Dp

TGa

b

a

ARRA

K‘FREG

1

ssvpia

oatae

h0

Scientia Horticulturae 171 (2014) 78–82

Contents lists available at ScienceDirect

Scientia Horticulturae

journa l h om epa ge: www.elsev ier .com/ locate /sc ihor t i

istinct expression profiles of ripening related genes in the ‘Nanguo’ear (Pyrus ussuriensis) fruits

ong Lia,1, Xinyue Lia,1, Dongmei Tana, Zhongyu Jianga, Yun Weia, Juncai Lib,uodong Dua, Aide Wanga,∗

Fruit Development and Metabolic Biology Laboratory, College of Horticulture, Shenyang Agricultural University, Shenyang 110866, Liaoning, ChinaDivision of Pear Breeding, Institute of Pomology, Liaoning Academy of Agricultural Sciences, Xiongyue 115009, China

r t i c l e i n f o

rticle history:eceived 23 February 2014eceived in revised form 27 March 2014ccepted 31 March 2014

eywords:Nanguo’ pear (Pyrus ussuriensis)ruitipeningthyleneene expression

a b s t r a c t

‘Nanguo’ pear (Pyrus ussuriensis) is one of the most important pear varieties in the northern part of China.It is typical climacteric fruit, and the ripening process is controlled by ethylene. In this study, we comparedthe fruit firmness and ethylene production between non-treated fruits and fruits treated with 1 �l l−1 of1-MCP (1-Methylcyclopropene, an ethylene inhibitor) under 4 ◦C or room temperature. The expressionof genes involved in ethylene biosynthesis and signal transduction was investigated. Fruits harvestedfrom different locations were also used to compare the gene expression. The results showed that 1-MCPtreatment slowed down the fruit firmness drop but did not change the ethylene production very muchduring storage. The expression of genes involved in ethylene biosynthesis (ACS1, ACS4 and ACO), reception(ERS1a) and response (PG1 and PG2) were inhibited by 1-MCP treatments, and affected by the treatmenttemperature. The expression of receptor gene ETR1a showed a constitutive pattern in fruits treated withor without 1-MCP at room temperature, but was induced in treatment under 4 ◦C. In the fruit harvested

from colder area (Shenyang), the ethylene production was higher and fruit firmness was lower than thatin fruit harvested from warmer area (Anshan). Moreover, the expression of ethylene biosynthesis andreceptor genes was lower in fruit from Shenyang than that from Anshan. PG2 was expressed earlier infruits from Shenyang than those from Anshan and may play more important role in fruit softening. Thepossible mechanism under the expression patterns was discussed.

© 2014 Elsevier B.V. All rights reserved.

. Introduction

‘Nanguo’ pear is the representative variety of Pyrus ussurien-is which grows in the northern, cold areas of China. It is muchought after by consumers because of its good taste, fragrant fla-or and nice aroma. The fruit of ‘Nanguo’ pear is climacteric androduces a large amount of ethylene in the ripening process dur-

ng which fruits undergo huge changes in sugar/acid content, flavornd aroma, as well as fruit texture.

Ethylene is the major plant hormone controlling the ripeningf climacteric fruit. Much knowledge on the ethylene biosynthesisnd signal transduction has been gained from studies on toma-

oes (Giovannoni, 2004). ACS (1-aminocyclopropane-1-carboxyliccid (ACC) synthase) and ACO (ACC oxidase) are two importantnzymes in the biosynthesis of ethylene, which are encoded by

∗ Corresponding author. Tel.: +86 24 88487143; fax: +86 24 88487146.E-mail address: adwang333@163.com (A. Wang).

1 These authors contributed equally to this work.

ttp://dx.doi.org/10.1016/j.scienta.2014.03.054304-4238/© 2014 Elsevier B.V. All rights reserved.

multigene families (Bleecker and Kende, 2000). The cascade ofethylene signal transduction includes ethylene receptors, CTR (con-stitutive triple response), EIN2 (ethylene insensitive2), EIN3 andEILs (EIN3 Like) and ERF (ethylene response factor), as well as theethylene response gene (Kendrick and Chang, 2008; Stepanova andAlonso, 2009).

