Embed Size (px)
Citation preview
Dissecting the impact of macrophage migration inhibitory factor (MIF) on host immune
response
Myeongseon Park
Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University in
partial fulfillment of the requirements for the degree of
Doctor of Philosophy
In
Animal and Poultry Sciences
Rami A. Dalloul, Chair
Mark C. Jenkins
Kiho Lee
Caroline M. Leeth
Eric A. Wong
August 8, 2018
Blacksburg, VA
Keywords: MIF, chicken, Eimeria, CXCR4, CD74, CRISPR/Cas9
Copyright 2018, Myeongseon Park
Dissecting the impact of macrophage migration inhibitory factor (MIF) on host immune
response
Myeongseon Park
Academic Abstract
Macrophage migration inhibitory factor (MIF) has been implicated in mediating both innate and
adaptive immune responses in inflammatory and infectious diseases. The sequence and structure
of MIF is highly conserved across the avian phylogeny, which underlies high sequence
homology and functional similarities between turkey and chicken MIFs. Turkey MIF (TkMIF)
inhibited cell migration and promoted cell proliferation with production of inflammatory
mediators, comparable to the biological properties of chicken MIF (ChMIF), thus indicating the
biological cross-reactivity between turkey and chicken MIFs. This study identified the cell
surface receptor(s) that could bind ChMIF and the biological roles triggered by such interactions.
In addition to CD74, a previously identified receptor, CXCR4 also interacts with ChMIF.
Moreover, the formation of receptor complexes was shown between CXCR4 and CD74. MIF
signaling through CXCR4 and CD74 led to cell chemotaxis and proliferation activity as well as
intracellular calcium influx. Intriguingly, Eimeria MIF (EMIF), a homologue secreted following
parasitic infection, also interacted with CD74 leading to comparable biological functions to those
of ChMIF. Given such observations, we hypothesized that CXCR4 and CD74 are receptors for
ChMIF leading to the functional consequences similarly manifested by EMIF interaction with
the corresponding receptors. EMIF, predominantly secreted from the invasive merozoite stage,
may help the parasite exploit the host immune response by interacting with common ChMIF
receptors. This may lead to functional mimicry thus provoking the question of whether EMIF
would modulate the biological functions of ChMIF to manipulate the host defense that allows
more efficient invasion of the host. To evaluate this concept, a transgenic E. tenella lacking MIF
was generated by in vivo passage of E. tenella transfected with a CRISPR plasmid targeting
EMIF. Although not fully disrupted, reduction of EMIF expression was observed in the
transgenic E. tenella itself as well as in inoculated cells, which resulted in enhanced survival of
host cells. Herein, we achieved a better characterization of the functional roles of both avian and
parasite MIFs underlying the interaction with common host receptors, along with the essential
role of parasite MIF promoting host cell death during parasitic infection.
General Public Abstract
When animals get infected or injured, their immune system senses invading pathogens or
damaged tissues as danger signals, which often elicits the production of inflammatory mediators.
These are chemical messengers secreted mostly by immune cells that initiate cellular
communication and infiltration of immune cells to the infection/damaged site leading to
inflammatory responses to eliminate the infectious agents and repair damaged tissues. Among
many inflammatory mediators, macrophage migration inhibitory factor (MIF) is involved in
inflammatory and immune response by regulating cell migration. Interestingly, MIF is secreted
by Eimeria parasites (that cause the costly coccidiosis disease in poultry) as well as by chickens
(host animal) after infection with this pathogen. Toward a better understanding of the impacts of
both avian and parasite MIFs on the host immune response, three specific studies were
completed. First, MIF displayed high degree of gene sequence identity and functional similarity
between chicken and turkey, supporting the evolutionarily conservation of MIF across birds.
The second study identified the MIF receptors and their complexes, which engage in the
biological functions of chicken MIF. Through binding to these cell surface receptors, chicken
MIF can regulate cell migration and proliferation with calcium release. Intriguingly, Eimeria
MIF secreted after parasitic infection is able to bind the same receptors leading to comparable
biological functions to those of chicken MIF. Lastly, the role of Eimeria MIF was further
evaluated by disrupting its gene in the parasite. Although not fully disrupted in the transgenic
parasites, its expression was decreased resulting in enhanced survival of host cells, thus
suggesting a deleterious effect of Eimeria MIF on the host, as well as its potential as a
therapeutic target to control coccidiosis in poultry.
v
ACKNOWLEDGEMENTS
I wish to express my sincere gratitude to all people who encouraged and helped me to
complete this dissertation. Foremost, I am deeply grateful to my advisor Dr. Rami Dalloul for
providing me this opportunity to pursue my Ph.D. degree. Under his supervision, I was able to
learn not only academic knowledge of avian immunology but also how to design and write
scientific papers. Without his continuous support and valuable guidance of my Ph.D. program and
research, it would not have been possible to complete this degree.
Further, I would like to thank my committee members Drs. Mark Jenkins, Kiho Lee,
Caroline Leeth, and Eric Wong for their helpful and insightful comments and suggestions
throughout my project. Specifically, I appreciate Dr. Jenkins’s help in providing plenty of Eimeria
oocysts as well as critical information regarding Eimeria transfection; his support and valuable
comments were instrumental to finish the last study. I thank Dr. Lee for invaluable advice on the
CRISPR plasmid construction and transfection. I am also grateful to Drs. Leeth and Wong for
their crucial remarks in terms of immunology and molecular biology that shaped my dissertation.
I also want to acknowledge a special debt to Dr. Dana Hawley, Dr. James Adelman, Ariel
Leon, and Laila Kirkpatrick for their dedicated work on the house finch IL-1 side-project. My
sincere thanks also goes to Drs. Raymond Fetterer, Nicks Evans, and Michael Persia for their
contributions to complete the turkey MIF study. I also express my big thanks to Dale Shumate for
his time and efforts dedicated to my bird trials.
I sincerely thank all my lab members Mallory White, Nima Khodambashi Emami, Aaron
Oxendine, Ali Calik, Shubao Yang, Shaimaa Hamad, Islam Omara, Sungwon Kim, Tiffany Potter
and Miranda Ritzi who helped me throughout my research and created the good memories during
my graduate work. Special thanks to Mallory and Sungwon, you guys are the best lab mates I had
vi
ever met. Special thank you goes to Jing Zhu for her technical support with flow cytometry and
Junghyun Ryu for providing me helpful advice regarding transfection experiment. And of course
thanks to all, Nathaniel Barret, Haihan Zhang, Xinyan Leng, and Misun Jeong for their help on
my studies.
Last but not least, I would like to thank my family and friends for supporting me spiritually
throughout my life. To my parents and little brother, no words can express the depth of my love
and enough gratitude for the three of you. I am more than thankful to my grandparents for always
believing in me and encouraging me to follow my dreams.
vii
Table of Contents
Abstract ........................................................................................................................................... ii
ACKNOWLEDGEMENTS .............................................................................................................v
Table of Contents .......................................................................................................................... vii
List of Tables ...................................................................................................................................x
List of Figures ................................................................................................................................ xi
List of Abbreviations .................................................................................................................... xii
Chapter I: Introduction .....................................................................................................................1
References ....................................................................................................................................5
Chapter II: Literature Review ..........................................................................................................7
Avian immune system ..................................................................................................................7
Innate immunity......................................................................................................................10
Adaptive immunity .................................................................................................................13
Immune mediators ......................................................................................................................14
Avian cytokines ......................................................................................................................16
Evolutionarily conserved cytokines across birds ...................................................................21
Macrophage migration inhibitory factor (MIF)..........................................................................22
Mechanism of MIF action ......................................................................................................24
The role of parasite MIF .........................................................................................................28
Genetic modification of parasites ...............................................................................................30
Apicomplexan parasites: Eimeria spp. ...................................................................................31
CRISPR/Cas9 system .............................................................................................................32
Gene manipulation of Eimeria species ...................................................................................34
In summary .................................................................................................................................36
References ..................................................................................................................................39
Chapter III: Functional characterization of the turkey macrophage migration inhibitory factor ..57
Abstract ......................................................................................................................................57
Introduction ................................................................................................................................58
Materials and methods ...............................................................................................................60
Turkey, RNA sources for cloning ..........................................................................................60
Sequence analyses ..................................................................................................................61
Tissue distribution of TkMIF .................................................................................................61
viii
Construction of recombinant TkMIF (rTkMIF) expression plasmid .....................................62
Expression and purification of rTkMIF by SEC-HPLC .........................................................62
Western blot analysis ..............................................................................................................63
Isolation of peripheral blood mononuclear cells (PBMCs) and splenocytes .........................64
Chemotaxis assay ...................................................................................................................65
Cell proliferation assay ...........................................................................................................65
Cell stimulation assay and cytokine transcripts analysis ........................................................66
Statistical analysis ..................................................................................................................66
Results ........................................................................................................................................67
Sequence and phylogenetic analyses of TkMIF .....................................................................67
TkMIF expression in tissues ...................................................................................................67
Expression and Western analysis of TkMIF ..........................................................................68
Chemotactic activity of rTkMIF .............................................................................................68
The effect of rTkMIF on proliferation of splenic lymphocytes .............................................69
Expression of pro-inflammatory cytokines and chemokines by TkMIF in PBMCs ..............69
Expression of Th1/Th2/Th17 cytokines by TkMIF in splenocytes ........................................70
Discussion ..................................................................................................................................71
References ..................................................................................................................................76
Chapter IV: The interaction of macrophage migration inhibitory factor (MIF) with CXCR4 and
CD74 ..............................................................................................................................................93
Abstract ......................................................................................................................................93
Introduction ................................................................................................................................94
Materials and methods ...............................................................................................................96
Cell lines, plasmids and reagents............................................................................................96
Birds and cell isolation ...........................................................................................................97
Transfection of ChCXCR4 and/or ChCD74...........................................................................97
Pull-down and co-immunoprecipitation assay .......................................................................98
Immunofluorescence and flow cytometric analysis ..............................................................98
ChCXCR4 internalization assay .............................................................................................99
Receptor binding assay between ChCXCR4 and ChCD74 ..................................................100
Chemotaxis assay .................................................................................................................101
Intracellular calcium measurement.......................................................................................102
Cell proliferation assay .........................................................................................................102
ix
Statistical analysis ...............................................................................................................102
Results ......................................................................................................................................103
MIF interacts with ChCXCR4 as its receptor.......................................................................103
ChCXCR4 internalization through the interaction with ChMIF or EMIF ...........................104
Receptor complex formation of ChCXCR4 and ChCD74 ...................................................104
MIF-mediated cell migration relies on ChCXCR4 or/and ChCD74 ....................................105
MIF triggers calcium influx through ChCXCR4 and ChCD74 ...........................................106
MIF-induced cell growth is regulated by ChCXCR4 and ChCD74 .....................................106
Discussion ................................................................................................................................107
References ................................................................................................................................112
Chapter V: Disruption of macrophage migration inhibitory factor in Eimeria tenella using
CRISPR system ............................................................................................................................124
Abstract ....................................................................................................................................124
Introduction ..............................................................................................................................125
Materials and methods .............................................................................................................129
Parasites, birds, and cells ......................................................................................................129
Plasmid construction ............................................................................................................130
Parasite transfection and inoculation ....................................................................................130
Gene analysis of transgenic E. tenella ..................................................................................131
qRT-PCR and western blot analysis .....................................................................................132
Indirect immunofluorescence (IFA) and flow cytometry assays .........................................133
Statistical analysis ................................................................................................................133
Results ......................................................................................................................................133
Transiently transfected E. tenella with CRISPR plasmid ....................................................133
MIF expression of stable transfected E. tenella ...................................................................134
The influence of MIF knockout E. tenella on PBMCs .........................................................136
Discussion ................................................................................................................................136
References ................................................................................................................................141
Chapter VI: Epilogue ...................................................................................................................150
Appendix A: Supplementary Data ...............................................................................................153
Appendix B: Identification and functional characterization of the house finch interleukin-1 ..155
x
List of Tables
Table 3.1. Primers sequences used for cloning TkMIF and qRT-PCR analysis............................80
Table 4.1. Primers sequences used for cloning ChCXCR4 and qRT-PCR analysis ....................115
Table 5.1. Primers used for CRISPR plasmid construction and PCR analysis............................144
xi
List of Figures
Figure 2.1. Signal transduction throught the MIF receptors CD74, CXCR2 and CXCR4 ............25
Figure 3.1. Nucleotide and its deduced amino acid sequences of TkMIF .....................................82
Figure 3.2. Multiple sequence alignment and phylogenetic analysis of the amino acid sequences
of TkMIF with homologous MIF from birds and mammals .........................................................83
Figure 3.3. Tissue-specific mRNA expression of TkMIF .............................................................85
Figure 3.4. Purification and Western blot analysis of rTkMIF ......................................................86
Figure 3.5. Inhibition the random migration of PBMCs and splenocytes by rTkMIF ..................87
Figure 3.6. Blocking of MIF-induced inhibition of cell migration ................................................88
Figure 3.7. The proliferative effect of rTkMIF on splenic lymphocytes .......................................89
Figure 3.8. Nitric oxide release of rTkMIF-treated PBMC derived monocytes ............................90
Figure 3.9. mRNA expression of pro-inflammatory cytokines and chemokine on rTkMIF treated
monocytes ......................................................................................................................................91
Figure 3.10. mRNA expression of Th1/Th2/Th17 cytokines on rTkMIF treated splenocytes ......92
Figure 4.1. Transient overexpression of ChCXCR4 in DF-1 cells ..............................................116
Figure 4.2. ChMIF binding to ChCXCR4 ...................................................................................117
Figure 4.3. EMIF binding to ChCXCR4 ......................................................................................118
Figure 4.4. ChCXCR4 internalization was induced by incubation with ChMIF or EMIF ..........119
Figure 4.5. Complex formation of ChCXCR4 and ChCD74 .......................................................120
Figure 4.6. ChMIF and EMIF promoted cell chemotaxis through ChCXCR4 and ChCD74 ......121
Figure 4.7. ChMIF and EMIF enhanced intracellular calcium influx by engagement of
ChCXCR4 and ChCD74 ..............................................................................................................122
Figure 4.8. The proliferative effect of ChMIF or EMIF on transfected HTC cells with empty
vector (pcDNA), ChCXCR4, ChCD74, or ChCXCR4 and ChCD74 .........................................123
Figure 5.1. Schematic representation of ∆EtMIF plasmid (pAct-Cas9-H4-sgMIF) carrying
double expression cassettes, sgMIF scaffold and Cas9-EGFP-DHFR ........................................145
Figure 5.2. In vitro intracellular development of transiently transfected E. tenella in PCKCs ...146
Figure 5.3. Generation of stable transgenic E. tenella expressing GFP and lacking MIF
expression ....................................................................................................................................147
Figure 5.4. Examination of PCKCs following inoculation with transgenic E. tenella ................148
Figure 5.5. Cell viability following inoculation with transgenic E. tenella .................................149
Figure S4.1. Relative transcription of MIF receptor components during Eimeria infection .......153
Figure S4.2. Endogenous expression of CXCR4 and CD74 in chicken cells..............................154
xii
List of Abbreviations
Act: Actin
APCs: Antigen-presenting cells
β-Me: β-mercaptoethanol
CCL: CC chemokine ligand
CD: Cluster of differentiation
cDNA: Complementary DNA
CI: Chemotactic index
CLF: Chemokine-like function
CLP: Common lymphoid progenitor
CLRs: C-type lectin receptors
ConA: Concanavalin A
COX-2: Cyclooxygenase 2
CpG: Cytosine-phosphate-Guanin
cPLA2: cytosolic phospholipase A2
CRISPR: Clustered Regularly Interspaced Short Palindromic Repeats
CRISPRi: CRISPR interference
crRNA: CRISPR RNA
CTLA-4: Cytotoxic T-lymphocyte antigen 4
CXCL: CXC chemokine ligand
CXCR: CXC chemokine receptor
DAMPs: damage-associated molecular patterns
DAPI: 4′,6-diamidino-2-phenylindole
DC: Dendritic cell
DHFR-TS: Dihydrofolate reductase-thymidylate synthase
DMEM: Dulbecco’s Modified Eagle Medium
dpi: Days post-inoculation
E. coli: Escherichia coli
EPCs: Endothelial progenitor cells
ER: Endoplasmic reticulum
ERK: Extracellular signal-regulated kinase
xiii
EYFP: Enhanced yellow fluorescent protein
FACS: Fluorescence activated cell sorting
FCS: Fetal calf serum
GAL: Galactose transporter
GAPDH: Glyceraldehyde 3-phosphate dehydrogenase
GBP: Guanylate-binding protein
gDNA: genomic DNA
GFP: Green fluorescent protein
GM-CSF: Granulocyte macrophage colony stimulating factor
GPCR: G-protein-coupled chemokine receptors
H4: Histone 4
HBSS: Hank’s Buffered Salt Solution
hr: Hour
HPLC: High-performance liquid chromatography
IELs: Intraepithelial lymphocytes
IFA: Indirect immunofluorescence
IFN: Interferon
Ig: Immunoglobulin
IL: Interleukin
iNOS: Inducible nitric oxide synthase
JNK: c-Jun-N-terminal kinase
LAL: Limulus Amebocyte Lysate
LITAF: LPS-induced TNF-α factor
LPS: Lipopolysaccharide
LRR: Leucine-rich repeat
MAF: Macrophage activating factor
MALT: Mucosa-associated lymphoid tissues
MAMPs: Microbe-associated molecular patterns
MAP: Mitogen-activated protein
MAPK: Mitogen-activated protein kinase
MHC: Major histocompatibility complex
xiv
MIF: Macrophage migration inhibitory factor
min: Minute
MIP-2: Macrophage inflammatory protein 2
MKPs: MAP kinase phosphatases
MSCs: Mesenchymal stromal cells
MW: Molecular weight
NALP: NACHT, LRR and PYD domains-containing protein
NF-κB: Nuclear factor kappa-light-chain-enhancer of activated B cells
NHEJ: Non-homologous end joining
NJ: Neighbor-joining
NK: Natural killer
NLRs: NOD-like receptors
NLRC: NLR containing a caspase-recruitment domain
NLRP: NOD-like receptor protein
NLS: Nuclear localization signal
NO: Nitric oxide
NOD: Nucleotide oligomerization and binding domain
NSPCs: Neural stem/progenitor cells
PAM: Protospacer adjacent motif
PBMCs: Peripheral blood mononuclear cells
PCKCs: Primary chicken kidney cells
PEMS: Poult enteritis and mortality syndrome
PFA: Paraformaldehyde
PGE2: Prostaglandin E2
PHA: Phytohaemagglutinin
pI: Isoelectric point
PI: Post-inoculation
PI3K: Phosphoinositide-3-kinase
PMN: Polymorphonuclear
PRRs: Pattern recognition receptors
PYD: Pyrin domain
xv
qRT-PCR: Quantitative real-time polymerase chain reaction
REMI: Restriction enzyme-mediated integration
RIG-I: Retinoic acid-inducible gene I
RLRs: RIG-I like receptors
RMS: Rhabdomyosarcoma
ROS: Reactive oxygen species
SAA: Serum amyloid A
SDF-1α: Stromal cell-derived factor-1α
sec: Second
SEC-HPLC: Size exclusion high performance liquid chromatography
SEM: Standard error of the mean
sgRNA: Single-guide RNA
T2A: Thosea asigna virus 2A peptide coding sequences
TCR: T cell receptors
Th: Helper T cells
Th1: Type 1 helper T cells
Th2: Type 2 helper T cells
Th17: T helper 17 cells
TLRs: Toll-like receptors
TNF: Tumor necrosis factor
tracrRNA: Trans-activating crRNA
Treg: Regulatory T cell
UTR: Untranslated region
WT: Wild-type
ZAP-70: Zeta-chain-associated protein kinase 70
- 1 -
CHAPTER I
Introduction
Upon infection, an innate immune response is initiated by recognizing conserved
microbial structures presented as danger signals through germline-encoded pattern recognition
receptors (PRRs). They elicit several signaling cascades that ultimately result in the production
of inflammatory mediators including cytokines, chemokines, and cell adhesion molecules (Akira
et al., 2006). The combination of microbial molecules and inflammatory mediators derived from
host cells give rise to the immune and inflammatory responses, in which leukocytes are recruited
to sites of infection or damaged tissues resulting in pathogen killing and prevention of infection
(Nathan, 2002; Medzhitov, 2007). Inflammatory mediators are chemical messengers secreted by
the cells to provide communication in response to infection that activate and regulate immune
responses. Among such mediators, some cytokines exert different biological functions on
different target cells (pleiotropy), while others share similar functional activities (redundancy)
(Ozaki and Leonard, 2002). In addition, cytokines can act either cooperatively or
antagonistically (Zhang and An, 2007). With these properties, cytokines regulate multiple
cellular activities in coordinated and interactive manners. In addition, chemokines refer to
chemotactic cytokines that orchestrate the activation and recruitment of leukocytes (Laing and
Secombes, 2004). Our understanding of the repertoire of cytokines and chemokines in avian
species has tremendously advanced due to the improved genetic resources. However, it still is
limited compared to those of mammals, therefore more extensive research is needed for better
elucidating the avian immune system.
Among these immune mediators, MIF was firstly identified as a cytokine secreted by
activated T lymphocytes that is capable of interfering with random migration of macrophages.
- 2 -
MIF was later described and produced by other cell types including pituitary cells and
macrophages as a pleiotropic cytokine associated with the pathogenesis of acute and chronic
inflammatory and immune diseases (Weiser et al., 1989, 1991; Lue et al., 2002). In diverse
inflammatory conditions, MIF plays a central role to regulate excessive innate immune and
inflammatory responses, also promotes cell growth and survival supporting the production of
inflammatory cytokines through inflammatory signaling transduction pathways (Calandra and
Roger, 2003). The intrinsic pro-inflammatory property of MIF counter-regulates the
immunosuppressive and anti-inflammatory effects of endogenous glucocorticoids. Accordingly,
MIF acts in concert with glucocorticoids to regulate the magnitude of the inflammatory and
immune responses (Flaster et al., 2007). Based on the structure similarity between monomer
MIF and dimer form of chemokine CXCL8, MIF is also classified as a chemokine-like function
(CLF) chemokine that regulates immune cell trafficking. Upon secretion via non-classical
pathway, MIF exerts functional activities in a receptor-dependent manner. Firstly, CD74 was
identified as the plasma membrane receptor for MIF. A complex of MIF and CD74 with CD44
initiates a signaling cascade resulting in the proliferation and survival of mature B cells (Leng et
al., 2003; Starlets et al., 2006). Secondly, non-cognate interaction of MIF with the CXC-motif
chemokine receptors CXCR2 and CXCR4 has been described in regulating the chemotactic
properties of macrophages and neutrophils, also eliciting calcium influx (Bernhagen et al., 2007).
Another atypical chemokine receptor, CXCR7, was also identified to directly bind MIF, leading
to the activation of the extracellular signal-regulated kinase (ERK)1/2 and ZAP-70 signaling,
thus contributing to the chemotaxis of B lymphocytes in inflammatory processes (Alampour-
Rajabi et al., 2015). Depending on the cellular context, MIF signals transduction pathways
through different clusters of receptors. MIF expressed from rhabdomyosarcoma cells in
- 3 -
autocrine and paracrine manners enhanced cell adhesion by interaction with CXCR4 and CXCR7
(Tarnowski et al., 2010). Additional heteromeric MIF receptors encompassing CXCR4 and
CD74 were involved in MIF endocytosis (Schwartz et al., 2009). Similar to mammalian MIFs,
both chicken and Eimeria MIFs were demonstrated to interact with the chicken receptor CD74
on avian macrophages (Kim et al., 2014). As described above, multiple mechanistic links
between MIF and its receptors have been evaluated in mammals; however, any formation of
receptor complex has not yet been described in avian species.
In avian species, up-regulation of MIF transcripts was detected in the intestinal
inflammatory response following infection with Eimeria parasites (Hong et al., 2006). These
causative agents of poultry coccidiosis that primarily invade epithelial cells of the host
gastrointestinal tract and undergo a complex life cycle that culminates in oocysts excreted in the
feces. Of note, MIF homologue was found during Eimeria developmental stages including
schizonts, macrogametes, and oocysts, with the most abundant expression being found in an
intracellular stage and secreted to the columnar epithelial cells after 24 hr post-infection (Miska
et al., 2007). Eimeria MIF (EMIF) has been characterized as sharing conserved secondary
structure and similar biological properties with mammalian MIFs, including migration inhibitory
activity and enhancement of production of inflammatory mediators in LPS-stimulated monocytes
(Miska et al., 2013). In addition, MIF homologues have been discovered in other apicomplexan
parasites including Plasmodium and Toxoplasma species. Using the MIF knock-out mouse
model, the impact of Plasmodium MIF on immune evasion and liver-stage development was well
demonstrated (Dobson et al., 2009; Sun et al., 2012; Miller et al., 2012). The MIF homologue in
T. gondii induced production of the chemokine IL-8 through ERK signaling pathway triggering
early recruitment of immature immune cells to infection sites that contributed to dissemination of
- 4 -
parasites (Sommerville et al., 2013). These observations demonstrated the immunomodulatory
activity of parasite MIF during infection in mammals.
As such, many studies have been performed with mammalian MIF as well as some
parasite homologues, but the relationship between host and parasite MIFs in avian immune
system has not been fully elucidated. The objective of this project was to investigate the
mechanism of MIF action and its impact on avian immune responses. This goal was addressed
by completing three specific studies. First, evolutionarily conservation of avian MIFs was
demonstrated by functional characterization of the turkey MIF following our earlier research on
chicken MIF. Second, a functional receptor complex for chicken and Eimeria MIFs was
identified with receptor-dependent functions. Third, the impact of Eimeria MIF on host cells
during Eimeria infection was examined using MIF-knockout parasites with in vitro and in vivo
models.
- 5 -
References
Akira, S., S. Uematsu and O. Takeuchi. (2006). Pathogen recognition and innate immunity. Cell
124, 783-801.
Alampour-Rajabi, S., O. El Bounkari, A. Rot, G. Muller-Newen, F. Bachelerie, M. Gawaz, C.
Weber, A. Schober and J. Bernhagen. (2015). MIF interacts with CXCR7 to promote receptor
internalization, ERK1/2 and ZAP-70 signaling, and lymphocyte chemotaxis. FASEB J. 29, 4497-
4511.
Bernhagen, J., R. Krohn, H. Lue, J. L. Gregory, A. Zernecke, R. R. Koenen, M. Dewor, I.
Georgiev, A. Schober, L. Leng, T. Kooistra, G. Fingerle-Rowson, P. Ghezzi, R. Kleemann, S. R.
McColl, R. Bucala, M. J. Hickey and C. Weber. (2007). MIF is a noncognate ligand of CXC
chemokine receptors in inflammatory and atherogenic cell recruitment. Nat Med. 13, 587-596.
Calandra, T. and T. Roger. (2003). Macrophage migration inhibitory factor: a regulator of innate
immunity. Nat Rev Immunol. 3, 791-800.
Dobson, S. E., K. D. Augustijn, J. A. Brannigan, C. Schnick, C. J. Janse, E. J. Dodson, A. P.
Waters and A. J. Wilkinson. (2009). The crystal structures of macrophage migration inhibitory
factor from Plasmodium falciparum and Plasmodium berghei. Protein Sci. 18, 2578-2591.
Flaster, H., J. Bernhagen, T. Calandra and R. Bucala. (2007). The macrophage migration
inhibitory factor-glucocorticoid dyad: regulation of inflammation and immunity. Mol
Endocrinol. 21, 1267-1280.
Hong, Y. H., H. S. Lillehoj, S. H. Lee, R. A. Dalloul and E. P. Lillehoj. (2006). Analysis of
chicken cytokine and chemokine gene expression following Eimeria acervulina and Eimeria
tenella infections. Vet Immunol Immunopathol. 114, 209-223.
Kim, S., C. M. Cox, M. C. Jenkins, R. H. Fetterer, K. B. Miska and R. A. Dalloul. (2014). Both
host and parasite MIF molecules bind to chicken macrophages via CD74 surface receptor. Dev
Comp Immunol. 47, 319-326.
Laing, K. J. and C. J. Secombes. (2004). Chemokines. Dev Comp Immunol. 28, 443-460.
Leng, L., C. N. Metz, Y. Fang, J. Xu, S. Donnelly, J. Baugh, T. Delohery, Y. Chen, R. A.
Mitchell and R. Bucala. (2003). MIF signal transduction initiated by binding to CD74. J Exp
Med. 197, 1467-1476.
Lue, H., R. Kleemann, T. Calandra, T. Roger and J. Bernhagen. (2002). Macrophage migration
inhibitory factor (MIF): mechanisms of action and role in disease. Microbes Infect. 4, 449-460.
Medzhitov, R. (2007). Recognition of microorganisms and activation of the immune response.
Nature 449, 819-826.
Miller, J. L., A. Harupa, S. H. Kappe and S. A. Mikolajczak. (2012). Plasmodium yoelii
macrophage migration inhibitory factor is necessary for efficient liver-stage development. Infect
Immun. 80, 1399-1407.
- 6 -
Miska, K. B., R. H. Fetterer, H. S. Lillehoj, M. C. Jenkins, P. C. Allen and S. B. Harper. (2007).
Characterisation of macrophage migration inhibitory factor from Eimeria species infectious to
chickens. Mol Biochem Parasitol. 151, 173-183.
Miska, K. B., S. Kim, R. H. Fetterer, R. A. Dalloul and M. C. Jenkins. (2013). Macrophage
migration inhibitory factor (MIF) of the protozoan parasite Eimeria influences the components of
the immune system of its host, the chicken. Parasitol Res. 112, 1935-1944.
Nathan, C. (2002). Points of control in inflammation. Nature 420, 846-852.
Ozaki, K. and W. J. Leonard. (2002). Cytokine and cytokine receptor pleiotropy and redundancy.
J Biol Chem. 277, 29355-29358.
Schwartz, V., H. Lue, S. Kraemer, J. Korbiel, R. Krohn, K. Ohl, R. Bucala, C. Weber and J.
Bernhagen. (2009). A functional heteromeric MIF receptor formed by CD74 and CXCR4. FEBS
Lett. 583, 2749-2757.
Sommerville, C., J. M. Richardson, R. A. Williams, J. C. Mottram, C. W. Roberts, J. Alexander
and F. L. Henriquez. (2013). Biochemical and immunological characterization of Toxoplasma
gondii macrophage migration inhibitory factor. J Biol Chem. 288, 12733-12741.
Starlets, D., Y. Gore, I. Binsky, M. Haran, N. Harpaz, L. Shvidel, S. Becker-Herman, A. Berrebi
and I. Shachar. (2006). Cell-surface CD74 initiates a signaling cascade leading to cell
proliferation and survival. Blood 107, 4807-4816.
Sun, T., T. Holowka, Y. Song, S. Zierow, L. Leng, Y. Chen, H. Xiong, J. Griffith, M. Nouraie, P.
E. Thuma, E. Lolis, C. J. Janse, V. R. Gordeuk, K. Augustijn and R. Bucala. (2012). A
Plasmodium-encoded cytokine suppresses T-cell immunity during malaria. Proc Natl Acad Sci
USA 109, E2117-2126.
Tarnowski, M., K. Grymula, R. Liu, J. Tarnowska, J. Drukala, J. Ratajczak, R. A. Mitchell, M.
Z. Ratajczak and M. Kucia. (2010). Macrophage migration inhibitory factor is secreted by
rhabdomyosarcoma cells, modulates tumor metastasis by binding to CXCR4 and CXCR7
receptors and inhibits recruitment of cancer-associated fibroblasts. Mol Cancer Res. 8, 1328-
1343.
Weiser, W. Y., P. A. Temple, J. S. Witek-Giannotti, H. G. Remold, S. C. Clark and J. R. David.
(1989). Molecular cloning of a cDNA encoding a human macrophage migration inhibitory
factor. Proc Natl Acad Sci USA 86, 7522-7526.
Weiser, W. Y., L. M. Pozzi and J. R. David. (1991). Human recombinant migration inhibitory
factor activates human macrophages to kill Leishmania donovani. J Immunol. 147, 2006-2011.
Zhang, J. M. and J. An. (2007). Cytokines, inflammation, and pain. Int Anesthesiol Clin. 45, 27-
37.
- 7 -
CHAPTER II
Literature Review
Avian immune system
The immune system is a complex network of organs, tissues, and cells which cooperate to
protect the host from invading and environmental threats that contribute to the maintenance of
immune homeostasis. Avian immune systems share many structural and functional
characteristics with those of mammals as both systems evolved from the same ancient reptilian
ancestor and retained general phylogenetic events. Since lineage separation over 200 million
years ago, avian immunological mechanisms and strategies consistently evolved to defend
against various pathogens and environmental antigens leading to its differential from mammalian
immune systems, yet many similar functional aspects to mammalian counterparts have been
conserved in avian species. For these reasons, it is necessary to understand unique
immunological elements of birds involved in the host-pathogen interactions as well as in
resistance to infections. Such a better understanding of the avian immune system can be applied
to develop effective strategy for controlling diseases, further benefit poultry health and reduce
production losses in the poultry industry. Considering its significant economic impact and
available resources such as genetic variation, the chicken is considered the model system among
avian species, especially much research has been devoted to the immune system of domestic
chicken, Gallus gallus, due to the availability of inbred lines.
