Diversity and dynamics of lactobacilli populationsduring ripening of RDO Camembert cheese

Segolene Henri-Dubernet, Nathalie Desmasures, and Micheline Gueguen

Abstract: The diversity and dynamics of Lactobacillus populations in traditional raw milk Camembert cheese were moni-tored throughout the manufacturing process in 3 dairies. Culture-dependent analysis was carried out on isolates grown onacidified de Man – Rogosa – Sharpe agar and Lactobacillus anaerobic de Man Rogosa Sharpe agar supplemented withvancomycin and bromocresol green media. The isolates were identified by polymerase chain reaction – temperature gra-dient gel electrophoresis (PCR–TGGE) and (or) species-specific PCR and (or) sequencing, and Lactobacillus paracaseiand Lactobacillus plantarum isolates were characterized by pulsed field gel electrophoresis (PFGE). Milk and cheese weresubjected to culture-independent analysis by PCR–TGGE. Presumed lactobacilli were detected by plate counts throughoutthe ripening process. However, molecular analysis of total DNA and DNA of isolates failed to detect Lactobacillus spp. incertain cases. The dominant species in the 3 dairies was L. paracasei. PFGE analysis revealed 21 different profiles among39 L. paracasei isolates. Lactobacillus plantarum was the second most isolated species, but it occurred nearly exclusivelyin one dairy. The other species isolated were Lactobacillus parabuchneri, Lactobacillus fermentum, Lactobacillus acido-philus, Lactobacillus helveticus, a Lactobacillus psittaci/delbrueckii subsp. bulgaricus/gallinarum/crispatus group, Lactoba-cillus rhamnosus, Lactobacillus delbrueckii subsp. bulgaricus, L. delbrueckii subsp. lactis, Lactobacillus brevis,Lactobacillus kefiri, and Lactobacillus perolens. Lactobacilli diversity at the strain level was high. Dynamics varied amongdairies, and each cheese exhibited a specific picture of species and strains.

Key words: Lactobacillus, bacterial dynamics, TGGE, PFGE, Camembert de Normandie cheese.

Resume : La diversite et les dynamiques des lactobacilles ont ete etudiees dans trois fromageries au cours de la fabricationde Camembert traditionnel au lait cru. Une analyse culture-dependante a ete realisee a partir d’isolats, obtenus sur gelosesMRS acidifiee et LAMVAB, qui ont ete identifies par PCR–TGGE et (ou) PCR espece-specifique et (ou) sequencage. Lesisolats de Lactobacillus paracasei et Lactobacillus plantarum ont ete caracterises par PFGE. Les laits et fromages ont etesoumis a une analyse culture-independante par PCR–TGGE. Bien que des lactobacilles presumes aient ete denombres toutau long de l’affinage, l’analyse moleculaire pratiquee en parallele n’a pas toujours permis de confirmer la presence de lac-tobacilles. L’espece dominante etait L. paracasei, l’analyse PFGE a revele la presence de 21 profils differents parmi 39isolats. Lactobacillus plantarum etait la deuxieme espece la plus representee globalement, bien que detectee presque exclu-sivement dans une seule fromagerie. Les autres especes etaient Lactobacillus parabuchneri, Lactobacillus fermentum, Lac-tobacillus acidophilus, Lactobacillus helveticus, le groupe Lactobacillus psittaci/delbrueckii subsp. bulgaricus/gallinarum/crispatus, Lactobacillus rhamnosus, Lactobacillus delbrueckii subsp. bulgaricus, L. delbrueckii subsp. lactis, Lactobacillusbrevis, Lactobacillus kefiri et Lactobacillus perolens. La diversite au niveau souche des lactobacilles etait importante. Lesdynamiques variaient d’une fromagerie a l’autre, chaque fromage avait une image propre en termes d’especes et de souches.

Mots-cles : Lactobacillus, dynamiques bacteriennes, TGGE, PFGE, Camembert de Normandie.

Introduction

Complex biochemical and microbiological processes oc-cur during the production of Registered Designation of Ori-gin (RDO) Camembert cheese, leading to the development

of the typical flavour. These processes are mediated in partby the starter, which is mostly composed of lactococci andsometimes leuconostocs and (or) pediococci, and by adven-titious nonstarter lactic acid bacteria (NSLAB), which arenot always well identified. Nonstarter lactobacilli are oftenone of the dominant or subdominant microbial groups foundduring cheese ripening and may contribute to the cheese-making process (Beresford et al. 2001). They have beenshown to be an important part of the NSLAB isolated fromCamembert cheese (M. Gueguen, personal communication,2004), but their identification is based only on phenotypicdata that was done about 15 years ago. The genus Lactoba-cillus, which currently contains 113 species and 18 subspe-cies (http://www.bacterio.cict.fr, accessed on 5 July 2007),is the largest genus within the lactic acid bacteria (LAB)group and is subject to continual taxonomic changes. Lacto-bacilli have been examined extensively in some hard

Received 23 July 2007. Revision received 11 December 2007.Accepted 12 December 2007. Published on the NRC ResearchPress Web site at cjm.nrc.ca on 7 March 2008.

S. Henri-Dubernet. Fromageries BEL S.A, DepartementRecherche Appliquee Groupe, 7 bd de l’Industrie, 41100Vendome, France.N. Desmasures1 and M. Gueguen. Laboratoire deMicrobiologie Alimentaire E.A. 3213, IFR 146 ICORE,Universite de Caen Basse-Normandie, Esplanade de la Paix,14032 Caen CEDEX, France.

1Corresponding author (e-mail: nathalie.desmasures@unicaen.fr).

218

Can. J. Microbiol. 54: 218–228 (2008) doi:10.1139/W07-137 # 2008 NRC Canada

cheeses, such as cheddar (Fitzsimons et al. 1999; Dasen etal. 2003), emmental (Demarigny et al. 1996), Comte(Depouilly et al. 2004), and in Italian cheeses (Randazzoet al. 2002; Lazzi et al. 2004). However except for a fewstudies (Ugarte et al. 2006), little is known about lactoba-cilli in soft ripened cheeses, especially in RDO Camembertcheese.

Research on food microflora, which has relied mainly oncultivation until recently, may not always be representativeof the complexity of a food ecosystem. Cultivation and phe-notypic identification methods are not always able to distin-guish among and to quantify lactobacilli species within afood-associated LAB community. Several techniques for theisolation, characterization, and identification of lactobacillispecies have been reviewed (Coeuret et al. 2003). Amongthem, PCR-based methods, such as single-strand conforma-tion polymorphism and denaturing/temperature gradient gelelectrophoresis (D/TGGE) have been developed to analysethe diversity of microorganism communities and to monitortheir evolution within dairy-food ecosystems (Ercolini2004), including raw milk (Lafarge et al. 2004; Callon et al.2007) and traditional cheeses (Randazzo et al. 2002; Erco-lini et al. 2004; Duthoit et al. 2005; Delbes and Montel2005).