The actions of ACS and ACO in pear fruit ripening have beenreported previously (El-Sharkawy et al., 2004; Fonseca et al., 2005;Shi and Zhang, 2012). The expressions of ACS1 and ACS2 in fruits ofEuropean pear (Pyrus communis) are regulated by cold and ethylene(El-Sharkawy et al., 2004). A CTR1 gene has been also isolated fromthe European pear by El-Sharkawy et al. (2003). Ethylene recep-tor is negative regulator in ethylene signal transduction. Genesencoding receptors such as ETR (ethylene response) and ERS (ethyl-ene response sensor) have been isolated from various plant speciesincluding pears (El-Sharkawy et al., 2003; Tatsuki et al., 2007; Zhang

et al., 2013). ERS1a, ETR1a and ETR5 increase in expression in theEuropean pear during ripening, and the expression of ETR1a isinduced by cold treatment (El-Sharkawy et al., 2003). As an eth-ylene response gene, the expression of PG (polygalacturonase) is

ticulturae 171 (2014) 78–82 79

r2

fesp

nsb‘tieTmf

2

2

aaoomssbrSsR

2

tiaUiMr2fp

2

3tip8rF

coe

Table 1Primers used in this study.

Gene Accession no. Primer Sequence (5′–3′)

ACS1 X87112 ACS1-F CTTGGCAATGCAGAGACTGAACS1-R CAGGCTGCCTTTCATCTACC

ACS4 AF386518 ACS4-F CCAGAAGGTTTGAGCAGGAAACS4-R GAGCACGTCCAAAACGAAAT

ACO EU047710 ACO-F AAATCCACGACTTGGACTGGACO-R CCAAGGTTCTCACACAGCAA

ETR1a AF386509 ETR1a-F GCATGAGGGTTGGTATGGATETR1a-R CCCTTGAAATCTTTCCTCTGC

ERS1a AF386515 ERS1a-F GCCACCTAAAGGACAAGCAAERS1a-R TCAAAATTCCCAGGTTGAGC

ETR5 AF386511 ETR5-F GCAAGGAATGTGGAGAATCGETR5-R AGCTCAGGCCCTTCTTGATT

CTR1 AF386508 CTR1-F GATTCTTTGACGCCGTTGATCTR1-R GGCCATACCCGAGACTATGA

PG1 AB084461 PG1-F ACTGCAGCCAAAGTGTTCCTPG1-R TGCTGATTGGTACAAGAATTGC

PG2 AB084462 PG2-F TTAAGGTCAGCGATGTGACGPG2-R AACAACTTGTCGGCTGAACC

T. Li et al. / Scientia Hor

elated to the loss of firmness in tomatoes and apples (Wakasa et al.,006; Saladié et al., 2007).

In addition to ethylene, other factors such as temperature andruit maturity at harvest influence fruit ripening (Adams-Phillipst al., 2004). Wang et al. (2009) have reported that a small heathock protein might serve to regulate fruit ripening through tem-erature.

Although the ‘Nanguo’ pear is an important local variety inorthern China, its ripening behavior has not been studied inten-ively yet. Understanding the mechanisms underlying the ripeningehaviors would be helpful in regulating the ripening process of the

Nanguo’ pear fruits and benefit the local fruit storage industry. Inhis study, we compared the expression of ripening-related genesn fruits treated with or without 1-MCP (1-Methylcyclopropene, anthylene inhibitor), and in fruit harvested from different locations.he ripening related genes responded differentially to 1-MCP treat-ent and showed distinct expression patterns in fruits harvested

rom different locations.