Avian lymphoid systems architecturally consist of primary (or central) and secondary (or
peripheral) lymphoid tissues, which are developed from epithelial (e.g., thymus and bursa of
Fabricius) and mesenchymal origins (e.g., spleen and bone marrow), respectively. The primary
lymphoid tissues including thymus and bursa of Fabricius are colonized by the common
- 8 -
lymphoid progenitor (CLP) that develop into immunologically competent T and B cells,
respectively (Moore and Owen, 1965; 1967). These immunologically mature cells travel to the
secondary lymphoid tissues such as spleen, eye-associated lymphoid tissues (EALT; Harderian
gland and the conjunctiva of the lower eyelid), gut-associated lymphoid tissues (GALT; cecal
tonsils, Peyer’s patches, and Meckel’s diverticulum), and other mucosa-associated lymphoid
tissues (MALT), in which T and B cells occupy their respective compartments, T- and B-
dependent zones. In concert with compartmentalization of T and B cell areas, non-lymphoid
cells develop the specific microenvironment in each compartment, while lymphoid tissues
further mature following antigen stimulation (Hedge et al., 1982). The thymus and bursa of
Fabricius are the primary lymphoid tissues for cell-mediated and antibody-mediated immunity,
respectively. Like mammals, chicken thymus contains most T cells expressing the heterodimeric
T cell receptor (TCR) including αβ and γδ TCRs that detect antigens presented on the surface of
antigen-presenting cells (APCs) in conjunction with MHC molecules (Chen et al., 1991). T cells
bearing αβ TCR are divided into T helper cells (TCR-αβ+CD4+ T cells) and cytotoxic T cells
(TCR-αβ+CD8+ T cells) depending on the expression of cluster of differentiation (CD) marker on
the cell surface, CD4 and CD8, respectively. Humans and mice have very low population of γδ-
T cells (5%), while chickens have relatively higher number of γδ-T cells (30-50%) in peripheral
blood, tissues, and gut especially in cecal tonsils following infection (Bucy et al., 1991; Haas et
al., 1993; Arstila and Lassila, 1993; Pieper et al., 2011). As such, chickens belong to the group
of γδ-T cell-high species like pigs, cattle, sheep, and goats. γδ-T cells, which are similar in
phenotype and fuction to NK cells, can exert spontaneous cytotoxic function that may
compensate for the low number of NK cells lacking cytotoxic function in the spleen (Neulen and
Göbel, 2012; Fenzl et al., 2017). The bursa was first identified in birds as the source of B-
- 9 -
dependent lymphocytes to make antibodies that did not exist in mammals but later discovered to
be functionally equivalent to the mammalian bone marrow (Glick, 1987). The antibody
repertoire, technically B cell receptor repertoire, is generated by gene conversion. As chickens
have only a single copy of V (variable) and J (joining) segments for construction of light and
heavy chains, the diversity of immunoglobulins in chickens is theoretically less than that of
mammals generated via rearrangement of multiple copies of V, D (diversity), and J segments
(Reynaud et al., 1985). However, the engagement of pseudogene V segment in gene conversion
contributes to increase the size of antibody repertoire comparable to that of mammals (Reynaud
et al., 1987, 1989; Benatar et al., 1992). Birds have three classes of immunoglobulins, namely
IgM, IgA, and IgY, which are functionally equivalent to the mammalian homologues, while IgD
and IgE are absent in birds (Ratcliffe, 2006). Chicken IgM, the first Ig isotype to be expressed
during embryonic development, shows similar structure and function to its mammalian
counterpart. Avian IgY is predominantly expressed in the serum which shares the homology
with mammalian IgG and IgE (Bengten et al., 2000). Chickens secrete high amount of
polymeric IgA to protect the gastrointestinal tract (Wieland et al., 2004). Following maturation
of B cells expressing rearranged B cell receptors by aid of T helper cells, mature B cells exit the
bursa. In the secondary lymphoid tissues, chickens lack lymph nodes that are the primary site for
antigen presentation in mammals, but possess highly developed mucosa-associated lymphoid
tissues (MALT) instead (Higgins et al., 1996; Matsumoto and Hashimoto, 2000). The MALT,
also referred to as solitary lymphoid nodules, are mainly present in the lamina propria of the
mucosal membrane that is the major site of local IgA production (Casteleyn et al., 2010). Due to
poorly developed avian lymph nodes, the spleen is thought as an important organ responsible for
embryonic lymphopoiesis and interaction between lymphoid and non-lymphoid cells, although
- 10 -
not a primary site for differentiation and proliferation of lymphocytes. Chickens have single and
compact MHC including only two class I and II β alleles compared to the multigene families of
class I and II molecules in mammals that confer strong association with resistance or
susceptibility. Birds defend themselves against invading pathogens by two primary innate and
adaptive immune systems, which can communicate with one another in practice to overcome a
wide range of pathogens (Kaufman and Wallny, 1996; Kaufman, 2000). .
Innate immunity
The innate immune response is immediate and non-specific as the first cellular line of
defense against physical and chemical attacks on the host. The cellular components of the innate
immune system consist of macrophages, dendritic cells (DCs), neutrophils (heterophils in birds),
natural killer cells (NK), basophils, eosinophils, mast cells, epithelial cells, and γδ-T cells.
Among the innate immune cells, macrophages, DC, and neutrophils act primarily via
phagocytosis by identifying, engulfing, and eliminating pathogens. Macrophages and DCs
express MHC II molecules enabling them to present antigens to B and T cells and lead to the
activation of adaptive immunity. Avian heterophils, primary polymorphonuclear (PMN) cells,
are functionally equivalent to neutrophils in mammals (Harmon, 1998) that are recruited to the
infection site and destroy the pathogen or infected cells by phagocytosis, release of reactive
oxygen species (ROS), production of inflammatory molecules along with proteolytic enzymes
and antimicrobial peptides (Kogut et al., 2005; Genovese et al., 2013). Avian NK cells share
many features with CD8+ cytotoxic T cells, although they do not recognize specific antigens due
to the lack of surface TCR with their development independent of the bursa and thymus (Göbel
et al., 2001). The population of avian NK cells in blood, spleen and cecal tonsils (0.5-1%) was
- 11 -
found significantly lower than in mammals (10%) (Roger et al., 2008). Compared to mammals,
chickens have fewer eosinophils, basophils, and mast cells (Giansanti et al., 2006) that are
essential for allergic inflammation as well as in both innate and adaptive immunity. On the other
hand, chickens have a larger population of γδ-T cells (up to 50%) than mammals (5%),
predominantly as intraepithelial lymphocytes (IELs) at the mucosal surfaces of gastrointestinal
and reproductive tracts and do not require initial exposure to the antigens unlike conventional T
lymphocytes (Berndt and Methner, 2001).
The innate immune cells expressing pattern recognition receptors (PRRs), which are
limited by the number of soluble and cell-associated receptors encoded in the germline. They
firstly distinguish if invading microbial pathogens are self or non-self antigen and respond to the
common signature molecules of pathogens known as microbe-associated molecular patterns
(MAMPs) (Mackey and McFall, 2006). Polymorphisms or mutations in PRRs are involved with
the susceptibility to diseases, in general four major classes of PRRs include Toll-like receptors
(TLRs), C-type lectin receptors (CLRs), RIG-I (retinoic acid-inducible gene I)-like helicase
receptors (RLRs), and NOD (nucleotide oligomerization and binding domain)-like receptors
(NLRs). Among PRR families, TLRs are divided into two groups on the basis of their cellular
localization that are the best characterized family of membrane-bound PRRs. In mammals,
TLR1, 2, 4, 5, 6, and 11 are expressed on the cell surface and recognize microbial membrane
components, while TLR3, 7, 8, and 9 are localized within the intracellular compartments such as
endosome, lysosome, and endoplasmic reticulum (ER) where they detect microbial nucleic acids
(Kawai and Akira, 2009). Chicken TLRs show patterns of gene duplication and loss compared
to those of mammals (Kaiser, 2010). To date, 10 chicken TLRs have been confirmed, of which
TLR3, 4, 5, and 7 are orthologous to those found in mammals (Leveque et al., 2003; Iqbal et al.,
- 12 -
2005a,b; Philbin et al., 2005) and TLR9 and 11 are absent in the chicken genome (Temperley et
al., 2008; Kaiser, 2010). Duplicated genes, TLR1LA and TLR1LB, are equivalent to the human
TLR1/6/10, and single TLR2 in mammals appear to be duplicated as TLR2A and TLR2B in
chickens (Fukui et al., 2001; Iqbal et al., 2005a; Yilmaz et al., 2005). Besides, there are two
chicken-specific TLRs such as TLR15 and 21. TLR15 was shown to elicit NF-κB in HEK293
cells, while TLR21 was found to recognize unmethylated CpG motifs (Brownlie et al., 2009;
Nerren et al., 2010; Boyd et al., 2012). As the family of cytosolic PRRs, NLRs are composed of
more than 20 members, of which NOD1 and 2 have been well characterized. In chickens,
NOD1, NLRC5 (NLR containing a caspase-recruitment domain), and NLRP3 (NOD-like
receptor protein 3) have been described (Lian et al., 2012; Tao et al., 2015; Ye et al., 2015),
although NOD2 and 14 genes of NALPs (NACHT-, LRR-, and pyrin domain containing protein)
are absent. Both TLRs and NLRs initiate overlapping signaling pathways upon antigen
recognition, suggesting cooperation of those receptors as innate sensors of pathogens (Martinon
et al., 2005). RIG-I was found in the duck genome (Barber et al., 2010), but not yet in the
chicken genome. The deficiency of RIG-I in chickens was attributed to the high susceptibility to
infection by avian influenza virus compared to ducks (Liniger et al., 2012).
PRRs express multiple leucine-rich regions to bind MAMPs including proteins,
carbohydrates, lipids, nucleic acids, along with lipopolysaccharide (LPS) and peptidoglycan,
which are primary endotoxins derived from Gram-negative bacteria and common structural motif
of Gram-positive bacteria, respectively (Zipfel and Felix, 2005; Akira et al., 2006). In addition,
stressed, injured, or transformed host cells release unique molecules as endogenous danger
signals, which is known as damage-associated molecular pattern molecules (DAMPs), alerting
the innate immune system (Kono and Rock, 2008; Srikrishna and Freeze, 2009). DAMPs
- 13 -
include heat-shock proteins and altered membrane phospholipids (Weismann and Binder, 2012).
Upon exposure to stimuli, innate immune cells are activated to recognize MAMPs or DAMPs
through PRRs and exert many effector functions including phagocytosis and degranulation, as
well as secretion of the inflammatory mediators activating a multitude of intracellular signaling
pathways toward inflammatory or antimicrobial responses, thus limiting the spread of pathogens
and priming the adaptive immune systems.
Adaptive immunity
The adaptive immune responses are only triggered when T and B lymphocytes recognize
processed antigens presented by MHC on APCs including macrophages, DCs, and B cells. Like
mammals, the main effector mechanisms are made up of humoral immune responses and cell-
mediated responses via antibody production from B cells and actions of cytotoxic and helper T
cells. MHC molecules are classified as class I and II based on the antigen type they present.
MHC class I molecules are expressed on most cells and bind to antigenic peptide derived from
intracellular pathogens. MHC I-bearing antigens are recognized by CD8+ cytotoxic T cells and
directly kill infected cells. On the other hand, MHC class II molecules expressed predominantly
on APCs bind antigenic peptides derived from extracellular pathogens that are detected by CD4+
helper T cells (Germain, 1994), thereby leading to the production of cytokines that activate other
cells. The classical helper T cells are classified into distinct subsets such as Th1, 2, and 17 based
on the patterns of cytokine production. As previously described, TCR signaling is triggered by
antigen recognition via MHC. Co-stimulatory signals acting in concert are required to initiate
clonal expansion and differentiation of naïve T cells into effector cells by interaction between B7
protein family (CD80 and CD86) on APCs and their receptors CD28 or cytotoxic T-lymphocyte
- 14 -
antigen 4 (CTLA-4) on T cells. In the absence of co-stimulation, T cells fail to differentiate into
effector cells resulting in apoptosis of T cell clonal population as well as T cell clonal anergy
(Harris and Ronchese, 1999). CD28 homologue was identified on all T cells and γδ-T cells from
chicken peripheral blood and shared similar functions with mammalian CD28 (Arstila et al.,
1994; Koskela et al., 1998). CTLA-4 homologue in chickens also possesses similar features with
its mammalian counterpart (Bernard et al., 2007). Unlike non-specific and broad scanning of
antigen in innate immune system, T and B cells express respective homogenous receptors from a
single clone of each cell recognizing only one specific epitope. In addition, the development of
immunological memory contributes to the rapid and efficient responses to subsequent infections
with the same pathogen.
Immune mediators
Many immune cells produce a variety of immune molecules that allow them to
communicate with one another by extracellular signaling and coordinate dynamic immune
responses. Among immune molecules secreted by immune cells, cytokines typically are the
most important immune mediators. Originally, soluble substances derived from lymphocytes
and monocytes/macrophages that regulate the growth and function of cells were called
lymphokines and monokines, respectively (Dumonde et al., 1969). Subsequently, all these
protein substances generated in cell-mediated reactions for host defense were generally termed as
“cytokine” by Cohen (1974). Cytokines are secreted typically as soluble form with low
molecular weight typically less than 30 kDa, and influence the behavior of cells bearing specific
receptors in autocrine, paracrine, and endocrine manners. The expression of a cytokine and its
receptor is tightly regulated, the action of which can be attributed to the pattern of gene
- 15 -
expression in target cells. They act as key regulatory mediators initiating, amplifying, and
regulating subsequent cellular differentiation/proliferation and immune processes, including
innate and adaptive responses. With pleiotropic effect and functional redundancy, cytokines can
trigger the production of other cytokines, and combination of cytokines contributes to well-
balanced immune responses (Ozaki and Leonard, 2002). As a large subfamily of cytokines,
chemokines generally are secreted as low molecular weight (7-15 kDa) proteins and able to
control the migration and location of all immune cells via their chemotactic action. Chemokines
primarily are classified according to the arrangement of the first two N-terminal cysteine
residues along with their known biological roles (Rollins, 1997).
Over time, the evolutionary distance between birds and mammals has increased resulting
in the rapid divergence of orthologous sequences under selection pressure exerted by pathogens
shaping the repertoire and evolution of immunity genes (Murphy, 1993; Kaiser, 2007; Temperley
et al., 2008). Accordingly, it is difficult to apply knowledge of molecular components of the
mammalian immune system to the avian counterparts. Following the release of the chicken
genome sequence (Wallis et al., 2004), many avian equivalents of mammalian cytokines and
chemokines were cloned and their biological roles in immune response characterized. However,
knowledge of the dynamics and plasticity of repertoires of avian cytokines and chemokines is
markedly scarce compared to mammalians as few cross-reactive antibodies are available due to
low sequence homology (25-35% amino acid sequence identity) between avian and mammalian
cytokines (Kaiser et al., 2005; 2007). Therefore, research on the avian immunity genes is
required to improve the current genome annotation of widely used poultry species including
chicken, turkey and duck, as well as to cover the existing gaps in the functionally important
- 16 -
genomic loci. Furthermore, understanding of avian immunity genes may be applied for vaccine
development as well as therapeutic treatments in the poultry industry.
Avian cytokines
Avian cytokines are generally classified based on their functions such as pro-
inflammatory, Th1, Th2, and Th17 response relative cytokines (Wigley and Kaiser, 2003). The
correlation among the expression of these cytokines can describe a great deal about the immune
response to specific pathogens. Promptly induced cytokines in response to stimuli have been
termed pro-inflammatory cytokines that are involved in the induction of innate immune
responses. This group generally includes IL-1β, IL-6, and TNF-α. As the IL-1 family members,
IL-1β is on chicken chromosome 22 whose primary pro-inflammatory effect is inhibited by IL-
1RN (IL-1 receptor antagonist), which is another IL-1 family member (Weining et al., 1998;
Gibson et al., 2012). Chicken IL-6 shares 35% amino acid sequence identity to human IL-6
which was able to induce proliferation of IL-6-dependent murine hybridoma cell line 7TD1 with
an increase in the level of serum corticosterone following injection into chickens (van Snick et
al., 1986; Schneider et al., 2001). Also, IL-6 activities during Eimeria infection and poult
enteritis and mortality syndrome (PEMS) described its function in inflammatory and immune
responses (Heggen et al., 2000; Lynagh et al., 2000). TNF-α, a monocyte-derived tumor
necrosis factor, was originally identified as an endotoxin-induced serum factor responsible for
the necrosis of certain tumors, subsequently described as a potent inflammatory mediator in the
innate immune system (Carswell et al., 1975). The precursor of TNF-α is initially located in the
plasma membrane, turns into soluble form via multiple proteolytic processes, and plays a central
role in the inflammatory action by inducing pro-inflammatory signals, typically IL-12
- 17 -
expression, as well as expression of adhesion molecules and growth stimulation (Turner et al.,
2014). TNF-α was initially thought to be missing in the avian genomes; instead, LPS-induced
TNF-α like factor (LITAF) was thought to be the functionally equivalent cytokine to mammalian
TNF-α (Hong et al., 2006b). More recently, Rohde et al. (2018) described TNF-α homologues in
avian species, cloned and expressed the full-length chicken TNF-α, and explored some of its
biological role in NF-κB activation. They attributed its long time absence from avian genomes
to the high GC content of the genomic region (microchromosomes), which resulted in poor
genome assembly.
In mammals, CD4+ effector T cells are subdivided into Th1, Th2, Th17, and Treg on the
basis of cytokine profiles they produce (Murphy and Reiner, 2002; Sallusto and Lanzavecchia,
2009). Protective Th1-related cytokines are involved in cellular immune responses, while Th2-
related cytokines are associated with humoral immunity and anti-inflammatory properties
(Jankovic et al., 2001). Th17 cells were found to recruit macrophages and neutrophils to infected
sites and amplify the inflammatory reactions. In chickens, cell subsets with Th1/Th2 paradigm
have been well described (Degen et al., 2005) but not Th17 cells in contrast to mammals;
instead, effector cytokines related to Th17 cells have been identified. Many cytokines and
chemokines found in mammals are also present in chickens, several others are still absent.
Consistent with the concept of minimal essential MHC for chickens, the family of cytokines and
chemokines contain smaller members in chickens than mammals (Kaufman, 1999). Although
most chicken cytokines have relatively low sequence homology compared to human
homologues, their effector functions appear to be conserved.
Th1 cytokines consist of IL-12, IL-18, and IFN-γ, which is associated with inflammatory
cytolytic responses that destroy cells infected with viruses or other intracellular microbes. Of the
- 18 -
Th1 cytokines, IFN-γ is the key signature cytokine that is associated with Th1 cell responses,
especially in controlling infection with intracellular pathogens. As in mammals, avian interferon
was identified as an antiviral cytokine from virus-induced embryonated chicken eggs and
embryo cells as well as concanavalin A (ConA)-stimulated splenocytes, and divided into two
classes as type I IFNs (IFN-α and IFN-β) and type II IFN (IFN-γ) (Krempien et al., 1985; Kohase
et al., 1986; Pusztai et al., 1986). Antiviral activity of purified type I chicken IFN was
remarkably resistant to acid and heat treatments that was observed in other Galliformes species.
As avian type II IFN, chicken IFN-γ is encoded by a single gene located on chromosome 1 that
was identified by cDNA library screening with highly conserved regional and structural
similarity to mammalian homologues, albeit low amino acid sequence identity (Kaiser et al.,
1998). Recombinant IFN-γ exhibited antiviral and macrophage activating factor (MAF)
activities, with up-regulation of transcription of class II MHC genes, Guanylate-binding proteins
(GBP), and iNOS as well as production of nitric oxide from the chicken macrophage HD11 cell
lines (Digby and Lowenthal, 1995; Weining et al., 1996). The production of IFN-γ in chicken T
cells is regulated by other Th1 cytokines, IL-12 and IL-18 (Barbulescu et al., 1998). As another
typical Th1 cytokine, two subunits of chicken IL-12, IL-12p35 and IL-12p40, were cloned and
characterized (Balu and Kaiser, 2003; Degen et al., 2004). Consistent with the bioactivity of
mammalian IL-12 in heterodimeric form, chicken IL-12p35 covalently links to the p40 subunit
forming the heterodimer p70, and turning to bioactive IL-12 inducing the synthesis of IFN-γ;
however, ChIL-12p40 alone is not able to induce IFN-γ expression (Gubler et al., 1991).
Likewise, the combination of p35 and p40 is only able to activate its properties including
proliferation and induction of nitric oxide in splenocytes (Degen et al., 2004). Intriguingly,
biological features of ChIL-12 are highly similar to their mammalian counterparts despite a
- 19 -
limited sequence homology (~30-50%) that indicates the functional conservation of IL-12 since
separation of avian and mammalian lineages ~300 million years ago (Degen et al., 2004). With
IL-12, chicken IL-18 induced high level of IFN-γ secretion by splenocytes and regulated
proliferative activity of splenocytes (Göbel et al., 2003). IFN-γ-inducing activity of IL-18 was
facilitated in synergy with IL-12 in mammals, while the biological effects of chicken IL-18 were
shown independent of IL-12 (Barbulescu et al., 1998; Schneider et al., 2001). The
immunoregulatory actions of chicken IL-18 were exerted following caspase-1 cleavage after
conserved aspartate residue in contrast to chicken IL-1β lacking a cleavage site (Giansanti et al.,
2006).
Th2 cells produce IL-3, IL-4, IL-5, IL-13, and granulocyte macrophage colony
stimulating factor (GM-CSF) that are involved in responses to extracellular parasitic pathogens
like helminths and allergic reactions, of which IL-5 was identified as a pseudogene in chickens
(Avery et al., 2004; Kaiser et al., 2005). In addition to the canonical Th2 cytokines, cytokine-
like transcript termed KK34 is encoded in the Th2 gene cluster between GM-CSF and P4HA2
that was found only in chicken γδ-T cells but not in the mammalian cells. Chicken IL-4 and IL-
13 were shown to promote B cell proliferation when co-stimulated with CD154 (CD40 ligand).
Contrast to mammals, chicken IL-4 exhibited bi-directional immune regulatory functions in
macrophages by activating or inhibiting NO synthesis in the absence or presence of microbial
MAMPs, respectively (He et al., 2011). Besides, IL-10 is considered as a Th2 promoting
cytokine based on the functions in inhibiting transcription of IL-12 and pro-inflammatory
responses of APCs (Mocellin et al., 2003; Trinchieri, 2003). Similar to mammalian IL-10,
chicken homologue was shown to induce anti-inflammatory activities by inhibiting IFN-γ
synthesis in lymphocytes activated with ConA and phytohaemagglutinin (PHA), also increased
- 20 -
expression after infection with Eimeria maxima and E. acervulina (Rothwell et al., 2004; Hong
et al., 2006a).
Th17 effector cytokines including IL-17A, IL-17F, IL-21, and IL-22 have been identified
in chickens, of which IL-22 is known to be produced by both Th17 and Th22 cells with high
levels in Th22 subsets (Eyerich et al., 2009). IL-17A is known as essential cytokine in host
defense at mucosal linings against extracellular bacteria and fungi as well as in autoimmune
diseases (Huang et al., 2004; Cho et al., 2010a; Tabarkiewicz et al., 2015). In chickens, IL-17A
production was identified in splenocytes, peripheral blood mononuclear cells (PBMCs), and
IELs, and was found to induce IL-6 expression and NO production in HD11 cells. Given the
prominent expression of IL-17A in both CD4+ T cells and γδ-T cells, the presence of a αβ-Th17
cell subset in the chicken was suggested (Walliser and Göbel, 2018). IL-17F was initially
identified using IL-17A sequences (Hymowitz et al., 2001). Further, IL-17F has similar pro-
inflammatory activities in the gut as IL-17A. In chickens, IL-17F also exhibited similar
biological activities compared to that of IL-17A in primary chicken embryonic fibroblasts,
although different expression of IL-17A and IL-17F were shown in mitogen-stimulated splenic
lymphocytes and Eimeria-infected intestinal tissues (Kim et al., 2012b). Chicken IL-21 is
predominantly expressed in CD4+ T cells that enhances proliferation of splenocytes and
thymocytes, similar to T cell co-stimulatory effect by mammalian counterpart. Like in
mammals, chicken IL-21 had similar inhibitory effect on DC maturation (Rothwell et al., 2012).
Chicken IL-22, a member of IL-10 family, induced expression of pro-inflammatory cytokines
including IL-1β, IL-6, and serum amyloid A (SAA), with antimicrobial peptide AvBD2 in
epithelial cells and hepatocytes (Kim et al., 2012a). IL-23 is a heterodimeric cytokine composed
of p19 and p40 subunits that is essential for cell differentiation of Th1 and 17 subsets (Bettelli
- 21 -
and Kuchroo, 2005; Kobayashi et al., 2008). More recently, p19 subunit of IL-23 was cloned
and its complex with subunit p40 of IL-12 characterized as pro-inflammatory activator in
chickens (Truong et al., 2017).
Evolutionarily conserved cytokines across birds
A unique characteristic of avian genomes is the large variability in the size of the
genome, although the physical size of the avian genome is around threefold smaller than that of
mammals (International Chicken Genome Sequencing Consortium, 2004). Depending on the
size, chicken genome is generally classified into macrochromosomes and microchromosomes
(Fillon, 1998). When comparing chicken and turkey genomes, microchromosomes showed
significantly higher sequence divergence in introns and higher rate of synonymous substitutions
in coding sequences than macrochromosomes (Axelsson et al., 2005). These observations likely
resulted from variation in germline mutation rate between chromosomal classes. In addition,
lower ratio of non-synonymous to synonymous substitutions (dN/dS) for genes located in
microchromosomes than those of macrochromosomes indicates that genes on
microchromosomes are more evolutionary conserved (Axelsson et al., 2005; Burt et al., 2005).
Comparative genomic analysis among chicken, turkey, and zebra finch showed that avian
genomes have remained relatively stable and conserved during evolution in comparison to
mammalian equivalents (Griffin et al., 2008; Dalloul et al., 2010).
Comparative analyses of the turkey and chicken genomes revealed sharing higher
sequence identity (Dalloul et al., 2010). Type I IFN was firstly identified to share high sequence
identity between chicken and turkey. Consistent with sequence similarity, chicken type I IFN
was shown to cross-react with both chicken and turkey cells to a similar extent, while functional
- 22 -
activity of turkey counterpart had less cross-reactivity with chicken cells and showed more
species-specificity than that of chicken (Suresh et al., 1995). Compared with type I IFN, IFN-γ
of chicken and turkey have the same size and high sequence identity, leading to similar ability to
stimulate macrophages and induce nitric oxide production, which was evidenced by neutralizing
the biological effects of chicken and turkey IFN-γ with antibody to chicken IFN-γ (Lawson et al.,
2001; Loa et al., 2001). IFN-γ has also been cloned from other Galliformes species including
guinea fowl, pheasant, and Japanese quail, which was cross-reactive among these species based
on high identity at the amino acid sequence level with conserved IFN-γ receptor binding motif
(Kaiser et al., 1998). Of interest, chicken and turkey IL-2 exert proliferation of both chicken and
turkey thymocytes despite less conserved sequence identity compared to their mammalian
counterparts (Lawson et al., 2000). Both chicken and turkey IL-10 also share similar ability to
inhibit IFN-γ expression in chicken and turkey splenocytes (Powell et al., 2012). IL-1β-encoding
genes of five avian species (chicken, turkey, duck, goose, and pigeon) showed sequence identity
range of 77-99% and their functional homology was confirmed by neutralizing biological
activity of IL-1β with homologous or heterologous antiserum (Wu et al., 2007). In addition,
cross-species reactivity of chemokine CXCL8 (IL-8) among the five avian species was observed
in binding reactivity between antisera and each CXCL8 protein (Wu et al., 2008). Such
sequence and functional conservation of avian immune mediators provides unique perspective on
the evolution of the immune system in birds.
Macrophage migration inhibitory factor (MIF)
In the beginning of lymphokine research, MIF was firstly explored as an immune
molecule secreted from activated lymphocytes exposed to antigen that influences the migration
- 23 -
of macrophages (Bloom and Bennett, 1966; David et al., 1966). Beyond its eponymous role in
modulating mobility of macrophages, MIF is now known as a pluripotent cytokine promoting the
production of pro-inflammatory cytokines and regulating both innate and adaptive immunity,
along with chemokine-like functions (Bacher et al., 1996; Mitchell et al., 2002; Calandra and
Roger, 2003; Schober et al., 2008). In addition, it sustains immune cell survival by counter-
regulating immunosuppressive action of glucocorticoids and inhibiting p53-dependent apoptosis
(Calandra et al., 1995; Flaster et al., 2007). Unlike most other cytokines, MIF is constitutively
expressed in a variety of immune and non-immune cells and stored in intracellular pools, thereby
rapidly released in response to diverse stimuli without de novo protein synthesis due to the
deficiency of N-terminal conventional leader sequence required for classical protein synthesis
(Flieger et al., 2003). Secreted MIF can act in an autocrine or paracrine manner to promote
immune responses (Onodera et al., 1997).
By analysis of its crystal structure, a potential mechanism of MIF actions have been
deduced. First of all, in accord with the fact that three-dimensional structure of MIF closely
resembles to that of two oxidoreductase and tautomerase, MIF exerted keto-enol tautomerase
enzymatic activities (Rosengren et al., 1996, 1997; Kleemann et al., 1998), although not
exhibited in avian MIFs. Second, the topological similarity of MIF with CXCL8 is likely to be
involved in chemokine-like function (CLF) of MIF. MIF has a pseudo-ELR motif comprising
Asp and Arg that mimics an N-terminal ELR (Glu-Leu-Arg), which is a common binding site of
chemokine to its receptor and essential for signaling through CXCR2 (Weber et al., 2008).
Despite such similar features of MIF with chemokines, MIF is not classified as a chemokine due
to the lack of N-terminal cysteine motif. Instead, MIF has been defined as CLF chemokine
- 24 -
based on its role in chemotaxis and leukocyte arrest by inducing the expression of adhesion
molecules or other chemokines (Tillmann et al., 2013).
MIF has been considered to be a pivotal regulator of both innate and adaptive immune
responses. As an upstream regulator of innate immunity, abundant expression of MIF was
observed in innate cells including neutrophils, eosinophils, and mast cells, upon stimulation that
sustained the activation of monocytes and macrophages and contributed to inflammatory
responses (Rossi et al., 1998; Riedemann et al., 2004; Wang et al., 2006). On the contrary, MIF-
deficient macrophages were hyporesponsive to bacterial infection, as shown by reduction of PRR
dectin-1 expression after microbial infection resulting in decreased production of cytokines
(TNF-α, IL-10, IL-12) and ROS along with impaired mycobacterial killing (Das et al., 2013).
MIF also leads to up-regulation of TLR4 expression in resting monocytes, thereby enabling
macrophages to be more sensitive to endotoxin and Gram-negative bacterial infection and
rapidly releasing pro-inflammatory cytokines for mounting the host defensive responses (Roger
et al., 2003). In the gastrointestinal tract, MIF plays a role in the up-regulation of M cell-
mediated transport of microparticles in the intestine (Man et al., 2008). In addition, MIF also
regulates subsequent adaptive responses. Neutralization of MIF in mice suppressed T cell
priming and proliferation as well as antibody production (Bacher et al., 1996). The role of MIF
in both B cell survival and differentiation of Th17 cells further supports the involvement of MIF
in adaptive immunity (Gore et al., 2008; Stojanović et al., 2009).
Mechanism of MIF action
MIF exerts its biological activities through a classical receptor-mediated pathway and
through a non-classical endocytic pathway. Depending on the cell type and stimulus status, MIF
- 25 -
can bind to different receptors, which results in different downstream signaling events (Fig. 2.1).
CD74 was firstly identified as a high affinity receptor for MIF (Leng et al., 2003). CD74 was
originally known as the cell surface form of MHC II invariant chain (li), which regulates
antigenic presentation to MHC class II proteins through its CLIP domain. Subsequently, CD74
was found to be expressed in the absence of MHC II protein binding to MIF as a membrane
receptor (Borghese and Clanchy, 2011). As such, MIF binds to the extracellular domain of
Figure 2.1. Signal transduction through the MIF receptors CD74, CXCR2 and CXCR4.
Schematic illustration represents how an individual receptor interacts with MIF and triggers
cellular signaling pathways (Bucala, 2012).
CD74 and forms a complex with co-receptor CD44, which is necessary for MIF signal
transduction (Meyer-Siegler et al., 2004; Shi et al., 2006). Although CD74/CD44 complex can
be formed even in the absence of MIF, this complex is required for the signaling cascade induced
by MIF (Gore et al., 2008). MIF signaling through CD74/CD44 receptor complex leads to the
phosphorylation of serine in the cytoplasmic tails of both MIF receptors, activation of a Src-
- 26 -
family tyrosine kinase (Shi et al., 2006), and initiation of ERK1/2 signal transduction. This
cascade results in MIF-dependent cell proliferation, survival, and pro-inflammatory
phospholipase A2 activity (Mitchell et al., 1999; Lue et al., 2006), as detailed below. ERK
cascade includes cytosolic phospholipase A2 (cPLA2), which produces the arachidonic acid and
activates c-Jun-N-terminal kinase (JNK) that promotes the efficient expression of pro-
inflammatory cytokines such as TNF-α, IFN-γ, IL-6, along with chemokine IL-8, MIP-2, COX-
2, and nitric oxide (Calandra and Roger, 2003). This pro-inflammatory response is also
associated with ERK-mediated NF-κB activation (Binsky et al., 2007). A series of events results
in inflammatory responses that can be suppressed by anti-inflammatory action of glucocorticoids
via expression of MAP kinase phosphatase (MKP-1) (Roger et al., 2005; Aeberli et al., 2006).
Moreover, MIF binding to CD74 prevents apoptosis and promotes cell survival through
activation of the phosphoinositide-3-kinase (PI3K)/AKT signaling pathway, which is initiated by
activation of receptor tyrosine kinases or G-protein-coupled receptors (Wetzker and Bohmer,
2003), along with a suppression effect of MIF on p53-mediated cell cycle arrest and apoptosis
(Mitchell et al., 2002).
In addition, chemokine receptors CXCR2 and CXCR4, seven helix-spanning G-protein
coupled receptors, were identified as functional receptors for MIF to play crucial role in
controlling cell chemotaxis and arrest in the inflammatory reactions (Bernhagen et al., 2007). At
the molecular level, noncognate interactions between MIF and chemokine receptors are based on
the structural homology between the MIF monomer and dimers of CXC family chemokines.
According to kinetic data of complex formation, noncognate binding of MIF to CXCR4
exhibited lower affinity than that with CXCR2 or CD74. Through CXCR2/CXCR4, MIF
initiates Gαi-coupled signaling pathway that induces up-regulation of the transcription of the αγβ3
- 27 -
integrin and calcium influx, followed by recruitment of monocytes/neutrophils and T cells under
atherogenic or inflammatory conditions (Bernhagen et al., 2007). MIF also induced monocyte
adhesion through rapid integrin activation similar to the effect of CXCL8 on cell arrest. CXCR2
was originally known as the most promiscuous receptor binding to ELR motif of seven known
CXC chemokines CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, and CXCL8 (Murphy et
al., 2000; Stillie et al., 2009). Given the homologous structural feature between MIF monomer
and the CXCL8 dimer, the possibility of MIF complexing with CXCR2 was elicited and the
function of CXCR2 ligand was shown as a non-cognate receptor (Weber et al., 2008). The
MIF/CXCR2 complex was able to arrest and recruit monocytes and neutrophils through
triggering calcium influx and integrin activation (Bernhagen et al., 2007; Cho et al., 2010b).
Basically, CXCR4 was thought to be a G-protein coupled receptor specific for CXCL12/SDF-1α
(stromal-derived factor-1α) (Bleul et al., 1996; Oberlin et al., 1996). Since the evidence that N-
like loop of MIF helps to interact with the N-domain of CXCR4 was demonstrated, CXCR4 was
considered as another non-cognate receptor for MIF to initiate signal transduction involved in T
cell adhesion and transmigration (Bernhagen et al., 2007). MIF signaling is also triggered by
heteromeric complexes formed by CD74 and CXCR2 or CXCR4. MIF, along with CXCR2 and
CD74, is involved in monocyte chemotaxis (Bernhagen et al., 2007), whereas MIF signaling
through CXCR4 and CD74 induces gene expression of the inflammatory chemokine CXCL8 in a
JNK-dependent manner (Schwartz et al., 2009; Lue et al., 2011). In addition to the direct link of
MIF/CXCR signaling toward leukocyte chemotaxis and arrest, both endogenous and exogenous
MIF indirectly enhance monocyte adhesion and endothelial transmigration in combination with
adhesion molecules, other chemokines, and pro-inflammatory stimuli (Gregory et al., 2004,
2006).