The aim of this study was to assess the diversity and dy-namics of Lactobacillus populations during the productionof traditional Camembert cheese (raw milk cheese). Toreach this objective, we chose to use mainly TGGE. One ofthe innovative aspects of this work was to focus on one ge-nus, whereas TGGE has been mainly applied to the study ofglobal bacterial populations. Another innovative aspect waslinked to the fact that this technique was applied both to thedirect examination of total DNA isolated from cheese and tothe analysis of DNA extracted from isolates.

Materials and methods

Milk and cheese samplesWe monitored 3 batches of raw milk Camembert cheese

manufactured in the spring in 3 dairies (A, B, and C) locatedin Normandy, France. Samples were taken from the raw rip-ened milk (day 0) and during the manufacturing process (2cheeses per analysis) at 1, 14, 30, and 60 days. They wereimmediately subjected to analysis.

Analysis based on bacterial isolates

Presumed lactobacilli countsMicroorganisms were extracted from the food matrix as

follows: 20 ± 0.1 g of cheese was transferred to a sterileblender and mixed with 180 mL of 2% tri-sodium acetate(Sigma Aldrich, St Quentin Fallavier, France), pH 7.0, atroom temperature for 1 min at high speed. Ten-fold dilu-tions of the cheeses and the corresponding ripened milkswere made in peptone–saline solution (1 g�L–1 pancreatic ca-sein peptone and 8.5 g�L–1 sodium chloride in distilledwater, pH 7.0) and were then plated on acidified de ManRogosa Sharpe agar (AMRSA) and Lactobacillus anaerobicde Man Rogosa Sharpe agar supplemented with vancomycinand bromocresol green (LAMVAB) (Hartemink et al. 1997),media on which starter and non-starter lactococci were not

able to grow. Incubation was done at 37 8C under anaerobicconditions for 72 h.

Identification and characterization of isolatesFor each batch at each sampling point, 5 isolates from

AMRSA and 5 from LAMVAB media were randomly se-lected, giving rise to a total of 150 presumed lactobacilli.The isolates were stored at –80 8C until further analysis.

All isolates were Gram stained and subjected to the cata-lase test using standard procedures. Genomic DNA was ex-tracted by the phenol–chloroform method (Sambrook et al.1989) and subjected to Lactobacillus-specific PCR (Table 1).Products amplified by Lactobacillus-specific PCR were sub-jected to TGGE for identification to the species level.

In addition, 150 isolates obtained in the same conditionsduring winter batches (Henri-Dubernet et al. 2004) and char-acterized using the same methodology were included in thisstudy, leading to a collection of 300 isolates representing 6batches.

Species-specific PCR (Table 1) was performed for confir-mation purposes for lactobacilli belonging to closely relatedspecies. Sequencing was carried out to identify or to confirmthe identity of representative isolates from winter and springbatches. All Lactobacillus paracasei isolates from dairy Band all Lactobacillus plantarum isolates from dairy C weresubjected to pulsed-field gel electrophoresis (PFGE) analy-sis.

Analysis based on total DNADNA was extracted from ripened milk by using a protocol

involving cell concentration with zirconium hydroxide(Lucore et al. 2000) and by using lytic enzymes (Henri-Dubernet et al. 2004). Total DNA was extracted from20 g of cheese, as described by Ogier et al. (2002).Samples were subjected to Lactobacillus-specific PCR–TGGE.

DNA amplificationPCR was performed in a PTC 200 thermal cycler (MJC

research, Waltham, Massachusetts, USA) using the Lactoba-cillus-specific primers R16.1-GC and LbLMA1-rev as de-scribed previously (Henri-Dubernet et al. 2004) (Table 1).

TGGE analysis and PFGE analysisTGGE was performed as previously described (Henri-

Dubernet et al. 2004) by using the Dcode system (BioRad,Ivry sur Seine, France) and 16 cm � 16 cm � 1 mm gels.Lactobacillus-specific PCR products were subjected toelectrophoresis for 12 h at 90 V with a temperature gra-dient of 56–62 8C (rate of 0.5 8C�h–1) on gels containing8% polyacrylamide, 7 mol�L–1 urea and 1� TAE buffer.PFGE was performed as described by Coeuret et al.(2004). Briefly, bacterial DNA was digested by incubatingplugs for 4 h at 37 8C in 0.2 mL of 1� buffer IV contain-ing 20 U NotI (QBIOgene, Illkirch, France). DNA electro-phoresis was performed on a 1% agarose gel in 1� TBEbuffer in a CHEF DR III apparatus (BioRad) with 0.5�TBE buffer. The gel was run for 18 h at 14 8C using alinear ramp of 2–25 s for L. paracasei subsp. paracaseiand a linear ramp of 5–10 s for L. plantarum at 6 V�cm–1.

Henri-Dubernet et al. 219

# 2008 NRC Canada

Images of the gels were processed using Bionumerics soft-ware version 2.0 (Applied Maths, Kortrijk, Belgium).

Sequencing of the 16S rRNA genePCR products amplified with the primers V3r and V3f

(Table 1) and corresponding to part of the V3 region of 16SrRNA (approximately 250 bp) were sequenced by Invitrogen(Cergy Pontoise, France). Each sequence was compared tosequences available in the GenBank and the GenEmbl data-bases by using the BLASTN program (Altschul et al. 1997).

Results

Presumed lactobacilli counts in spring samplesThe counts in raw ripened milk (day 0) were similar on

LAMVAB for the 3 dairies (Table 2), reaching about103 cfu�mL–1, while they were higher (up to 106) andshowed important variations on AMRSA. From day 1 to

day 60, counts were similar on LAMVAB and AMRSA fordairies B and C, reaching 108 and 109 cfu�g–1, respectively.Conversely, presumptive lactobacilli counts varied stronglybetween AMRSA and LAMVAB in dairy A during the

Table 2. Microbial counts in samples taken at various stages during Camembertcheese production in the spring in 3 dairies (A, B, and C).