. Materials and methods

.1. Plant materials

The fruits of ‘Nanguo’ pear (P. ussuriensis) were harvested fromn orchard in Anshai (Liaoning, China) on Sep. 14, 2012 and fromnother orchard in Shenyang (Liaoning, China) on Sep. 8, 2012. Therchard in Shenyang (N42◦4′, E123◦37′) is located 200 km northf Anshan orchard (N41◦2, E122◦54′), and both are under normalanagement. Trees in the two orchards are all 10 years old with

imilar productivity and on the same rootstock ‘Shanli’ (P. ussurien-is). Fruits were harvested at commercial harvest day and takenack to the lab and stored at room temperature for 15 d. Two sepa-ate groups of fruits from Anshan were used for 1-MCP treatment.amples were collected every 5 d and the mesocarp of each fruit wasliced and frozen in liquid N2 immediately and stored at −80 ◦C forNA extraction. Five fruits were used for each sampling.

.2. Fruit treatment with 1-MCP

The ethylene inhibitor 1-MCP (1-Methylcyclopropene) was usedo suppress the ethylene signal transduction. Fruits were enclosedn an air-tight container with a septa built in the lid. The certainmount of 1-MCP (EthylBloc, Rohm and Haas, Philadelphia, PA,SA) powder was put in a 10 ml centrifuge tube and water was

njected into the tube through the septa to produce 1 �l l−1 of 1-CP. Fruits were treated with 1 �l l−1 of 1-MCP for 24 h at 4 ◦C or

oom temperature (24 ◦C). After treatment, the fruits were held at4 ◦C for 15 d and sampled every 5 d. At each sampling point, fiveruits were subjected to measurements of firmness and ethyleneroduction.

.3. Measurements of fruit firmness and ethylene production

Fruit firmness was measured with a portable penetrometer (FT-27, Facchini, Italy) fitted with an 8-mm-diameter probe accordingo Tan et al. (2013). Briefly, four skin discs (approximately 1 cmn diameter) were removed from opposite sides of each fruit. Therobe was pressed into the tissue of the cut surface to depth of–9 mm in a single smooth motion. The mean of these four testsepresented the firmness of a certain fruit at each sampling point.ive fruits of each sample were measured.

At each sampling point, five intact fruits were kept in a gas-tightontainer (0.8 l, 24 ◦C) equipped with a septa for 1 h, and then 1 mlf headspace gas was sampled by means of a syringe. The ethyl-ne production was measured with a gas chromatograph (Agilent

ACTIN AF386514 Actin-F GTTGCAATTCAGGCTGTCCTActin-R GCTCAGCAGTTGTGGTGAAA

7890A) equipped with a flame ionization detector. An HP-AL/S col-umn (Cat. no. 19095P-S25, Agilent) was used. The temperatures ofoven, injector and detector were 110 ◦C, 120 ◦C and 180 ◦C, respec-tively; H2 was used as the carrier gas at 50 ml min−1, and N2 wasused as makeup gas at 40 ml min−1. Five fruits were used for eachmeasurement. The mean of these five tests represented the ethyl-ene production of each sampling point. The significant differenceamong data was analyzed with Duncan’s multiple range tests.

2.4. Gene expression analysis

Total RNA was isolated according to the method of Gasic et al.(2004). The first strand cDNA was synthesized from 500 ng oftotal RNA using M-MLV RTase cDNA Synthesis Kit (Cat. no. D6130,TaKaRa, Tokyo, Japan), and then used as template for RT-PCR assays.The total volume of PCR mixture was 20 �l, containing 10 �l of 2×EX TaqTM Mix (Cat. no. RR902A, TaKaRa), 1 �l of forward primerand 1 �l of reverse primer (0.5 �M for each), and 1 �l of templatecDNA. The final volume was brought to 20 �l by adding 7 �l of H2O.The thermal cycling conditions were 3 min at 94 ◦C; 30 cycles of30 s at 94 ◦C, 30 s at 55 ◦C and 1 min at 72 ◦C; and a final extensionof 3 min at 72 ◦C. Five �l of the each PCR product were sepa-rated in 1% agarose gel and photographed with GelDoc XR System(BioRad). Specific primers for each gene were designed accordingto the sequences of related genes in European pears by Primer3(http://frodo.wi.mit.edu/) and were listed in Table 1. The appleActin gene was used as an internal control.

