Encephalopathy agents or “prions”.
• Ensures the safety of Nation’s blood supply– by reviewing, evaluating and recommending actions
• PLAs, PMAs, INDs, IDEs, 510(k)s for blood screening and diagnostic testing for above mentioned agents.
• Develops and revises FDA Guidance for users of blood screening and diagnostic products.
Division of Emerging and Transfusion Transmitted Diseases (DETTD) Mission
• Performs lot-release testing for approval of investigational tests and of licensed products.
• Develops reference materials for lot-release testing.
• Performs inspections of manufacturers of licensed products, manufacturing facilities.
• Provides expert scientific and technical advice to other Agency and Government components.
• Presents issues related to the safety and efficacy of blood donor screening testing at the Blood Product Advisory Committee and TSE Advisory Committee meetings
DETTD Strategic Plan to Counter Terrorism- policy and regulation
– Donor screening/suitability• Agent exposure (diagnostic or detection)
• Emergency release of blood components
– Product Release• Exemptions
– Testing • Sensitivity and Specificity
Actions to protect the blood supplyDETTD-Policy
– Use of ongoing and proposed vaccine trials to define the period of viremia/ bacteremia after vaccination
– Development of a plan to vaccinate repeat donors
– Consider whether immunosupressed blood recipients should get IG or antitoxins with transfusion
RegulationTest kit performance: Specificity
Clinical
-Donor populations, e.g. intended use for blood and plasma donor testing
Analytical
-Other diseases
-Interference
RegulationTest kit performance: Sensitivity
Clinical– Known positives and high risk populations
– Seroconversion panels
– Variants
Analytical– Endpoint dilutions
– Well characterized reference materials (WHO and CBER standards)
• Reproducibility– multiple sites, operators, kit lots
DETTD Strategic Plan to Counter Terrorism
• Actions to Protect the Blood Supply- Research
– Detection and donor screening• Microarray technology• Nucleic Acid Testing
– Pathogen Removal/Inactivation• Tests for Blood and Blood products• Tests for Plasma Derivatives
– Pathogenesis of BT agents in blood
Actions to protect the blood supplyDETTD Research Plan-short range plan
• I. Devise donor screening methods and tests to assure that affected individuals do not spread bioterrorism agents.
– Adapt previously established nucleic acid based tests to detect BT agents in blood.
– Develop primers and possibly probes for fluorogenic-based PCR for BT agents.
– Collaborate with other agencies to test our reagents in their systems.
– Encourage industry to submit INDs for serologic and nucleic acid based tests for blood screening and diagnosis.
Common Gene Amplification Chemistry
Reverse Primer 5 ’
5 ’3 ’
5 ’ 3 ’
Forward Primer R Q5’
5 ’ 3 ’3 ’ 5 ’
5 ’
5’ QR
5 ’3 ’
Fluorescent reporter and quencher dyescovalently linked to olignucleotide probe
Nucleic Acid Template
Reporter dye released during amplification.
Reverse Primer
5 ’3 ’
Forward Primer
Actions to protect the blood supply-long range plan
• II. Investigate experimental testing methodologies to facilitate evaluation of industry methods.– For detection of several agents simultaneously
– Development of a DNA oligonucleotide microarray for detection of bioweapon agents such as Variola major (Smallpox), Filoviruses, Yersinia pestis (Plague), Francisella tularensis (Tularemia), Bacillus anthracis (Anthrax) in blood and blood product based on their potential for transmission by blood during the asymptomatic incubation period.
Microarray as a Blood/BT Agent Diagnostic ToolHIV TAGGAATACCACATCCCGCAHCV ACCCCCCCTCCCGGGAGAGCLeishmania. CTTTCCCATCGCAACTTCGGTT.cruzi TTTTGGGAGGGGCGTTCAAAPlague CTTTCCGTGAGAAGACATCCB. anthracis GAACTCAAGAAAAAAGCGASmallpox ACGACTCTCCATACGATGAT
Pathogen sequencesfrom databases
AGC
CGG
G CC
T GA
Synthesize probes,Print on microchip
Extract genetic materialfrom blood or blood products
HIV genotyping array (Lipshutz et al., Nat. Gen., 1999)
Amplify and labelthe target with multiple,
pathogen-specific primers
Hybridize to microarray (hypothetical result)
Actions to protect the blood supplyDETTD Research Plan-long range plan
• III. Develop antiviral compounds against viral BT agents capable of neutralizing and preventing viral growth.
• For in-vitro inactivation of BT agents in blood and blood products
Small-moleculeSmall-molecule microarraymicroarray
Binding of Binding of RNA-polymeraseRNA-polymerase
Addition of purifiedAddition of purified RNA-polymeraseRNA-polymerase
Detection of binding by Detection of binding by plasmon resonanceplasmon resonance
Screening of small-molecules that bind to the Screening of small-molecules that bind to the Ebola virus RNA-dependent RNA-polymeraseEbola virus RNA-dependent RNA-polymerase
DETTD Strategic Plan to Counter Terrorism
• Outcome:• Develop laboratory expertise in new technologies
• Utilize this expertise for evaluation of related submissions from industry
• Transfer technology for industry development
• Lot-release testing
• Understand the molecular mechanisms of pathogenesis of BT agents in blood