Microbial counts on:

Medium Dairy Day 0 Day 1 Day 14 Day 30 Day 60

AMRSA A 3.72 3.71 8.41 6.23 7.85B 5.04 7.79 8.20 8.23 8.04C 6.08 6.62 9.28 9.18 8.96

LAMVAB A 3.46 3.86 5.94 5.34 5.35B 2.94 7.77 8.18 8.23 8.06C 3.56 6.53 9.15 9.23 8.89

Note: AMRSA, acidified de Man Rogosa Sharpe agar; LAMVAB, Lactobacillus anae-robic de Man Rogosa Sharpe agar supplemented with vancomycin and bromocresol green.Data are presented as log values of colony forming units obtained per millilitre of milk(day 0) or per gram of curd and cheese (days 1–60).

Table 1. Primers used in this study.

Primer Sequence 5’–3’ Target ReferenceR16.1-GC* GCclamp-CTTGTACACACCGCCCGTCA 16S rRNA gene Nakagawa et al. 1994;

Dubernet et al. 2002LbLMA1-rev (/R16.1-GC)* CTCAAAACTAAACAAAGTTTC 16S–23S SR lactobacilliLac1* AGCAGTAGGGAATCTTCCA 16S rRNA gene Walter et al. 2001Lac2-GC (/Lac1)* GCclamp-ATTYCACCGCTACACATGV3f{ ACTCCTACGGGAGGCAGCAG 16S rRNA gene (V3 region) Coppola et al. 2001V3r (/V3f){ GTATTACCGCGGCTGCTGG16{ GCTGGATCACCTCCTTTC 16S rRNA gene Berthier and Ehrlich 1998;

Depouilly et al. 2004Helv(/16){ CCCCAAGGTCTTTTATTTC 16S–23S SR Lactobacillus

helveticusLpapl (/16){ ATGAGGTATTCAACTTATT 16S–23S SR Lactobacillus

paraplantarumLpl(/16){ ATGAGGTATTCAACTTATG 16S–23S SR Lactobacillus

plantarumY2{ CCCACTGCTGCCTCCCGTAGGAGT 16S rRNA gene Ward and Timmins 1999Para(/Y2){ CACCGAGATTCAACATGG 16S Lactobacillus paracaseiPrI{ CAGACTGAAAGTCTGACGG 16S rRNA gene Walter et al. 2000RhaII (/PrI){ GCGATGCGAATTTCTATTATT 16S–23S SR Lactobacillus

rhamnosus

Note: All primers were obtained from Invitrogen (Cergy Pontoise, France). GCclamp: CGGCCGGGGCGCGCCCCGGGCGGCCCGGGGGCACCGGGGG.*Used for total DNA from cheese samples and DNA from isolates.{Used for DNA of isolates.

Table 3. Amplification by Lactobacillus-specific primers of total DNA present incheese at different processing stages dur-ing spring batches.

Ripening time A B CDay 0 – – –Day 1 – – +Day 14 – + +Day 30 – + +Day 60 – + +

220 Can. J. Microbiol. Vol. 54, 2008

# 2008 NRC Canada

ripening period and remained about 3 orders of magnitudelower on LAMVAB compared with the 2 other dairies.

Diversity and dynamics of lactobacilli during cheeseprocessing

Confirmation of lactobacilli in spring samplesAmplification by Lactobacillus-specific primers of total

DNA present in cheese from dairy A never succeeded atany stage (Table 3), whereas PCR products were detectedfrom the 14th or the 1st day of ripening for dairies B andC, respectively. With isolates (data not shown), lactobacilliwere detected earlier than with total DNA. Among the iso-lates, the number of confirmed lactobacilli varied as a func-tion of the dairy and the production stage. In dairy A, nolactobacilli were detected in raw ripened milk and few iso-

lates were confirmed during cheese processing, but theirnumbers increased during ripening. No lactobacilli were de-tected on day 1 in dairy B, but they were detected in the rawripened milk and from day 14 until the end of ripening.Most isolates originating from dairy C were lactobacilli, es-pecially from the 14th day.

Diversity and dynamics of lactobacilli at the species levelPCR–TGGE analysis of total DNA from spring batches

using Lactobacillus-specific primers (Fig. 1) revealed, inCamembert cheese from dairy B, one band appearing fromthe 14th day of ripening that co-migrated with L. paracaseiCIP 102993 and CNRZ 763 and with Lactobacillus rhamno-sus CIP A 157. From the 30th day of ripening, a secondband was seen. None of the reference strains used in thisstudy co-migrated with this band. Analysis of total DNA

Fig. 1. Temperature gradient gel electrophoresis profiles of 16S–23S spacer region rDNA fragments of reference strains and of cheese ex-tracts from 2 dairies at various stages of ripening. No PCR products were obtained from dairy A, on day 0 in dairies B and C, and on day 1in dairy B. BII, dairy B; CII, dairy C.

Henri-Dubernet et al. 221

# 2008 NRC Canada

from dairy C yielded 2 different pictures, depending on thestage of sampling. In the day 1 ripening sample, 2 majorbands appeared. One co-migrated with the major band ofLactobacillus acidophilus CNRZ 204. The second one wasseen at all further sampling stages but no correspondingband appeared with reference strains. A minor band wasalso observed and co-migrated with L. paracasei CIP102993 and CNRZ 763 and with L. rhamnosus CIP A 157.From the 14th day of ripening, this band and 2 additionalones that co-migrated with L. plantarum CNRZ 211 wereobserved. No amplification products were obtained at anystage for dairy A.

The lactobacilli isolates obtained from the winter andspring batches were divided into 14 groups (Table 4) on thebasis of their responses to TGGE analysis, species-specificPCR analysis, and (or) sequencing. Each group corre-sponded either to a Lactobacillus species or to a group ofclosely related species. Lactobacillus paracasei (112 iso-lates) and L. plantarum (46 isolates) were the most encoun-tered species. These were followed by Lactobacillusparabuchneri (9 isolates), Lactobacillus fermentum (8 iso-lates), Lactobacillus psittaci/delbrueckii subsp. bulgaricus/gallinarum/crispatus (4 isolates), Lactobacillus helveticus (3isolates), L. acidophilus (3 isolates), L. rhamnosus (2 iso-lates), Lactobacillus delbrueckii subsp. lactis (2 isolates),Lactobacillus brevis (1 isolate), L. delbrueckii subsp. bul-garicus (1 isolate), Lactobacillus kefiri (1 isolate), Lactoba-cillus paraplantarum (1 isolate), and Lactobacillus perolens(1 isolate). Only 2 species were found in all the 3 dairies:L. paracasei (predominant species), and L. parabuchneri.