3. Results

3.1. Changes of fruit firmness and ethylene production

In order to understand the ripening behavior of ‘Nanguo’ pearfruits, we collected them at commercial harvest day from anorchard in Anshan and stored at room temperature for 15 d. Thefruit firmness and ethylene production were measured. The fruitfirmness did not change much at the beginning of the storage (5 d),but decreased rapidly in the following 10 d, and at 15 d it droppedto less than 10 N (Fig. 1A, Anshan). The ethylene production wasnot detectable at commercial harvest day and increased promptly

after storing for 5 d. It peaked at 10 d and declined slightly at 15 d(Fig. 1B, Anshan).

As a climacteric fruit, the ripening of the ‘Nanguo’ pear is consid-ered to be under the regulation of ethylene. Therefore, we treated

80 T. Li et al. / Scientia Horticulturae 171 (2014) 78–82

Fig. 1. Fruit firmness (A) and ethylene production (B) of ‘Nanguo’ pear fruits treatedwith or without 1-MCP. Shenyang and Anshan indicate the fruits harvested fromS ◦

wi

tmRgtiMnt

p2iwcwtddsw

3

s(igiweatbit

Fig. 2. Expression profiles of ripening-related genes in fruits treated with or with-out 1-MCP. Shenyang and Anshan indicate the fruits harvested from Shenyang andAnshan, respectively. RT-MCP and 4 ◦C-MCP indicate the fruits treated with 1-MCP at

henyang and Anshan, respectively. RT-MCP and 4 C-MCP indicate the fruits treatedith 1-MCP at room temperature and 4 ◦C, respectively. Numbers under X-axis

ndicate the days after harvest; 0 signifies the commercial harvested day; ** p < 0.01.

he ‘Nanguo’ pear fruits with an ethylene inhibitor 1-MCP. Treat-ents of 1-MCP were performed under room temperature (24 ◦C,

T-MCP) or 4 ◦C (4 ◦C-MCP). As shown in Fig. 1A, both treatmentsreatly inhibited the fruit softening rate during the experimen-al period. Interestingly, RT-MCP treatment did not significantlynhibit the ethylene production during the storage (Fig. 1B); 4 ◦C-

CP treatment only inhibited the ethylene production at 5 d, ando significant difference was observed at 10 d and 15 d comparedo non-treated fruits (Fig. 1B).

Moreover, we investigated the ripening behavior of ‘Nanguo’ear fruits growing in an orchard in Shenyang, which is located00 km north of Anshan. The firmness showed a rapid decrease

n fruits from Shenyang during storage, similar to that of Anshan,hile it was 13.4 N softer than those from Anshan at 0 d (commer-

ial harvest day) (Fig. 1A). Surprisingly, the ethylene productionas significantly higher (p < 0.01) in the fruits from Shenyang than

hose from Anshan. At 0 d of fruits from Anshan, no ethylene wasetected, while more than 0.12 �l g−1 h−1 of ethylene was pro-uced in fruits of Shenyang at this point (Fig. 1B). At each of otherampling points, the ethylene production in fruits from Shenyangas about twice as much as that in fruits from Anshan (Fig. 1B).

.2. Expression analysis of ripening related genes

The expression of genes involved in ethylene biosynthesis andignal transduction was investigated among the above samplesFig. 2). The expression of ACS1, ACS4 and ACO was increased dur-ng storage in non-treated fruits from Anshan, whereas they werereatly inhibited by 1-MCP treatment. CTR1 expression decreasedn non-treated fruits during the storage and not much difference

as observed between non-treated and 1-MCP treated fruits. Thexpression of ethylene receptor genes (ETR1a, ETR5 and ERS1a) waslso investigated. ETR1a showed constitutive expression in non-

◦

reated fruits and was induced by 4 C-MCP treatment but noty RT-MCP treatment. The expression of ETR5 was not detectable

n non-treated fruits, while it was slightly induced by 1-MCPreatments (room temperature or 4 ◦C). The expression of ERS1a

room temperature and 4 ◦C, respectively. Numbers underneath the picture indicatethe days after harvest; 0 signifies the commercial harvested day.

increased first and then decreased in non-treated fruits duringstorage, and was slightly inhibited by 1-MCP treatments (roomtemperature or 4 ◦C). PG is considered to be the major enzymeresponsible for cell wall degradation and fruit softening (Saladiéet al., 2007; García-Gago et al., 2009). The expression of PG1 andPG2 showed similar ripening-related patterns in non-treated fruits(Fig. 2). PG1 was inhibited by RT-MCP treatment and only expressedat 15 d in 4 ◦C-MCP treated fruits; PG2 was inhibited by 4 ◦C-MCPtreatment and was only expressed at day 10 in RT-MCP treatedfruits (Fig. 2).