- 28 -
Later, CXCR7 was identified as an additional decoy receptor for MIF. CXCR7, a seven-
transmembrane receptor, was previously characterized as a receptor for CXCL11 and CXCL12
(Balabanian et al., 2005; Burns et al., 2006). Unlike other prototypical chemokine receptors,
CXCR7 contains amino acid substitution in the second intracellular loop, and thereby CXCR7
per se does not trigger G-protein signaling nor causes Ca2+ mobilization in response to ligand
binding (Burns et al., 2006; Zabel et al., 2009). In addition to CXCR7 interaction with either
CXCL11 or CXCL12, CXCR7 was implicated in a direct interaction with MIF as well. CXCR7
was shown to internalize on human rhabdomyosarcoma (RMS) cells following exposure to MIF
that also engaged in MIF-induced RMS cell adhesion with CXCR4 (Tarnowski et al., 2010).
MIF binding to CXCR7 counteracted apoptotic effect on platelets through activation of the
PI3K/AKT pathways (Chatterjee et al., 2014).
The role of parasite MIF
Many MIF orthologues encoded in apicomplexan parasites such as Plasmodium,
Toxoplasma, and Eimeria have been identified and implicated in the pathogenesis of parasitic
infection. These MIF orthologues were described to share structural as well as biological
similarities with mammalian MIFs, suggesting that parasite proteins may act to modulate the host
immune response. Using a genetically modified strain of Plasmodium berghei, the role for
Plasmodium orthologue of MIF in regulating the host inflammatory response to malaria was
explored (Sun et al., 2012). Mice infected with the MIF-deficient P. berghei showed less
production of inflammatory cytokines and reduced apoptosis of active CD4 T cells. Conversely,
the presence of MIF increased the susceptibility of CD4 T cells to apoptosis, thereby blocking
differentiation of CD4 T cells into memory T cells. These findings highlight the importance of
- 29 -
Plasmodium MIF in regressing the adaptive immune response and interfering in long-term
protection by memory CD4 T cells, further enabling parasites to evade immunological
destruction against homologous parasites. In the mouse experimental model of malaria caused
by P. yoelii, Plasmodium MIFs acted synergistically with host MIF to activate MAPK-ERK1/2
signaling pathway at low concentration, while both acted antagonistically at high concentration
(Shao et al., 2010). During infection, mice had a marked upregulation of several pro-
inflammatory cytokines following challenge with recombinant Plasmodium MIF and delay in
onset of death. The involvement of Plasmodium-encoded MIF for efficient liver-stage
development of Plasmodium was also identified by utilizing a MIF knockout P. yoelii (Miller et
al., 2012). Furthermore, Plasmodium MIF was shown to bind mammalian MIF receptor, CD74,
indicating that parasite MIF might be capable of interfering with host MIF activity through
comparative ligand binding (Dobson et al., 2009). In addition, MIF homologue in Toxoplasma
exhibited enzymatic and immunologic activities by production of recombinant MIF protein from
Toxoplasma gondii. MIF homologue in the T. gondii induced production of the chemokine
CXCL8 by host PBMCs through ERK signaling pathways (Sommerville et al., 2013), triggering
the early recruitment of neutrophils to the site of infection and synthesis of CC chemokine ligand
(CCL). MIF homologue also leads trafficking of immature dendritic cells that may function as
Trojan horses and facilitate parasites dissemination. Thus, these findings demonstrate the
immunomodulatory activity of Toxoplasma MIF during infection in mammals. Another
apicomplexan parasite, Eimeria, also produces a MIF orthologue during developmental stages
(schizonts, macrogametes, and oocysts) with high amounts found in excretory-secretory products
of E. acervulina merozoites (Miska et al., 2007). Secreted MIF was detected in the columnar
epithelial cells 24 h post-infection with Eimeria sporozoites (Miska et al., 2013), supporting the
- 30 -
essential role of MIF during developmental cycle of Eimeria parasites and infection of host
tissues. Eimeria MIF (EMIF) has been characterized as sharing conserved secondary structure
and similar biological properties with mammalian MIFs, including inhibitory activity of
macrophage migration and enhancement of pro-inflammatory cytokine expression. It appears
that EMIF is partially orthologous to mammalian MIF with respect to structural and biological
properties. Also in the phylum Apicomplexa, Leishmania species also found to encode
orthologues of mammalian MIF, whose role in promoting parasite persistence has been
demonstrated using genetic manipulation strategy (Holowka et al., 2016). MIF-deficient
Leishmania enhanced susceptibility to destruction by LPS-stimulated macrophages, thus
showing the protective action of Leishmania MIF on host cell apoptosis. Also, Leishmania MIF
was able to mimic the abilities of mammalian MIF by interacting with host receptor CD74 and
regulating migration of PBMCs (Kamir et al., 2008). Furthermore, the anti-apoptotic action of
Leishmania MIF was shown to engage with host MIF receptor CD74. Given these reports, MIF
orthologues in parasitic organisms may have potential capabilities in regulating host-parasite
interaction, which in turn may facilitate long-term parasitism and establish permissive conditions
for parasite survival.
Genetic modification of parasites
Many parasitic diseases are increasingly caused by apicomplexan species in human and
domestic animals. As these parasites negatively impact animal health, novel strategy and
approaches for controlling the spread of such diseases are needed. In order to develop new
control strategy, the understanding of the molecular biology of apicomplexan parasites and
disease pathogenesis is indispensable. In this context, recent studies have aimed to describe the
- 31 -
role of certain genes or molecular mechanisms involved in host cell invasion, the strategy to
escape host immune system, parasite transmission, and virulent factors by application of gene
manipulation methods to apicomplexan parasites of veterinary interest. Comparison of annotated
genome sequences of apicomplexan parasites allows identification of conserved molecules
across species, which may be essential for the life cycle of parasite, species-specific genes, and
genes involved in adaptation to host, that can be the target of gene manipulation techniques.
Following genetic modification techniques including gene knock-out or knock-in, their functions
can be characterized and exploited for identification of therapeutic targets. For example, the
microneme protein SPATR was found to be conserved in Plasmodium, Toxoplasma, Eimeria,
and Neospora, and contributes to invasion and virulence (Huynh et al., 2014). With the
availability of genome sequence and in vitro culture, the application of genetic manipulation
becomes a critical tool for investigating the molecular biology of parasites including virulent
factors and parasite transmission factors, which may enable the development of novel vaccine
delivery platforms. Currently, classic transfection methods are commonly used to insert
exogenous DNA by homologous recombination and more recently CRISPR/Cas9 system has
been applied to apicomplexan parasites.
Apicomplexan parasites: Eimeria spp.
The Apicomplexa are diverse ancient phylum of obligate intracellular protozoan parasites
that are defined by the presence of apical complex structures, which are an assembly of
organelles critical for the parasitic life cycle. This phylum includes over 6000 species such as
Plasmodium, Toxoplasma, Eimeria, Cryptosporidium, Babesia, Theileria, and Sarcocystis
(Levine et al., 1980; Adl et al., 2007). Of the Apicomplexa, Eimeria species cause coccidiosis of
- 32 -
several vertebrates, particularly poultry (Fernando, 1990). In poultry, coccidiosis is a common
disease in chickens that incurs huge economic losses in the poultry industry worldwide
(Williams, 1999). As the causative agent of poultry coccidiosis, Eimeria sp. primarily invade
epithelial cells of the host gastrointestinal tract and undergo both asexual and sexual stages of
their developmental life cycle that terminates in oocysts excreted in the feces. The excreted
oocysts are unsporulated and covered by the inner and outer walls composed of cross-linked
peptides to protect against chemical and mechanical damages in the external environment
(Wang, 1982; Belli et al., 2006, 2009). In the presence of appropriate temperature (~30℃),
moisture and oxygen, the oocysts undergo a period of development period called sporulation and
become infectious containing 4 sporocysts, each with 2 sporozoites. Eimeria parasites within the
intestinal epithelial cells elicit solid protective immunity via cellular effectors CD4+ and CD8+ T
cells residing in gut-associated lymphoid tissues (Yun et al., 2000). CD4+ Th1 lymphocytes
induce transcription of IFN-γ, IL-2, and IL-12, and thereby helping CD8+ T cells to kill parasite-
infected cells (Trout and Lillehoj, 1996; Hong et al., 2006a). High level of IFN-γ activates
macrophages to produce nitric oxide, which effectively inhibits replication of Eimeria within
host cells (Lillehoj and Choi, 1998), as well as upregulates IL-1β expression, which recruits
inflammatory cells such as macrophages, heterophils, and lymphocytes to the site of infection
(Laurent et al., 2001).
CRISPR/Cas9 system
CRISPR (clustered regularly interspaced short palindromic repeats), a single RNA-
guided DNA nuclease system, is derived from a natural immune system in bacteria and archaea
as a defense against invasive phages and plasmid DNAs (Cong et al., 2013). It has been adapted
- 33 -
for mammalian genome engineering by two components, constant endonuclease Cas9 and single-
guide RNA (sgRNA) designed to target specific gene. Cas9, a protein derived from
Streptococcus pyogenes, forms an active nuclease by complexing with sgRNA, consisting of a
fusion of two noncoding RNA elements: CRISPR RNA (crRNA) and the trans-activating crRNA
(tracrRNA) that are combined into a single synthetic guide RNA (sgRNA). A ~20-nt sequence
of sgRNA is complementary to genomic sequences adjacent to a protospacer adjacent motif
(PAM), which guides Cas9 nuclease to cleave double stranded DNA sequences that contain
complementary target sites bearing the PAM by Watson-Crick base pairing (Jinek et al., 2012).
sgRNA can be designed to include the specific base sequences that match the target gene of
interest using the CRISPR design tool. With modified CRISPR interference (CRISPRi) system,
catalytically inactive Cas9 (dCas9)-sgRNA complexed to the target DNA can specifically
interfere with RNA polymerase binding or elongation and suppress gene transcription. Fusion of
dCas9 with transcription activators or repressors can robustly activate or silence expression of
endogenous genes (Amelio and Melino, 2015). The CRISPR/Cas9 system has been adopted for
targeted genome editing in apicomplexan parasites such as Plasmodium falciparum (Lee and
Fidock, 2014), Cryptosporidium parvum (Vinayak et al., 2015), and T. gondii (Shen et al., 2014).
More recently, CRISPR/Cas9 system was used for genome-wide screening in T. gondii to
identify genes involved in either fitness of parasites during infection of human fibroblast or drug
sensitivity (Sidik et al., 2016). Using the same experimental approach, a conserved invasion
factor across the phylum Apicomplexa was also found. As such, gene manipulation techniques
have been increasingly employed for better understanding the role of genes, generation of
transgenic parasites, and development of novel control methods, although there are still possible
off-target mutations and potential limitations.
- 34 -
Gene manipulation of Eimeria species
Genetic manipulation strategies have been developed in Eimeria species to study their
biological involvement in the development of pathology as well as in host immune response.
Better understanding of the basic biology of Eimeria parasites is essential for the development of
new strategies for efficient control of avian coccidia. Considering the fact that Eimeria infection
elicits protective cell-mediated immunity but reduces pathogenicity (Wallach, 2010), Eimeria
species could be administered as a eukaryotic vaccine vehicle (Clark et al., 2012). To develop
new control and vaccination strategies for Eimeria, many efforts have been focused on the
development of transfection system for Eimeria sp. Prior to establish the transfection techniques
in Eimeria, Toxoplasma had been used as a model parasite for effective validation of potential
drug targets for Eimeria sp. This is because both Eimeria and Toxoplasma species share many
similarities in biology and genomics including similar mechanisms of host cell invasion and
possession of highly conserved adhesive proteins (Donald and Liberator, 2002; Donald et al.,
2002), along with amenable transfection system with high efficiency and convenience in
Toxoplasma spp. Since great progress has been achieved in a whole-genome sequencing of E.
tenella (Ling et al., 2007), both transient and stable transfection systems in Eimeria sp. were
developed (Kelleher and Tomley, 1998; Hao et al., 2007; Yan et al., 2009). However, genetic
manipulation techniques in Eimeria species lagged behind other apicomplexan parasites. This is
because Eimeria species cannot be continuously cultivated in vitro, in addition to the lack of
genetic information. Compared to transfection systems of Toxoplasma and Plasmodium sp.,
Eimeria species can be transiently transfected and invaded primary immortal cell lines in vitro,
but its development is interrupted during the asexual stages, thereby the life cycle of parasite is
- 35 -
not completed by in vitro culture (Kelleher and Tomley, 1998). This limitation has been
overcome by using primary chicken kidney cells (PCKCs), in which transfected E. tenella could
complete the entire life cycle and differentiated into oocysts in vitro (Shi et al., 2008). However,
the system is still limited by the inability to transfect oocysts and sporocysts, difficulty of
obtaining single sporocyst-derived recombinant clones, and requirement of in vivo amplification
and selection to obtain an appropriate amount of transformed oocysts (Clark et al., 2008; Shi et
al., 2008; Yan et al., 2009). In addition, the very low transfection efficiency imposes a serious
obstacle to further molecular studies of Eimeria sp. To overcome low transfection efficiency,
cytomix-buffered restriction enzyme-mediated integration (REMI) strategy was adapted for
transfection of sporozoites by BTX electroporation or AMAXA nucleofection systems (Liu et
al., 2008; Clark et al., 2008; Yan et al., 2009). Generally, transfection of Eimeria species
requires preparation and purification of sporozoites from oocysts and is conducted by
electroporation. In addition to transfection method of Eimeria sporozoites by electroporation,
another transfection protocol for E. maxima oocysts was established using a gene gun system (Li
et al., 2012). As a selection marker, fluorescent proteins such as enhanced yellow fluorescent
protein (EYFP) have been used to explore the developmental stages of transgenic Eimeria
parasites (Hao et al., 2007; Qin et al., 2014). Additionally, the drug selection of transformed
Eimeria has been accomplished with the help of the integrated pyrimethamine resistance
conferred by gene DHFR (Dihydrofolate reductase) (Hanig et al., 2012). By screening with drug
selection and fluorescence activating cell sorting (FACS), stable transfection system has been
successfully established (Clark et al., 2008; Yan et al., 2009). In transfection studies for
designing plasmid construct, a couple of promoters originating from E. tenella were functionally
effective in other species of the same genus as well as in T. gondii and vice versa (Kurth and
- 36 -
Entzeroth, 2009; Zou et al., 2009). Given the mutual recognition of promoter sequences in both
Eimeria and Toxoplasma such as histone H4, actin, and tubulin, T. gondii could be used as a
novel transfection system for Eimeria-rooted vectors because genetic manipulation tools are well
developed for T. gondii. Furthermore, in order to study gene function in Eimeria spp., effective
insertional mutagenesis was achieved in E. tenella using the piggybac system, in which a cut-
and-paste-mediated transposon enabling integration of genes of interest into a target genome (Su
et al., 2012). As previously mentioned, using EYFP as a model antigen and Campylobacter
jejuni antigen A (CjaA) as pathogen antigen, transgenic Eimeria was developed as a vaccine
vector capable of delivering heterologous antigens, which induce host cellular and humoral
immune responses against heterologous intracellular microbes (Huang et al., 2011; Clark et al.,
2012). Transgenic E. mitis expressing chicken IL-2 enhanced cellular immune response against
challenge with wild-type parasites and rapidly eliminated the intracellular pathogens that could
be implemented as an alternative anticoccidial vaccine (Li et al., 2015). As such, by gene
addition or replacement with an altered or tagged gene, functions of specific genes have been
explored for Eimeria parasites.
In summary
Many researchers concerned with poultry health have become interested in avian immune
regulation against diseases. The release of chicken genome sequence provided more
opportunities to investigate immune responses in birds via enabling them to get more precise
picture and a better understanding of the avian immune system. Moreover, the chicken genome
sequence is considered as a critical landmark in both avian biology and agriculture as the first
genome to be completely sequenced in livestock. Typically, the potential contribution of avian
- 37 -
cytokines to disease has been considerably investigated due to the importance in understanding
the interactions between immune system and disease. As immune response modifiers, cytokines
were identified to have potential therapeutic properties by inducing immune responses; for
example, administration of IFN-γ to chickens was shown to increase body weight gain of birds
during a coccidial challenge (Lowenthal et al., 1997). Chicken IFN-γ was also shown to induce
pre-immune state for antiviral protection against influenza virus (Yuk et al., 2016). The
capability of cytokines in enhancing the efficacy of vaccines as immune adjuvants was also
described when delivered via recombinant proteins in viral or plasmid vectors (Schijns et al.,
2000; Xiaowen et al., 2009; Hung et al., 2010). In addition, cytokine profiling can be used to
assess not only the host immune status, but also immune responses to infection that can help to
elucidate the mechanisms of disease resistance or susceptibility (Stäheli et al., 2001). Compared
to considerable evidence for the therapeutic use of cytokines in mammals, the study of avian
cytokines is still in need of exploration to fill the knowledge gap between birds and mammals,
and get new insights into the role of avian cytokines in the development of immunity to a wide
range of infections and their use as therapeutic agents. An advanced understanding of avian
cytokines leads to improve our understanding of the pathways or dynamics of disease and
establish disease model, further allowing the development of more effective vaccines and control
strategies as suitable alternatives to antibiotics in the poultry industry.
For deeper understanding of the function of cytokines in the activation and regulation of
the avian immune system in this dissertation, multifaceted aspects of MIF have been
characterized as a conserved immune mediator across avian species and its biological activities
studied through receptor-mediated pathways, in addition to the binding activity of the Eimeria
- 38 -
MIF homologue with host MIF receptors. Furthermore, the involvement of Eimeria MIF in
invasion and survival of the parasite during infection was assessed by gene editing techniques.
- 39 -
References
Adl, S. M., B. S. Leander, A. G. Simpson, J. M. Archibald, O. R. Anderson, D. Bass, S. S.
Bowser, G. Brugerolle, M. A. Farmer, S. Karpov, M. Kolisko, C. E. Lane, D. J. Lodge, D. G.
Mann, R. Meisterfeld, L. Mendoza, O. Moestrup, S. E. Mozley-Standridge, A. V. Smirnov and
F. Spiegel. (2007). Diversity, nomenclature, and taxonomy of protists. Syst Biol. 56, 684-689.
Aeberli, D., Y. Yang, A. Mansell, L. Santos, M. Leech and E. F. Morand. (2006). Endogenous
macrophage migration inhibitory factor modulates glucocorticoid sensitivity in macrophages via
effects on MAP kinase phosphatase-1 and p38 MAP kinase. FEBS Lett. 580, 974-981.
Akira, S., S. Uematsu and O. Takeuchi. (2006). Pathogen recognition and innate immunity. Cell
124, 783-801.
Amelio, I. and G. Melino. (2015). CRISPR: a new method for genetic engineering - a
prokaryotic immune component may potentially open a new era of gene silencing. Cell Death
Differ. 22, 3-5.
Arstila, T. P. and O. Lassila. (1993). Androgen-induced expression of the peripheral blood
gamma delta T cell population in the chicken. J Immunol. 151, 6627-6633.
Arstila, T. P., O. Vainio and O. Lassila. (1994). Evolutionarily conserved function of CD28 in
alpha beta T cell activation. Scand J Immunol. 40, 368-371.
Avery, S., L. Rothwell, W. D. Degen, V. E. Schijns, J. Young, J. Kaufman and P. Kaiser. (2004).
Characterization of the first nonmammalian T2 cytokine gene cluster: the cluster contains
functional single-copy genes for IL-3, IL-4, IL-13, and GM-CSF, a gene for IL-5 that appears to
be a pseudogene, and a gene encoding another cytokinelike transcript, KK34. J Interferon
Cytokine Res. 24, 600-610.
Axelsson, E., M. T. Webster, N. G. Smith, D. W. Burt and H. Ellegren. (2005). Comparison of
the chicken and turkey genomes reveals a higher rate of nucleotide divergence on
microchromosomes than macrochromosomes. Genome Res. 15, 120-125.
Bacher, M., C. N. Metz, T. Calandra, K. Mayer, J. Chesney, M. Lohoff, D. Gemsa, T. Donnelly
and R. Bucala. (1996). An essential regulatory role for macrophage migration inhibitory factor in
T-cell activation. Proc Natl Acad Sci U S A. 93, 7849-7854.
Balabanian, K., B. Lagane, S. Infantino, K. Y. Chow, J. Harriague, B. Moepps, F. Arenzana-
Seisdedos, M. Thelen and F. Bachelerie. (2005). The chemokine SDF-1/CXCL12 binds to and
signals through the orphan receptor RDC1 in T lymphocytes. J Biol Chem. 280, 35760-35766.
Balu, S. and P. Kaiser. (2003). Avian interleukin-12beta (p40): cloning and characterization of
the cDNA and gene. J Interferon Cytokine Res. 23, 699-707.
Barber, M. R., J. R. Aldridge, Jr., R. G. Webster and K. E. Magor. (2010). Association of RIG-I
with innate immunity of ducks to influenza. Proc Natl Acad Sci U S A. 107, 5913-5918.
Barbulescu, K., C. Becker, J. F. Schlaak, E. Schmitt, K. H. Meyer zum Buschenfelde and M. F.
Neurath. (1998). IL-12 and IL-18 differentially regulate the transcriptional activity of the human
IFN-gamma promoter in primary CD4+ T lymphocytes. J Immunol. 160, 3642-3647.
- 40 -
Belli, S. I., N. C. Smith and D. J. Ferguson. (2006). The coccidian oocyst: a tough nut to crack.
Trends Parasitol. 22, 416-423.
Belli, S. I., D. J. Ferguson, M. Katrib, I. Slapetova, K. Mai, J. Slapeta, S. A. Flowers, K. B.
Miska, F. M. Tomley, M. W. Shirley, M. G. Wallach and N. C. Smith. (2009). Conservation of
proteins involved in oocyst wall formation in Eimeria maxima, Eimeria tenella and Eimeria
acervulina. Int J Parasitol. 39, 1063-1070.
Benatar, T., L. Tkalec and M. J. Ratcliffe. (1992). Stochastic rearrangement of immunoglobulin
variable-region genes in chicken B-cell development. Proc Natl Acad Sci USA 89, 7615-7619.
Bengten, E., M. Wilson, N. Miller, L. W. Clem, L. Pilstrom and G. W. Warr. (2000).
Immunoglobulin isotypes: structure, function, and genetics. Curr Top Microbiol Immunol. 248,
189-219.
Bernard, D., J. D. Hansen, L. Du Pasquier, M. P. Lefranc, A. Benmansour and P. Boudinot.
(2007). Costimulatory receptors in jawed vertebrates: conserved CD28, odd CTLA4 and multiple
BTLAs. Dev Comp Immunol. 31, 255-271.
Berndt, A. and U. Methner. (2001). Gamma/delta T cell response of chickens after oral
administration of attenuated and non-attenuated Salmonella typhimurium strains. Vet Immunol
Immunopathol. 78, 143-161.
Bernhagen, J., R. Krohn, H. Lue, J. L. Gregory, A. Zernecke, R. R. Koenen, M. Dewor, I.
Georgiev, A. Schober, L. Leng, T. Kooistra, G. Fingerle-Rowson, P. Ghezzi, R. Kleemann, S. R.
McColl, R. Bucala, M. J. Hickey and C. Weber. (2007). MIF is a noncognate ligand of CXC
chemokine receptors in inflammatory and atherogenic cell recruitment. Nat Med. 13, 587-596.
Bettelli, E. and V. K. Kuchroo. (2005). IL-12- and IL-23-induced T helper cell subsets: birds of
the same feather flock together. J Exp Med. 201, 169-171.
Binsky, I., M. Haran, D. Starlets, Y. Gore, F. Lantner, N. Harpaz, L. Leng, D. M. Goldenberg, L.
Shvidel, A. Berrebi, R. Bucala and I. Shachar. (2007). IL-8 secreted in a macrophage migration-
inhibitory factor- and CD74-dependent manner regulates B cell chronic lymphocytic leukemia
survival. Proc Natl Acad Sci U S A. 104, 13408-13413.
Bleul, C. C., M. Farzan, H. Choe, C. Parolin, I. Clark-Lewis, J. Sodroski and T. A. Springer.
(1996). The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1
entry. Nature 382, 829-833.
Bloom, B. R. and B. Bennett. (1966). Mechanism of a reaction in vitro associated with delayed-
type hypersensitivity. Science 153, 80-82.
Borghese, F. and F. I. Clanchy. (2011). CD74: an emerging opportunity as a therapeutic target in
cancer and autoimmune disease. Expert Opin Ther Targets 15, 237-251.
Boyd, A. C., M. Y. Peroval, J. A. Hammond, M. D. Prickett, J. R. Young and A. L. Smith.
(2012). TLR15 is unique to avian and reptilian lineages and recognizes a yeast-derived agonist. J
Immunol. 189, 4930-4938.
- 41 -
Brownlie, R., J. Zhu, B. Allan, G. K. Mutwiri, L. A. Babiuk, A. Potter and P. Griebel. (2009).
Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG
oligodeoxynucleotides. Mol Immunol. 46, 3163-3170.
Bucala, R. (2012). The MIF handbook. World Scientific.
Bucy, R. P., C. H. Chen and M. D. Cooper. (1991). Analysis of gamma delta T cells in the
chicken. Semin Immunol. 3, 109-117.
Burns, J. M., B. C. Summers, Y. Wang, A. Melikian, R. Berahovich, Z. Miao, M. E. Penfold, M.
J. Sunshine, D. R. Littman, C. J. Kuo, K. Wei, B. E. McMaster, K. Wright, M. C. Howard and T.
J. Schall. (2006). A novel chemokine receptor for SDF-1 and I-TAC involved in cell survival,
cell adhesion, and tumor development. J Exp Med. 203, 2201-2213.
Burt, D. W. (2005). Chicken genome: current status and future opportunities. Genome Res. 15,
1692-1698.
Calandra, T., J. Bernhagen, C. N. Metz, L. A. Spiegel, M. Bacher, T. Donnelly, A. Cerami and
R. Bucala. (1995). MIF as a glucocorticoid-induced modulator of cytokine production. Nature
377, 68-71.
Calandra, T. and T. Roger. (2003). Macrophage migration inhibitory factor: a regulator of innate
immunity. Nat Rev Immunol. 3, 791-800.
Carswell, E. A., L. J. Old, R. L. Kassel, S. Green, N. Fiore and B. Williamson. (1975). An
endotoxin-induced serum factor that causes necrosis of tumors. Proc Natl Acad Sci USA 72,
3666-3670.
Casteleyn, C., M. Doom, E. Lambrechts, W. Van den Broeck, P. Simoens and P. Cornillie.
(2010). Locations of gut-associated lymphoid tissue in the 3-month-old chicken: a review. Avian
Pathol. 39, 143-150.
Chatterjee, M., O. Borst, B. Walker, A. Fotinos, S. Vogel, P. Seizer, A. Mack, S. Alampour-
Rajabi, D. Rath, T. Geisler, F. Lang, H. F. Langer, J. Bernhagen and M. Gawaz. (2014).
Macrophage migration inhibitory factor limits activation-induced apoptosis of platelets via
CXCR7-dependent Akt signaling. Circ Res. 115, 939-949.
Chen, C.-L. H., Pickel, J. M., Lahti, J. M., Cooper, M. D. (1991). Surface markers on avian
immune cells. In: Sharma, J.M. (Ed.), Avian Cellular Immunology. CRC Press, Boca Raton, FL,
pp. 1-22.
Cho, J. S., E. M. Pietras, N. C. Garcia, R. I. Ramos, D. M. Farzam, H. R. Monroe, J. E.
Magorien, A. Blauvelt, J. K. Kolls, A. L. Cheung, G. Cheng, R. L. Modlin and L. S. Miller.
(2010a). IL-17 is essential for host defense against cutaneous Staphylococcus aureus infection in
mice. J Clin Invest. 120, 1762-1773.
Cho, Y., G. V. Crichlow, J. J. Vermeire, L. Leng, X. Du, M. E. Hodsdon, R. Bucala, M.
Cappello, M. Gross, F. Gaeta, K. Johnson and E. J. Lolis. (2010b). Allosteric inhibition of
macrophage migration inhibitory factor revealed by ibudilast. Proc Natl Acad Sci USA 107,
11313-11318.
- 42 -
Clark, J. D., K. Billington, J. M. Bumstead, R. D. Oakes, P. E. Soon, P. Sopp, F. M. Tomley and
D. P. Blake. (2008). A toolbox facilitating stable transfection of Eimeria species. Mol Biochem
Parasitol. 162, 77-86.
Clark, J. D., R. D. Oakes, K. Redhead, C. F. Crouch, M. J. Francis, F. M. Tomley and D. P.
Blake. (2012). Eimeria species parasites as novel vaccine delivery vectors: anti-Campylobacter
jejuni protective immunity induced by Eimeria tenella-delivered CjaA. Vaccine 30, 2683-2688.
Cohen, S., P. E. Bigazzi and T. Yoshida. (1974). Commentary. Similarities of T cell function in
cell-mediated immunity and antibody production. Cell Immunol. 12, 150-159.
Cong, L., F. A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P. D. Hsu, X. Wu, W. Jiang, L. A.
Marraffini and F. Zhang. (2013). Multiplex genome engineering using CRISPR/Cas systems.
Science 339, 819-823.
Dalloul, R. A., J. A. Long, A. V. Zimin, L. Aslam, K. Beal, A. Blomberg Le, P. Bouffard, D. W.
Burt, O. Crasta, R. P. Crooijmans, K. Cooper, R. A. Coulombe, S. De, M. E. Delany, J. B.
Dodgson, J. J. Dong, C. Evans, K. M. Frederickson, P. Flicek, L. Florea, O. Folkerts, M. A.
Groenen, T. T. Harkins, J. Herrero, S. Hoffmann, H. J. Megens, A. Jiang, P. de Jong, P. Kaiser,
H. Kim, K. W. Kim, S. Kim, D. Langenberger, M. K. Lee, T. Lee, S. Mane, G. Marcais, M.
Marz, A. P. McElroy, T. Modise, M. Nefedov, C. Notredame, I. R. Paton, W. S. Payne, G.
Pertea, D. Prickett, D. Puiu, D. Qioa, E. Raineri, M. Ruffier, S. L. Salzberg, M. C. Schatz, C.
Scheuring, C. J. Schmidt, S. Schroeder, S. M. Searle, E. J. Smith, J. Smith, T. S. Sonstegard, P.
F. Stadler, H. Tafer, Z. J. Tu, C. P. Van Tassell, A. J. Vilella, K. P. Williams, J. A. Yorke, L.
Zhang, H. B. Zhang, X. Zhang, Y. Zhang and K. M. Reed. (2010). Multi-platform next-
generation sequencing of the domestic turkey (Meleagris gallopavo): genome assembly and
analysis. PLoS Biol. 8, e1000475.
Das, R., M. S. Koo, B. H. Kim, S. T. Jacob, S. Subbian, J. Yao, L. Leng, R. Levy, C. Murchison,
W. J. Burman, C. C. Moore, W. M. Scheld, J. R. David, G. Kaplan, J. D. MacMicking and R.
Bucala. (2013). Macrophage migration inhibitory factor (MIF) is a critical mediator of the innate
immune response to Mycobacterium tuberculosis. Proc Natl Acad Sci USA 110, E2997-3006.
David, J. R. (1966). Delayed hypersensitivity in vitro: its mediation by cell-free substances
formed by lymphoid cell-antigen interaction. Proc Natl Acad Sci USA 56, 72-77.
Degen, W. G., N. van Daal, H. I. van Zuilekom, J. Burnside and V. E. Schijns. (2004).
Identification and molecular cloning of functional chicken IL-12. J Immunol. 172, 4371-4380.
Degen, W. G., N. Daal, L. Rothwell, P. Kaiser and V. E. Schijns. (2005). Th1/Th2 polarization
by viral and helminth infection in birds. Vet Microbiol. 105, 163-167.
Digby, M. R. and J. W. Lowenthal. (1995). Cloning and expression of the chicken interferon-
gamma gene. J Interferon Cytokine Res. 15, 939-945.
Dobson, S. E., K. D. Augustijn, J. A. Brannigan, C. Schnick, C. J. Janse, E. J. Dodson, A. P.
Waters and A. J. Wilkinson. (2009). The crystal structures of macrophage migration inhibitory
factor from Plasmodium falciparum and Plasmodium berghei. Protein Sci. 18, 2578-2591.
- 43 -
Donald, R. G., J. Allocco, S. B. Singh, B. Nare, S. P. Salowe, J. Wiltsie and P. A. Liberator.
(2002). Toxoplasma gondii cyclic GMP-dependent kinase: chemotherapeutic targeting of an
essential parasite protein kinase. Eukaryot Cell 1, 317-328.
Donald, R. G. and P. A. Liberator. (2002). Molecular characterization of a coccidian parasite
cGMP dependent protein kinase. Mol Biochem Parasitol. 120, 165-175.
Dumonde, D. C., R. A. Wolstencroft, G. S. Panayi, M. Matthew, J. Morley and W. T. Howson.
(1969). Lymphokines: non-antibody mediators of cellular immunity generated by lymphocyte
activation. Nature 224, 38-42.
Eyerich, S., K. Eyerich, D. Pennino, T. Carbone, F. Nasorri, S. Pallotta, F. Cianfarani, T.
Odorisio, C. Traidl-Hoffmann, H. Behrendt, S. R. Durham, C. B. Schmidt-Weber and A. Cavani.
(2009). Th22 cells represent a distinct human T cell subset involved in epidermal immunity and
remodeling. J Clin Invest 119, 3573-3585.
Fenzl, L., T. W. Gobel and M. L. Neulen. (2017). gammadelta T cells represent a major
spontaneously cytotoxic cell population in the chicken. Dev Comp Immunol. 73, 175-183.
Fernando, M. A. (1990). Eimeria infections of the intestine. In: Coccidiosis of Man and
Domestic Animals (ed. P. L. Long), pp. 63–75. CRC Press, Boca Raton, FL, USA.
Fillon, V., M. Morisson, R. Zoorob, C. Auffray, M. Douaire, J. Gellin and A. Vignal. (1998).
Identification of 16 chicken microchromosomes by molecular markers using two-colour
fluorescence in situ hybridization (FISH). Chromosome Res. 6, 307-313.
Flaster, H., J. Bernhagen, T. Calandra and R. Bucala. (2007). The macrophage migration
inhibitory factor-glucocorticoid dyad: regulation of inflammation and immunity. Mol
Endocrinol. 21, 1267-1280.