The repartition of the lactobacilli isolates identified duringCamembert production in the 3 dairies in winter and springbatches is shown in Fig. 2. Lactobacillus paracasei wasglobally the predominant species. Although it was not de-tected in all samples, it was always present at the end of rip-ening in the 6 batches. Except in winter in dairy C,L. parabuchneri was detected in all batches but at differentstages, depending on the batch. Lactobacillus plantarum wasisolated nearly exclusively from dairy C where it was de-tected in all stages in winter as the dominant or one of theco-dominant species. In spring, it was supplanted byL. paracasei, but it was isolated from the 14th day and itco-dominated at day 30. It appeared sporadically in winterin dairy A (in curd and at day 30). Isolates belonging to theL. fermentum species were encountered in winter and springin dairy C and during the winter batch in A but only in curd.Lactobacillus helveticus, the L. psittaci/delbrueckii subsp.bulgaricus/gallinarum/crispatus group, L. delbrueckii subsp.lactis, L. rhamnosus, and L. brevis seemed to be isolatedrandomly from samples.

The number of species identified was greater in the winterbatch than in the spring batch for dairy A and, to a smallerextent, for dairy B, while it was almost the same in the 2batches for dairy C. Species dynamics were very differentbetween the 2 batches in dairies A and C. Conversely, dairyB exhibited a relative stability in terms of repartition of spe-cies at a given stage of sampling.

Diversity and dynamics of lactobacilli at the intraspecieslevel

PFGE analysis showed high intra-species diversity within

L. paracasei isolates and much lower intra-species diversitywithin L. plantarum (Figs. 3A and 3B). PFGE analysis ofL. paracasei isolates from dairy B showed a wide range ofPFGE profiles, as 21 different profiles were obtained fromthe 39 isolates identified to this species. Among them, 12were strain specific and 9 were shared by different isolates.For example, profile 5 was displayed by 6 isolates found atdifferent stages of ripening in B in winter and spring (seealso profiles 13 and 14, Fig. 3A). Other profiles were de-tected only at some stages. For example, profile 3 was onlyassociated with raw ripened milk isolates. Similarly, 2strains seemed to be specific to the end of ripening(Fig. 3A, lines 15 and 19).

PFGE analysis of L. plantarum isolates (15 from the win-ter batch and 9 from the spring batch in dairy C) revealed 4different profiles. One strain of L. plantarum dominated atall stages in the winter batch in dairy C but was not recov-ered from the spring batch. Two of the 3 profiles found inspring were associated with different stages of ripening (pro-files 2 and 3, Fig. 3B).

Other microorganismsAmong presumed lactobacilli, isolates that were not con-

firmed as lactobacilli belonged to 2 main groups. Sequenc-ing of several isolates from these led to the identification ofPediococcus acidilactici for one group and Leuconostoc lac-tis and Leuconostoc pseudomesenteroides for the secondgroup. Pediococcus acidilactici was found in dairy B whereit was the only microorganism isolated from the curd. Thegenus Leuconostoc was mainly encountered in dairy A andwas either subdominant or undetected in the other dairies.In dairy C, virtually no microorganisms other than lactoba-cilli were present from day 1 onwards.

DiscussionMicrobiological counts and molecular confirmation

showed that except at day 1 in dairy B, lactobacilli werepresent throughout the ripening period in the 3 dairies. How-ever, the molecular methods failed to detect Lactobacillusspp. in several cases. Culture-independent methods maylead to false-negative results owing to low levels of cellsand low relative concentration of target DNA, or the pres-ence of competing DNA and PCR reactions can also intro-duce bias owing to selective amplification (Muyzer 1999;Ercolini et al. 2001; Henri-Dubernet et al. 2004). This wasconfirmed here.

Data from this study reveal that the Camembert cheesemicrobiology can show strong variability. Both the detectionof Lactobacillus DNA and the microbial counts on AMRSAand LAMVAB differed among the dairies, and variationsappeared regarding the diversity and dynamics of lactoba-cilli populations at the species and strains levels. Therewere also important differences between the 2 batches fromdairy A, whereas, in dairy C and especially in dairy B, theresults were similar in the winter and spring batches. Thissuggests, as already shown for artisanal raw milk cheeses(Poznanski et al. 2004), not only a strong influence of thecomposition of the raw milk but also of the cheesemakingpractices that appeared to be highly controlled in dairy B.

In 1989, the diversity of LAB in RDO Camembert from

222 Can. J. Microbiol. Vol. 54, 2008

# 2008 NRC Canada

Table 4. Molecular characterization of lactobacilli isolated throughout the cheese-making process in the 3 dairies and subsequent identification.

Defined group DairyNo. ofisolates

PCRgenusspecific

TGGE genusspecific

PCR speciesspecific Sequencing Final identification

L. paracasei A 29 + L. paracasei/rhamnosus L. paracasei ND L. paracasei subsp. paracaseiA 3 + L. paracasei/rhamnosus L. paracasei L. paracasei/rhamnosus L. paracasei subsp. paracaseiA 2 NR ND NR L. paracasei/rhamnosus L. paracasei/rhamnosusB 37 + L. paracasei/rhamnosus L. paracasei ND L. paracasei subsp. paracaseiB 3 + L. paracasei/rhamnosus L. paracasei L. paracasei/rhamnosus L. paracasei subsp. paracaseiC 36 + L. paracasei/rhamnosus L. paracasei ND L. paracasei subsp. paracaseiC 2 + L. paracasei/rhamnosus L. paracasei L. paracasei/rhamnosus L. paracasei subsp. paracasei

L. plantarum A 2 + L. plantarum L. plantarum L. plantarum/paraplantarum/pentosus L. plantarum

C 26 + L. plantarum L. plantarum ND L. plantarumC 9 + NR L. plantarum L. plantarum/paraplantarum/

pentosusL. plantarum

C 9 + L. plantarum L. plantarum L. plantarum/paraplantarum/pentosus L. plantarum

L. parabuchneri A 5 NR ND ND L. parabuchneri L. parabuchneriB 3 NR ND ND L. parabuchneri L. parabuchneriC 1 NR ND ND L. parabuchneri L. parabuchneri

L. fermentum A 4 NR ND ND L. fermentum L. fermentumC 4 NR ND ND L. fermentum L. fermentum

L. psittaci/delbrueckiibulgaricus/gallinarum/crispatus

A 2 + L. helveticus/delbrueckii subsp.delbrueckii/lactis

NR L. psittaci/delbrueckii subsp.bulgaricus/heveticus/galli-narum/crispatus

L. psittaci/delbrueckii subsp.bulgaricus/gallinarum/crispatus

A 2 + L. helveticus/delbrueckii subsp.delbrueckii/lactis

NR ND L. psittaci/delbrueckii subsp.bulgaricus/gallinarum/crispatus

L. helveticus A 2 + L. helveticus/delbrueckii subsp.delbrueckii/lactis

L. helveticus L. psittaci/delbrueckii subsp.bulgaricus/heveticus/gallinarum/crispatus

L. helveticus

B 1 + L. helveticus/delbrueckii subsp.delbrueckii/lactis

L. helveticus L. psittaci/delbrueckii subsp.bulgaricus/heveticus/gallinarum/crispatus

L. helveticus

L. acidophilus B 3 + L. acidophilus ND L. acidophilus L. acidophilusL. rhamnosus B 2 + L. paracasei/rhamnosus L. rhamnosus L. paracasei/rhamnosus L. rhamnosusL. delbrueclii subsp. lactis A 1 + L. delbrueckii subsp.

delbrueckii/lactisND L. delbrueckii sp.