In the fruits harvested from Shenyang, the genes illustrated dif-ferent expression patterns (Fig. 3). ACS1 was only expressed in traceamount in fruits from Shenyang, and ACS4 expression was lowerthan that in fruits from Anshan. The expression of CTR1, ETR1a andERS1a declined in fruits from Shenyang during storage. Only faintbands were observed for PG1 expression in the fruit from Shenyang,and the expression of PG2 started at 0 d (Fig. 3), which was earlierthan that in fruits from Anshan (Fig. 2).

4. Discussion

The fruit of ‘Nanguo’ pear is climacteric, and the ripening processis accompanied by a burst of ethylene production. Genes involved inethylene biosynthesis and signal transduction responded differen-tially under the existence of ethylene in the ripening process. Thiswork aimed to understand the actions of these genes in ‘Nanguo’pear fruits that were harvested from different locations or treatedwith 1-MCP under different temperatures.

The fruit firmness dropped rapidly during storage in non-treatedfruits, and this drop was inhibited in 1-MCP treated (room tem-perature or 4 ◦C) fruits (Fig. 1A). This result indicated that 1-MCPblocked the ethylene signal transduction in the mesocarp and madethe fruits stay firm during storage, which is consistent with that inother fruit such as apple (Tan et al., 2013). However, the ethylene

production did not change much in 1-MCP treated fruits comparedto that in non-treated fruits (Fig. 1B). This might be caused bythe uneven diffusion of 1-MCP in pear fruit. Although we treatedthe fruits with 1-MCP for 24 h, it might not diffuse into all part of

T. Li et al. / Scientia Horticultu

Fig. 3. Expression profiles of ripening-related genes in ‘Nanguo’ pear fruits har-vh

tadoe(stmse

4sat1l

ested from Shenyang. Numbers underneath the picture indicate the days afterarvest; 0 signifies the commercial harvested day.

he fruits, especially the core. Therefore, the ethylene biosynthesisnd signal transduction in the core could be still active and pro-uced ethylene that was detected in 1-MCP treated fruits. Basedn this reason, it is understandable that the expression of ethyl-ne biosynthesis genes (ACS1, ACS4 and ACO) and responsive genesPG1 and PG2) was suppressed but high amount of ethylene wastill observed in 1-MCP treated fruits, because we only checkedheir expression in the mesocarp. On the other hand, 1-MCP treat-

ent may lead to increased ethylene production in some speciesuch as avocado (Hershkovitza et al., 2005). This could be anotherxplanation for the ethylene production in 1-MCP treated fruit.

In addition, the ethylene production was inhibited at 5 d in◦C-MCP fruits, but not in RT-MCP fruits (Fig. 1B). This result

uggested that 1-MCP might be easier to diffuse in pear fruits◦

t 4 C because the gas solubility gets higher as the tempera-

ure decreases. Moreover, the ethylene production increased at0 d and 15 d in 4 ◦C-MCP fruits. This could be resulted from the

imited amount of 1-MCP diffused into the core part at 5 d, and

rae 171 (2014) 78–82 81

newly produced ethylene receptors activated the ethylene signaltransduction at 10 d and 15 d and induced the burst of ethyl-ene.