Flieger, O., A. Engling, R. Bucala, H. Lue, W. Nickel and J. Bernhagen. (2003). Regulated
secretion of macrophage migration inhibitory factor is mediated by a non-classical pathway
involving an ABC transporter. FEBS Lett. 551, 78-86.
Fukui, A., N. Inoue, M. Matsumoto, M. Nomura, K. Yamada, Y. Matsuda, K. Toyoshima and T.
Seya. (2001). Molecular cloning and functional characterization of chicken toll-like receptors. A
single chicken toll covers multiple molecular patterns. J Biol Chem. 276, 47143-47149.
Genovese, K. J., H. He, C. L. Swaggerty and M. H. Kogut. (2013). The avian heterophil. Dev
Comp Immunol. 41, 334-340.
Germain, R. N. (1994). MHC-dependent antigen processing and peptide presentation: providing
ligands for T lymphocyte activation. Cell 76, 287-299.
Giansanti, F., M. F. Giardi and D. Botti. (2006). Avian cytokines--an overview. Curr Pharm Des.
12, 3083-3099.
Gibson, M. S., M. Fife, S. Bird, N. Salmon and P. Kaiser. (2012). Identification, cloning, and
functional characterization of the IL-1 receptor antagonist in the chicken reveal important
differences between the chicken and mammals. J Immunol. 189, 539-550.
- 44 -
Glick, B. (1987). How it all began: the continuing story of the bursa of Fabricius. In: Avian
Immunology: Basis and Practice, (Toivanen, A. and Toivanen, P. Eds), vol. 1, pp. 1_7, CRC
Press, Boca Raton, FL.
Göbel, T. W., B. Kaspers and M. Stangassinger. (2001). NK and T cells constitute two major,
functionally distinct intestinal epithelial lymphocyte subsets in the chicken. Int Immunol. 13,
757-762.
Göbel, T. W., K. Schneider, B. Schaerer, I. Mejri, F. Puehler, S. Weigend, P. Stäheli and B.
Kaspers. (2003). IL-18 stimulates the proliferation and IFN-gamma release of CD4+ T cells in
the chicken: conservation of a Th1-like system in a nonmammalian species. J Immunol. 171,
1809-1815.
Gore, Y., D. Starlets, N. Maharshak, S. Becker-Herman, U. Kaneyuki, L. Leng, R. Bucala and I.
Shachar. (2008). Macrophage migration inhibitory factor induces B cell survival by activation of
a CD74-CD44 receptor complex. J Biol Chem. 283, 2784-2792.
Gregory, J. L., M. T. Leech, J. R. David, Y. H. Yang, A. Dacumos and M. J. Hickey. (2004).
Reduced leukocyte-endothelial cell interactions in the inflamed microcirculation of macrophage
migration inhibitory factor-deficient mice. Arthritis Rheum 50, 3023-3034.
Gregory, J. L., E. F. Morand, S. J. McKeown, J. A. Ralph, P. Hall, Y. H. Yang, S. R. McColl and
M. J. Hickey. (2006). Macrophage migration inhibitory factor induces macrophage recruitment
via CC chemokine ligand 2. J Immunol. 177, 8072-8079.
Griffin, D. K., L. B. Robertson, H. G. Tempest, A. Vignal, V. Fillon, R. P. Crooijmans, M. A.
Groenen, S. Deryusheva, E. Gaginskaya, W. Carre, D. Waddington, R. Talbot, M. Volker, J. S.
Masabanda and D. W. Burt. (2008). Whole genome comparative studies between chicken and
turkey and their implications for avian genome evolution. BMC Genomics. 9: 168.
Gubler, U., A. O. Chua, D. S. Schoenhaut, C. M. Dwyer, W. McComas, R. Motyka, N. Nabavi,
A. G. Wolitzky, P. M. Quinn, P. C. Familletti and et al. (1991). Coexpression of two distinct
genes is required to generate secreted bioactive cytotoxic lymphocyte maturation factor. Proc
Natl Acad Sci U S A. 88, 4143-4147.
Haas, W., P. Pereira and S. Tonegawa. (1993). Gamma/delta cells. Annu Rev Immunol. 11, 637-
685.
Hanig, S., R. Entzeroth and M. Kurth. (2012). Chimeric fluorescent reporter as a tool for
generation of transgenic Eimeria (Apicomplexa, Coccidia) strains with stage specific reporter
gene expression. Parasitol Int. 61, 391-398.
Hao, L., X. Liu, X. Zhou, J. Li and X. Suo. (2007). Transient transfection of Eimeria tenella
using yellow or red fluorescent protein as a marker. Mol Biochem Parasitol. 153, 213-215.
Harmon, B. G. (1998). Avian heterophils in inflammation and disease resistance. Poult Sci. 77,
972-977.
Harris, N. L. and F. Ronchese. (1999). The role of B7 costimulation in T-cell immunity.
Immunol Cell Biol. 77, 304-311.
- 45 -
He, H., K. J. Genovese and M. H. Kogut. (2011). Modulation of chicken macrophage effector
function by T(H)1/T(H)2 cytokines. Cytokine 53, 363-369.
Hedge, S. N., B. A. Rolls, A. Turvey and M. E. Coates. (1982). Influence of gut microflora on
the lymphoid tissue in the chicken (Gallus domesticus) and Japanese quail (Coturnix coturnix
Japonica). Comp. Biochem. Physiol. 72A, 205-209.
Heggen, C. L., M. A. Qureshi, F. W. Edens and H. J. Barnes. (2000). Alterations in macrophage-
produced cytokines and nitrite associated with poult enteritis and mortality syndrome. Avian Dis.
44, 59-65.
Higgins, D. A. 1996. Comparative immunology of avian species. In: Poultry Immunology,
(Davison, T. F., Morris, T. R., and Payne, L. N., eds.), pp. 149-205. Carfax, Abingdon.
Holowka, T., T. M. Castilho, A. B. Garcia, T. Sun, D. McMahon-Pratt and R. Bucala. (2016).
Leishmania-encoded orthologs of macrophage migration inhibitory factor regulate host
immunity to promote parasite persistence. FASEB J. 30, 2249-2265.
Hong, Y. H., H. S. Lillehoj, S. H. Lee, R. A. Dalloul and E. P. Lillehoj. (2006a). Analysis of
chicken cytokine and chemokine gene expression following Eimeria acervulina and Eimeria
tenella infections. Vet Immunol Immunopathol. 114, 209-223.
Hong, Y. H., H. S. Lillehoj, S. H. Lee, D. Park and E. P. Lillehoj (2006b). Molecular cloning and
characterization of chicken lipopolysaccharide-induced TNF-alpha factor (LITAF). Dev Comp
Immunol. 30, 919-929.
Huang, W., L. Na, P. L. Fidel and P. Schwarzenberger. (2004). Requirement of interleukin-17A
for systemic anti-Candida albicans host defense in mice. J Infect Dis. 190, 624-631.
Huang, X., J. Zou, H. Xu, Y. Ding, G. Yin, X. Liu and X. Suo. (2011). Transgenic Eimeria
tenella expressing enhanced yellow fluorescent protein targeted to different cellular
compartments stimulated dichotomic immune responses in chickens. J Immunol. 187, 3595-
3602.
Hung, L. H., H. P. Li, Y. Y. Lien, M. L. Wu and H. C. Chaung. (2010). Adjuvant effects of
chicken interleukin-18 in avian Newcastle disease vaccine. Vaccine 28, 1148-1155.
Huynh, M. H., M. J. Boulanger and V. B. Carruthers. (2014). A conserved apicomplexan
microneme protein contributes to Toxoplasma gondii invasion and virulence. Infect Immun. 82,
4358-4368.
Hymowitz, S. G., E. H. Filvaroff, J. P. Yin, J. Lee, L. Cai, P. Risser, M. Maruoka, W. Mao, J.
Foster, R. F. Kelley, G. Pan, A. L. Gurney, A. M. de Vos and M. A. Starovasnik. (2001). IL-17s
adopt a cystine knot fold: structure and activity of a novel cytokine, IL-17F, and implications for
receptor binding. EMBO J. 20, 5332-5341.
International Chicken Genome Sequencing, C. (2004). Sequence and comparative analysis of the
chicken genome provide unique perspectives on vertebrate evolution. Nature 432, 695-716.
Iqbal, M., V. J. Philbin and A. L. Smith. (2005a). Expression patterns of chicken Toll-like
receptor mRNA in tissues, immune cell subsets and cell lines. Vet Immunol Immunopathol. 104,
117-127.
- 46 -
Iqbal, M., V. J. Philbin, G. S. Withanage, P. Wigley, R. K. Beal, M. J. Goodchild, P. Barrow, I.
McConnell, D. J. Maskell, J. Young, N. Bumstead, Y. Boyd and A. L. Smith. (2005b).
Identification and functional characterization of chicken toll-like receptor 5 reveals a
fundamental role in the biology of infection with Salmonella enterica serovar typhimurium.
Infect Immun. 73, 2344-2350.
Jankovic, D., Z. Liu and W. C. Gause. (2001). Th1- and Th2-cell commitment during infectious
disease: asymmetry in divergent pathways. Trends Immunol. 22, 450-457.
Jinek, M., K. Chylinski, I. Fonfara, M. Hauer, J. A. Doudna and E. Charpentier. (2012). A
programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science
337, 816-821.
Kaiser, P., H. M. Wain and L. Rothwell. (1998). Structure of the chicken interferon-gamma
gene, and comparison to mammalian homologues. Gene 207, 25-32.
Kaiser, P., T. Y. Poh, L. Rothwell, S. Avery, S. Balu, U. S. Pathania, S. Hughes, M. Goodchild,
S. Morrell, M. Watson, N. Bumstead, J. Kaufman and J. R. Young. (2005). A genomic analysis
of chicken cytokines and chemokines. J Interferon Cytokine Res. 25, 467-484.
Kaiser, P. (2007). The avian immune genome--a glass half-full or half-empty? Cytogenet
Genome Res. 117, 221-230.
Kaiser, P., J. Howell, M. Fife, J. R. Sadeyen, N. Salmon, L. Rothwell, J. Young, P. van Diemen,
M. Stevens, T. Y. Poh, M. Jones, P. Barrow, C. Swaggerty, M. Kogut, J. Smith and D. Burt.
(2008). Integrated immunogenomics in the chicken: deciphering the immune response to identify
disease resistance genes. Dev Biol. (Basel) 132, 57-66.
Kaiser, P. (2010). Advances in avian immunology--prospects for disease control: a review.
Avian Pathol 39, 309-324.
Kamir, D., S. Zierow, L. Leng, Y. Cho, Y. Diaz, J. Griffith, C. McDonald, M. Merk, R. A.
Mitchell, J. Trent, Y. Chen, Y. K. Kwong, H. Xiong, J. Vermeire, M. Cappello, D. McMahon-
Pratt, J. Walker, J. Bernhagen, E. Lolis and R. Bucala. (2008). A Leishmania ortholog of
macrophage migration inhibitory factor modulates host macrophage responses. J Immunol. 180,
8250-8261.
Kaufman, J. and H. J. Wallny. (1996). Chicken MHC molecules, disease resistance and the
evolutionary origin of birds. Curr Top Microbiol Immunol. 212, 129-141.
Kaufman, J. (1999). Co-evolving genes in MHC haplotypes: the "rule" for nonmammalian
vertebrates? Immunogenetics 50, 228-236.
Kaufman, J. (2000). The simple chicken major histocompatibility complex: life and death in the
face of pathogens and vaccines. Philos Trans R Soc Lond B Biol Sci. 355, 1077-1084.
Kawai, T. and S. Akira. (2009). The roles of TLRs, RLRs and NLRs in pathogen recognition. Int
Immunol. 21, 317-337.
Kelleher, M. and F. M. Tomley. (1998). Transient expression of beta-galactosidase in
differentiating sporozoites of Eimeria tenella. Mol Biochem Parasitol. 97, 21-31.
- 47 -
Kurth, M. and R. Entzeroth (2009). "Reporter gene expression in cell culture stages and oocysts
of Eimeria nieschulzi (Coccidia, Apicomplexa)." Parasitol Res 104(2): 303-310.
Kim, S., L. Faris, C. M. Cox, L. H. Sumners, M. C. Jenkins, R. H. Fetterer, K. B. Miska and R.
A. Dalloul. (2012a). Molecular characterization and immunological roles of avian IL-22 and its
soluble receptor IL-22 binding protein. Cytokine 60, 815-827.
Kim, W. H., J. Jeong, A. R. Park, D. Yim, Y. H. Kim, K. D. Kim, H. H. Chang, H. S. Lillehoj, B.
H. Lee and W. Min. (2012b). Chicken IL-17F: identification and comparative expression
analysis in Eimeria-infected chickens. Dev Comp Immunol. 38, 401-409.
Kleemann, R., A. Kapurniotu, R. W. Frank, A. Gessner, R. Mischke, O. Flieger, S. Juttner, H.
Brunner and J. Bernhagen. (1998). Disulfide analysis reveals a role for macrophage migration
inhibitory factor (MIF) as thiol-protein oxidoreductase. J Mol Biol. 280, 85-102.
Kobayashi, T., S. Okamoto, T. Hisamatsu, N. Kamada, H. Chinen, R. Saito, M. T. Kitazume, A.
Nakazawa, A. Sugita, K. Koganei, K. Isobe and T. Hibi. (2008). IL23 differentially regulates the
Th1/Th17 balance in ulcerative colitis and Crohn's disease. Gut 57, 1682-1689.
Kogut, M. H., L. Rothwell and P. Kaiser. (2005). IFN-gamma priming of chicken heterophils
upregulates the expression of proinflammatory and Th1 cytokine mRNA following receptor-
mediated phagocytosis of Salmonella enterica serovar Enteritidis. J Interferon Cytokine Res. 25,
73-81.
Kohase, M., H. Moriya, T. A. Sato, S. Kohno and S. Yamazaki. (1986). Purification and
characterization of chick interferon induced by viruses. J Gen Virol. 67, 215-218.
Kono, H. and K. L. Rock. (2008). How dying cells alert the immune system to danger. Nat Rev
Immunol. 8, 279-289.
Koskela, K., T. P. Arstila and O. Lassila. (1998). Costimulatory function of CD28 in avian
gammadelta T cells is evolutionarily conserved. Scand J Immunol. 48, 635-641.
Krempien, U., I. Redmann and C. Jungwirth. (1985). Purification of chick interferon by zinc
chelate affinity chromatography and sodium dodecylsulfate-polyacrylamide gel electrophoresis.
J Interferon Res. 5, 209-214.
Laurent, F., R. Mancassola, S. Lacroix, R. Menezes and M. Naciri. (2001). Analysis of chicken
mucosal immune response to Eimeria tenella and Eimeria maxima infection by quantitative
reverse transcription-PCR. Infect Immun. 69, 2527-2534.
Lawson, S., L. Rothwell and P. Kaiser. (2000). Turkey and chicken interleukin-2 cross-react in
in vitro proliferation assays despite limited amino acid sequence identity. J Interferon Cytokine
Res. 20, 161-170.
Lawson, S., L. Rothwell, B. Lambrecht, K. Howes, K. Venugopal and P. Kaiser. (2001). Turkey
and chicken interferon-gamma, which share high sequence identity, are biologically cross-
reactive. Dev Comp Immunol. 25, 69-82.
Lee, M. C. and D. A. Fidock. (2014). CRISPR-mediated genome editing of Plasmodium
falciparum malaria parasites. Genome Med. 6, 63.
- 48 -
Leng, L., C. N. Metz, Y. Fang, J. Xu, S. Donnelly, J. Baugh, T. Delohery, Y. Chen, R. A.
Mitchell and R. Bucala. (2003). MIF signal transduction initiated by binding to CD74. J Exp
Med. 197, 1467-1476.
Leveque, G., V. Forgetta, S. Morroll, A. L. Smith, N. Bumstead, P. Barrow, J. C. Loredo-Osti,
K. Morgan and D. Malo. (2003). Allelic variation in TLR4 is linked to susceptibility to
Salmonella enterica serovar Typhimurium infection in chickens. Infect Immun. 71, 1116-1124.
Levine, N. D., J. O. Corliss, F. E. Cox, G. Deroux, J. Grain, B. M. Honigberg, G. F. Leedale, A.
R. Loeblich, 3rd, J. Lom, D. Lynn, E. G. Merinfeld, F. C. Page, G. Poljansky, V. Sprague, J.
Vavra and F. G. Wallace. (1980). A newly revised classification of the protozoa. J Protozool. 27,
37-58.
Li, J., J. Zou, G. Yin, X. Liu and X. Suo. (2012). Plasmid DNA could be delivered into Eimeria
maxima unsporulated oocyst with gene gun system. Acta Vet Hung. 60, 431-440.
Li, Z., X. Tang, J. Suo, M. Qin, G. Yin, X. Liu and X. Suo. (2015). Transgenic Eimeria mitis
expressing chicken interleukin 2 stimulated higher cellular immune response in chickens
compared with the wild-type parasites. Front Microbiol. 6, 533.
Lian, L., C. Ciraci, G. Chang, J. Hu and S. J. Lamont. (2012). NLRC5 knockdown in chicken
macrophages alters response to LPS and poly (I:C) stimulation. BMC Vet Res. 8, 23.
Lillehoj, H. S. and K. D. Choi. (1998). Recombinant chicken interferon-gamma-mediated
inhibition of Eimeria tenella development in vitro and reduction of oocyst production and body
weight loss following Eimeria acervulina challenge infection. Avian Dis. 42, 307-314.
Ling, K. H., M. A. Rajandream, P. Rivailler, A. Ivens, S. J. Yap, A. M. Madeira, K. Mungall, K.
Billington, W. Y. Yee, A. T. Bankier, F. Carroll, A. M. Durham, N. Peters, S. S. Loo, M. N. Isa,
J. Novaes, M. Quail, R. Rosli, M. Nor Shamsudin, T. J. Sobreira, A. R. Tivey, S. F. Wai, S.
White, X. Wu, A. Kerhornou, D. Blake, R. Mohamed, M. Shirley, A. Gruber, M. Berriman, F.
Tomley, P. H. Dear and K. L. Wan. (2007). Sequencing and analysis of chromosome 1 of
Eimeria tenella reveals a unique segmental organization. Genome Res. 17, 311-319.
Liniger, M., A. Summerfield, G. Zimmer, K. C. McCullough and N. Ruggli. (2012). Chicken
cells sense influenza A virus infection through MDA5 and CARDIF signaling involving LGP2. J
Virol. 86, 705-717.
Liu, X., T. Shi, H. Ren, H. Su, W. Yan and X. Suo. (2008). Restriction enzyme-mediated
transfection improved transfection efficiency in vitro in Apicomplexan parasite Eimeria tenella.
Mol Biochem Parasitol. 161, 72-75.
Loa, C. C., M. K. Hsieh, C. C. Wu and T. L. Lin. (2001). Molecular identification and
characterization of turkey IFN-gamma gene. Comp Biochem Physiol B Biochem Mol Biol. 130,
579-584.
Lowenthal, J. W., J. J. York, T. E. O'Neil, S. Rhodes, S. J. Prowse, D. G. Strom and M. R.
Digby. (1997). In vivo effects of chicken interferon-gamma during infection with Eimeria. J
Interferon Cytokine Res. 17, 551-558.
Lue, H., A. Kapurniotu, G. Fingerle-Rowson, T. Roger, L. Leng, M. Thiele, T. Calandra, R.
Bucala and J. Bernhagen. (2006). Rapid and transient activation of the ERK MAPK signalling
- 49 -
pathway by macrophage migration inhibitory factor (MIF) and dependence on JAB1/CSN5 and
Src kinase activity. Cell Signal 18, 688-703.
Lue, H., M. Dewor, L. Leng, R. Bucala and J. Bernhagen. (2011). Activation of the JNK
signalling pathway by macrophage migration inhibitory factor (MIF) and dependence on CXCR4
and CD74. Cell Signal 23, 135-144.
Lynagh, G. R., M. Bailey and P. Kaiser. (2000). Interleukin-6 is produced during both murine
and avian Eimeria infections. Vet Immunol Immunopathol. 76, 89-102.
Mackey, D. and A. J. McFall. (2006). MAMPs and MIMPs: proposed classifications for inducers
of innate immunity. Mol Microbiol. 61, 1365-1371.
Man, A. L., F. Lodi, E. Bertelli, M. Regoli, C. Pin, F. Mulholland, A. R. Satoskar, M. J. Taussig
and C. Nicoletti. (2008). Macrophage migration inhibitory factor plays a role in the regulation of
microfold (M) cell-mediated transport in the gut. J Immunol. 181, 5673-5680.
Martinon, F. and J. Tschopp. (2005). NLRs join TLRs as innate sensors of pathogens. Trends
Immunol. 26, 447-454.
Matsumoto, R. and Y. Hashimoto. (2000). Distribution and developmental change of lymphoid
tissues in the chicken proventriculus. J Vet Med Sci. 62, 161-167.
Meyer-Siegler, K. L., E. C. Leifheit and P. L. Vera. (2004). Inhibition of macrophage migration
inhibitory factor decreases proliferation and cytokine expression in bladder cancer cells. BMC
Cancer 4, 34.
Miller, J. L., A. Harupa, S. H. Kappe and S. A. Mikolajczak. (2012). Plasmodium yoelii
macrophage migration inhibitory factor is necessary for efficient liver-stage development. Infect
Immun. 80, 1399-1407.
Miska, K. B., R. H. Fetterer, H. S. Lillehoj, M. C. Jenkins, P. C. Allen and S. B. Harper. (2007).
Characterisation of macrophage migration inhibitory factor from Eimeria species infectious to
chickens. Mol Biochem Parasitol. 151, 173-183.
Miska, K. B., S. Kim, R. H. Fetterer, R. A. Dalloul and M. C. Jenkins. (2013). Macrophage
migration inhibitory factor (MIF) of the protozoan parasite Eimeria influences the components of
the immune system of its host, the chicken. Parasitol Res. 112, 1935-1944.
Mitchell, R. A., C. N. Metz, T. Peng and R. Bucala. (1999). Sustained mitogen-activated protein
kinase (MAPK) and cytoplasmic phospholipase A2 activation by macrophage migration
inhibitory factor (MIF). Regulatory role in cell proliferation and glucocorticoid action. J Biol
Chem. 274, 18100-18106.
Mitchell, R. A., H. Liao, J. Chesney, G. Fingerle-Rowson, J. Baugh, J. David and R. Bucala.
(2002). Macrophage migration inhibitory factor (MIF) sustains macrophage proinflammatory
function by inhibiting p53: regulatory role in the innate immune response. Proc Natl Acad Sci
USA 99, 345-350.
Mocellin, S., M. C. Panelli, E. Wang, D. Nagorsen and F. M. Marincola. (2003). The dual role of
IL-10. Trends Immunol. 24, 36-43.
- 50 -
Moore, M. A. and J. J. Owen. (1965). Chromosome marker studies on the development of the
haemopoietic system in the chick embryo. Nature 208, 956 passim.
Moore, M. A. and J. J. Owen. (1967). Experimental studies on the development of the thymus. J
Exp Med. 126, 715-726.
Murphy, K. M. and S. L. Reiner. (2002). The lineage decisions of helper T cells. Nat Rev
Immunol. 2, 933-944.
Murphy, P. M. (1993). Molecular mimicry and the generation of host defense protein diversity.
Cell 72, 823-826.
Murphy, P. M., M. Baggiolini, I. F. Charo, C. A. Hebert, R. Horuk, K. Matsushima, L. H. Miller,
J. J. Oppenheim and C. A. Power. (2000). International union of pharmacology. XXII.
Nomenclature for chemokine receptors. Pharmacol Rev. 52, 145-176.
Nerren, J. R., H. He, K. Genovese and M. H. Kogut. (2010). Expression of the avian-specific
toll-like receptor 15 in chicken heterophils is mediated by Gram-negative and Gram-positive
bacteria, but not TLR agonists. Vet Immunol Immunopathol. 136, 151-156.
Neulen, M. L. and T. W. Göbel. (2012). Chicken CD56 defines NK cell subsets in embryonic
spleen and lung. Dev Comp Immunol. 38, 410-415.
Oberlin, E., A. Amara, F. Bachelerie, C. Bessia, J. L. Virelizier, F. Arenzana-Seisdedos, O.
Schwartz, J. M. Heard, I. Clark-Lewis, D. F. Legler, M. Loetscher, M. Baggiolini and B. Moser.
(1996). The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-
cell-line-adapted HIV-1. Nature 382, 833-835.
Onodera, S., K. Suzuki, T. Matsuno, K. Kaneda, M. Takagi and J. Nishihira. (1997).
Macrophage migration inhibitory factor induces phagocytosis of foreign particles by
macrophages in autocrine and paracrine fashion. Immunology 92, 131-137.
Ozaki, K. and W. J. Leonard. (2002). Cytokine and cytokine receptor pleiotropy and redundancy.
J Biol Chem. 277, 29355-29358.
Philbin, V. J., M. Iqbal, Y. Boyd, M. J. Goodchild, R. K. Beal, N. Bumstead, J. Young and A. L.
Smith. (2005). Identification and characterization of a functional, alternatively spliced Toll-like
receptor 7 (TLR7) and genomic disruption of TLR8 in chickens. Immunology 114, 507-521.
Pieper, J., U. Methner and A. Berndt. (2011). Characterization of avian gammadelta T-cell
subsets after Salmonella enterica serovar Typhimurium infection of chicks. Infect Immun. 79,
822-829.
Powell, F., L. Rothwell, M. Clarkson and P. Kaiser. (2012). Development of reagents to study
the turkey's immune response: cloning and characterisation of two turkey cytokines, interleukin
(IL)-10 and IL-13. Vet Immunol Immunopathol. 147, 97-103.
Pusztai, R., B. Tarodi and I. Beladi. (1986). Production and characterization of interferon
induced in chicken leukocytes by concanavalin A. Acta Virol. 30, 131-136.
- 51 -
Qin, M., X. Y. Liu, X. M. Tang, J. X. Suo, G. R. Tao and X. Suo. (2014). Transfection of
Eimeria mitis with yellow fluorescent protein as reporter and the endogenous development of the
transgenic parasite. PLoS One 9, e114188.
Ratcliffe, M. J. (2006). Antibodies, immunoglobulin genes and the bursa of Fabricius in chicken
B cell development. Dev Comp Immunol. 30, 101-118.
Reynaud, C. A., V. Anquez, A. Dahan and J. C. Weill. (1985). A single rearrangement event
generates most of the chicken immunoglobulin light chain diversity. Cell 40, 283-291.
Reynaud, C. A., V. Anquez, H. Grimal and J. C. Weill. (1987). A hyperconversion mechanism
generates the chicken light chain preimmune repertoire. Cell 48, 379-388.
Reynaud, C. A., A. Dahan, V. Anquez and J. . Weill. (1989). Somatic hyperconversion
diversifies the single Vh gene of the chicken with a high incidence in the D region. Cell 59, 171-
183.
Riedemann, N. C., R. F. Guo, H. Gao, L. Sun, M. Hoesel, T. J. Hollmann, R. A. Wetsel, F. S.
Zetoune and P. A. Ward. (2004). Regulatory role of C5a on macrophage migration inhibitory
factor release from neutrophils. J Immunol. 173, 1355-1359.
Roger, T., C. Froidevaux, C. Martin and T. Calandra. (2003). Macrophage migration inhibitory
factor (MIF) regulates host responses to endotoxin through modulation of Toll-like receptor 4
(TLR4). J Endotoxin Res. 9, 119-123.
Roger, T., A. L. Chanson, M. Knaup-Reymond and T. Calandra. (2005). Macrophage migration
inhibitory factor promotes innate immune responses by suppressing glucocorticoid-induced
expression of mitogen-activated protein kinase phosphatase-1. Eur J Immunol. 35, 3405-3413.
Rogers, S. L., B. C. Viertlboeck, T. W. Göbel and J. Kaufman. (2008). Avian NK activities, cells
and receptors. Semin Immunol. 20, 353-360.
Rohde, F., B. Schusser, T. Hron, H. Farkasova, J. Plachy, S. Hartle, J. Hejnar, D. Elleder and B.
Kaspers. (2018). Characterization of chicken tumor necrosis factor-alpha, a long missed cytokine
in birds. Front Immunol. 9, 605.
Rollins, B. J. (1997). Chemokines. Blood. 90, 909-928.
Rosengren, E., R. Bucala, P. Aman, L. Jacobsson, G. Odh, C. N. Metz and H. Rorsman. (1996).
The immunoregulatory mediator macrophage migration inhibitory factor (MIF) catalyzes a
tautomerization reaction. Mol Med. 2, 143-149.
Rosengren, E., P. Aman, S. Thelin, C. Hansson, S. Ahlfors, P. Bjork, L. Jacobsson and H.
Rorsman (1997). The macrophage migration inhibitory factor MIF is a phenylpyruvate
tautomerase. FEBS Lett. 417, 85-88.
Rossi, A. G., C. Haslett, N. Hirani, A. P. Greening, I. Rahman, C. N. Metz, R. Bucala and S. C.
Donnelly. (1998). Human circulating eosinophils secrete macrophage migration inhibitory factor
(MIF). Potential role in asthma. J Clin Invest. 101, 2869-2874.
- 52 -
Rothwell, L., J. R. Young, R. Zoorob, C. A. Whittaker, P. Hesketh, A. Archer, A. L. Smith and
P. Kaiser. (2004). Cloning and characterization of chicken IL-10 and its role in the immune
response to Eimeria maxima. J Immunol. 173, 2675-2682.
Rothwell, L., T. Hu, Z. Wu and P. Kaiser. (2012). Chicken interleukin-21 is costimulatory for T
cells and blocks maturation of dendritic cells. Dev Comp Immunol. 36, 475-482.
Sallusto, F. and A. Lanzavecchia. (2009). Heterogeneity of CD4+ memory T cells: functional
modules for tailored immunity. Eur J Immunol. 39, 2076-2082.
Schijns, V. E., K. C. Weining, P. Nuijten, E. O. Rijke and P. Stäheli. (2000). Immunoadjuvant
activities of E. coli- and plasmid-expressed recombinant chicken IFN-alpha/beta, IFN-gamma
and IL-1beta in 1-day- and 3-week-old chickens. Vaccine 18, 2147-2154.
Schneider, K., R. Klaas, B. Kaspers and P. Stäheli. (2001). Chicken interleukin-6. cDNA
structure and biological properties. Eur J Biochem. 268, 4200-4206.
Schober, A., J. Bernhagen and C. Weber. (2008). Chemokine-like functions of MIF in
atherosclerosis. J Mol Med. (Berl) 86, 761-770.
Schwartz, V., H. Lue, S. Kraemer, J. Korbiel, R. Krohn, K. Ohl, R. Bucala, C. Weber and J.
Bernhagen. (2009). A functional heteromeric MIF receptor formed by CD74 and CXCR4. FEBS
Lett. 583, 2749-2757.
Shao, D., X. Zhong, Y. F. Zhou, Z. Han, Y. Lin, Z. Wang, L. Bu, L. Zhang, X. D. Su and H.
Wang. (2010). Structural and functional comparison of MIF ortholog from Plasmodium yoelii
with MIF from its rodent host. Mol Immunol. 47, 726-737.
Shen, B., K. M. Brown, T. D. Lee and L. D. Sibley. (2014). Efficient gene disruption in diverse
strains of Toxoplasma gondii using CRISPR/CAS9. MBio. 5, e01114-01114.
Shi, T. Y., X. Y. Liu, L. L. Hao, J. D. Li, A. N. Gh, M. H. Abdille and X. Suo. (2008).
Transfected Eimeria tenella could complete its endogenous development in vitro. J Parasitol. 94,
978-980.
Shi, X., L. Leng, T. Wang, W. Wang, X. Du, J. Li, C. McDonald, Z. Chen, J. W. Murphy, E.
Lolis, P. Noble, W. Knudson and R. Bucala. (2006). CD44 is the signaling component of the
macrophage migration inhibitory factor-CD74 receptor complex. Immunity 25, 595-606.
Sidik, S. M., D. Huet, S. M. Ganesan, M. H. Huynh, T. Wang, A. S. Nasamu, P. Thiru, J. P. J.
Saeij, V. B. Carruthers, J. C. Niles and S. Lourido. (2016). A genome-wide CRISPR screen in
Toxoplasma identifies essential apicomplexan genes. Cell 166, 1423-1435.
Sommerville, C., J. M. Richardson, R. A. Williams, J. C. Mottram, C. W. Roberts, J. Alexander
and F. L. Henriquez. (2013). Biochemical and immunological characterization of Toxoplasma
gondii macrophage migration inhibitory factor. J Biol Chem. 288, 12733-12741.
Srikrishna, G. and H. H. Freeze. (2009). Endogenous damage-associated molecular pattern
molecules at the crossroads of inflammation and cancer. Neoplasia 11, 615-628.
Stäheli, P., F. Puehler, K. Schneider, T. W. Göbel and B. Kaspers. (2001). Cytokines of birds:
conserved functions--a largely different look. J Interferon Cytokine Res. 21, 993-1010.
- 53 -
Stillie, R., S. M. Farooq, J. R. Gordon and A. W. Stadnyk. (2009). The functional significance
behind expressing two IL-8 receptor types on PMN. J Leukoc Biol. 86, 529-543.
Stojanovic, I., T. Cvjeticanin, S. Lazaroski, S. Stosic-Grujicic and D. Miljkovic. (2009).
Macrophage migration inhibitory factor stimulates interleukin-17 expression and production in
lymph node cells. Immunology 126, 74-83.
Su, H., X. Liu, W. Yan, T. Shi, X. Zhao, D. P. Blake, F. M. Tomley and X. Suo. (2012).
piggyBac transposon-mediated transgenesis in the apicomplexan parasite Eimeria tenella. PLoS
One 7, e40075.
Sun, T., T. Holowka, Y. Song, S. Zierow, L. Leng, Y. Chen, H. Xiong, J. Griffith, M. Nouraie, P.
E. Thuma, E. Lolis, C. J. Janse, V. R. Gordeuk, K. Augustijn and R. Bucala. (2012). A
Plasmodium-encoded cytokine suppresses T-cell immunity during malaria. Proc Natl Acad Sci
USA 109, E2117-2126.
Suresh, M., K. Karaca, D. Foster and J. M. Sharma. (1995). Molecular and functional
characterization of turkey interferon. J Virol. 69, 8159-8163.
Tabarkiewicz, J., K. Pogoda, A. Karczmarczyk, P. Pozarowski and K. Giannopoulos. (2015).
The role of IL-17 and Th17 lymphocytes in autoimmune diseases. Arch Immunol Ther Exp.
(Warsz) 63, 435-449.
Tao, Z. Y., C. H. Zhu, Z. H. Shi, C. Song, W. J. Xu, W. T. Song, J. M. Zou and A. J. Qin.