L. delbrueckii subsp. lactis*

B 1 + L. delbrueckii subsp.delbrueckii/lactis

ND L. delbrueckii sp.L. delbrueckii subsp. lactis

L. brevis B 1 + ND ND L. brevis L. brevisL. delbrueclii subsp.

bulgaricusA 1 + L. delbrueckii subsp. bulgaricus ND L. delbrueckii subsp.

bulgaricus L. delbrueckii subsp. bulgaricus

L. kefiri C 1 + Non assigned ND L. kefiri L. kefiriL. paraplantarum C 1 + L. plantarum L. paraplantarum ND L. paraplantarumL. perolens A 1 NR ND ND L. perolens L. perolens

Note: NR, no response; ND, not determined.*Fermentation of trehalose (+), salicin (+), amygdalin (+), hydrolysis of esculin (+).

Henri-D

ubernetet

al.223

#2008

NR

CC

anada

Fig

.2.

Dis

trib

utio

nof

lact

obac

illi

spec

ies

orgr

oups

amon

gis

olat

esob

tain

eddu

ring

Cam

embe

rtch

eese

prod

uctio

nin

win

ter

and

spri

ngin

3da

irie

s(A

,B

,an

dC

).

224 Can. J. Microbiol. Vol. 54, 2008

# 2008 NRC Canada

dairy A (10 isolates per stage of ripening) was studied byphenotypic methods (API 50 strips) (M. Gueguen, personalcommunication, 2004). The most frequently isolated specieswere L. casei, L. plantarum, and L. brevis. However, theAPI 50 system could not differentiate between L. paracaseiand the closely related L. casei. It is probable that isolatesidentified as L. casei in the previous study would have beenconsidered as L. paracasei today. Lactobacillus buchneri,L. fermentum, L. acidophilus, L. helveticus, and L. del-brueckii were less abundant. Most species were identified inboth studies, suggesting that this panel of lactobacilli is wellestablished in RDO Camembert. However, in the previousstudy, L. brevis dominated the microflora of raw ripenedmilk and curd and then decreased during ripening. The factthat L. brevis was subdominant in the present study could bedue to (i) its failure to grow on the media used, notably on

LAMVAB, (ii) a decrease in the diversity of the raw milkproduced nowadays, or (iii) inaccurate identification by API50 strips.

Some general tendencies, observed in cheeses issued fromvarious technologies, were confirmed in Camembert cheeseregarding L. paracasei and L. plantarum and their evolutionduring ripening. Among the different lactobacilli isolatedduring ripening of raw milk Camembert cheese, L. paraca-sei was the most common. It seems to find favourable con-ditions during the cheese-making process (Wouters et al.2002), whatever the type of cheese. Its presence has alreadybeen reported in soft, and in many semi-hard and hardcheeses made from cow, ewe, and goat’s milk, such asCaciocavallo (Coppola et al. 2003), Ibores (Mas et al.2002), Cheddar (Fitzsimons et al. 1999), and Salers (Duthoitet al. 2003). The fact that L. paracasei is widespread in

Fig. 3. Diversity in pulsed-field gel electrophoresis patterns after digestion with NotI of (A) Lactobacillus paracasei from dairy B and(B) Lactobacillus plantarum from dairy C in winter (I) and spring (II).

Henri-Dubernet et al. 225

# 2008 NRC Canada

cheese is probably linked to its mesophilic properties and itsorigin from raw milk (Depouilly et al. 2004). It is generallybelieved that when this adventitious bacterium is present incheese, it overcomes all the other lactobacilli to become pre-dominant by the end of ripening (Ostlie et al. 2004; Poznan-ski et al. 2004). Although L. paracasei is often isolated fromother fermented foods including traditional fermented milk(Mathara et al. 2004), its dominance seems to be restrictedto cheese, since other species dominate in such cases (Leeet al. 2005). The fact that L. paracasei is widespread incheese, whatever the technology, is not well documented.Antimicrobial properties have been demonstrated in this spe-cies (Schwenninger et al. 2005) and, compared with L. plan-tarum, it is able to metabolize citrate (Weinrichter et al.2001); this could favour its development.

Lactobacillus plantarum was the second most-isolatedspecies, but it occurred nearly exclusively in dairy C. Lacto-bacillus plantarum has also been recovered from differentcheeses made from cow’s milk (Ercolini et al. 2003; Duthoitet al. 2005), ewe’s milk (Mannu et al. 2000), and goat’smilk (Oneca et al. 2003). It is also used as an adjunct cul-ture (Dasen et al. 2003; Coeuret et al. 2004). This is the firsttime that L. perolens and L. kefiri have been detected inCamembert cheese. Lactobacillus perolens, which was re-cently identified, has only been reported in an artisanalsemi-hard cheese made with raw milk (Ugarte et al. 2006).Lactobacillus kefiri has also been described in Ricotta fortecheese (Baruzzi et al. 2000).

PFGE analysis of L. paracasei isolates from dairy B re-vealed numerous different profiles. We also analysed someisolates of L. paracasei from dairies A and C; their patternswere all different from each other and from those of isolatesfrom dairy B (data not shown). Thus, diversity at the intra-species level was large and varied between batches and es-pecially among dairies. A great diversity of strains has beenreported in Comte cheese, and their growth kinetics arecheese specific (Depouilly et al. 2004). Here, we usedPFGE to investigate strain dynamics throughout ripening.Although most strains of L. paracasei were recovered onlyat one clearly defined stage, some strains seemed to be spe-cific to a given stage and others seemed to be specific to agiven dairy. For example in dairy B, one strain was encoun-tered only in raw ripened milk, whatever the batch, and an-other was very stable during the cheese-making process(recovered in raw ripened milk, and at days 14 and 60) andduring the 2 seasons. This latter wild strain seemed to bewell established in the dairy. Furthermore, the different iso-lates from dairies A and C showed patterns different fromeach other, suggesting that the intraspecies diversity and dy-namics are dependent on the dairy. In addition, all wildstrains belonged to taxa other than the taxon including col-lection strains. This has already been reported for Staphylo-coccus strains (Irlinger et al. 1997). The dynamics ofL. plantarum strains were studied in dairy C. The fact thatonly one PFGE profile was found in CI suggests that thisstrain could intentionally be added during the cheese manu-facturing process. Although only one profile was obtained inCI, 3 different strains were isolated in CII. This suggeststhat the former strain was not established in dairy C andhas probably, in winter batches, hidden intraspecies diversityand dynamics that were seen in spring batches (2 strains

persistent during ripening). Based on the dynamics ofL. paracasei, it appears that a wild strain can become estab-lished durably in a dairy and that each cheese exhibits itsown diversity and its own specificity regarding populationdynamics.