In the fruits from Shenyang, the ethylene production was muchhigher (Fig. 1B), but the expression of ACS1 and ACS4 was lower ateach sampling point of fruits from Shenyang than that in fruits fromAnshan (Figs. 2 and 3). Moreover, the expression of ACO, down-stream of ACS, did not show much difference between fruits fromAnshan and Shenyang (Figs. 2 and 3). These results suggested thatother ACSs might exist in the pear genome, accounting for theethylene evolution in fruits from Shenyang. On the other hand,the expression of ethylene receptor genes (ETR1a and ERS1a) waslower in fruits from Shenyang than that in fruits from Anshan(Figs. 2 and 3), suggesting that the amount of ethylene receptorsis lower and the auto-catalyzing rate of ethylene is higher in fruitsfrom Shenyang because receptors are negative regulators in eth-ylene signal transduction. Thus, higher ethylene production andlower fruit firmness were observed in fruits from Shenyang com-pared to the fruits from Anshan (Fig. 1A and B).

The ethylene receptor gene ETR1a was not affected by the RT-MCP treatment, and was induced by the 4 ◦C-MCP treatment (Fig. 2),suggesting that the transcript of ETR1a was accumulated under lowtemperature. This finding confirmed the result in European pearsby El-Sharkawy et al. (2003), in which ETR1a expression increasesduring chilling treatment. ETR5 was not detectable in non-treatedfruits from Anshan, whereas faint bands were observed in 1-MCP-treated fruits (Fig. 2), suggesting that its expression is induced by1-MCP treatment. ERS1a was increased in expression in non-treatedfruits from Anshan during storage and slightly inhibited by 1-MCPtreatments (Fig. 2). This result suggested that the roles of receptorgenes vary in fruit ripening.

PG is closely related to fruit softening and its expression isgreatly suppressed by 1-MCP in apple fruits (Wakasa et al., 2006).In our study, PG1 and PG2 increased in expressions during stor-age, showing ripening-related patterns in non-treated fruits fromAnshan (Fig. 2). In 1-MCP treated fruits, the expression of PG1 andPG2 were inhibited and this result explained the slow drop rate offirmness after treatment. In the fruits from Shenyang, the expres-sion of PG2 started at 0 d (Fig. 3), unlike that in fruit from Anshanwhich started from 5 d during storage (Fig. 2). This might be the rea-son why the firmness was lower at 0 d in fruit from Shenyang thanthat from Anshan at this point (Fig. 1A). The expression of PG1 wasobserved in trace amount in fruit from Shenyang (Fig. 3), whereasit was much higher in fruit from Anshan (Fig. 2), suggesting thatPG1 played less role than PG2 in the fruit softening.

In the fruits harvested from Shenyang, ACS1, CTR1, ethylenereceptor genes (ETR1a and ERS1a) and PG1 showed completely dif-ferent expression patterns from that in non-treated fruits fromAnshan (Figs. 2 and 3). It can be concluded that factors other thanethylene participate in the ripening processes of ‘Nanguo’ pearfruits. Taking into account the surroundings in which they aregrown, ambient temperatures most likely contribute to the differ-ences of ethylene production and expression of related genes sincethe fruits from Shenyang were harvested from an orchard furtherto the north than those from Anshan, and the fruits from Shenyangexperienced much lower temperature during development. Thetemperature related genes such as HSP (heat shock protein) whichacts as a molecular chaperone might modulate the ripening relatedgenes and result in their differential expression. More researchesneed to be done to clarify this point.

Taken together, 1-MCP treatment inhibited the firmness lossbut did not change the ethylene production significantly in pear

fruits during storage. The expression of ripening related genes wasinhibited by 1-MCP treatment, and was affected by treatment tem-perature. Fruits harvested from various locations showed differentripening behavior and gene expression profile.