(2015). Molecular characterization, expression, and functional analysis of NOD1 in Qingyuan
partridge chicken. Genet Mol Res. 14, 2691-2701.
Tarnowski, M., K. Grymula, R. Liu, J. Tarnowska, J. Drukala, J. Ratajczak, R. A. Mitchell, M.
Z. Ratajczak and M. Kucia. (2010). Macrophage migration inhibitory factor is secreted by
rhabdomyosarcoma cells, modulates tumor metastasis by binding to CXCR4 and CXCR7
receptors and inhibits recruitment of cancer-associated fibroblasts. Mol Cancer Res. 8, 1328-
1343.
Temperley, N. D., S. Berlin, I. R. Paton, D. K. Griffin and D. W. Burt. (2008). Evolution of the
chicken Toll-like receptor gene family: a story of gene gain and gene loss. BMC Genomics 9, 62.
Tillmann, S., J. Bernhagen and H. Noels. (2013). Arrest functions of the MIF ligand/receptor
axes in atherogenesis. Front Immunol. 4, 115.
Trinchieri, G. (2003). Interleukin-12 and the regulation of innate resistance and adaptive
immunity. Nat Rev Immunol. 3, 133-146.
Trout, J. M. and H. S. Lillehoj. (1996). T lymphocyte roles during Eimeria acervulina and
Eimeria tenella infections. Vet Immunol Immunopathol. 53, 163-172.
Truong, A. D., C. T. Hoang, Y. Hong, J. Lee, K. Lee, H. S. Lillehoj and Y. H. Hong. (2017).
Functional analyses of the interaction of chicken interleukin 23 subunit p19 with IL-12 subunit
p40 to form the IL-23 complex. Mol Immunol. 92, 54-67.
Turner, M. D., B. Nedjai, T. Hurst and D. Pennington. (2014). Cytokines and chemokines: At the
crossroads of cell signalling and inflammatory disease. Biochim Biophys Acta. 1843, 2563-2582.
- 54 -
Van Snick J, Cayphas S, Vink A, Uyttenhove C, Coulie P, Simpson R. (1986). Purification and
NH2-terminal amino acid sequence of a new T cell-derived lymphokine with growth factor
activity for B cell hybridomas. Proc Natl Acad Sci USA 83, 9679-9683.
Vinayak, S., M. C. Pawlowic, A. Sateriale, C. F. Brooks, C. J. Studstill, Y. Bar-Peled, M. J.
Cipriano and B. Striepen (2015). "Genetic modification of the diarrhoeal pathogen
Cryptosporidium parvum." Nature 523(7561): 477-480.
Wallach, M. (2010). Role of antibody in immunity and control of chicken coccidiosis. Trends
Parasitol. 26, 382-387.
Wallis, J. W., J. Aerts, M. A. Groenen, R. P. Crooijmans, D. Layman, T. A. Graves, D. E.
Scheer, C. Kremitzki, M. J. Fedele, N. K. Mudd, M. Cardenas, J. Higginbotham, J. Carter, R.
McGrane, T. Gaige, K. Mead, J. Walker, D. Albracht, J. Davito, S. P. Yang, S. Leong, A.
Chinwalla, M. Sekhon, K. Wylie, J. Dodgson, M. N. Romanov, H. Cheng, P. J. de Jong, K.
Osoegawa, M. Nefedov, H. Zhang, J. D. McPherson, M. Krzywinski, J. Schein, L. Hillier, E. R.
Mardis, R. K. Wilson and W. C. Warren. (2004). A physical map of the chicken genome. Nature
432, 761-764.
Walliser, I. and T. W. Göbel. (2018). Chicken IL-17A is expressed in alphabeta and gammadelta
T cell subsets and binds to a receptor present on macrophages, and T cells. Dev Comp Immunol.
81, 44-53.
Wang, B., X. Huang, P. J. Wolters, J. Sun, S. Kitamoto, M. Yang, R. Riese, L. Leng, H. A.
Chapman, P. W. Finn, J. R. David, R. Bucala and G. P. Shi. (2006). Cutting edge: Deficiency of
macrophage migration inhibitory factor impairs murine airway allergic responses. J Immunol.
177, 5779-5784.
Wang, C. C. (1982). Biochemistry and physiology of the coccidia. In The Biology of the
Coccidia (ed. Long, P. L.). pp. 167-228. London: University Park Press.
Warner, N. L., A. Szenberg and F. M. Burnet. (1962). The immunological role of different
lymphoid organs in the chicken. I. Dissociation of immunological responsiveness. Aust J Exp
Biol Med Sci. 40, 373-387.
Weber, C., S. Kraemer, M. Drechsler, H. Lue, R. R. Koenen, A. Kapurniotu, A. Zernecke and J.
Bernhagen. (2008). Structural determinants of MIF functions in CXCR2-mediated inflammatory
and atherogenic leukocyte recruitment. Proc Natl Acad Sci U S A. 105, 16278-16283.
Weining, K. C., U. Schultz, U. Munster, B. Kaspers and P. Stäheli. (1996). Biological properties
of recombinant chicken interferon-gamma. Eur J Immunol. 26, 2440-2447.
Weining, K. C., C. Sick, B. Kaspers and P. Stäheli. (1998). A chicken homolog of mammalian
interleukin-1 beta: cDNA cloning and purification of active recombinant protein. Eur J Biochem.
258, 994-1000.
Weismann, D. and C. J. Binder. (2012). The innate immune response to products of phospholipid
peroxidation. Biochim Biophys Acta. 1818, 2465-2475.
Wetzker, R. and F. D. Bohmer. (2003). Transactivation joins multiple tracks to the ERK/MAPK
cascade. Nat Rev Mol Cell Biol. 4, 651-657.
- 55 -
Wieland, W. H., D. Orzaez, A. Lammers, H. K. Parmentier, M. W. Verstegen and A. Schots.
(2004). A functional polymeric immunoglobulin receptor in chicken (Gallus gallus) indicates
ancient role of secretory IgA in mucosal immunity. Biochem J. 380, 669-676.
Wigley, P. and Kaiser, P. (2003). Avian cytokines in health and disease. Braz J Poult Sci. 5, 1-
14.
Williams, R. B. (1999). A compartmentalised model for the estimation of the cost of coccidiosis
to the world's chicken production industry. Int J Parasitol. 29, 1209-1229.
Wu, Y. F., H. J. Liu, S. H. Chiou and L. H. Lee. (2007). Sequence and phylogenetic analysis of
interleukin (IL)-1beta-encoding genes of five avian species and structural and functional
homology among these IL-1beta proteins. Vet Immunol Immunopathol. 116, 37-46.
Wu, Y. F., J. H. Shien, H. H. Yin, S. H. Chiow and L. H. Lee. (2008). Structural and functional
homology among chicken, duck, goose, turkey and pigeon interleukin-8 proteins. Vet Immunol
Immunopathol. 125, 205-215.
Xiaowen, Z., Y. Qinghua, Z. Xiaofei and Y. Qian. (2009). Co-administration of inactivated avian
influenza virus with CpG or rIL-2 strongly enhances the local immune response after intranasal
immunization in chicken. Vaccine 27, 5628-5632.
Yan, W., X. Liu, T. Shi, L. Hao, F. M. Tomley and X. Suo. (2009). Stable transfection of
Eimeria tenella: constitutive expression of the YFP-YFP molecule throughout the life cycle. Int J
Parasitol. 39, 109-117.
Ye, J., M. Yu, K. Zhang, J. Liu, Q. Wang, P. Tao, K. Jia, M. Liao and Z. Ning. (2015). Tissue-
specific expression pattern and histological distribution of NLRP3 in Chinese yellow chicken.
Vet Res Commun. 39, 171-177.
Yilmaz, A., S. Shen, D. L. Adelson, S. Xavier and J. J. Zhu. (2005). Identification and sequence
analysis of chicken Toll-like receptors. Immunogenetics 56, 743-753.
Yuk, S. S., D. H. Lee, J. K. Park, E. O. Tseren-Ochir, J. H. Kwon, J. Y. Noh, J. B. Lee, S. Y.
Park, I. S. Choi and C. S. Song. (2016). Pre-immune state induced by chicken interferon gamma
inhibits the replication of H1N1 human and H9N2 avian influenza viruses in chicken embryo
fibroblasts. Virol J. 13, 71.
Yun, C. H., H. S. Lillehoj and K. D. Choi. (2000). Eimeria tenella infection induces local gamma
interferon production and intestinal lymphocyte subpopulation changes. Infect Immun. 68, 1282-
1288.
Zabel, B. A., Y. Wang, S. Lewen, R. D. Berahovich, M. E. Penfold, P. Zhang, J. Powers, B. C.
Summers, Z. Miao, B. Zhao, A. Jalili, A. Janowska-Wieczorek, J. C. Jaen and T. J. Schall.
(2009). Elucidation of CXCR7-mediated signaling events and inhibition of CXCR4-mediated
tumor cell transendothelial migration by CXCR7 ligands. J Immunol. 183, 3204-3211.
Zipfel, C. and G. Felix. (2005). Plants and animals: a different taste for microbes? Curr Opin
Plant Biol. 8, 353-360.
- 56 -
Zou, J., X. Liu, T. Shi, X. Huang, H. Wang, L. Hao, G. Yin and X. Suo. (2009). Transfection of
Eimeria and Toxoplasma using heterologous regulatory sequences. Int J Parasitol. 39, 1189-
1193.
57
CHAPTER III
Functional characterization of the turkey macrophage migration inhibitory factor
Abstract
Macrophage migration inhibitory factor (MIF) is a soluble protein that inhibits the random
migration of macrophages and plays a pivotal immunoregulatory function in innate and adaptive
immunity. The aim of this study was to clone the turkey MIF (TkMIF) gene, express the active
protein, and characterize its basic function. The full-length TkMIF gene was amplified from
total RNA extracted from turkey spleen, followed by cloning into a prokaryotic (pET11a)
expression vector. Sequence analysis revealed that TkMIF consists of 115 amino acids with 12.5
kDa molecular weight. Multiple sequence alignment revealed 100%, 65%, 95% and 92%
identity with chicken, duck, eagle and zebra finch MIFs, respectively. Recombinant TkMIF
(rTkMIF) was expressed in E. coli and purified through HPLC and endotoxin removal. SDS-
PAGE analysis revealed an approximately 13.5 kDa of rTkMIF monomer containing T7 tag in
soluble form. Western blot analysis showed that anti-chicken MIF (ChMIF) polyclonal antisera
detected a monomer form of TkMIF at approximately 13.5 kDa size. Further functional analysis
revealed that rTkMIF inhibits migration of both mononuclear cells and splenocytes in a dose-
dependent manner, but was abolished by the addition of anti-ChMIF polyclonal antisera. qRT-
PCR analysis revealed elevated transcripts of pro-inflammatory cytokines by rTkMIF in LPS-
stimulated monocytes. rTkMIF also led to increased levels of IFN-γ and IL-17F transcripts in
Con A-activated splenocytes, while IL-10 and IL-13 transcripts were decreased. Overall, the
sequences of both the turkey and chicken MIF have high similarity and comparable biological
functions with respect to migration inhibitory activities of macrophages and enhancement of pro-
58
inflammatory cytokine expression, suggesting that turkey and chicken MIFs would be
biologically cross-reactive.
Introduction
Macrophage migration inhibitory factor (MIF), an evolutionarily conserved multi-
functional protein, was originally identified as activated T cell-derived factor inhibiting random
migration of macrophages (David et al., 1966). Following determination of complementary
DNA sequence of human MIF (Weiser et al., 1989), a variety of biological properties has been
reported and defined MIF as a cytokine, enzyme, and chemokine-like function (CLF)
chemokine. MIF is constitutively expressed in a wide range of tissues and cells, and rapidly
released after stimulation with Gram-negative bacteria, bacterial endotoxin (LPS), pro-
inflammatory mediators (Calandra et al., 1994), and low concentration of glucocorticoids
(Calandra et al., 1995). Due to the absence of N-terminal consensus leader sequence, MIF is
rapidly secreted through non-classical pathway that requires the activation of the Golgi-associate
protein p115a (Flieger et al., 2003).
As a pleiotropic inflammatory cytokine, MIF modulates both innate and adaptive immune
responses through the activation of macrophages and T cells (Calandra et al., 2003). MIF
upregulates the expression of TLR4 in response to stimuli and prompts induction of pro-
inflammatory cytokines and chemokine (TNF-α, IFN-γ, IL-1β, IL-2, IL-6, IL-8), nitric oxide
(NO) (Calandra et al., 1994; 1995; Bacher et al., 1996), and macrophage inflammatory protein 2
(MIP2) (Makita et al., 1998). In adaptive immunity, MIF inhibits CD8+ T lymphocytes (CTL)
cytotoxicity and regulates T cell trafficking (Abe et al., 2001). MIF reverses the anti-
inflammatory and immunosuppressive activities of glucocorticoids, and sustains inflammatory
59
response against them (Calandra et al., 1995). A high-affinity interaction of MIF with CD74 is
responsible to induce cell proliferation by activation ERK1/2 family of mitogen-activated protein
(MAP) in growth-promoting signaling pathway (Leng et al., 2003). Induction of
cyclooxygenase-2 (COX-2) and products of the arachidonic acid pathway (PGE2) by MIF is
required to suppress apoptotic-inducing function of the tumor suppress protein (p53), which
promotes cell survival (Mitchell et al., 2002). Structural analysis revealed MIF exists as a
homotrimer form, and two adjacent sites between monomers possess enzymatic activities
(Lubetsky et al., 1999), such as a D-dopachrome tautomerase (Rosengren et al., 1996), a
phenylpyruvate tautomerase (Rosengren et al., 1997), and a thiol-protein oxidoreductase
(Kleemann et al., 1998). Moreover, MIF is classified into CLF chemokine based on the
structural and functional similarities with chemokines. Comparison of crystal structure revealed
that MIF monomer resembles the dimer form of CXCL8 (Weber et al., 2008). The non-cognate
interaction of MIF with chemokine receptors, CXCR2, CXCR4 and CXCR7, promotes
chemotactic migration and leukocytes arrest (Bernhagen et al., 2007; Tarnowski et al., 2010).
In birds, chicken MIF was identified as a marker for cellular differentiation in developing
chicken eye lens (Wistow et al., 1993) and upregulated MIF transcript was observed in the small
intestine of Eimeria-infected chickens, thus supporting involvement of MIF in intestinal immune
responses (Hong et al., 2006a,b). Molecular function of chicken MIF was characterized by
analysis of cell migration, transcription of Th1/Th2-associated and pro-inflammatory cytokines,
cell proliferation after LPS stimulation (Kim et al., 2010). Recently, it was verified that ChMIF
binds to macrophage via surface receptor, CD74p41 (Kim et al., 2014).
Comparative analyses of the turkey and chicken genomes revealed high similarity
between the two sequences being relatively conservative and stable despite 40 million years of
60
species divergence (Dalloul et al., 2010). However, these two species showed lower similarity
(83%) at the protein level than at the genome level (90%) (Arsenault et al., 2014). To elucidate
these distinctions at the protein level, further biological characterization is required. To date,
several cytokines have been biologically characterized in turkeys, and also describing the cross-
reactivities of avian cytokines including IFN-γ, IL-2, IL-10, IL-13, and IL-18 (Lawson et al.,
2000, 2001; Kaiser, 2002; Powell et al., 2012).
Given that these cytokines are functionally cross-reactive between two closely related
Galliformes (turkey and chicken), MIF may also have a similar role in both species. To describe
the biological function of MIF in turkeys that may have cross-reactivity with chicken MIF, we
cloned the full-length turkey MIF (TkMIF) gene, and explored its biological functions including
inhibitory effect of random cell migration, proliferative effect of splenic lymphocytes, and
expression of pro-inflammatory and Th1/Th2/Th17 cytokines by activated immune cells.
Materials and methods
Turkey, RNA sources for cloning
Tissue samples, including heart, liver, brain, thymus, spleen, small intestine sections
(duodenum, jejunum, ileum), proventriculus, cecal tonsil and bursa were collected from 21-day-
old commercial turkey (Meleagris gallopavo). A total of 30 mg tissue samples was excised and
homogenized in lysis buffer (Qiagen, CA) containing β-mercaptoethanol (β-Me) with stainless
steel beads using TissueLyser II (Qiagen) for 5 min at 25 Hz. Total RNA was isolated from
homogenized tissues using the RNeasy Mini kit (Qiagen) according to the manufacturer’s
instructions, and its concentration and purity measured using a NanoDrop. Isolated RNAs were
61
used to assess TkMIF tissue distribution, and RNA extracted from spleen was used to amplify
the full-length TkMIF gene.
Sequence analyses
Nucleotide and deduced amino acid sequences of TkMIF were compared with other
sequences reported in NCBI’s GenBank using Clustal Omega program (Sievers and Higgins,
2014). The phylogenetic tree was constructed from the aligned sequences by the neighbor-
joining (NJ) method and evaluated with 1000 bootstrap replicates using MEGA4 (Tamura et al.,
2007). The molecular weight (MW) and theoretical isoelectric point (pI) of MIF were computed
using the Translate software. The presence of signal peptide and potential N-glycosylation sites
were predicted using SignalP3.0 and NetNGlyc 1.0, respectively. The protein secondary
structure of MIF was determined using SSpro 5.1 (Magnan and Baldi, 2014).
Tissue distribution of TkMIF
In order to analyze TkMIF expression in various turkey tissues, qRT-PCR was performed
using 7500 Fast Real-Time PCR system (Applied Biosystems, CA). Specific primer sets were
designed using Primer Express (Ver 3.0; Applied Biosystems) (Table 3.1). First-strand cDNA
was synthesized with 2 µg of total RNA from turkey tissues using High-capacity cDNA Reverse
Transcription kit (Applied Biosystems). Synthesized cDNA was diluted to 1:25 with nuclease-
free water and 1 µl of diluted cDNA was used as template with 0.1 µM primers targeting TkMIF
and 5 µl of 2× Fast SYBR Green Master Mix (Applied Biosystems) in 10 µl volume of final
qRT-PCR reaction. The PCR reaction was performed as follows: samples were initially
denatured at 95°C for 20 sec, followed by 40 cycles of denaturation at 95°C for 3 sec and
62
annealing/extension at 57°C for 30 sec. Reactions were prepared in triplicate and GAPDH was
used as reference gene. TkMIF expression was normalized to GAPDH and calculated relative to
that of the heart by the 2−ΔΔCt comparative method.
Construction of recombinant TkMIF (rTkMIF) expression plasmid
The full-length TkMIF gene was amplified from total RNA extracted from turkey spleen
using primers designed by Kim et al. (2010) as follows: initial denaturation at 92°C for 2 min,
followed by 35 cycles of denaturation at 92°C for 15 sec, annealing at 57°C for 15 sec, and
extension at 72°C for 30 sec with a final extension at 72°C for 7 min. The amplified PCR
product was purified using Wizard SV Gel and PCR Clean-up system (Promega, WI), ligated
into pGEM-T vector, and followed by transformation into E. coli Top10. Transformants
containing the target gene were selected by combination of colony PCR screening and
endonuclease digestion with EcoR I (New England Biolabs, MA), confirmed by sequencing
(Virginia Bioinformatics Institute at VT, VA). For sub-cloning into a prokaryotic expression
vector, TkMIF was digested with restriction endonucleases Nde I and Nhe I (New England
Biolabs), and sub-cloned into the pET11a vector. The recombinant plasmid was transformed
into E. coli Top10 and positive clones including TkMIF were selected and confirmed by
sequencing.
Expression and purification of rTkMIF by SEC-HPLC
The TkMIF in pET11a plasmid was transformed into E. coli BL21 (DE3) and cultured at
30°C overnight and the production of recombinant TkMIF was induced by shake-incubating for
5 hr in the presence of 1 mM IPTG. The cells were harvested and lysed by rapid sonication-
63
freeze-thaw cycles in 20 mM NaH2PO4, 500 mM NaCl (pH 7.8), followed by treatment of RNase
A (10 µg/ml) and DNase I (10 µg/ml) on ice for 15 min. By centrifugation, the supernatant
including rTkMIF was collected. For endotoxin removal prior to purification, TX-114 (Sigma,
MO) was added to the bacterial lysate containing rTkMIF to a final concentration of 1%. The
mixture was shortly vortexed and incubated at 41°C for 5 min, followed by centrifugation to
collect the upper aqueous phase containing rTkMIF. This procedure was repeated three times.
Subsequently, size exclusion high performance liquid chromatography (SEC-HPLC) was used to
purify rTkMIF. In SEC-HPLC, a mobile phase containing 50 mM K2HPO4, 150 mM NaCl (pH
6.8) was passed through two size exclusion columns (7.7mm×300mm, Biosuite 5 µm HR;
Waters, MA) at a rate of 0.5 ml/min and the absorbance was monitored with a photo diode array
detector (Model 997; Waters, MA) at 214 nm and 280 nm. Following injection of lysates,
fractions were collected, analyzed by SDS-PAGE, and the concentration of proteins determined
by BCA assay (Thermo Scientific, IL). The level of endotoxin in purified protein sample was
measured using Limulus Amebocyte Lysate (LAL) chromogenic endotoxin quantitation kit
(Rockfold, IL).
Western blot analysis
Western blotting was performed to examine whether a rabbit anti-ChMIF polyclonal
antisera (Kim et al., 2010) would recognize TkMIF as it shares high identity with ChMIF.
Briefly, 1 ng of purified TkMIF was resolved on SDS-PAGE gel under reduced conditions,
transferred to a PVDF membrane (Millipore, MA) and incubated with anti-ChMIF polyclonal
antisera in a 1:1000 dilution as the primary antibody. Goat anti-rabbit IgG conjugated with HRP
(Thermo Scientific, IL) was applied as the secondary antibody and the blot was incubated in the
64
SuperSignal® West Pico Chemiluminescent Substrate (Rockford, IL), and exposed to X-ray film
(Genesee Scientific, CA).
Isolation of peripheral blood mononuclear cells (PBMCs) and splenocytes
In order to perform cellular assay, turkey PBMCs were isolated from freshly drawn blood
by density-gradient centrifugation. Briefly, 20 ml of blood were collected from the heart
(immediately following euthanasia) and diluted with equal volume of Hank’s Buffered Salt
Solution without magnesium and calcium (HBSS; HyClone, UT). Following centrifugation at 50
x g for 10 min, the supernatant and buffy coat were collected and then carefully overlaid on
Histopaque-1077 (Sigma, MO). After centrifugation at 400 x g for 30 min at room temperature,
mononuclear cells from the interphase were collected by Pasteur pipette and mixed with PBS for
washing. After centrifugation at 250 x g for 10 min, the collected cells were washed with
Dulbecco’s Modified Eagle Medium (DMEM; Mediatech, VA), counted using a hemocytometer
and cultured at 1.0×106 cells/well in a 24-well plate for 3 hr at 39°C with 5% CO2 humidified air.
By gently washing with DMEM, non-adherent cells were removed leaving adherent
monocytes/macrophages on the plate.
For turkey splenocytes isolation, spleens were cut into small pieces and smashed through
a 70 μm cell strainer (BD, CA) using a syringe plunger. Cell suspension was washed three times
with HBSS to remove cell debris and overlaid onto Histopaque-1077, followed by isolation of
splenocytes as described above. Isolated splenocytes were resuspended with RPMI-1640
(Mediatech, VA) supplemented with 20% fetal calf serum (FCS) and 1% penicillin/streptomycin
and cultured for 24 hr at 39°C with 5% CO2 humidified air. After overnight incubation, non-
adherent cells were collected and adjusted to a cell density of 2×106 cells/ml.
65
Chemotaxis assay
To measure the ability of TkMIF in inhibiting the random migration of immune cells,
serially diluted rTkMIF (0.01, 0.1, 1.0 μg/ml) with DMEM supplemented with 10% FCS and 1%
penicillin/streptomycin were freshly prepared. Diluted rTkMIF (25 μl) was loaded to the bottom
wells of the Boyden chemotaxis chamber in absence or presence of anti-rChMIF polyclonal
antisera along with the medium supplemented with 10% FCS and serum-free medium as positive
and negative controls, respectively. Polycarbonate filter membrane (Neuro Probe, MD) was
placed with forceps and then 50 μl of prepared PBMCs or splenocytes (1.0×105 cells/ml) were
loaded on the top well above the membrane. After incubation at 39°C with 5% CO2 for 4 hr,
cells that migrated to the bottom side of the membrane were fixed, stained using Diff-Quick
Staining (Fisher Scientific, NJ) and counted. The percentage of migration inhibition was
calculated as previously described (Kotkes et al., 1979).
Cell proliferation assay
Cell proliferation was determined with CellTiter 96® Non-Radioactive Cell Proliferation
Assay Kit (Promega, WI). For this assay, isolated splenocytes (1.0×105 cells/ml) were treated
with medium alone, Concanavalin A (Con A) alone (10 μg/ml), rTkMIF (0.01 and 0.1 μg/ml) or
rTkMIF (0.01 and 0.1μg/ml) with Con A (10 μg/ml) in the presence or absence of anti-ChMIF
polyclonal antibody at 39°C with 5% CO2 for 24 hr. After incubation, the Dye solution was
added and the mixture incubated at 39°C with 5% CO2 for 4 hr. The Solubilization solution/Stop
mix were added followed by incubation at 39°C with 5% CO2 for 1 hr, after which absorbance
66
was measured at 595 nm and 630 nm using a microplate reader. The results were analyzed after
subtraction of the 630 nm value as a background.
Cell stimulation assay and cytokine transcripts analysis
PBMCs were cultured at 2.0×106 cells/well in a 24-well plate and treated with medium
alone, LPS alone (5 μg/ml), rTkMIF (0.01 and 0.1 μg/ml) or rTKMIF (0.01 and 0.1 μg/ml) with
LPS (5 μg/ml) at 39°C with 5% CO2 for 6 hr. The supernatants were collected for NO assay
using Griess Reagent System (Promega, WI). The cells were lysed with Buffer RLT (Qiagen)
containing β-Me followed by RNA extraction using RNeasy Mini Kit (Qiagen). After cDNA
synthesis using 1 μg of RNA, expression levels of pro-inflammatory cytokines (IL-1β, IL-6, IL-
12β, IL-18), the chemokine L-8, and nitric oxide (NO) were analyzed using pre-designed primer
sets (Table 3.1).
Isolated splenocytes were cultured at 2.0×106 cells/well in a 24-well plate and treated
with medium alone, Con A alone (10 μg/ml), rTkMIF (0.01 and 0.1μg/ml) or rTKMIF (0.01 and
0.1 μg/ml) with Con A (10 μg/ml) at 39°C with 5% CO2 for 6, 12, or 24 hr. After incubation,
NO assay was performed using the supernatant and total RNA was extracted. After cDNA
synthesis, the transcripts of Th1/Th2/Th17 cytokines (IFN-γ, IL-10, IL-13, IL-17F) were
analyzed by qRT-PCR.
Statistical analysis
All data were analyzed by Student’s t-test or one-way analysis of variance (ANOVA)
using JMP software (Ver 11) and significant differences between groups were considered
significant by Tukey-Kramer multiple comparison test at P < 0.05.
67
Results
Sequence and phylogenetic analyses of TkMIF
The full-length TkMIF amplified from turkey spleen contained 348 bp nucleotides
encoding a 115-amino acid protein, which had 97% nucleotide and 100% amino acid identities
with Chicken MIF (Fig. 3.1 and Fig. 3.2A). Multiple sequence alignment and phylogenetic
analysis revealed that TkMIF shares 71% identity with human and mouse MIFs, and over 61%
identity among bird species with the highest identity with eagle (95%) and zebra finch (92%)
MIFs (Fig. 3.2). The phylogenetic tree shows that turkey MIF is closest to the chicken MIF as
well as clusters together with eagle and zebra finch MIFs. Similar to mammalian MIF and
ChMIF, TkMIF retained conserved amino acid residues, Pro2, Lys33, Ile65, Tyr96, Asn98, which
are essential for enzymatic activities. The putative TkMIF showed a calculated MW of 12.5 kDa
and theoretical isoelectric point of 7.82. Computational analysis revealed two possible N-
glycosylations (73Asn-Lys-Thr75, 110Asn-Gly-Ser112) and four cysteine residues (Cys11, Cys57,
Cys60, Cys81) in the amino acid sequence. Cys11 is only conserved among the chicken, eagle, and
zebra finch MIFs that are highly similar to TkMIF, and Cys57and Cys60 formed conserved Cys-
X-X-Cys motif mediated by enzymatic oxidoreductase activity. Secondary structure of TkMIF
exhibits two α-helices and six β-strands (Fig. 3.1), similar to that of human MIF monomer.
TkMIF expression in tissues
The expression pattern of TkMIF gene was measured in various tissues including heart,
liver, brain, thymus, spleen, proventriculus, cecal tonsils, bursa, and intestinal sections using
qRT-PCR (Fig. 3.3). The expression level was normalized to GAPDH expression as an
68
endogenous reference gene and then fold changes were calculated relative to the lowest
expression level of heart. The result demonstrated that TkMIF is ubiquitously expressed in all
tested tissues, with lowest level in the heart and relatively highest levels in spleen and thymus.
Expression and Western analysis of TkMIF
rTkMIF was expressed in E. coli BL21 (DE3) as a soluble form and 20% of protein from
bacterial lysates was detected in predicted MW of rTkMIF on a gel after endotoxin removal by
TX-114 extraction. rTkMIF was purified and collected from fractions 19 and 20 by SEC-HPLC
with 80% purity. Purified rTkMIF was observed around 13.5 kDa by SDS-PAGE (Fig. 3.4B,
left), which is slightly higher molecular weight than that of only rTkMIF, 12.5 kDa due to the
presence of T7 tag (approximately 1.3 kDa) in the recombinant protein that was encoded by the
plasmid vector. Endotoxin concentration of purified rTkMIF was 0.04 EU (endotoxin units) per
μg protein. Since turkey and chicken MIFs showed high identify, we examined whether anti-
ChMIF polyclonal antisera (Kim et al., 2010) can bind rTkMIF molecule (Fig. 3.4B, right). The
anti-ChMIF polyclonal antisera recognized 13.5 kDa of rTkMIF along with rChMIF, which was
used as a positive control. Based on the Western blotting results, anti-ChMIF polyclonal antisera
were used to neutralize rTkMIF in further assays.
Chemotactic activity of rTkMIF
In order to evaluate the regulation of PBMCs and splenocytes migration by rTkMIF,
chemotaxis assay was performed. Migration of PBMCs was inhibited by rTkMIF in a dose-
dependent manner, with 90% and 60% migration inhibition at high (1 µg/ml) and low (0.01
µg/ml) concentration of rTkMIF, respectively (Fig. 3.5A). Although the inhibition level of cell
69
migration is slightly lower than in PBMCs, rTkMIF also inhibited migration by approximately
80% (1 µg/ml) and 10% (0.01 µg/ml) of splenic lymphocytes (Fig. 3.5B). The results show that
rTkMIF has appreciable inhibition activity of migration on PBMCs as well as on splenocytes,
revealing different inhibitory pattern between these two cell types. Since 0.01 and 0.1 µg/ml of
rTkMIF showed noticeable reduction of both PBMCs and splenocytes migration, these two
concentrations were used in subsequent assays.
To substantiate its biological specificity, rTkMIF was neutralized using anti-ChMIF
polyclonal antisera to examine whether MIF-induced inhibition of cell migration can be
abolished. Pre-incubation of rTkMIF (0.1 μg/ml) with anti-ChMIF polyclonal antisera blocked
approximately 70% and 30% migration inhibition of PBMCs and splenocytes, respectively (Fig.
3.6). Anti-ChMIF antisera alone had no effect on migration of both PBMCs and splenocytes.
The effect of rTkMIF on proliferation of splenic lymphocytes
To determine the effect of rTkMIF on cell proliferation, the isolated splenocytes were
cultured with rTkMIF in the presence or absence of Con A (Fig. 3.7). We did not observe
significantly induced cell proliferation under the treatment with 0.01 µg/ml of rTkMIF both
presence and absence of Con A. However, treatment with 0.1 μg/ml of rTkMIF significantly
induced splenocytes proliferation. Additionally, 0.1 µg/ml of rTkMIF enhanced proliferation of
Con A co-stimulated splenocytes. This rTkMIF-induced splenocyte proliferation was abolished
by pre-incubation with anti-ChMIF antisera, further substantiated its biological activity on cell
proliferation.
Expression of pro-inflammatory cytokines and chemokine by TkMIF in PBMCs
70
The administration of rTkMIF alone did not affect cytokine expression (data not shown),
but overall treatment of rTkMIF with LPS enhanced mRNA level of pro-inflammatory cytokines
(IL-1β, IL-6) and chemokine (IL-8) compared to those of LPS alone-treated cells (Fig. 3.9).
Transcripts of IL-1β and iNOS were enhanced approximately 14-fold and 19-fold, respectively,
by incubation with 0.01 μg/ml rTkMIF but not with 0.1 µg/ml. IL-1β transcript was enhanced by
13-fold following 12 hr incubation (data not shown). The addition of rTkMIF induced mRNA
levels of IL-6 and IL-8 regardless of concentration, and markedly enhanced IL-8 transcript
shown for 6 hr as well as 12 hr incubation. LPS-stimulated PBMCs exhibited no significant
induction of IL-12β (p40) and had reduced IL-18 transcript after 6 hr incubation with rTkMIF.
However, enhanced IL-12β and IL-18 transcripts by 2-fold were shown at 12 hr incubation with
0.01 μg/ml rTkMIF (data not shown). In addition, the production of NO by PBMCs was
observed after rTkMIF (0.01µg/ml) stimulation in combination with LPS, but not after treatment
with rTkMIF alone (Fig. 3.8).
Expression of Th1/Th2/Th17 cytokines by TkMIF in splenocytes
Splenocytes were treated with rTkMIF (0.01 and 0.1 μg/ml) in the presence of Con A for
6, 12, and 24 hr (Fig. 3.10). Transcript of IFN-γ, a Th1 cytokine, was induced by Con A
treatment, but no effect was observed by rTkMIF at 6 hr point; however, rTkMIF enhanced IFN-
γ transcript in a dose-dependent manner at 12 hr post-stimulation. No difference in mRNA level
was observed by Con A and/or rTkMIF at 24 hr post-stimulation. On the other hand, rTkMIF
reduced transcripts of Th2 cytokines (IL-10 and IL-13) after 24 hr stimulation; however, IL-10
transcript was enhanced when the Con A-activated splenocytes were incubated with 0.1 µg/ml of
rTkMIF at 6 hr. rTkMIF significantly enhanced mRNA level of IL-17F over the tested
71
incubation periods, especially 24 hr post-stimulation. MIF transcript was not changed with
either Con A treatment alone or Con A and rTkMIF treatment.