Usually, metagenomic approaches are used to describecomplex microbial populations involving many known andunknown microbial genera. In food microbial ecology, thestudy published by Le Bourhis et al. (2005) and the presentstudy are the only two, to our knowledge, to focus onTTGE/TGGE analysis of only one genus. Both studies haveshown that TGGE/TTGE can be used as an identificationtool at the species level. Indeed, Le Bourhis et al. (2005)were able to detect and distinguish the majority of speciesbelonging to the phylogenetic cluster I of the genus Clostri-dium. In this study, we were able to generate specific pro-files for most of 21 lactobacilli species. It was also possibleto distinguish the subspecies bulgaricus from the 2 othersubspecies of L. delbrueckii. However, limitations appearedin this approach because the complexity of some profiles(several bands for a given species) led to difficulties in in-terpreting data from mixed lactobacilli populations, as en-countered in cheese.

The polyphasic approach that we used here allowed us toexamine lactobacilli populations using TGGE with both totalDNA and DNA from isolates. If the combination of culture-dependent and culture-independent methods is now beingwidely used to overcome the limitations inherent to each ap-proach (Duthoit et al. 2003; Ercolini et al. 2003), few stud-ies compare the 2 approaches using the same identificationtool. Le Bourhis et al. (2005), studying Clostridium speciesin cheese, showed that culture and direct molecular detec-tion are consistent, but they observed a higher diversity bythe direct approach, since spores of some species were notable to grow in the conditions used for the culture approach.Here, we also obtained consistent data using the direct andculture-dependent TGGE, but conversely, we highlighted ahigher diversity with the culture method. This is probablydue to the fact that DNA from subdominant species was notamplified. Furthermore, it seems that few noncultivable lac-tobacilli were present, thus limiting the interest of using aculture-independent approach in this field.

Microorganisms other than lactobacilli were also recov-ered from AMRSA and LAMVAB. Members of the leuco-nostocs and pediococci groups were sometimes abundant.The fact that Leuconostoc lactis was mainly encountered inAII and dominated in raw ripened milk and curd suggeststhat it was used as a starter. In this batch, diversity wasvery low and few lactobacilli were isolated. This may bedue to leuconostocs, which appear to affect the developmentof adventitious NSLAB when they are used as a starter(Wouters et al. 2002). In BI and BII, Pediococcus acidilac-tici dominated the curd microflora. Its presence has alreadybeen reported in several different cheeses (Coppola et al.1997; Depouilly et al. 2004), and furthermore pediococcican be used as a starter (Bhowmik and Marth 1990).

The use of molecular methods to monitor lactobacillithroughout Camembert production allowed us to draw anovel and more accurate picture of the diversity and dynam-ics of lactobacilli populations in Camembert cheese at boththe species and strain levels. The polyphasic approach that

226 Can. J. Microbiol. Vol. 54, 2008

# 2008 NRC Canada

we used here allowed us to examine the temporal distribu-tion of species found in different dairies. It underlines thefact that the cultivation method remains necessary andshould be maintained together with new approaches.

AcknowledgementsWe thank Jean-Michel Bre and Marie-Joelle Jacob for

their technical assistance. This study was supported in partby the Syndicat Normand des Fabricants de Camembert(SNFC), the Institut National de la Recherche Agronomique(INRA) and the Conseil Regional de Basse-Normandie,France.

ReferencesAltschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., and

Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new gen-eration of protein database search programs. Nucleic Acids Res.25: 3389–3402. doi:10.1093/nar/25.17.3389. PMID: 9254694.

Baruzzi, F., Morea, M., Matarante, A., and Cocconcelli, P.S. 2000.Changes in the Lactobacillus community during Ricotta fortecheese natural fermentation. J. Appl. Microbiol. 89: 807–814.doi:10.1046/j.1365-2672.2000.01183.x. PMID:11119155.

Beresford, T.P., Fitzsimons, N.A., Brennan, N.L., and Cogan, T.M.2001. Recent advances in cheese microbiology. Int. Dairy J. 11:259–274. doi:10.1016/S0958-6946(01)00056-5.

Berthier, F., and Ehrlich, S.D. 1998. Rapid species identificationwithin two groups of closely related lactobacilli using PCR pri-mers that target the 16S/23S rRNA spacer region. FEMS Micro-biol. Lett. 161: 97–106. doi:10.1111/j.1574-6968.1998.tb12934.x. PMID:9561736.

Bhowmik, T., and Marth, E.H. 1990. Role of Micrococcus andPediococcus species in cheese ripening: a review. J. Dairy Sci.73: 859–866.

Callon, C., Duthoit, F., Delbes, C., Ferrand, M., Le Frileux, Y., DeCremoux, R., and Montel, M.C. 2007. Stability of microbialcommunities in goat milk during a lactation year: molecular ap-proaches. Syst. Appl. Microbiol., In press. doi:10.1016/j.syapm.2007.05.004. PMID:17604934.

Coeuret, V., Dubernet, S., Bernardeau, M., Gueguen, M., and Ver-noux, J.P. 2003. Isolation, characterization and identification oflactobacilli focusing mainly on cheeses and other dairy products.Lait, 83: 269–306. doi:10.1051/lait:2003019.

Coeuret, V., Gueguen, M., and Vernoux, J.P. 2004. In vitro screen-ing of potential probiotic activities of selected lactobacilli iso-lated from unpasteurized milk products for incorporation intosoft cheese. J. Dairy Res. 71: 451–460. doi:10.1017/S0022029904000469. PMID:15605712.

Coppola, R., Nanni, M., Iorizzo, M., Sorrentino, A., Sorrentino, E.,and Grazia, L. 1997. Survey of lactic acid bacteria during theadvanced stages of the ripening of Parmigiano Reggiano cheese.J. Dairy Res. 64: 305–310. doi:10.1017/S0022029996002038.