8 ticultu

A

tI

R

A

B

E

E

F

G

G

2 T. Li et al. / Scientia Hor

cknowledgments

This work was supported by the Activating Foundation for Doc-oral Researchers of Liaoning Province, China (20121140) and thennovative Program for Fruit Tree Research of Liaoning Province.

eferences

dams-Phillips, L., Barry, C., Giovannoni, J., 2004. Signal transduction systems reg-ulating fruit ripening. Trends Plant Sci. 9, 331–338.

leecker, A.B., Kende, H., 2000. Ethylene: a gaseous signal molecule in plants. Annu.Rev. Cell Dev. Biol. 16, 1–18.

l-Sharkawy, I., Jones, B., Gentzbittel, l., Lelièvre, J.M., Pech, J.C., Latché, A.,2004. Differential regulation of ACC synthase genes in cold-dependentand -independent ripening in pear fruits. Plant Cell Environ. 27,1197–1210.

l-Sharkawy, I., Jones, B., Li, Z.G., Lelièvre, J.M., Pech, J.C., Latche, A., 2003. Isolationand characterization of four ethylene perception elements and their expressionduring ripening in pears (Pyrus communis L.) with/without cold requirement. J.Exp. Bot. 54, 1615–1625.

onseca, S., Monteiro, L., Barreiro, M.G., Pais, M.S., 2005. Expression of genes encod-ing cell wall modifying enzymes is induced by cold storage and reflects changesin pear fruit texture. J. Exp. Bot. 56, 2029–2036.

arcía-Gago, J.A., Posé, S., Munoz-Blanco, J., Quesada, M.A., Mercado, J.A., 2009. The

polygalacturonase FaPG1 gene plays a key role in strawberry fruit softening.Plant Signal Behav. 4, 766–768.

asic, K., Hernandez, A., Korban, S.S., 2004. RNA extraction from different appletissues rich in polyphenols and polysaccharides for cDNA library construction.Plant Mol. Biol. Rep. 22, 437a–1437a.

rae 171 (2014) 78–82

Giovannoni, J.J., 2004. Genetic regulation of fruit development and ripening. PlantCell. 16, 170–180.

Hershkovitza, V., Saguyb, S.I., Pesis, E., 2005. Postharvest application of 1-MCP toimprove the quality of various avocado cultivars. Postharvest Biol. Technol. 37,252–264.

Kendrick, M.D., Chang, C., 2008. Ethylene signaling: new levels of complexity andregulation. Curr. Opin. Plant Biol. 11, 479–485.

Saladié, M., Matas, A.J., Isaacson, T., Jenks, M.A., Goodwin, S.M., Niklas, K.J., 2007. A re-evaluation of the key factors that influence tomato fruit softening and integrity.Plant Physiol. 144, 1012–1028.

Shi, H.Y., Zhang, Y.X., 2012. Pear ACO genes encoding putative 1-aminocyclopropane-1-carboxylate oxidase homologs are functionallyexpressed during fruit ripening and involved in response to salicylic acid.Mol. Biol. Rep. 39, 9509–9519.

Stepanova, A.N., Alonso, J.M., 2009. Ethylene signaling and response: where differentregulatory modules meet. Curr. Opin. Plant Biol. 12, 548–555.

Tan, D., Li, T., Wang, A., 2013. Apple 1-aminocyclopropane-1-carboxylic acid syn-thase genes, MdACS1 and MdACS3a are expressed in different systems ofethylene biosynthesis. Plant Mol. Biol. Rep. 31, 204–209.

Tatsuki, M., Endo, A., Ohkawa, H., 2007. Influence of time from harvest to 1-MCPtreatment on apple fruit quality and expression of genes for ethylene biosyn-thesis enzymes and ethylene receptors. Postharvest Biol. Technol. 43, 28–35.

Wakasa, Y., Kudo, H., Ishikawa, R., Akada, S., Senda, M., Niizeki, M., Harada, T., 2006.Low expression of an endopolygalacturonase gene in apple fruit with long-termstorage potential. Postharvest Biol. Technol. 39, 193–198.

Wang, A., Tan, D., Tatsuki, M., Kasai, A., Li, T., Saito, H., Harada, T., 2009. Molecular

mechanism of distinct ripening profiles in apple fruits of ‘Fuji’, and its earlymaturing sports. Postharvest Biol. Technol. 52, 38–43.

Zhang, Y.F., Shi, H.Y., Zhang, Y.X., 2013. Expression and regulation of the ethylenereceptor PpERS gene during pear fruit development and following salicylic acidtreatment. Plant Cell Tissue Org. Cult. 114, 385–394.