Discussion
Previously, the molecular cloning and biological characterization of ChMIF have been described
(Kim et al., 2010). Interestingly, MIF homologue from turkey has high sequence identity with
the corresponding gene of its sister Galliformes bird, the domesticated chicken. This finding led
us to characterize the biological activities of TkMIF in order to compare this cytokine functions
between two closely related Galliformes species (Kim et al., 2010). In this study, we cloned the
full-length MIF from domesticated turkey spleen and characterized its biological functions ex
vivo. Sequence analysis revealed that TkMIF contains conserved residues including CXXC
motif mediating enzymatic activity, similar to human and mouse. In addition, secondary
structure analysis revealed that TkMIF possesses two α-helices and six β-strands in the same
order as mammalian MIF (Sun et al., 1996; Suzuki et al., 1996), implying a similar tertiary
structure and function between turkey and mammalian MIFs. The conserved sequences
mediating enzymatic activities suggest the potential similar activities of TkMIF. However,
catalytic activities were not exhibited in TkMIF in contrast to mammalian MIFs (Sugimoto et al.,
1999). Interestingly, a lack of catalytic properties also was exhibited in chicken MIF (Kim et al.,
2010). Also, TkMIF shares high homology with variant-1 of zebra finch among its two
isoforms. MIF is highly conserved among birds and mammals, indicating this molecule is
evolutionary conserved across species and hence implying its significant function.
MIF is ubiquitously expressed not only by immune cells as macrophages and activated T
lymphocytes, but also by non-immune cells such as endothelial, epithelial and parenchymal cells
72
(Lue et al., 2002; Calandra et al., 2003). Consistent with the distribution pattern of MIF in
various species, TkMIF was ubiquitously expressed in all tissues examined, and highly expressed
in the primary and secondary lymphoid tissues (thymus and spleen), in contrast to abundant
ChMIF transcript in stomach (Kim et al., 2010). Of note, only subtle differences were observed
in TkMIF expression between male and female tissues. Mammalian MIF is more expressed by
monocytes and T lymphocytes, and up-regulated by stimulation with bacterial LPS and certain
cytokines like IFN-γ and TNF-α (Calandra et al., 1994). Although TkMIF is constitutively
expressed, it is not significantly induced by stimulated monocytes and lymphocytes, similar to
ChMIF (Kim et al., 2010).
Like mammalian MIFs, TkMIF lacks an N-terminal signal sequence, indicating it is
easily released from its intracellular stores as a soluble form via a non-conventional mechanism
(Weiser et al., 1989). As expected from high sequence identity between turkey and chicken
MIFs, the ability of anti-ChMIF antisera to bind TkMIF was substantiated by performing
Western blotting, which shows the cross reactivity of chicken MIF antibody against TkMIF.
In the mouse, MIF regulated the recruitment of monocytes, T lymphocytes, and
neutrophils like a CLF chemokine (Bernhagen et al., 2007). The migration inhibitory properties
of MIF on monocytes and lymphocytes were examined in the fish and further confirmed by
neutralizing antibody (Qiu et al., 2013). Consistent with previous reports, rTkMIF inhibited
random migration of both monocytes and splenic lymphocytes in a dose-dependent manner.
This inhibitory effect was abolished in the presence of anti-ChMIF polyclonal antisera,
demonstrating that the observed inhibitory effect on the migration of immune cells was
specifically associated with rTkMIF. The rTkMIF exhibited similar pattern of chemotactic
73
activity with ChMIF, suggesting that chemokine-like properties of MIF is conserved in both
mammalian and avian species.
Based on the finding that MIF was abundantly expressed in the epithelial cells of chicken
embryonic lens (Wistow et al., 1993), MIF has been considered an important factor for cell
growth and differentiation. Mammalian MIF induced a survival cascade via interaction with
CD74, resulting in B cell proliferation and survival (Starlets et al., 2006). Immuno-
neutralization of MIF indicated its proliferative effect on splenocytes and T lymphocytes (Bacher
et al., 1996; Calandra et al., 1998). Additionally, MIF is secreted by murine dendritic cells
(DCs) and neural stem/progenitor cells (NSPCs) that can support the proliferation and survival of
NSPCs (Ohta et al., 2012). In chickens, MIF induced proliferation of lymphocytes primed by
Con A, although MIF alone did not impact cell proliferation (Kim et al., 2010). In the present
study, enhancement of cell proliferation was detected by addition of TkMIF on splenic
lymphocytes both in the presence and absence of Con A stimulation. The proliferative effect of
TkMIF was suppressed by anti-ChMIF antisera. These small but statistically significant effects
support its ability to promote cell proliferation.
Furthermore, MIF activated macrophages and induced significant production of pro-
inflammatory cytokines and NO in stimulated macrophages/monocytes (Bernhagen et al., 1994;
Calandra et al., 1995). In chickens, upregulated expression of pro-inflammatory cytokines and
iNOS was shown in response to 0.01 µg/ml of rChMIF by LPS-primed monocytes/macrophages.
The current findings that addition of TkMIF significantly augmented pro-inflammatory cytokines
and chemokine (IL-1β, IL-6, IL-8) transcription and NO release by LPS-stimulated monocytes
are consistent with previous reports. TkMIF stimulation induced IL-12β and IL-18 at later time-
points when compared with other pro-inflammatory cytokines and chemokine. These inductions
74
may consequently result in synergistic action of IL-12β and IL-18 that would lead to IFN-γ
production and stimulation of a Th1 response (Takeda et al., 1998). Taken together, these data
support the pro-inflammatory roles of avian MIFs in stimulated immune cells. Given that avian
MIF promotes pro-inflammatory responses of innate immune cells, these findings suggest its
potential role in host innate immune defenses of infected birds.
In regards to MIF involvement in T cell immunity, murine MIF promoted Th1 cytokine
production, typically IL-2 and IFN-γ, in activated T cells (Bacher et al., 1996). In chickens, the
production of Th1 and Th2 cytokines was regulated by MIF levels in Con A-stimulated
lymphocytes (Kim et al., 2010). In the present study, the addition of rTkMIF induced the
expression of IFN-γ at 12 hr, and reduced transcripts of the Th2 cytokines IL-10 and IL-13 at 24
hr. The expression of IL-10 was briefly reduced and elevated after stimulation with low (0.01
μg/ml) and high (0.1 μg/ml) concentrations of TkMIF at 6 hr, and then gradually decreased over
24 hr. Given the ability of avian IL-10 to inhibit IFN-γ expression by stimulated splenocytes
(Rothwell et al., 2004; Powell et al., 2012), late enhancement of IFN-γ may be caused by gradual
decline in IL-10 transcript combined with synergistic activity of IL-12β and IL-18. As to the
expression patterns of Th1 and Th2 cytokines in MIF-stimulated lymphocytes, TkMIF promoted
Th1 transcript whereas suppressed Th2 transcripts, contrast to ChMIF that enhanced the
transcript of both Th1 and Th2 cytokines. These findings indicate different expression profiles
of Th1 and Th2 between two species that may mediate the different susceptibilities to host-
specific pathogens; turkeys were extremely susceptible to Histomonas meleagridis exhibiting
high mortality, while chickens were resistant to the parasite (Powell et al., 2009). In this regard,
it would be interesting to investigate whether MIF is associated with the susceptibility of turkeys
to protozoan pathogens. The stimulatory effect of MIF on IL-17 production was observed in
75
activated murine lymphocytes (Stojanovic et al., 2009). Similarly, rTkMIF continuously
stimulated IL-17F production over the 24 hr incubation period, suggesting the possibility that
avian MIF might be involved in differentiation of Th17 cells. Abundant MIF transcript by
stimulation with PMA/ION was observed in mice (Bacher et al., 1996), whereas
TkMIF was not significantly induced by stimulated splenic lymphocytes as well as monocytes
from turkeys similar to chicken MIF, indicating that avian MIFs are constitutively expressed in
immune cells regardless of stimulation. These findings indicate the unique expression pattern of
avian MIF contrast to most cytokines and chemokines that are expressed by activated cells.
TkMIF alone is not sufficient to induce cytokine expression in splenic lymphocytes as well as in
monocytes, similar to results by ChMIF alone. Overall, these data suggest that MIF can be
directly involved in the modulation of Th1/Th2/Th17 cytokines in turkeys, further revealing
different innate immune responses in stimulated cells between turkeys and chickens.
In summary, Turkey MIF was cloned and its biological functions characterized including
migration inhibitory effect, proliferative effect, and the ability to modulate production of pro-
inflammatory mediators as well as Th1/Th2/Th17 cytokines. These results help us to better
understand the biological functions of evolutionarily conserved avian MIFs in the birds’ immune
system, and predict functional cross-reactivity between turkey and chicken MIFs.
76
References
Abe, R., T. Peng, J. Sailors, R. Bucala and C. N. Metz. (2001). Regulation of the CTL response
by macrophage migration inhibitory factor. J Immunol. 166, 747-753.
Arsenault, R.J., Trost, B. Kogut, M.H. (2014). A comparison of the chicken and turkey
proteomes and phosphoproteomes in the development of poultry-specific immuno-metabolism
kinome peptide arrays. Front. Vet. Sci. 1, 22.
Bacher, M., C. N. Metz, T. Calandra, K. Mayer, J. Chesney, M. Lohoff, D. Gemsa, T. Donnelly
and R. Bucala. (1996). An essential regulatory role for macrophage migration inhibitory factor in
T-cell activation. Proc Natl Acad Sci USA 93, 7849-7854.
Bernhagen, J., R. A. Mitchell, T. Calandra, W. Voelter, A. Cerami and R. Bucala. (1994).
Purification, bioactivity, and secondary structure analysis of mouse and human macrophage
migration inhibitory factor (MIF). Biochemistry 33, 14144-14155.
Bernhagen, J., R. Krohn, H. Lue, J. L. Gregory, A. Zernecke, R. R. Koenen, M. Dewor, I.
Georgiev, A. Schober, L. Leng, T. Kooistra, G. Fingerle-Rowson, P. Ghezzi, R. Kleemann, S. R.
McColl, R. Bucala, M. J. Hickey and C. Weber. (2007). MIF is a noncognate ligand of CXC
chemokine receptors in inflammatory and atherogenic cell recruitment. Nat Med. 13, 587-596.
Calandra, T., J. Bernhagen, R. A. Mitchell and R. Bucala. (1994). The macrophage is an
important and previously unrecognized source of macrophage migration inhibitory factor. J Exp
Med. 179, 1895-1902.
Calandra, T., J. Bernhagen, C. N. Metz, L. A. Spiegel, M. Bacher, T. Donnelly, A. Cerami and
R. Bucala. (1995). MIF as a glucocorticoid-induced modulator of cytokine production. Nature
377, 68-71.
Calandra, T., L. A. Spiegel, C. N. Metz and R. Bucala. (1998). Macrophage migration inhibitory
factor is a critical mediator of the activation of immune cells by exotoxins of Gram-positive
bacteria. Proc Natl Acad Sci USA 95, 11383-11388.
Calandra, T. (2003). Macrophage migration inhibitory factor and host innate immune responses
to microbes. Scand J Infect Dis. 35, 573-576.
Dalloul, R.A., Long, J.A. Zimin, A.V. Aslam, L. Beal, K. Blomberg, L.A., et al. (2010). Multi-
platform next-generation sequencing of the domestic turkey (Meleagris gallopavo): genome
assembly and analysis. PLoS Biol. 8, e1000475.
David, J. R. (1966). Delayed hypersensitivity in vitro: its mediation by cell-free substances
formed by lymphoid cell-antigen interaction. Proc Natl Acad Sci USA 56, 72-77.
Flieger, O., A. Engling, R. Bucala, H. Lue, W. Nickel and J. Bernhagen. (2003). Regulated
secretion of macrophage migration inhibitory factor is mediated by a non-classical pathway
involving an ABC transporter. FEBS Lett. 551, 78-86.
Hong, Y. H., H. S. Lillehoj, S. H. Lee, R. A. Dalloul and E. P. Lillehoj. (2006a). Analysis of
chicken cytokine and chemokine gene expression following Eimeria acervulina and Eimeria
tenella infections. Vet Immunol Immunopathol. 114, 209-223.
77
Hong, Y. H., H. S. Lillehoj, E. P. Lillehoj and S. H. Lee. (2006b). Changes in immune-related
gene expression and intestinal lymphocyte subpopulations following Eimeria maxima infection
of chickens. Vet Immunol Immunopathol. 114, 259-272.
Kaiser, P. (2002). Turkey and chicken interleukin-18 (IL18) share high sequence identity, but
have different polyadenylation sites in their 3' UTR. Dev. Comp. Immunol. 26, 681-687.
Kim, S., K. B. Miska, M. C. Jenkins, R. H. Fetterer, C. M. Cox, L. H. Stuard and R. A. Dalloul.
(2010). Molecular cloning and functional characterization of the avian macrophage migration
inhibitory factor (MIF). Dev Comp Immunol. 34, 1021-1032.
Kim, S., C. M. Cox, M. C. Jenkins, R. H. Fetterer, K. B. Miska and R. A. Dalloul. (2014). Both
host and parasite MIF molecules bind to chicken macrophages via CD74 surface receptor. Dev
Comp Immunol. 47, 319-326.
Kleemann, R., A. Kapurniotu, R. W. Frank, A. Gessner, R. Mischke, O. Flieger, S. Juttner, H.
Brunner and J. Bernhagen. (1998). Disulfide analysis reveals a role for macrophage migration
inhibitory factor (MIF) as thiol-protein oxidoreductase. J Mol Biol. 280, 85-102.
Kotkes, P. and E. Pick. (1979). Studies on guinea-pig macrophage migration inhibitory factor
(MIF). II. Purification of MIF after treatment with reducing and denaturing agents. Clin Exp
Immunol. 37, 540-550.
Lawson, S., Rothwell, L. Kaiser, P. (2000). Turkey and chicken interleukin-2 cross-react in in
vitro proliferation assays despite limited amino acid sequence identity. J. Interferon Cytokine
Res. 20, 161-170.
Lawson, S., Rothwell, L. Lambrecht, B. Howes, K. Venugopal, K. Kaiser, P. (2001). Turkey and
chicken interferon-gamma, which share high sequence identity, are biologically cross reactive.
Dev. Comp. Immunol. 25, 69-82.
Leng, L., C. N. Metz, Y. Fang, J. Xu, S. Donnelly, J. Baugh, T. Delohery, Y. Chen, R. A.
Mitchell and R. Bucala. (2003). MIF signal transduction initiated by binding to CD74. J Exp
Med. 197, 1467-1476.
Lubetsky, J. B., M. Swope, C. Dealwis, P. Blake and E. Lolis. (1999). Pro-1 of macrophage
migration inhibitory factor functions as a catalytic base in the phenylpyruvate tautomerase
activity. Biochemistry 38, 7346-7354.
Lue, H., R. Kleemann, T. Calandra, T. Roger and J. Bernhagen. (2002). Macrophage migration
inhibitory factor (MIF): mechanisms of action and role in disease. Microbes Infect. 4, 449-460.
Magnan, C. N. and P. Baldi. (2014). SSpro/ACCpro 5: almost perfect prediction of protein
secondary structure and relative solvent accessibility using profiles, machine learning and
structural similarity. Bioinformatics 30, 2592-2597.
Makita, H., M. Nishimura, K. Miyamoto, T. Nakano, Y. Tanino, J. Hirokawa, J. Nishihira and Y.
Kawakami. (1998). Effect of anti-macrophage migration inhibitory factor antibody on
lipopolysaccharide-induced pulmonary neutrophil accumulation. Am J Respir Crit Care Med.
158, 573-579.
78
Mitchell, R. A., H. Liao, J. Chesney, G. Fingerle-Rowson, J. Baugh, J. David and R. Bucala.
(2002). Macrophage migration inhibitory factor (MIF) sustains macrophage proinflammatory
function by inhibiting p53: regulatory role in the innate immune response. Proc Natl Acad Sci
USA 99, 345-350.
Ohta, S., A. Misawa, R. Fukaya, S. Inoue, Y. Kanemura, H. Okano, Y. Kawakami and M. Toda.
(2012). Macrophage migration inhibitory factor (MIF) promotes cell survival and proliferation of
neural stem/progenitor cells. J Cell Sci. 125, 3210-3220.
Powell, F.L., Rothwell, L. Clarkson, M.J. Kaiser, P. (2009). The turkey, compared to the
chicken, fails to mount an effective early immune response to Histomonas meleagridis in the gut.
Parasite Immunol. 31, 312-327.
Powell, F., Rothwell, L. Clarkson, M. Kaiser, P. (2012). Development of reagents to study the
turkey's immune response: cloning and characterisation of two turkey cytokines, interleukin (IL)-
10 and IL-13. Vet. Immunol. Immunopathol.147, 97-103.
Qiu, R., J. Li, Z. Z. Xiao and L. Sun. (2013). Macrophage migration inhibitory factor of
Sciaenops ocellatus regulates immune cell trafficking and is involved in pathogen-induced
immune response. Dev Comp Immunol. 40, 232-239.
Rosengren, E., R. Bucala, P. Aman, L. Jacobsson, G. Odh, C. N. Metz and H. Rorsman. (1996).
The immunoregulatory mediator macrophage migration inhibitory factor (MIF) catalyzes a
tautomerization reaction. Mol Med. 2, 143-149.
Rosengren, E., P. Aman, S. Thelin, C. Hansson, S. Ahlfors, P. Bjork, L. Jacobsson and H.
Rorsman. (1997). The macrophage migration inhibitory factor MIF is a phenylpyruvate
tautomerase. FEBS Lett. 417, 85-88.
Rothwell, L., Young, J.R. Zoorob, R. Whittaker, C.A. Hesketh, P. Archer, A. Smith, A.L. Kaiser,
P. (2004). Cloning and characterization of chicken IL-10 and its role in the immune response to
Eimeria maxima. J. Immunol. 173, 2675-2682.
Sievers, F. and D. G. Higgins. (2014). Clustal Omega, accurate alignment of very large numbers
of sequences. Methods Mol Biol. 1079, 105-116.
Starlets, D., Y. Gore, I. Binsky, M. Haran, N. Harpaz, L. Shvidel, S. Becker-Herman, A. Berrebi
and I. Shachar. (2006). Cell-surface CD74 initiates a signaling cascade leading to cell
proliferation and survival. Blood 107, 4807-4816.
Stojanovic, I., T. Cvjeticanin, S. Lazaroski, S. Stosic-Grujicic and D. Miljkovic. (2009).
Macrophage migration inhibitory factor stimulates interleukin-17 expression and production in
lymph node cells. Immunology 126, 74-83.
Sugimoto, H., M. Taniguchi, A. Nakagawa, I. Tanaka, M. Suzuki and J. Nishihira. (1999).
Crystal structure of human D-dopachrome tautomerase, a homologue of macrophage migration
inhibitory factor, at 1.54 A resolution. Biochemistry 38, 3268-3279.
Sun, H. W., J. Bernhagen, R. Bucala and E. Lolis. (1996). Crystal structure at 2.6-A resolution of
human macrophage migration inhibitory factor. Proc Natl Acad Sci USA 93, 5191-5196.
79
Suzuki, M., H. Sugimoto, A. Nakagawa, I. Tanaka, J. Nishihira and M. Sakai. (1996). Crystal
structure of the macrophage migration inhibitory factor from rat liver. Nat Struct Biol. 3, 259-
266.
Takeda, K., H. Tsutsui, T. Yoshimoto, O. Adachi, N. Yoshida, T. Kishimoto, H. Okamura, K.
Nakanishi and S. Akira. (1998). Defective NK cell activity and Th1 response in IL-18-deficient
mice. Immunity 8, 383-390.
Tamura, K., Dudley, J. Nei, M. Kumar, S. (2007). MEGA4: Molecular Evolutionary Genetics
Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596-1599.
Tarnowski, M., K. Grymula, R. Liu, J. Tarnowska, J. Drukala, J. Ratajczak, R. A. Mitchell, M.
Z. Ratajczak and M. Kucia. (2010). Macrophage migration inhibitory factor is secreted by
rhabdomyosarcoma cells, modulates tumor metastasis by binding to CXCR4 and CXCR7
receptors and inhibits recruitment of cancer-associated fibroblasts. Mol Cancer Res. 8, 1328-
1343.
Weber, C., S. Kraemer, M. Drechsler, H. Lue, R. R. Koenen, A. Kapurniotu, A. Zernecke and J.
Bernhagen. (2008). Structural determinants of MIF functions in CXCR2-mediated inflammatory
and atherogenic leukocyte recruitment. Proc Natl Acad Sci USA 105, 16278-16283.
Weiser, W. Y., P. A. Temple, J. S. Witek-Giannotti, H. G. Remold, S. C. Clark and J. R. David.
(1989). Molecular cloning of a cDNA encoding a human macrophage migration inhibitory
factor. Proc Natl Acad Sci USA 86, 7522-7526.
Wistow, G. J., M. P. Shaughnessy, D. C. Lee, J. Hodin and P. S. Zelenka. (1993). A macrophage
migration inhibitory factor is expressed in the differentiating cells of the eye lens. Proc Natl
Acad Sci USA 90, 1272-1275.
80
Table 3.1. Primers sequences used for cloning TkMIF and qRT-PCR analysis.
Name Sequence (5’→3’) GenBank accession No. Application
TkMIF_F GATCATATGAGATCTATGCCCATGTTCACCATCCACACC From turkey genome Gene cloning
TkMIF_R GATGCTAGCCTATGCAAAGGTGGAACCGTTCCA
MIF_F CGGATCCCTGCGCTCTCT XM_425824 qRT-PCR
MIF_R TGTTCTGCTGCCCTCCGATT
IFN- γ_F CAAAGCCGCACATCAAACAC AJ000725.1
IFN- γ_R GCCATCAGGAAGGTTGTTTTTC
IL-1b_F CCGACACGCAGGGACTTT DQ393271.1
IL-1b_R GAAGGTGACGGGCTCAAAAA
IL-2_F GAGCATCGCTATCACCAGAAAA AF209705.1
IL-2_R TTGTTCTTGCTTTCTTCCAGTATTTCTA
IL-6_F ACTCAGCCACCCAGAAATCC XM_003207130.1
IL-6_R TCTCTATCCACGCCTTATCTGACT
IL-8_F GGTTTCAGCAGCTCTGTCACA DQ393276.1
IL-8_R TGGCACCGCAGCTCGTT
IL-10_F CCAGCCACCAGGAGAGCAT AM493432.1
IL-10_R GCGCTTCATTGTCATCTTCAG
IL-12B_F ACTACTGTCCATTTGCCGAAGA XM_003210283.1
IL-12B_R CATCAATGACCTCCAGGAACA
IL-13_F CGAGCTCCATGCCCAAGAT AM493431.1
IL-13_R TGTTGAGCTGCTGGATGCTT
IL-17F_F GTCTCCAATCCCTTGTTCTCCTT XM_003204633.1
IL-17F_R GACAGCACGGCCAGCAA
IL-18_F TGCCCGTCGCATTCAG AJ312000.1
IL-18_R CCATGCTCTTTCTCACAACACA
iNOS_F TTGGGTGGAAGCCGAAAT XM_003211871.1
81
iNOS_R TTGCTTGGAGAATGAGTGGAACT
GAPDH_F GCTGAGAATGGGAAACTTGTGAT NM_001303179.1
GAPDH_R GGGTTACGCTCCTGGAAGATAG
82
Figure 3.1. Nucleotide and its deduced amino acid sequences of TkMIF. The underlined
nucleotide sequences indicate the primer sequences used to amplify the full-length TkMIF, and
the dotted lined nucleotide sequences indicate the primer sequences to detect TkMIF in various
tissues by qRT-PCR. Predicted α-helices and β-strand structures were shown at the bottom of
amino acid sequences. The shaded sequences represent two N-linked glycosylation sites.
83
84
Figure 3.2. Multiple sequence alignment and phylogenetic analysis of the amino acid sequences
of TkMIF with homologous MIF from birds and mammals. (A) The amino acid sequence of
TkMIF was compared with other known sequences using Clustal Omega. Identical residues
were denoted by an asterisk and consensus cystein residues are highlighted. The gaps (-) were
introduced to maximize alignment. The active sites of catalytic activity were marked with
triangle (▼) and conserved C-X-X-C motifs were in box. GenBank accession numbers of
homologues are as follows: Gallus gallus (XP_003642282.1), Taeniopygia guttata
(NP_001232585.1), Haliaeetus leucocephalus (XP_010573737.1), Falco peregrines
(XP_005233428.1), Columba livia (XP_005503934.1), Egretta garzetta (XP_009641398.1),
Nipponia nippon (XP_009461948.1), Ornithorhynchus anatinus (XP_001507338.1), Anas
platyrhynchos (XP_005023586.1), Balearica regulorum gibbericeps (XP_010305480.1),
Chaetura pelagic (XP_010003089.1), Corvus cornix (XP_010396447.1), Tinamus guttatus
(XP_010215699.1), Caprimulgus carolinensis (XP_010165290.1), Pterocles gutturalis
(XP_010083983.1), Homo sapiens (NP_002406.1), Mus musculus (NP_034928.1). (B)
Evolutionary analysis shown as the phylogenetic tree constructed using amino acid multiple
alignments by the neighbor-joining method within MEGA 4 program. The clades were validated
by 1000 bootstrap replications, which were represented by percentage in branch nodes. The
scale bar represents a genetic distance of 0.05.
85
Figure 3.3. Tissue-specific mRNA expression of TkMIF. The relative TkMIF transcription in
each tissue of male and female turkey was calculated by the 2-∆∆Ct methods using GAPDH as a
reference gene, and the relative expression level was compared with the expression level in heart
(arbitrarily set at 1.0). Error bars represent SEM.
86
Figure 3.4. Purification and Western blot analysis of rTkMIF. (A) rTkMIF was purified from
bacterial lysate by SEC-HPLC and scanned the gel. The fractions containing rTkMIF proteins
are indicated by arrows. (B) Purified rTkMIF was analyzed by SDS-PAGE analysis (left).
Western blot analysis of rTkMIF was performed with anti-chicken MIF polyclonal antisera
(1:1000) (right), MW, protein molecular weight marker; lane 1, rChMIF (1 ng); lane 2, rTkMIF
(1 ng).
87
Figure 3.5. Inhibition the random migration of PBMCs and splenocytes by rTkMIF. Migration
of turkey PBMCs-derived monocytes (A) and splenic lymphocytes (B) was observed in the
presence of serially diluted rTkMIF (0.01, 0.1, and 1.0 μg/ml). Experimental wells were set up
in triplicate and values represent mean of two independent experiments. Error bars represent
SEM. Asterisks (*) indicate statistically significant differences (*, ** = P < 0.05, 0.01,
respectively).
88
Figure 3.6. Blocking of MIF-induced inhibition of cell migration. Migration of PBMC-derived
monocytes and splenic lymphocytes were examined in the combination of rTkMIF (0.1 µg/ml) in
the absence or presence of anti-ChMIF antisera (1:1000 dilution). The experiment was set up in
triplicate and data represent mean of two independent experiments. Error bars represent SEM.
Statistically significant differences indicated by asterisks (*, ** = P < 0.05, 0.01, respectively).
89
Figure 3.7. The proliferative effect of rTkMIF on splenic lymphocytes. 1x105 cells were treated
with media alone, Con A (10 µg/ml) alone, rTkMIF (0.01 and 0.1 µg/ml) alone, Con A with
rTkMIF (0.01 and 0.1 µg/ml), rTkMIF (0.01, 0.1 µg/ml) with anti-rChMIF polyclonal antibody
(1:1000 dilution) and Con A with anti-rChMIF polyclonal antisera in the absence or presence of
rTkMIF (0.01 and 0.1 µg/ml) for 24 hr. The cell proliferation assay was performed in triplicate
per manufacturer’s instruction. Data represent the mean of two independent experiments and
significant differences are indicated by asterisks (P < 0.05). Error bars represent SEM.
90
Figure 3.8. Nitric oxide release of rTkMIF-treated PBMC derived monocytes. Monocytes
(1x106 cells/well) were treated with media alone, rTkMIF (0.01 and 0.1 µg/ml) alone, LPS (5
µg/ml) alone, rTkMIF (0.01 and 0.1 µg/ml) with LPS (5 µg/ml) for 6 hr. NO assay was
performed in triplicate following the manufacturer’s instructions. Data represent the mean of
three independent experiments with significant differences indicated by asterisks (P < 0.05).
Error bars represent SEM.
91
Figure 3.9. mRNA expression of pro-inflammatory cytokines and chemokine on rTkMIF
treated monocytes. PBMCs derived monocytes (1x106 cells/well) were treated with media alone,
LPS (5 µg/ml) alone, rTkMIF (0.01 and 0.1 µg/ml) with LPS (5 µg/ml) for 6 hr and the
expression of pro-inflammatory cytokines was examined by qRT-PCR. Transcript levels were
standardized to GAPDH and compared to media alone. Data shown represent the mean of three
different experiments with significant differences indicated by asterisks (*, ** = P < 0.05, 0.01,
respectively). Error bars represent SEM.
92
Figure 3.10. mRNA expression of Th1/Th2/Th17 cytokines on rTkMIF treated splenocytes.
Splenic lymphocytes (1x106 cells/well) were treated with media alone, Con A (10 µg/ml) alone,
rTkMIF (0.01and 0.1 µg/ml) with Con A (10 µg/ml) for 6, 12, 24 hr and the expression of
cytokines was examined by qRT-PCR. Transcript levels were standardized to GAPDH and
compared to media alone. Data shown represent the mean of two independent experiments with
significant difference of transcription compared to that of Con A alone indicated by asterisks (*,
** = P < 0.05, 0.01, respectively). Error bars represent SEM.
93
CHAPTER IV
The interaction of macrophage migration inhibitory factor (MIF) with CXCR4 and CD74
Abstract
Macrophage migration inhibitory factor (MIF) is known as a chemokine-like inflammatory
cytokine that regulates leukocyte migration and is involved in a wide variety of biological and
pathological processes. The function of avian MIF in inhibiting the migration of chicken
mononuclear cells while enhancing lymphocyte proliferation has been well documented. Efforts
continue to characterize this pluripotent cytokine and its receptors in both host (chicken) and
pathogen (Eimeria). Here, we further evaluated the interaction of avian MIF with its receptors
CXCR4 and CD74. Receptor-specific transformants were constructed and the interactions tested
using an array of assays with chicken immune cells. Receptor binding tests included pull-down
assay, co-immunoprecipitation, immunofluorescence, and flow cytometry. Data were analyzed
by ANOVA and Tukey-Kramer multiple comparison test, and differences were considered
significant at P < 0.05. Chicken MIF interacts not only with the cell surface receptor CD74
(ChCD74), but also with CXCR4 (ChCXCR4) as observed by immunofluorescence and flow
cytometric analyses, as well as evidenced by an immunoprecipitated complex of ChMIF and
ChCXCR4. ChMIF binding to ChCXCR4 promoted substantial internalization of ChCXCR4 in
splenocytes, but to a lesser extent in PBMCs and heterophils. Further, secreted MIF by the
apicomplexan parasite Eimeria (EMIF) also binds to ChCXCR4 in a comparable fashion to
ChMIF. ChCXCR4 binds to not only ChMIF and EMIF but it also interacts with ChCD74 as
observed by co-localization analysis. Overexpression of both ChCXCR4 and ChCD74 resulted
in cell chemotaxis that abrogated inhibition of cell migration induced by ChMIF or EMIF.
Conversely, cell migration was more impeded by ChMIF or EMIF as a result of blocking
94
ChCXCR4 and ChCD74 than by treatment with MIF alone, corroborating the co-engagement of
ChCXCR4 and ChCD74 in cell migration. A transient and rapid intracellular calcium influx was
elicited upon stimulation with ChMIF or EMIF through ChCXCR4 alone or ChCXCR4 and
ChCD74. ChMIF or EMIF-induced cell proliferation involving the interaction with ChCD74
was prominently enhanced when coupled with ChCXCR4. Collectively, these results support the
functional responses followed by MIF interaction through CXCR4 and CD74 in regulating cell
migration, calcium mobilization, and cell proliferation, implying that ChCXCR4 and ChCD74
are the effective receptors mediating the activity of avian and Eimeria MIFs.
Introduction
As initially described, MIF is known to play a role in inhibition of the random migration of
macrophages (David, 1966). This capacity has been well demonstrated especially in avian MIF
that reduced random migration of macrophages, monocytes, and splenic lymphocytes in a dose-
dependent manner (Kim et al., 2010; Park et al., 2016). Additionally, avian MIF promotes the
proliferation of activated lymphocytes and modulation of pro-inflammatory Th1/Th2/Th17
cytokines with nitric oxide (NO) production in stimulated monocytes and lymphocytes (Kim et
al., 2010; Park et al., 2016). Interestingly, when chickens were infected with Eimeria species, a
MIF homologue was secreted by the invading parasites, along with an upregulation of ChMIF
expression (Hong et al., 2006a,b). Secreted Eimeria MIF (EMIF), like ChMIF, also exhibited
chemotactic ability by inhibiting the migration of mononuclear cells, accompanied by regulation
of the production of pro-inflammatory cytokines and chemokines (Miska et al., 2013). Such
biological functions of avian and parasite MIFs appear to emerge via an association with putative
host cell receptors. Much experimental evidence revealed receptors for MIF that induces
95
signaling based on which receptor(s) it interacts with, thus participating in various biological
activities.
CD74, the invariant chain (Ii) of MHC II molecule, is a type 2 transmembrane protein
identified as the surface receptor for MIF (Leng et al., 2003). In avian species, two isoforms of
CD74, p31 and p41, are expressed of which CD74p41 was described to interact with MIF on the
surface of monocytes/macrophages (Kim et al., 2014). MIF binds to CD74 along with an
accessory protein CD44 (Shi et al., 2006), signaling not only to the PI3K-Akt pathway that leads
to the induction of anti-apoptotic activity with cell survival effect (Gore et al., 2008), but also to
the MAPK/ERK pathway that is associated with proliferation and differentiation of fibroblasts
and macrophages (Lue et al., 2006, 2007).
MIF has been classified as chemokine-like function (CLF) cytokine based on structural
homology with the N-terminal region of the CXC chemokine family, which bind to G-protein-
coupled chemokine receptors (GPCR) as well as its similar chemotactic features in the
recruitment of leukocytes. As such, chemokine receptors including CXCR2, CXCR4, and
CXCR7 have additionally been considered as receptors for MIF. The non-cognate interaction of
MIF with CXCR2 was reported to control the migration of peripheral blood mononuclear cells
(PBMCs) (Bernhagen et al., 2007; Cho et al., 2010). CXCR4 was previously defined as the
receptor for stromal cell-derived factor-1α (SDF-1α)/CXCL12. Afterwards, CXCR4 also has
been shown to engage in MIF-induced recruitment of various cells including lymphocytes,
eosinophils, endothelial progenitor cells (EPCs), mesenchymal stromal cells (MSCs), and colon
cancer cells (Bernhagen et al,. 2007; Simons et al., 2011; Shin et al., 2012; Lourenco et al., 2015;
De Souza et al., 2015). Furthermore, the MIF-CXCR axes drive the induction of rapid integrin
and calcium influx (Bernhagen et al., 2007). Further, CXCR7, named atypical chemokine
96
receptor (Ulvmar et al., 2011), was identified to engage in the direct interaction with MIF, leads
to the activation of MIF-mediated ERK and ZAP-70 pathways, contributing to the migration of
B cells (Alampour-Rajabi et al., 2015).