Coppola, R., Nanni, M., Succi, M., Sorrentino, A., Iorizzo, M.,Chiavari, C., and Grazia, L. 2001. Enumeration of thermophiliclactic acid bacteria in ripened cheeses manufactured from rawmilk. Milchwissenschaft, 56: 140–142.

Coppola, R., Succi, M., Sorrentino, E., Iorizzo, M., and Grazia, L.2003. Survey of lactic acid bacteria during the ripening of Ca-ciocavallo cheese produced in Molise. Lait, 83: 211–222.doi:10.1051/lait:2003011.

Dasen, A., Berthier, F., Grappin, R., Williams, A.G., and Banks, J.2003. Genotypic and phenotypic characterization of the dynamicsof the lactic acid bacterial population of adjunct-containingcheddar cheese manufactured from raw and microfiltered pas-

teurized milk. J. Appl. Microbiol. 94: 595–607. doi:10.1046/j.1365-2672.2003.01878.x. PMID:12631195.

Delbes, C., and Montel, M.C. 2005. Design and application ofa Staphylococcus-specific single strand conformationpolymorphism-PCR analysis to monitor Staphylococcus popu-lations diversity and dynamics during production of raw milkcheese. Lett. Appl. Microbiol. 41: 169–174. doi:10.1111/j.1472-765X.2005.01732.x. PMID:16033516.

Demarigny, Y., Beuvier, E., Dasen, A., and Duboz, G. 1996. Influ-ence of raw milk microflora on the characteristics of Swiss-typecheeses. I. Evolution of microflora during ripening and charac-terization of facultatively heterofermentative lactobacilli. Lait,76: 371–387. doi:10.1051/lait:1996428.

Depouilly, A., Dufrene, F., Beuvier, E., and Berthier, F. 2004. Gen-otypic characterization of the dynamics of the lactic acid bacter-ial population of Comte cheese. Lait, 84: 155–167. doi:10.1051/lait:2003036.

Dubernet, S., Desmasures, N., and Gueguen, M. 2002. A PCR-based method for identification of lactobacilli at the genus level.FEMS Microbiol. Lett. 214: 271–275. doi:10.1111/j.1574-6968.2002.tb11358.x. PMID:12351242.

Duthoit, F., Godon, J.J., and Montel, M.C. 2003. Bacterial commu-nity dynamics during production of registered designation of ori-gin Salers cheese as evaluated by 16S rRNA gene single-strandconformation polymorphism analysis. Appl. Environ. Microbiol.69: 3840–3848. doi:10.1128/AEM.69.7.3840-3848.2003. PMID:12839752.

Duthoit, F., Tessier, L., and Montel, M.C. 2005. Diversity, dy-namics and activity of bacterial populations in ‘‘Registered Des-ignation of Origin’’ Salers cheese by single-strand conformationpolymorphism analysis of 16S rRNA genes. J. Appl. Microbiol.98: 1198–1208. doi:10.1111/j.1365-2672.2005.02575.x. PMID:15836490.

Ercolini, D., Moschetti, G., Blaiotta, G., and Coppola, S. 2001. Thepotential of a polyphasic PCR-DGGE approach in evaluatingmicrobial diversity of natural whey cultures for water-buffaloMozzarella cheese production: bias of culture-dependent andculture-independent analyses. Syst. Appl. Microbiol. 24: 610–617. doi:10.1078/0723-2020-00076. PMID:11876368.

Ercolini, D., Hill, P.J., and Dodd, C.E.R. 2003. Bacterial commu-nity structure and location in Stilton cheese. Appl. Environ. Mi-crobiol. 69: 3540–3548. doi:10.1128/AEM.69.6.3540-3548.2003.PMID:12788761.

Ercolini, D. 2004. PCR–DGGE fingerprinting: novel strategies fordetection of microbes in food. J. Microbiol. Methods, 56: 297–314. doi:10.1016/j.mimet.2003.11.006. PMID:14967221.

Ercolini, D., Mauriello, G., Blaiotta, G., Moschetti, G., andCoppola, S. 2004. PCR–DGGE fingerprints of microbial succes-sion during a manufacture of traditional water buffalo mozzar-ella cheese. J. Appl. Microbiol. 96: 263–270. doi:10.1046/j.1365-2672.2003.02146.x. PMID:14723687.

Fitzsimons, N.A., Cogan, T.M., Condon, S., and Beresford, T.1999. Phenotypic and genotypic characterization of non-starterlactic acid bacteria in mature Cheddar cheese. Appl. Environ.Microbiol. 65: 3418–3426. PMID:10427029.

Hartemink, R., Domenech, V.R., and Rombouts, F.M. 1997.LAMVAB — a new selective medium for the isolation of lacto-bacilli from faeces. J. Microbiol. Methods, 29: 77–84. doi:10.1016/S0167-7012(97)00025-0.

Henri-Dubernet, S., Desmasures, N., and Gueguen, M. 2004.Culture-dependent and culture-independent methods formolecular analysis of the diversity of lactobacilli in ‘‘Camembertde Normandie’’ cheese. Lait, 84: 179–189. doi:10.1051/lait:2003037.

Henri-Dubernet et al. 227

# 2008 NRC Canada

Irlinger, F., Morvan, A., El Solh, N., and Bergere, J.L. 1997. Taxo-nomic characterization of coagulase-negative staphylococci inripening flora from traditional french cheeses. Syst. Appl. Mi-crobiol. 20: 319–328.

Lafarge, V., Ogier, J.C., Girard, V., Maladen, V., Leveau, J.Y.,Gruss, A., and Delacroix-Buchet, A. 2004. Raw cow milk bac-terial population shifts attribuable to refrigeration. Appl. En-viron. Microbiol. 70: 5644–5650. doi:10.1128/AEM.70.9.5644-5650.2004. PMID:15345453.

Lazzi, C., Rossetti, L., Zago, M., Neviani, E., and Giraffa, G. 2004.Evaluation of bacterial communities belonging to natural wheystarters for Grana Padano cheese by length heterogeneity-PCR.J. Appl. Microbiol. 96: 481–490. doi:10.1111/j.1365-2672.2004.02180.x. PMID:14962128.

Le Bourhis, A.G., Saunier, K., Dore, J., Carlier, J.P., Chamba, J.F.,Popoff, M.R., and Tholozan, J.L. 2005. Development and vali-dation of PCR primers to assess the diversity of Clostridiumspp. in cheese by temporal temperature gradient gel electrophor-esis. Appl. Environ. Microbiol. 71: 29–38. doi:10.1128/AEM.71.1.29-38.2005. PMID:15640166.