In the present study, we focused on the interaction of chicken and Eimeria MIFs with
CXCR4 on the cell surface, further examined the biological roles of avian or Eimeria MIF
depending on the engagement of CXCR4 and/or CD74 by ectopic overexpression of MIF
receptors or its blocking with neutralizing antibodies.
Materials and methods
Cell lines, plasmids and reagents
Chicken macrophage cell line HTC and fibroblast cell DF-1 were routinely cultured in
Dulbecco’s modified Eagle medium (DMEM; Mediatech) supplemented with 10% fetal calf
serum (FCS; Atlanta Biologicals, GA) and 1% penicillin/streptomycin at 39℃ with 5% CO2
humidified air for subsequent experiments. The full-length ChCXCR4 was amplified from total
RNA extracted from bursa using specific primers (Table 4.1) under the following conditions:
92℃ for 2 min, 35 cycles of denaturation at 92℃ for 15 s, annealing at 57℃ for 15 s and
extension at 72℃ for 30 s, with a final extension at 72℃ for 7 min. The amplified target gene
was cloned into pGEM-T easy vector (Invitrogen, CA) and transformed into E. coli Top 10
(Invitrogen). Transformants containing the target gene were selected by PCR screening, and
then sub-cloned into pcDNA3.1 (Invitrogen) and pEYFP-N1 (BD Biosciences Clontech, CA).
The positive clones including ChCXCR4 were obtained by colony PCR screening and their
sequences confirmed by sequencing. Endotoxin-free recombinant chicken and Eimeria MIF
proteins were obtained from previous studies (Miska et al., 2013; Kim et al., 2010). ChMIF was
97
sub-cloned into pET28a (Novagen, CA) and than His-tagged ChMIF was produced as described
previously.
Birds and cell isolation
Healthy broiler chicks were housed and maintained in accordance with the Institutional
Animal Care and Use Committee Guidelines (IACUC) of Virginia Tech. Bursa tissues were
collected from 3-day-old chicks. Fresh blood and tissue samples including spleen and bursa
were obtained from 5-week-old broilers for isolating primary cells. PBMCs and heterophils
were isolated from freshly drawn peripheral blood using Histopaque-1077 and -1119 (Sigma,
MO), and lymphocytes were isolated from spleen and bursa using Histopaque-1077 as described
(Park et al., 2016).
Transfection of ChCXCR4 and/or ChCD74
DF-1 cells (1.0×106 cells/ml) were plated without antibiotics 24 hr before transfection. After
washing with DMEM, cells were incubated with Opti-MEM for 30 min followed by addition of
ChCXCR4 plasmid DNA with Lipofectamine 2000 (Invitrogen). Following 24 hr incubation at
39℃ with 5% CO2 humidified air, cells were continuously cultured in the fresh medium for an
additional 24 hr. Following 48 hr transfection, ChCXCR4 transfectants were observed under a
fluorescence microscope (Nikon Corp., Japan) using tagged yellow fluorescent protein (YFP).
In addition, over-expression of ChCXCR4 was confirmed not only by measuring mRNA
expression level by qRT-PCR using total RNA which was extracted from transfected cells and
purified with DNase I treatment (Qiagen), but also by using flow cytometry.
98
Pull-down and co-immunoprecipitation assay
To access the direct physical interaction between MIF and CXCR4, 5×106 CXCR4
transfected DF-1 cells were resuspended in DMEM medium and incubated with 1 μg His-ChMIF
for 1 hr at 4℃. Cells were washed with ice-cold PBS and lysed with CoIP lysis buffer (Thermo
Scientific, MA) supplemented with protease inhibitor cocktail and phosphatase inhibitors (1 mM
NaF and 1 mM Na3VO4) for 1 hr at 4℃. After incubation for 30 min on ice with periodic
mixing, the clear lysates were collected by centrifugation and incubated with Ni-NTA resin
(Bioline, MA) for 1 hr at 4℃. After washing, the precipitated ligand-receptor complexes were
eluted from the collected resin by addition of 250 mM imidazole. The precipitated protein
complexes were analyzed by Western blotting using anti-chicken CXCR4 (Bio-Rad, CA), anti-
YFP, anti-His, anti-ChMIF antibodies. Due to the absence of tag protein in EMIF, EMIF-
CXCR4 interaction was determined by co-immunoprecipitation. Briefly, resuspended CXCR4
transfectants (5×106 cells) in DMEM medium were incubated with 1 μg EMIF for 1 hr at 4℃.
After washing, the cell lysates were collected as previously described, followed by incubation
with anti-YFP-conjugated beads or beads alone (Thermo Scientific) overnight at 4℃. Ligand-
receptor complexes were eluted by addition of elution buffer, subjected to SDS-PAGE, and
analyzed by Western blotting with anti-chicken CXCR4, anti-his, or anti-EMIF antibodies.
Immunofluorescence and flow cytometric analysis
For immunofluorescence assay, transiently transfected DF-1 cells with pcDNA-ChCXCR4 or
pcDNA (1.0×106 cells/well) adherently grown on coverslips in 6-well plates were incubated with
rChMIF or EMIF (100 ng/ml) in blocking buffer (PBS with 10% FBS) supplemented by sodium
azide (0.1% NaN3), which was used to prevent the internalization of surface protein that
99
enhances fluorescence intensity. After incubation for 2 hr at 39℃, the washed cells were fixed
with 4% paraformaldehyde (PFA) in PBS for 15 min at room temperature and washed three
times with ice-cold PBS, followed by incubation with blocking buffer for 1 hr. After washing,
the cells were treated with anti-ChMIF or anti-EMIF as the primary antibody and anti-rabbit
IgG-FITC and anti-mouse IgG-680 antibodies (Santa Cruz Biotechnology, CA) as the secondary
antibodies, followed by counterstaining with DAPI. After washing, the coverslip was mounted
on a glass slide with Prolong Gold anti-fade solution (Thermo Scientific) and the stained cells
were observed under fluorescence microscopy.
For flow cytometric analysis of MIF-CXCR4 interaction, 1×106 DF-1 cells over-expressing
YFP alone or YFP-CXCR4 were resuspended in FACS buffer (PBS with 2% FBS and 0.1%
NaN3) and treated with 1 μg ChMIF, EMIF, or medium alone for 1 hr at 4℃. For double-label
analyses, cells were sequentially incubated with anti-ChMIF or anti-EMIF and a mixture of
secondary antibodies including anti-rabbit IgG conjugated with PerCP-Cy5.5 (Santa Cruz
Biotechnology) and anti-mouse IgG-680 for 30 min at 4℃. In addition, isolated PBMCs or
splenocytes (1×106 cells) were incubated with 1 μg ChMIF, EMIF, or medium alone for 1 hr at
4℃. Treated cells were washed twice with PBS and sequentially incubated with anti-ChMIF or
anti-EMIF antibody, followed by the antibody mixture with anti-rabbit IgG conjugated with
FITC and anti-mouse IgG-680. The stained cells were washed twice and analyzed using Attune®
NxT Acoustic Focusing Cytometry (Invitrogen).
ChCXCR4 internalization assay
1×106 YFP-CXCR4 transfected DF-1 cells adherently grown on coverslip was incubated in
DMEM medium alone, ChMIF, EMIF, or HuSDF-1 (100 ng/ml) for 2 hr at 39℃ with 5% CO2
100
humidified air. The coverslip with cells were washed twice with PBS and mounted on a
microscope slide with Prolong Gold anti-fade solution. Intracellular distribution of YFP-CXCR4
was observed under the fluorescence microscope using the YFP tag. In addition, isolated
PBMCs, heterophils, or splenocytes were treated with medium alone, ChMIF, or EMIF (1 μg)
for 2 hr. After washing with PBS, cells were stained with anti-chicken CXCR4, and anti-mouse
IgG-680, followed by flow cytometry analysis using Attune® NxT Acoustic Focusing
Cytometry.
Receptor binding assay between ChCXCR4 and ChCD74
In order to examine co-localization of ChCXCR4 and ChCD74, DF-1 cells transiently co-
overexpressing ChCXCR4 and ChCD74 (1.0×106 cells/well) adherently grown on coverslip in 6-
well plate were fixed with 4% PFA in PBS for 15 min at room temperature and washed three
times with PBS, followed by incubation with blocking buffer (PBS with 10% FCS) for 1 hr.
After washing three times with ice-cold PBS, cells were stained with anti-CXCR4, followed by
anti-mouse IgG-680 and anti-chicken CD74-FITC antibodies (Santa Cruz Biotechnology) with
counterstaining by DAPI. After washing, the coverslip was mounted on a glass slide with
Prolong Gold anti-fade solution and the stained cells were observed under fluorescence
microscopy.
Additionally, the interaction between ChCXCR4 and ChCD74 was determined by co-
immunoprecipitation assay. 1.0×107 co-transfectants with ChCXCR4 and GFP-ChCD74 were
dissolved in CoIP lysis buffer with protease inhibitor cocktail and phosphatase inhibitors, and
incubated on ice for 30 min with shaking. After centrifugation, the clear lysates were collected
and incubated with either anti-GFP-conjugated beads or untreated beads (for control) overnight
101
at 4℃. The beads were washed twice with PBS and resuspended in the elution buffer with SDS
loading buffer. After heating, immunoprecipitated protein complexes were collected and
resolved on SDS-PAGE gel, followed by Western blotting using anti-CXCR4, anti-CD74, and
anti-GFP antibodies.
Chemotaxis assay
Serially diluted rChMIF or rEMIF (0.01, 0.1, 1 μg/ml) were loaded on the bottom of 96-well
ChemoTx microplate (Neuro Probe, MD) and the framed filter placed above the samples.
Prepared transfected cells (2.0×105 cells/well) with empty vector (pcDNA), ChCXCR4,
ChCD74, or ChCXCR4 and ChCD74 were filled on each side on the filter top. After 4 hr
incubation at 39℃ with CO2 humidified air, non-migrated cells from the top were removed by
gently scrapping and migrated cells on the bottom side of the membrane were detached by
adding TrypLE. Migrated cells were stained by MTT assay per manufacturer’s instructions
(Promega, WI), which reduces the yellow tetrazolium dye MTT to purple formazan in living
cells. The number of migrated cells was calculated based on a standard curve generated with the
known number of viable cells. To perform the chemotaxis assay using primary cells, rChMIF,
rEMIF (0.1 μg/ml), or medium alone were added to the bottom of the plate in the absence or
presence of anti-CXCR4, anti-CD74, anti-CXCR4 and anti-CD74, or control IgG (Santa Cruz
Biotechnology). Isolated PBMCs (5.0×105 cells/well) were transferred onto the top and
subsequent procedures were followed as described earlier. Data are presented as the chemotactic
index (CI), a ratio of the cell numbers calculated by dividing the number of migrated cells in the
presence of stimulants by the number of migrated cells in the absence of stimulants (medium
alone control).
102
Intracellular calcium measurement
Transfectants (1.0×106 cells) with either pcDNA (empty vector, control), CXCR4, CD74, or
CXCR4 and CD74 adherently grown on coverslips in 6-well plates were stained with 1 μM
calcium-sensitive fluorogenic dye (Fura-2AM, Invitrogen) for 40 min in the dark. After washing
twice with calcium-free HBSS, stained cells were resuspended in DMEM containing 0.1% BSA
and incubated for 10 min at 39℃. After addition of stimulants (100 ng/ml) such as ChMIF,
EMIF, or HuSDF-1, the ratio of Fura-2 fluorescence at 510 nm excited by ultraviolet light at 340
(Ca2+ binding) and 380 (Ca2+ unbinding) nm as the measurement of intracellular calcium amount
was recorded every 5 sec for 120 sec using a photon-counting fluorescence microscope system
(Nikon Corp., Japan).
Cell proliferation assay
CellTiter 96® Non-Radioactive Cell Proliferation Assay Kit (Promega, WI) was used to
determine the role of receptors (CXCR4 or/and CD74) in MIF-induced cell proliferation.
Transfected HTC (avian macrophage cell line) cells (1.0×105 cells/well) with empty vector
(pcDNA), CXCR4, CD74, or CXCR4 and CD74 were seeded on 96-well plate and incubated
with ChMIF or EMIF (0.01 or 0.1 μg/ml) for 24 hr at 39℃ with 5% CO2 humidified air. After
incubation, all procedures were performed as previously described.
Statistical analysis
103
All data were analyzed by Student’s t-test or one-way analysis of variance (ANOVA) using
JMP software (Ver 11) and significant differences between groups were considered significant
by Tukey-Kramer multiple comparison test at P < 0.05.
Results
MIF interacts with ChCXCR4 as its receptor
To delineate the physical interaction of ChCXCR4 with ChMIF, either ChCXCR4 or empty
vector was transfected into DF-1 cells and its overexpression observed using YFP tag. Using
fluorescence microscopy, ChCXCR4 expression fused to YFP was detected on the cell surface
membrane as well as the cytoplasmic region of DF-1 cells (Fig. 4.1A). By flow cytometry, the
majority of transfected cells (>90%) were double positive for YFP and CXCR4, although some
endogenous CXCR4 expression (<1%) was observed in DF-1 cells (Fig. 4.1C). Furthermore, the
significant up-regulation of ChCXCR4 expression compared to transfectants with empty vector
(pEYFP) was evaluated by qRT-PCR (Fig. 4.1B). With DF-1 cells transiently overexpressing
ChCXCR4, we evaluated whether ChMIF binds to ChCXCR4 expressed on the cell surface. By
fluorescence microscopy, ChCXCR4-transfectant treated with ChMIF showed the cell staining
for ChMIF as well as ChCXCR4 (Fig. 4.2A). We also identified that His-tagged ChMIF and
ChCXCR4 protein complexes were precipitated using Ni-resin and then detected not only MIF
with the antibodies to His tag and ChMIF, but also ChCXCR4 with the antibodies to YFP tag
and ChCXCR4 (Fig. 4.2B). Also, Western blot analysis showed that the anti-ChMIF antibody
detected both endogenous (band on the bottom) and exogenous MIF (band on top) expression,
the latter exhibited slightly higher molecular weight than the endogenous ChMIF due to the
presence of histidine tag. Flow cytometry analysis showed 60% CXCR4-YFP-transfectant, but
104
not vector control, is double-positive for ChMIF as well as CXCR4 (Fig. 4.2C). This interaction
was substantiated in the primary cells, PBMCs and splenocytes, although a lower percentage of
cell subpopulation (~10%) were double-positive for ChMIF and CXCR4 than in CXCR4-
transfectants (Fig. 4.2D). Comparable to the interaction of ChMIF with CXCR4, EMIF binding
to CXCR4 was detected from double-stained CXCR4-transfectant with the antibodies to CXCR4
and EMIF (Fig. 4.3A), along with co-precipitated EMIF and CXCR4 on the blot (Fig. 4.3B). In
addition, binding of EMIF to CXCR4 expressing transfectant and primary cells including PBMC
and splenocytes was exhibited similarly to ChMIF by flow cytometry analysis (Fig. 4.3C and D).
ChCXCR4 internalization through the interaction with ChMIF or EMIF
ChMIF interaction with ChCXCR4 was confirmed by assessing ChCXCR4 internalization
after stimulation with ChMIF. In Fig. 4.4A, untreated CXCR4 transfected cells showed diffuse
CXCR4 expression throughout the cytosol as well as in the cell membrane. SDF-1 treatment, a
known CXCR4 ligand used as a positive control, led to pronounced CXCR4 internalization.
Both ChMIF and EMIF, like SDF-1, induce noticeable aggregates of ChCXCR4 staining in the
cytosol but not in the nucleus. Moreover, flow cytometry histograms show that the percentage of
cells expressing ChCXCR4 declined after treatment with either ChMIF or EMIF compared to
non-treated cells (media alone) as observed in the splenocytes (Fig. 4.4B). All data demonstrate
that ChCXCR4 undergoes internalization after interaction with ChMIF or EMIF.
Receptor complex formation of ChCXCR4 and ChCD74
After determining the interaction of ChMIF or EMIF with ChCXCR4, we further explored if
ChCXCR4 binds to ChCD74, a known receptor of ChMIF and EMIF as previously identified.
105
First, co-localization of ChCXCR4 and ChCD74 was examined in co-transfectants (ChCXCR4
and ChCD74) by dual-immunofluorescence assay. Fig. 4.5A shows the plasma membrane and
intracellular regions of co-transfectants immunostained for CXCR4 (red color), CD74 (green
color), and an overlay of double staining, with the nuclear staining by DAPI shown in blue.
Furthermore, co-immunoprecipitation assay was performed to verify the receptors interaction.
Using beads labeled with anti-GFP, ChCXCR4 and GFP-ChCD74 protein complexes was
precipitated, followed by Western blot analysis with antibodies against GFP tag, CD74, or
CXCR4 (Fig. 4.5B).
MIF-mediated cell migration relies on ChCXCR4 or/and ChCD74
To investigate whether ChMIF or EMIF modulates macrophage migration by interaction
with ChCXCR4 or/and ChCD74, HTC macrophage cells overexpressing vector control,
ChCXCR4, ChCD74, or ChCXCR4 and ChCD74 were allowed to migrate for 4 hr after adding
serially diluted ChMIF or EMIF to the lower chamber. Individual overexpression of either
ChCXCR4 or ChCD74 showed no effect on the inhibition of cell migration by ChMIF or EMIF
treatment shown as negligible difference compared to MIF-treated empty vector transfectant
(Fig. 4.6A). In the presence of co-overexpression of both ChCXCR4 and ChCD74, both ChMIF
and EMIF retained its capacity to inhibit macrophage migration. However, co-expression of
ChCXCR4 and ChCD74 enhanced HTC macrophage cell migration regardless of MIF treatment,
despite substantially being abrogated by treatment with ChMIF or EMIF at 1 μg/ml (Fig. 4.6A).
As the greatest inhibition of non-transfected control cell migration was shown following the
addition of 0.1 μg/ml of ChMIF or EMIF, this concentration was used for subsequent
experiments. Further, the migration behavior after MIF treatment was examined in primary cells
106
by blocking the expression of ChCXCR4 and/or ChCD74. Initially, it was identified that
PBMCs express high level of CXCR4 and moderate level of CD74 by qRT-PCR analysis (data
not shown); therefore, ChMIF- and EMIF-inhibited cell migration was tested in PBMCs with
neutralizing antibodies to CXCR4 and CD74. Blocking CXCR4 or CD74 accelerated ChMIF-
induced macrophage migratory inhibition, while EMIF-induced macrophage migratory inhibition
was promoted by blocking CD74 but not CXCR4. However, blocking of both CXCR4 and
CD74 prominently reduced the cell migration with the addition of ChMIF or EMIF, whereas the
control IgG had no effect (Fig. 4.6B).
MIF triggers calcium influx through ChCXCR4 and ChCD74
As CXCR4 was previously reported to play a role in calcium influx that is required for the
activation and proliferation of T cells, transfected cells with ChCXCR4, ChCD74, or ChCXCR4
and ChCD74 along with control empty vector were stimulated with ChMIF or EMIF and the
intracellular calcium concentration measured using the calcium-sensitive dye Fura-2AM by
ratiometric method. HuSDF-1, a known ligand for ChCXCR4 that induces calcium flux, was
used as a positive control. Upon addition of ChMIF or EMIF, calcium concentration was rapidly
and transiently upregulated in transfectants overexpressing ChCXCR4 or ChCXCR4/ChCD74.
Otherwise, no measurable calcium amount was found in ChCD74-transfectant in the presence of
ChMIF or EMIF (Fig. 4.7). These results indicate that ChMIF or EMIF interacts with cell-
surface expressed CXCR4 and CD74 and then elicits a transient and rapid intracellular free
calcium influx.
MIF-induced cell growth is regulated by ChCXCR4 and ChCD74
107
Previously, ChMIF was demonstrated to enhance proliferation of activated lymphocytes,
prompting the investigation of whether MIF-induced cell proliferation can be elicited through
interaction with ChCXCR4 or ChCD74. ChCXCR4 overexpression decreased cell growth, while
ChCD74 overexpression enhanced cell growth. Notably, double expression of ChCXCR4 and
ChCD74 exerted marked cell growth compared to only ChCD74 overexpression (Fig. 4.8).
Conversely, blocking the expression of CXCR4 and/or CD74 in primary cells did not
significantly attenuate ChMIF or EMIF-induced proliferation of activated lymphocytes (data not
shown).
Discussion
MIF has been implicated in receptor-based functions through interactions with CD74 as well
as the chemokine receptors CXCR2, CXCR4, and CXCR7 dependent on the cellular and
environmental context. In avian species, chicken MIF binds to the cell surface receptor CD74,
which also interacts with MIF homologue secreted from parasites following Eimeria infection
(Kim et al., 2014). Based on previous observations, we decided to examine the engagement of
other receptors with either avian or parasite MIF. In preliminary tests, upregulated transcription
of MIF receptor components CXCR4 and CD74, accompanied by abundant production of
chicken and Eimeria MIFs, was observed in the intestinal region of Eimeria-infected chickens
compared to non-infected controls (Fig. S4.1 in supplementary Data). These data have prompted
speculation that chemokine receptor also may act as the common receptor for both chicken and
parasite MIFs. To address this speculation, we elucidated the interaction of either avian or
parasite MIF with the chemokine receptor CXCR4, further scrutinizing the precise contribution
of MIF receptors, ChCXCR4 and ChCD74, in MIF-mediated cellular activities.
108
Chicken CXCR4 is expressed in various tissues and cells including brain, bursa, small and
large intestines, liver, and embryonic fibroblasts (Liang et al., 2001). Similarly, its primary
expression was shown in bursal and splenic lymphocytes but to a lesser extent in PBMCs, in
which relatively equivalent expression of ChCD74 was observed (Fig. S4.2). As the N-terminal
extracellular region of CXCR4 is necessary to interact with MIF (Rajasekaran et al., 2016), the
cDNA corresponding to the ChCXCR4 obtained from bursal tissue was cloned into pEYFP-N1,
resulting in an in-frame fusion to the N-terminus of YFP. DF-1 cells expressed low and
negligible level of CXCR4 as evidenced by flow cytometry (Fig. 4.1C) and qRT-PCR analysis
(Fig. S4.2C), and thereby these cells were used for CXCR4 overexpression. Following
transfection, prominent overexpression of CXCR4 was observed on the cell membrane of DF-1
cells that was capable of binding directly to both chicken and Eimeria MIFs, indicating that
ChMIF shares its receptor ChCXCR4 with EMIF. Corroborating previous findings in terms of
MIF-dependent internalization of CXCR4 (Bernhagen et al., 2007; Chatterjee et al., 2014;
Alampour-Rajabi et al., 2015), exogenous addition of either ChMIF or EMIF led to
internalization of cell surface ChCXCR4 that was comparable to internalization elicited by
HuSDF-1, thus indicating a receptor-ligand interaction between ChCXCR4 and either ChMIF or
EMIF. MIF-induced CXCR4 internalization in monocytes, lymphocytes, and heterophils may
regulate surface expression level of CXCR4 by endocytosis and degradation or recycling itself
(Brühl et al., 2003; Futahashi et al., 2007), thus, it is likely to modulate GPCR activation and
signaling cascade strength of intracellular or extracellular events mediated by MIF stimulation,
although this downstream effect remains unclear.
CXCR4 has previously been found to homo- or hetero-dimerize with other chemokine or
non-chemokine receptors including CCR2, CCR5, CXCR3, CXCR7 as well as CD74 generating
109
disparate downstream signal transduction, allowing fine-tuning of the functional consequences of
receptor herterodimerization following chemokine stimulation (Sohy et al., 2009; Schwartz et al.,
2009; Décaillot et al., 2011; Watts et al., 2013). Such dimerization and oligomerization of
GPCR could occur under certain inflammatory conditions or by engagement of chemokines for
regulation of chemokine-receptor interactions and its functions (Weber et al., 2006). In
agreement with prior evidence regarding heterologous complex formation of chemokine
receptors, avian MIF receptors, ChCXCR4 and ChCD74, were co-localized on the cell
membrane and intracellular region under overexpression conditions that was confirmed by
biochemical methods, indicating both MIF receptors can be formed into a heteromeric complex.
These observations raise the question of whether ChCXCR4 and ChCD74 participate in MIF-
dependent cell responses individually or in concert with each other.
In an attempt to answer this question, MIF-mediated cellular effects were measured upon
overexpression or blockade of either ChCXCR4, ChCD74, or both. Of note, MIF was originally
thought to inhibit the random migration of macrophages; however, later studies showed that MIF
can interfere or accelerate cell migration through CXCR2/CXCR4, depending on the cell type
and circumstances (Bernhagen et al., 2007). In avian species, inhibition of mononuclear cell
migration in response to chicken or turkey MIF was noted and the corresponding effect caused
by Eimeria MIF (Kim et al., 2010; Miska et al., 2013; Park et al., 2016). Previously, MIF-
triggered cell migration inhibitory effect following a bell-shaped dose response curve peaking at
0.1 μg/ml, but this response was reduced by high concentration of MIF (Berhagen et al., 1994).
Given the collective evidence regarding endogenous receptor formation between CXCR4 and
CD74 in monocytes (Schwartz et al., 2009), as well as MIF-induced B cell migration through
cooperative engagement of CXCR4 and CD74 (Klasen et al., 2014), we speculated that
110
ChCXCR4 and/or ChCD74 may be responsible for the migration of mononuclear cells controlled
by stimulation of either avian or parasite MIF. Indeed, our results showed that overexpression of
both ChCXCR4 and ChCD74 triggered cell migration. On the other hand, treatment with
ChMIF or EMIF substantially reduced cell migration following blocking of either ChCXCR4,
ChCD74, or both (by neutralizing antibody), implying that ChCXCR4 and ChCD74 are the MIF
induced chemotaxis-mediating receptors. Moreover, inhibition of cell migration by MIF likely
occurs through other potential receptors such as CXCR2 or CXCR7 that appears to be governed
by opposing actions through CXCR4 and CD74.
Calcium is an essential component of the signaling cascade activated upon chemokine
binding to its receptors involving GPCR-mediated cell migratory response (Dewor et al., 2007).
A rapid and transient rise of intracellular calcium level is associated with the interaction of
chemokines with their receptors, for instance, CXCL8 or CXCL12 induces calcium mobilization
through CXCR2 or CXCR4, respectively (Jones et al., 1997; Levoye et al., 2009). As stated in
previous reports, MIF induces calcium influx through CXCR2 and CXCR4 (Bernhagen et al.,
2007). Both avian and parasite MIFs also were able to trigger intracellular calcium release in
ChCXCR4-expressing HTC cells comparable to that induced by CXCL12 stimulation. Such an
effect was magnified in the presence of ChCD74, suggesting that MIF-dependent calcium influx
can be activated by engagement of both ChCXCR4 and ChCD74 as well as ChCXCR4 alone.
MIF can regulate growth and survival of monocytes, lymphocytes, fibroblasts, and tumor
cells in an autocrine manner. Through CD74, MIF initiated a survival signaling cascade that
potentiated B cell proliferation and survival activities (Starlets et al., 2006). Besides, the effect
of MIF or SDF-1 on the enhancement of cell proliferation was observed in pancreatic cancer
cells expressing CXCR4 (Shin et al., 2012). In accordance with previous findings, avian and
111
parasite MIFs significantly induced cell proliferation under ChCD74 expression or co-expression
of ChCXCR4 and ChCD74. In primary cells, blocking CXCR4 or CD74 on
macrophages/monocytes disrupted the migration of macrophages but did not reduce macrophage
proliferation. Interestingly, the combination of both ChCXCR4 and ChCD74 controls cell
proliferation as well as cell chemotaxis even in the absence of MIF stimulation. Overall, our
data showed that concerted involvement of ChCXCR4 and ChCD74 with MIF resulted in the
synergistic enhancement of cell chemotaxis, calcium mobilization, and cell proliferation, albeit
no evidence was shown in primary cells.
Based on previous reports and preliminary tests, EMIF release following Eimeria infection
appears to coexist in host tissue with ChMIF that is ubiquitously expressed in various tissues.
Also, both MIF cytokines share the common MIF receptor ChCD74 and exhibit similar functions
with respect to inhibition of macrophage migration as well as expression patterns of pro-
inflammatory cytokines as expected from similar amino acid sequences and structural identity
between chicken and Eimeria MIFs (Kim et al., 2010, 2014; Miska et al., 2013). In parallel, the
involvement of another common receptor ChCXCR4 for both chicken and Eimeria MIFs was
described herein. Furthermore, the biological actions of ChMIF through ChCXCR4 and
ChCD74 are also considerably consistent with that of EMIF. Based on the current findings, it is
conceivable that Eimeria parasite secretes MIF compounds that mimic the host cytokine, and
manipulates the host immune responses in favor of the parasite allowing its survival under
“unfavorable” host environment. Further research is required to elucidate these potential
relationships. In conclusion, the current study has defined another common chemokine receptor
for both chicken and Eimeria MIFs that is also involved in MIF-driven cellular functions along
with CD74.
112
References
Alampour-Rajabi, S., O. El Bounkari, A. Rot, G. Muller-Newen, F. Bachelerie, M. Gawaz, C.
Weber, A. Schober and J. Bernhagen. (2015). MIF interacts with CXCR7 to promote receptor
internalization, ERK1/2 and ZAP-70 signaling, and lymphocyte chemotaxis. FASEB J. 29, 4497-
4511.
Bernhagen, J., R. Krohn, H. Lue, J. L. Gregory, A. Zernecke, R. R. Koenen, M. Dewor, I.
Georgiev, A. Schober, L. Leng, T. Kooistra, G. Fingerle-Rowson, P. Ghezzi, R. Kleemann, S. R.
McColl, R. Bucala, M. J. Hickey and C. Weber. (2007). MIF is a noncognate ligand of CXC
chemokine receptors in inflammatory and atherogenic cell recruitment. Nat Med. 13, 587-596.
Bruhl, H., C. D. Cohen, S. Linder, M. Kretzler, D. Schlondorff and M. Mack. (2003). Post-
translational and cell type-specific regulation of CXCR4 expression by cytokines. Eur J
Immunol. 33, 3028-3037.
Chatterjee, M., O. Borst, B. Walker, A. Fotinos, S. Vogel, P. Seizer, A. Mack, S. Alampour-
Rajabi, D. Rath, T. Geisler, F. Lang, H. F. Langer, J. Bernhagen and M. Gawaz. (2014).
Macrophage migration inhibitory factor limits activation-induced apoptosis of platelets via
CXCR7-dependent Akt signaling. Circ Res. 115, 939-949.
Cho, Y., G. V. Crichlow, J. J. Vermeire, L. Leng, X. Du, M. E. Hodsdon, R. Bucala, M.
Cappello, M. Gross, F. Gaeta, K. Johnson and E. J. Lolis. (2010). Allosteric inhibition of
macrophage migration inhibitory factor revealed by ibudilast. Proc Natl Acad Sci USA 107,
11313-11318.
David, J. R. (1966). Delayed hypersensitivity in vitro: its mediation by cell-free substances
formed by lymphoid cell-antigen interaction. Proc Natl Acad Sci USA 56, 72-77.
de Souza, H. S., C. A. Tortori, L. Lintomen, R. T. Figueiredo, C. Bernardazzi, L. Leng, R.
Bucala, K. Madi, F. Buongusto, C. C. Elia, M. T. Castelo-Branco and M. T. Bozza. (2015).
Macrophage migration inhibitory factor promotes eosinophil accumulation and tissue remodeling
in eosinophilic esophagitis. Mucosal Immunol. 8, 1154-1165.
Decaillot, F. M., M. A. Kazmi, Y. Lin, S. Ray-Saha, T. P. Sakmar and P. Sachdev. (2011).
CXCR7/CXCR4 heterodimer constitutively recruits beta-arrestin to enhance cell migration. J
Biol Chem. 286, 32188-32197.
Dewor, M., G. Steffens, R. Krohn, C. Weber, J. Baron and J. Bernhagen. (2007). Macrophage
migration inhibitory factor (MIF) promotes fibroblast migration in scratch-wounded monolayers
in vitro. FEBS Lett. 581, 4734-4742.
Futahashi, Y., J. Komano, E. Urano, T. Aoki, M. Hamatake, K. Miyauchi, T. Yoshida, Y.
Koyanagi, Z. Matsuda and N. Yamamoto. (2007). Separate elements are required for ligand-
dependent and -independent internalization of metastatic potentiator CXCR4. Cancer Sci. 98,
373-379.
Gore, Y., D. Starlets, N. Maharshak, S. Becker-Herman, U. Kaneyuki, L. Leng, R. Bucala and I.
Shachar. (2008). Macrophage migration inhibitory factor induces B cell survival by activation of
a CD74-CD44 receptor complex. J Biol Chem. 283, 2784-2792.
113
Hong, Y. H., H. S. Lillehoj, S. H. Lee, R. A. Dalloul and E. P. Lillehoj. (2006a). Analysis of
chicken cytokine and chemokine gene expression following Eimeria acervulina and Eimeria
tenella infections. Vet Immunol Immunopathol. 114, 209-223.
Hong, Y. H., H. S. Lillehoj, E. P. Lillehoj and S. H. Lee. (2006b). Changes in immune-related
gene expression and intestinal lymphocyte subpopulations following Eimeria maxima infection
of chickens. Vet Immunol Immunopathol. 114, 259-272.
Jones, S. A., B. Dewald, I. Clark-Lewis and M. Baggiolini. (1997). Chemokine antagonists that
discriminate between interleukin-8 receptors. Selective blockers of CXCR2. J Biol Chem. 272,
16166-16169.
Kim, S., K. B. Miska, M. C. Jenkins, R. H. Fetterer, C. M. Cox, L. H. Stuard and R. A. Dalloul.
(2010). Molecular cloning and functional characterization of the avian macrophage migration
inhibitory factor (MIF). Dev Comp Immunol. 34, 1021-1032.
Kim, S., C. M. Cox, M. C. Jenkins, R. H. Fetterer, K. B. Miska and R. A. Dalloul. (2014). Both
host and parasite MIF molecules bind to chicken macrophages via CD74 surface receptor. Dev
Comp Immunol. 47, 319-326.
Klasen, C., K. Ohl, M. Sternkopf, I. Shachar, C. Schmitz, N. Heussen, E. Hobeika, E. Levit-
Zerdoun, K. Tenbrock, M. Reth, J. Bernhagen and O. El Bounkari. (2014). MIF promotes B cell
chemotaxis through the receptors CXCR4 and CD74 and ZAP-70 signaling. J Immunol. 192,
5273-5284.