Lee, J.S., Heo, G.Y., Lee, J.W., Oh, Y.J., Park, J.A., Park, Y.H.,Pyun, Y.R., and Ahn, J.S. 2005. Analysis of kimchi microflorausing denaturing gradient gel electrophoresis. Int. J. Food Mi-crobiol. 102: 143–150. doi:10.1016/j.ijfoodmicro.2004.12.010.PMID:15992614.

Lucore, L.A., Cullison, M.A., and Jaykus, L.A. 2000. Immobiliza-tion with metal hydroxides as a means to concentrate food-bornebacteria for detection by cultural and molecular methods. Appl.Environ. Microbiol. 66: 1769–1776. doi:10.1128/AEM.66.5.1769-1776.2000. PMID:10788338.

Mannu, L., Communian, R., and Scintu, M.F. 2000. Mesophiliclactobacilli in Fiore Sardo cheese: PCR-identification and evolu-tion during cheese ripening. Int. Dairy J. 10: 383–389. doi:10.1016/S0958-6946(00)00074-1.

Mas, M., Tabla, R., Moriche, J., Roa, I., Gonzalez, J., Rebollo,J.E., and Caceres, P. 2002. Ibores goat’s milk cheese: microbio-logical and physicochemical changes throughout ripening. Lait,82: 579–587. doi:10.1051/lait:2002034.

Mathara, J.M., Schillinger, U., Kutima, P.M., Mbugua, S.K., andHolzapfel, W.H. 2004. Isolation, identification and characteriza-tion of the dominant microorganisms of kule naoto: the tradi-tional fermented milk in Kenya. Int. J. Food Microbiol. 94:269–278. doi:10.1016/j.ijfoodmicro.2004.01.008. PMID:15246238.

Muyzer, G. 1999. DGGE/TGGE a method for identifying genesfrom natural ecosystems. Curr. Opin. Microbiol. 2: 317–322.doi:10.1016/S1369-5274(99)80055-1. PMID:10383868.

Nakagawa, T., Shimada, M., Mukai, H., Asada, K., Kato, I., Fujino,K., and Sato, T. 1994. Detection of alcohol-tolerant hiochi bac-teria by PCR. Appl. Environ. Microbiol. 60: 637–640.PMID:7510942.

Ogier, J.C., Son, O., Gruss, A., Tailliez, P., and Delacroix-Buchet,A. 2002. Identification of bacterial microflora in dairy productsby temporal temperature gradient gel electrophoresis. Appl. En-viron. Microbiol. 68: 3691–3701. doi:10.1128/AEM.68.8.3691-3701.2002. PMID:12147461.

Oneca, M., Irigoyen, A., Ortigosa, M., and Torre, P. 2003. PCR

and RAPD identification of L. plantarum strains isolated fromovine milk and cheese. Geographical distribution of strains.FEMS Microbiol. Lett. 227: 271–277. doi:10.1016/S0378-1097(03)00691-8. PMID:14592719.

Ostlie, H.M., Eliassen, L., Florvaag, A., and Skeie, S. 2004. Pheno-typic and PCR-based characterization of the microflora in Nor-vegia cheese during ripening. Int. J. Food Microbiol. 94: 287–299. doi:10.1016/j.ijfoodmicro.2004.01.012. PMID:15246240.

Poznanski, E., Cavazza, A., Cappa, F., and Cocconceli, P.S. 2004.Indigenous raw milk microbiota influences the bacterial devel-opment in traditional cheese from alpine natural park. Int. J.Food Microbiol. 92: 141–151. doi:10.1016/j.ijfoodmicro.2003.09.006. PMID:15109791.

Randazzo, C.L., Torriani, S., Akkermans, A.D.L., de Vos, W.M.,and Vaughan, E.E. 2002. Diversity, dynamics, and activity ofbacterial communities during production of an artisanal Siciliancheese as evaluated by 16S rRNA analysis. Appl. Environ. Mi-crobiol. 68: 1882–1892. doi:10.1128/AEM.68.4.1882-1892.2002.PMID:11916708.

Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular clon-ing: a laboratory manual. 2nd ed. Cold Spring Harbour Labora-tory, Cold Spring Harbour, N.Y.

Schwenninger, S.M., von Ah, U., Niederer, B., Teuber, M., andMeile, L. 2005. Detection of antifungal properties in Lactobacil-lus paracasei subsp. paracasei SM20, SM29, and SM63 andmolecular typing of the strains. J. Food Prot. 68: 111–119.PMID:15690811.

Ugarte, M.B., Guglielmotti, D., Giraffa, G., Reinheimer, J., andHynes, E. 2006. Nonstarter lactobacilli isolated from soft andsemihard Argentinean cheeses: genetic characterization and re-sistance to biological barriers. J. Food Prot. 69: 2983–2991.PMID:17186668.

Walter, J., Tannock, G.W., Tilsala-Timisjarvi, A., Rodtong, S.,Loach, D.M., Munro, K., and Alatossava, T. 2000. Detectionand identification of gastrointestinal Lactobacillus species byusing denaturing gradient gel electrophoresis and species-speci-fic PCR primers. Appl. Environ. Microbiol. 66: 297–303.PMID:10618239.

Walter, J., Hertel, C., Tannock, G.W., Lis, C.M., Munro, K., andHammes, W.P. 2001. Detection of Lactobacillus, Pediococcus,Leuconostoc, and Weissella species in human feces by usinggroup-specific PCR primers and denaturing gradient gel electro-phoresis. Appl. Environ. Microbiol. 67: 2578–2585. doi:10.1128/AEM.67.6.2578-2585.2001. PMID:11375166.

Ward, L.J., and Timmins, M.J. 1999. Differentiation of Lactobacil-lus casei, Lactobacillus paracasei and Lactobacillus rhamnosusby polymerase chain reaction. Lett. Appl. Microbiol. 29: 90–92.doi:10.1046/j.1365-2672.1999.00586.x. PMID:10499296.

Weinrichter, B., Luginbuhl, W., Rohm, H., and Jimeno, J. 2001.Differentiation of facultatively heterofermentative lactobacillifrom plants, milk, and hard type cheeses by SDS-PAGE,RAPD, FTIR, energy source utilisation and autolysis type.Lebensmittel-Wissenschaft und-Technologie 34: 556–566.

Wouters, J.T.M., Ayad, E.H.E., Hugenholtz, J., and Smit, G. 2002.Microbes from raw milk for fermented dairy products. Int. DairyJ. 12: 91–109. doi:10.1016/S0958-6946(01)00151-0.

228 Can. J. Microbiol. Vol. 54, 2008

# 2008 NRC Canada