Leng, L., C. N. Metz, Y. Fang, J. Xu, S. Donnelly, J. Baugh, T. Delohery, Y. Chen, R. A.
Mitchell and R. Bucala. (2003). MIF signal transduction initiated by binding to CD74. J Exp
Med. 197, 1467-1476.
Levoye, A., K. Balabanian, F. Baleux, F. Bachelerie and B. Lagane. (2009). CXCR7
heterodimerizes with CXCR4 and regulates CXCL12-mediated G protein signaling. Blood 113,
6085-6093.
Liang, T., K. Tan, K. Chong, Z. Zhu, S. Pongor and A. Simoncsits. (2001). Selection and design
of high affinity DNA ligands for mutant single-chain derivatives of the bacteriophage 434
repressor. Sci China C Life Sci. 44, 274-286.
Lourenco, S., V. H. Teixeira, T. Kalber, R. J. Jose, R. A. Floto and S. M. Janes. (2015).
Macrophage migration inhibitory factor-CXCR4 is the dominant chemotactic axis in human
mesenchymal stem cell recruitment to tumors. J Immunol. 194, 3463-3474.
Lue, H., A. Kapurniotu, G. Fingerle-Rowson, T. Roger, L. Leng, M. Thiele, T. Calandra, R.
Bucala and J. Bernhagen. (2006). Rapid and transient activation of the ERK MAPK signalling
pathway by macrophage migration inhibitory factor (MIF) and dependence on JAB1/CSN5 and
Src kinase activity. Cell Signal. 18, 688-703.
Lue, H., M. Thiele, J. Franz, E. Dahl, S. Speckgens, L. Leng, G. Fingerle-Rowson, R. Bucala, B.
Luscher and J. Bernhagen. (2007). Macrophage migration inhibitory factor (MIF) promotes cell
survival by activation of the Akt pathway and role for CSN5/JAB1 in the control of autocrine
MIF activity. Oncogene 26, 5046-5059.
114
Miska, J., P. Devarajan and Z. Chen. (2013). The immunological identity of tumor: Self
implications. Oncoimmunology 2, e23794.
Park, M., S. Kim, R. H. Fetterer and R. A. Dalloul. (2016). Functional characterization of the
turkey macrophage migration inhibitory factor. Dev Comp Immunol. 61, 198-207.
Rajasekaran, D., S. Groning, C. Schmitz, S. Zierow, N. Drucker, M. Bakou, K. Kohl, A.
Mertens, H. Lue, C. Weber, A. Xiao, G. Luker, A. Kapurniotu, E. Lolis and J. Bernhagen.
(2016). Macrophage migration inhibitory factor-CXCR4 receptor interactions: Evidence for
partial allosteric agonism in comparison with cxcl12 chemokine. J Biol Chem. 291, 15881-
15895.
Schwartz, V., H. Lue, S. Kraemer, J. Korbiel, R. Krohn, K. Ohl, R. Bucala, C. Weber and J.
Bernhagen. (2009). A functional heteromeric MIF receptor formed by CD74 and CXCR4. FEBS
Lett. 583, 2749-2757.
Shi, X., L. Leng, T. Wang, W. Wang, X. Du, J. Li, C. McDonald, Z. Chen, J. W. Murphy, E.
Lolis, P. Noble, W. Knudson and R. Bucala. (2006). CD44 is the signaling component of the
macrophage migration inhibitory factor-CD74 receptor complex. Immunity 25, 595-606.
Shin, H. N., H. H. Moon and J. L. Ku. (2012). Stromal cell-derived factor-1alpha and
macrophage migration-inhibitory factor induce metastatic behavior in CXCR4-expressing colon
cancer cells." Int J Mol Med. 30, 1537-1543.
Simons, D., G. Grieb, M. Hristov, N. Pallua, C. Weber, J. Bernhagen and G. Steffens. (2011).
Hypoxia-induced endothelial secretion of macrophage migration inhibitory factor and role in
endothelial progenitor cell recruitment. J Cell Mol Med. 15, 668-678.
Sohy, D., H. Yano, P. de Nadai, E. Urizar, A. Guillabert, J. A. Javitch, M. Parmentier and J. Y.
Springael. (2009). Hetero-oligomerization of CCR2, CCR5, and CXCR4 and the protean effects
of "selective" antagonists. J Biol Chem. 284, 31270-31279.
Starlets, D., Y. Gore, I. Binsky, M. Haran, N. Harpaz, L. Shvidel, S. Becker-Herman, A. Berrebi
and I. Shachar. (2006). Cell-surface CD74 initiates a signaling cascade leading to cell
proliferation and survival. Blood 107, 4807-4816.
Ulvmar, M. H., E. Hub and A. Rot. (2011). Atypical chemokine receptors. Exp Cell Res. 317,
556-568.
Watts, A. O., M. M. van Lipzig, W. C. Jaeger, R. M. Seeber, M. van Zwam, J. Vinet, M. M. van
der Lee, M. Siderius, G. J. Zaman, H. W. Boddeke, M. J. Smit, K. D. Pfleger, R. Leurs and H. F.
Vischer. (2013). Identification and profiling of CXCR3-CXCR4 chemokine receptor heteromer
complexes. Br J Pharmacol. 168, 1662-1674.
Weber, C. and R. R. Koenen. (2006). Fine-tuning leukocyte responses: towards a chemokine
'interactome'. Trends Immunol. 27, 268-273.
115
Table 4.1. Primers sequences used for cloning ChCXCR4 and qRT-PCR analysis.
Primer Name Sequence (5’→3’) GenBank accession No. Application
ChCXCR4_F ATGGACGGCAGCATGGACGGTTTGGATCTG NM_204617 Gene
cloning ChCXCR4_R TTAGCTGGAATGGAAACTTGAAGACTCTGAC
CXCR4_F CGGATCTTCTTGCCAACCAT
qRT-PCR
CXCR4_R TCCATTCCCGATTATTCCTGTT
GAPDH_F CCTAGGATACACAGAGGACCAGGTT
NM_204305 GAPDH_R GGTGGAGGAATGGCTGTCA
116
Figure 4.1. Transient overexpression of ChCXCR4 in DF-1 cells. (A) Through fluorescence
microscopy, ChCXCR4 expression was observed using yellow fluorescent protein (YFP). (B)
mRNA expression level of ChCXCR4 in transfected cells was measured by qRT-PCR. (C) Cell
surface expression of CXCR4 in DF-1 cells or transfected DF-1 cells with YFP or CXCR4-YFP
was examined by flow cytometric analysis.
117
Figure 4.2. ChMIF binding to ChCXCR4. (A) Immunofluorescence assay revealed the
interaction of ChMIF (green) with ChCXCR4 (red) presented on the CXCR4 transfected cells.
Nuclear staining by DAPI is shown in blue. (B) ChMIF-His ligation to either CXCR4-YFP or
YFP alone was pulled down using Ni+-resin, followed by Western blot analysis using anti-his,
anti-ChMIF, anti-YFP, or anti-CXCR4 antibody. (C) Transfected DF-1 cells expressing
CXCR4-YFP or YFP alone were treated with ChMIF or media alone, stained with antibody
against ChMIF or CXCR4, and analyzed by flow cytometry. (D) Similar flow cytometric
analysis was conducted on primary cells including monocytes and splenocytes.
118
Figure 4.3. EMIF binding to ChCXCR4. (A) The interaction of EMIF (green) with cell surface
ChCXCR4 (red) was observed by immunofluorescence assay. (B) EMIF binding to CXCR4-
YFP was co-immunoprecipitated using anti-YFP-labeled beads or beads alone, followed by
Western blot analysis using anti-EMIF, anti-YFP, or anti-CXCR4 antibody. Transfected DF-1
cells expressing CXCR4-YFP or YFP alone (C) and primary cells including monocytes and
splenocytes (D) were treated with EMIF or media alone and analyzed by flow cytometry after
antibody staining against EMIF or CXCR4.
119
Figure 4.4. ChCXCR4 internalization was induced by incubation with ChMIF or EMIF. (A)
ChCXCR4 transfectant was treated with ChMIF or EMIF. Media alone and SDF-1 were used as
negative and positive controls, respectively. The arrows indicate internalized spots of YFP-
tagged ChCXCR4. (B) Isolated primary cells, PBMCs, heterophils, or splenocytes were
incubated with ChMIF (red), EMIF (green), or media (grey, control) and stained with anti-
CXCR4 antibody. Flow cytometry histograms show CXCR4-expressing cells after MIF
treatment.
120
Figure 4.5. Complex formation of ChCXCR4 and ChCD74. (A) Following co-transfection with
ChCXCR4 and ChCD74, subcellular co-localization of both receptors was visualized after
antibody staining by fluorescence microscopy (CXCR4, red; CD74, green; nuclei, blue). (B)
Receptor complexes from lysates of transfected cells expressing ChCXCR4 and GFP-ChCD74
were co-immunoprecipitated using beads conjugated with anti-GFP antibody or beads alone
(control) and analyzed by Western blot using anti-GFP (top), anti-CD74 (middle), or anti-
CXCR4 antibody (bottom). Controls, lysates of ChCXCR4-ChCD74 transfectant without
immunoprecipitation (Input) or beads alone.
121
Figure 4.6. ChMIF and EMIF promoted cell chemotaxis through ChCXCR4 and ChCD74. (A)
Migration of transfected cells with empty vector (pcDNA), ChCXCR4, ChCD74, or ChCXCR4
and ChCD74 was examined in response to different concentrations of rChMIF or rEMIF (0.01,
0.1, 1 μg/ml). (B) Migration of PBMCs was measured after addition of rChMIF or rEMIF in the
presence of antibodies to CXCR4, CD74, or both, with IgG control. Data (Mean ± SEM) are
representative of two independent experiments each performed in triplicate.
122
Figure 4.7. ChMIF and EMIF enhanced intracellular calcium influx by engagement of
ChCXCR4 and ChCD74. Transfected cells with empty vector (pcDNA, control), ChCXCR4, or
ChCXCR4 and ChCD74 were labeled with the fluorescent calcium indicator Fura-2AM and
stimulated with ChMIF, EMIF, or HuSDF-1 (0.1 μg/ml). Subsequently, MFI (measure of the
released cytosolic Ca2+ concentration) was monitored for 120 s by fluorescent microscopy. Data
represent mean ± SEM of three independent experiments.
123
Figure 4.8. The proliferative effect of ChMIF or EMIF on transfected HTC cells with empty
vector (pcDNA), ChCXCR4, ChCD74, or ChCXCR4 and ChCD74. 1x105 cells were treated
with media alone, rChMIF, or rEMIF (0.01 and 0.1 μg/ml) for 24 hr. Data are presented as mean
± SEM of three independent experiments each performed in triplicate.
124
CHAPTER V
Disruption of macrophage migration inhibitory factor in Eimeria tenella using CRISPR
system
Abstract
Macrophage migration inhibitory factor (MIF) is a multifaceted molecule as a cytokine as well as
a chemokine, involved in several immune responses. Of interest, MIF homologue was
predominantly secreted from the invasive stage of Eimeria parasites during infection, primarily
in poultry, exerting similar biological activities compared to that of chicken and turkey MIFs.
However, the potential involvement of MIF homolog in Eimeria infection has not been clearly
elucidated. To determine whether Eimeria MIF secretion reflects potential evasion of the host
immune defense to disseminate parasite infection, we generated a transgenic E. tenella lacking
MIF expression using genetic manipulation. For selection of MIF knockout parasites, selectable
genes (EGFP and drug-resistant DHFR genes) and sgRNA targeting Eimeria MIF (sgMIF) with
Cas9 binding motif were placed downstream of actin and histone 4 promoters, respectively.
Following transfection, the fluorescent protein was primarily localized in the nucleus of
transgenic E. tenella, in which MIF expression was interrupted by the activation of sgMIF-
guided Cas9 nuclease under the control of promoters originating from E. tenella. After genomic
DNA analysis of stable transgenic parasites by confirming the presence of integrated genes,
partial disruption of MIF expression was observed in transgenic E. tenella with ∆EtMIF at the
molecular levels. By in vitro assay, a lower number of cells expressing EtMIF was detected
when inoculated with ∆EtMIF rather than after inoculation with control parasites. This was
analyzed by flow cytometric analysis and substantiated by decreased level of MIF transcript in
125
cDNA of infected cells with ∆EtMIF compared to those with wild-type (WT) or control
parasites. In addition, elevated percentage of live cells was shown in PBMCs infected with
∆EtMIF parasites in comparison with WT or control parasites, suggesting the critical impact of
parasite MIF on the death of host cells. In the present study, CRISPR system was adapted in E.
tenella to characterize the role of parasite MIF during Eimeria infection; in addition, the
evidence for a role of MIF in the viability of host cells following infection highlights the
potential of parasite MIF as a possible therapeutic target in coccidiosis.
Introduction
Eimeria species are the obligate intracellular protozoan parasites belonging to the phylum
Apicomplexa that cause coccidiosis in several animals including chickens, rabbits, goats, sheep,
and cattle. As one of the prevalent parasitic diseases especially in poultry (Chapman, 2014;
Mohammed and Sunday, 2015), avian coccidiosis inflicts huge economic losses to the poultry
industry worldwide (Dalloul and Lillehoj, 2006; Bera et al., 2010). Currently, prophylactic
chemotherapy with anticoccidial drugs has been primarily used to control coccidiosis but their
extensive administration led to the emergence of resistant parasites (Peek and Landman, 2011).
As an alternative strategy, anticoccidial vaccination is efficiently used to protect layers and
breeders, and subsequently becoming available in broilers, although their use has been limited
due to the relatively high cost as well as the side effect on performance caused by intermediate or
low immunogenic Eimeria species (Chapman et al., 2002; Tang et al., 2017). In order to
overcome these limitations of current control measures, a number of novel strategies have been
continuously developed including genetic modification tools, which are enabling studying and
dissecting complex traits of genes. Of seven species of Eimeria, E. tenella is an emerging model
126
organism to study basic cell biology of protozoan parasites by successful implementation of
transient and stable transfections (Shi et al., 2008; Yan et al., 2009). A transfection system has
been developed for E. tenella using restriction enzyme-mediated integration (REMI) (Liu et al.,
2008) and several powerful screening methods (Clark et al., 2008). REMI method was applied
to enhance the transformation efficiency and facilitate the stable transfection through non-
homologous integration into the genome. Transformed parasites were isolated using several
selectable markers, of which mutated dihydrofolate reductase-thymidylate synthase (DHFR-TS)
gene from Toxoplasma gondii confers resistance to pyrimethamine that has been used as a drug
resistance marker available for the transfection of Eimeria species (Chapman, 1997; Fohl and
Roos, 2003; Clark et al., 2008). In addition, incorporation of a fluorescent reporter gene was
used to visually monitor growth of parasites as well as selection of transformed parasites. By
combining both drug resistance gene DHFR and fluorescent protein GFP, transformed parasites
were initially selected after pyrimethamine treatment and then sorted by FACS analysis.
Although limitations of in vitro cultivation of Eimeria species has hindered progress in
developing gene editing techniques, transgenic parasites have been generated expressing not only
heterologous antigens derived from this poultry pathogen but also host immune cytokine to
enhance immunogenicity of Eimeria as a vaccine (Clark et al., 2012; Liu et al., 2013; Li et al.,
2015). One genome editing methodology is CRISPR (clustered regularly interspaced short
palindromic repeats) – Cas9 system, a naturally occurring immune system in bacteria and
archaea against mobile genetic elements including plasmids and bacteriophages (Cong et al.,
2013). This system requires expression of two essential components, single-guide RNA
(sgRNA) and Cas9 endonuclease. sgRNA, a 20-nucleotide sequence followed by protospacer-
adjacent motif (PAM) that is designed to match the target DNA site and flanked by trans-
127
activating RNA scaffold, is paired with cDNA in the genome, thereby directing Cas9 nuclease to
its target site and generating double-strand break in the genome. Genetic engineering techniques
based on prokaryotic CRISPR/Cas9 system facilitated by RNA-guided site-specific DNA
cleavage have been widely used in diverse organisms, recently extended to the closely related
apicomplexan parasite T. gondii. CRISPR/Cas9 was able to disrupt target gene and introduce
selectable marker without homology regions in T. gondii (Shen et al., 2014), which can generate
knockout without selection yielding significant efficiency in the absence of the NHEJ pathway
for DNA repair (Sidik et al., 2014).
Macrophage migration inhibitory factor (MIF) is a versatile molecule with a wide range of
capabilities including inflammatory cytokine and chemokine-like functions (CLF) and enzymatic
activity. Initially, MIF was discovered as the first lymphokine as a soluble factor secreted by
antigen stimulating lymphocytes inhibiting random migration of macrophages (Bloom and
Bennett, 1966; David, 1966). Few decades later, it was identified to induce the activation of
monocytes/macrophages through upregulation of Toll-like receptor 4 (TLR4) triggering LPS
receptor complex-mediated signaling pathway (Roger et al., 2001). Also, it inhibited
cytotoxicity of CD8+ T lymphocytes via regulation of T cell proliferation and trafficking (Abe et
al., 2001), thus revealing the immunomodulatory effect of MIF on both innate and adaptive
immune responses. Activated immune cells including macrophages and lymphocytes produce
MIF, which induces the secretion of pro-inflammatory and T cell cytokines in an autocrine
manner, acting as a pivotal mediator in the control of inflammatory response (Calandra, 2003).
Based on the 3-D structural homology between MIF and CXC family cytokines, MIF can engage
in non-cognate interaction with chemokine receptors leading to the regulation of leukocyte
recruitment and arrest (Weber et al., 2008; Tillmann et al., 2013). In the same context, structural
128
similarity of MIF to that of isomerases and tautomerases underlie the catalytic activity of MIF
that contributes to its pro-inflammatory activity (Rosengren et al., 1996, 1997; Kleemann et al.,
1998). Such regulatory MIF properties are known to play a crucial role in a range of parasitic,
bacterial, and viral diseases.
In birds, high expression of MIF following infection implicated the involvement of MIF
during Eimeria infection (Hong et al., 2006). Along with host MIF, a homologous molecule was
also found to be released from infected Eimeria parasites. Like other homologous MIFs in many
parasitic species including Leishmania, Plasmodium, Brugia, Trichinella, and Ancylostoma,
Eimeria MIF shares similar structural and functional properties with mammalian MIFs. MIF has
a conserved secondary structure and function throughout most apicomplexan MIFs, capable of
interfering with macrophage migration and enhancing production of pro-inflammatory cytokine
and chemokine when pre-stimulated with LPS, similar to the biological effects of chicken MIF
(Miska et al., 2007, 2013). In addition, Eimeria MIF can interact with host receptors CD74 (Kim
et al., 2014) and CXCR4 (Park et al., unpublished), whereby this complex influences cell
migration, calcium mobilization, and cell proliferation.
Given the fact that an Eimeria infection is accompanied by the production of MIF cytokine,
we hypothesized that Eimeria MIF is involved in the parasite invasion and modulation of the
host immune response. To investigate the role of Eimeria MIF in parasitic infection, we
generated a MIF-knockout Eimeria parasite using the CRISPR system. Here, target MIF gene
was disrupted in E. tenella using a single linear plasmid DNA containing sgRNA and Cas9
nuclease. The present study in E. tenella could pave the way for developing CRISPR/Cas9
genetic modification in this and other Eimeria species, which may be applied in vaccine design
and development.
129
Materials and methods
Parasites, birds, and cells
Sporulated oocysts of E. tenella laboratory strain APU-2 (Dr. Mark Jenkins, USDA-ARS,
Beltsville, MD) were repeatedly washed in deionized water by centrifugation at 1,850 × g for 10
min at 4℃, then incubated with 6% sodium hypochlorite on ice for 10 min with stirring every 2
min. After the bleach treatment, oocysts were repeatedly washed with water and centrifugation
until fully clear of bleach. The oocysts were suspended in Hank’s Buffered Salt Solution without
calcium and magnesium (HBSS; Atlanta Biologicals, GA) and disrupted on ice using a Teflon
pestle until 80% of oocysts were broken (determined microscopically). Following centrifugation
at 3,080 × g for 15 min, the pelleted sporocysts were resuspended in excystation media (HBSS
containing 4% taurodeoxycholic acid and 0.25% trypsin, pH 7.8) and incubated at 41℃ with
shaking until 80% being excysted as confirmed by microscopic examination. Excysted
sporozoites were purified by filtering through a cellulose nitrate filter (Nalgene, NY), followed
by counting using a hemocytometer for both in vitro and in vivo assays. For in vivo infection,
coccidian-free broiler chicks were reared in a coccidian-free environment and provided a drug-
free diet and water ad libitum for later in vivo infection. Primary chicken kidney cells (PCKCs)
were isolated to perform the in vitro assays. Briefly, kidneys were obtained from 4-week-old
broilers, washed extensively with PBS, and minced into small pieces using 70 μm cell strainer
(VWR, NY). After washing with PBS, tissues were digested with 0.25% trypsin/EDTA in HBSS
with shaking for 30 min at 37℃. The supernatant was decanted into a new tube containing fetal
calf serum (FCS; Atlanta Biologicals) and centrifuged at 250 × g for 10 min. Isolated PCKCs
were resuspended in Dulbecco’s Modified Eagle Medium (DMEM; Mediatech, VA)
130
supplemented with 10% FCS and 100 U penicillin/streptomycin and cultured at a cell density of
5 × 105 cells/ml at 41℃ with 5% CO2 humidified air.
Plasmid construction
In order to construct the Eimeria CRISPR plasmid, the backbone plasmid pSAG1::Cas9-
U6::sgUPRT (Addgene, MA) encoding Cas9 nuclease under the control of promoters of T.
gondii was modified as follows. Briefly, 5’-flanking regions of histone 4 as well as 5’ and 3’
untranslated regions (UTR) of actin gene were PCR-amplified from genomic DNA of E. tenella
using designed primers (Table 5.1). As a selectable marker for resistance to pyrimethamine, the
dihydrofolate reductase (DHFR) gene was amplified from pLoxP-DHFR-mCherry (Addgene)
and flanked by Cas9-EGFP cassette using a linker, which is a synthesized 66-bp nucleotide
encoding 2A sequence from Thosea asigna virus. Subsequently, a 20-bp sgRNA targeting
EtMIF (sgMIF) was designed using CRISPR primer designer (Yan et al., 2014) and synthesized
using two complementary oligos containing the EtMIF guide sequences, thereby placed adjacent
to 5’ flanking region of histone 4. All amplicons were joined via Gibson assembly (NEB, MA)
and cloned through replacement of gene cassettes including promoters and sgRNA using
restriction enzyme sites BamH I and Pci I, followed by transforming into E. coli 10-beta (NEB).
Through these steps, a CRISPR plasmid containing sgMIF (pAct-Cas9-H4-sgMIF, ∆EtMIF) and
plasmid without sgMIF (pAct-Cas9, control) were generated and confirmed by sequencing.
Parasite transfection and inoculation
Parasite transfection was conducted using REMI and Amaxa nucleofector system. Prior to
transfection, either ∆EtMIF or control plasmid was linearized by digestion with Asc I and
131
purified using Wizard SV Gel and PCR Clean-up system (Promega, WI). Freshly purified
sporozoites were resuspended in AMAXA nucleofector solution (Lonza) at a concentration of 7
× 106 cells/ml and then mixed with 5 μg linearized DNA and 20 U Asc I that were subjected to
electroporation using AMAXA nucleofector (Program U-033) and then incubated for 20 min at
room temperature.
Following nucleofection, 6 × 105 non-transfected WT or transfected sporozoites with either
∆EtMIF or control plasmid were inoculated onto monolayers of PCKCs and cultured in a
humidified atmosphere of 5% CO2 at 41℃, followed by observation using a fluorescence
microscope at 24, 48, and 72 hr post-inoculation (PI). In order to obtain stable transgenic
populations, 1 × 106 transfected sporozoites were inoculated into six 2-week-old chickens via the
cloacal route. At 18 hr PI, chickens were fed with a standard diet supplemented with 150 ppm
pyrimethamine (VWR). Oocysts were collected from feces excreted 6-10 days post-inoculation
(dpi), sporulated, then observed under a fluorescence microscope.
Gene analysis of transgenic E. tenella
To detect the presence of transfected plasmid DNA in the transgenic parasites, genomic DNA
(gDNA) was extracted from sporulated transgenic oocysts using Quick-DNA fecal/soil microbe
miniprep kit (Zymo Research, CA). gDNA of WT oocysts was used as a control. With the
primers used for plasmid construction, EGFP, DHFR-TS, and sgMIF with Cas9 binding scaffold
were amplified as follows: initial denaturation at 95℃ for 2 min, followed by 35 cycles of
denaturation at 95℃ for 30 s, annealing at 50℃ for 1 min, and extension at 72℃ for 1 min, with
a final extension at 72℃ for 7 min.
132
qRT-PCR and Western blot analysis
To examine the expression of endogenous MIF in transgenic E. tenella, total RNA was
extracted from infected cells with either transient or stable transgenic parasites including WT,
∆EtMIF, or control using the RNeasy Mini kit (Qiagen, CA) and then reverse-transcribed into
cDNA using High-capacity cDNA Reverse Transcription kit (Applied Biosystems, CA).
Synthesized cDNA was mixed with 0.1 μM primers and 5 μl of 2x Fast SYBR Green Master
Mix (Applied Biosystems) followed by performing qRT-PCR reaction with the following
thermal cycling conditions: 95℃ for 20 s as initial denaturation, followed by 40 cycles of
denaturation at 95 ℃ for 3 s, and annealing/extension at 57 ℃ for 30 s. Transcription of EtMIF
in infected cells was normalized to GAPDH and calculated relative to that of the cell alone by
the 2-∆∆Ct comparative method (Livak and Schmittgen, 2001). A corresponding qRT-PCR
analysis was conducted using cDNA synthesized from total RNA extracted from stable
transgenic E. tenella. Transcription of EtMIF was normalized against the expression of 18s
rRNA and calibrated relative to MIF expression of WT parasites by the 2-∆∆Ct comparative
method.
To assess translated protein expression of MIF in the stable transgenic E. tenella, soluble
proteins were extracted from transgenic oocysts with either ∆EtMIF or control along with WT
oocysts, which were resolved on SDS-PAGE gel under reduced conditions and transferred to a
PVDF membrane. Anti-EtMIF polyclonal antisera in a 1:500 dilution were used as the primary
antibody, followed by applying of goat anti-rabbit IgG conjugated with HRP (Santa Cruz
Biotechnology, CA) as the secondary antibody. In parallel, anti-GAPDH antibody (Millipore,
MA) was used as a reference for protein loading and for relative quantification. Subsequently,
133
the blot was stained with the SuperSignal West Pico chemiluminescent substrate (Pierce, IL) and
then developed by a gel imaging system (Bio-Rad, CA).
Indirect immunofluorescence (IFA) and flow cytometric assays
Either transiently transfected sporozoites or sporozoites released from sporulated stable
transgenic oocysts were applied to monolayers of PCKCs. Following incubation, infected
PCKCs grown on coverslips were washed with PBS and fixed with 2% paraformaldehyde in
PBS. After washing, the cells were incubated with anti-EtMIF antibody followed by anti-rabbit
IgG-680 (Santa Cruz Biotechnology). Stained cells were observed using a fluorescence
microscope. In addition, monolayers of infected PCKCs grown on a petri-dish were harvested
and washed with PBS. Cells were sequentially incubated with anti-EtMIF and anti-rabbit IgG-
680 for 30 min at 4℃. Stained cells were washed three times with PBS and then analyzed using
Attune NxT Acoustic Focusing Cytometry (Invitrogen, CA). In parallel, cells were treated with
dead cell staining dye (BD Biosciences, NJ) discriminating live from dead cells to measure the
cell viability.
Statistical analysis
All data were analyzed by Student’s t-test or one-way analysis of variance (ANOVA) using
JMP software (Ver 14). Differences between groups were considered significant by Tukey-
Kramer multiple comparison test at P < 0.05.
Results
Transiently transfected E. tenella with CRISPR plasmid
134
In an attempt to disrupt the MIF expression in E. tenella using CRISPR/Cas9 system, a
CRISPR plasmid was constructed using promoter sequences derived from E. tenella strain (Fig.
5.1). A plasmid expressing a Cas9 nuclease flanked by NLS was fused toT2A-linked selectable
markers including fluorescent protein and drug resistant DHFR gene that are driven by the
transcription control of actin promoter. Along with Cas9-EGFP-DHFR cassette, sgRNA
containing 20 bp of direct homology to exon 1 of the EtMIF gene is positioned upstream of the
PAM sequences driven by the H4 promoter. Therefore, Cas9 fused to GFP and DHFR was
expressed from actin promoter, while sgMIF was expressed from H4 promoter. After
nucleofection of CRISPR plasmid into E. tenella laboratory strain APU-2, GFP expression was
monitored in transiently transfected sporozoites to determine the transfection efficiency (Fig.
5.2). In vitro, fluorescent sporozoites, trophozoites, and schizonts were observed after addition
of transfected E. tenella with either control or ∆EtMIF to PCKCs, followed by cultivation for 24,
48, and 72 hr. The regulatory sequences of actin were found to support the expression of
fluorescent protein, resulting in the localization of GFP mainly in the nucleus of parasites,
although GFP fluorescence was distributed in the cytosol of trophozoites after 48 hr incubation.
Moreover, MIF expression was examined by immunofluorescence assay. In contrast to the
transfected parasites with control plasmid, partial absence of EtMIF expression in the transgenic
parasites with ∆EtMIF was observed at all different stages of development.
MIF expression of stable transfected E. tenella
Stable transfection of E. tenella was conducted by cloacal inoculation of sporozoites,
combined with drug selection. Under the action of pyrimethamine, transgenic parasites were
obtained and confirmed as a positive population expressing EGFP (by fluorescence microscopy).
135
Transgenic oocysts (1.5×103) were harvested through drug selection, indicating that the function
of DHFR was activated together with EGFP under the control of the actin promoter without the
interference by T2A link. The GFP expression driven by actin promoter was strongly shown in
the intracellular region of sporulated oocysts, but only detected at the surface region of
unsporulated oocysts (Fig. 5.3A). Using the DNA extracted from transgenic oocysts, the
incorporation of foreign genes including EGFP, DHFR-TS, and Cas9 binding motif with sgMIF
into the genome of transgenic parasites was confirmed by PCR using gene-specific primers (Fig.
5.3B). Amplification of EGFP and DHFR yielded bands of 743 and 1870 bp, respectively, while
insertion of sgMIF scaffold resulted in a band of 118 bp. All amplicons were of the expected
size as amplified by ∆EtMIF plasmid, whereas no bands were detected in WT parasites. To
evaluate the disruption of MIF expression by CRISPR system, the molecular level of the target
MIF gene in the transgenic E. tenella was characterized using RNA and protein extracted from
transgenic parasites. First, the transcription level of MIF in the transgenic parasites was
measured by qRT-PCR (Fig. 5.3C). MIF expression in the control parasites was similar to that
in the WT parasites, while diminished expression was shown in the ∆EtMIF parasites compared
to that in both WT and control parasites, although not statistically significant. Second, relative
protein level was examined using protein extracts from transgenic parasites by Western blotting
(Fig. 5.3D). In a blot, two bands corresponding to the monomer and trimer forms of EtMIF (12
and 40 kDa) were exhibited in both WT and control, while only a monomer was shown in
∆EtMIF parasites. Although no significant difference was shown in the expression level of the
monomer MIF between control and ∆EtMIF, trimer MIF was absent in ∆EtMIF, in contrast to
that in the WT and control parasites.
136
The influence of MIF knockout E. tenella on PBMCs
To examine whether MIF deficiency impacts host immune defense during Eimeria infection,
obtained transgenic sporozoites were applied to chicken primary cells, PCKCs and PBMCs. The
percentage of PCKCs expressing EtMIF was reduced to 22 and 31% when inoculated with
∆EtMIF parasites compared to the percentage of that after inoculation with WT or control
parasites, respectively. Also, 26 and 36% reduction of PMBCs expressing EtMIF were observed
following infection with ∆EtMIF parasites than following inoculation with WT or control
parasites, respectively (Fig. 5.4A). MIF disruption was substantiated by qRT-PCR analysis
using total RNA extracted from infected cells with stable transgenic parasites. mRNA level of
EtMIF was significantly reduced by 18-fold and 13-fold following infection with ∆EtMIF
parasites compared to that after infection with WT and control parasites, respectively (Fig. 5.4B).
In parallel, the percentage of live cells following inoculation with ∆EtMIF parasites was
calculated relative to those inoculated with control parasites (Fig. 5.5). Following 24 hr
incubation with ∆EtMIF parasites, the percentage of live cells was enhanced by 14% than after
incubation with control parasites. Enhancement of cell viability is likely to be exhibited in MIF-
deficient E. tenella as opposed to the control parasites.
Discussion
Eimeria parasites express MIF homologue predominantly secreted following infection,
having similar sequence and structure as well as functional homology compared to chicken MIF
(Miska et al., 2013). Moreover, Eimeria MIF was found to share the host (chicken) MIF
receptors (Kim et al., 2014), suggesting Eimeria MIF may be capable of interfering with host
MIF activity through a competitive receptor binding and modulating or restricting host immune
137
system for establishing efficient infection. However, the biological role of Eimeria MIF was
only characterized using recombinant MIF in vitro, therefore the precise contribution of MIF to
the parasite infection still needs to be clearly delineated. Given the fact that MIF was abundantly
secreted in the invasive merozoites and capable of accessing host surface receptors and then
mimicking the biological roles of host MIF, we hypothesized that genetic deletion of MIF in
Eimeria would influence the parasite’s ability to evade the host immune defense and promote
infection. To determine the role of MIF homologue during Eimeria infection, we generated
Eimeria MIF knockout strains (∆EtMIF parasites) using a stable transfection system together
with a CRISPR technique. To minimize the potential off-target effect by CRISPR-mediated
mutation, the designed sgMIF sequences were examined by BLAST search that confirmed the
target MIF sequence is not homologous to other gene sequences within the E. tenella genome.
In apicomplexan parasites, regulatory sequences influence the expression level and final
destination of transgenes within the cellular compartments; therefore, it is important to choose a
suitable promoter for optimizing expression of foreign genes in parasites. Previously, both
regulatory genes of actin and histone 4 have shown to be strong promoters for transfection of E.
tenella, of which the actin promoter exerted constant expression of fluorescent protein
throughout all stages of parasite development (Yan et al., 2009; Yin et al., 2011). Such
compelling evidence led us to use both promoter genes leading expression cassette. Similar to
previous findings, the fluorescence signal was directed in the endogenous stages of transfected E.
tenella including sporozoite, trophozoite, and schizont by the regulatory sequences of actin
derived from E. tenella. As in the stable transgenic populations, the fluorescence was strongly
detected in sporulated but significantly less intense on the surface of unsporulated oocysts,
similar to the function of SAG13 limiting the expression of transgenes in specific stages (Tang et
138
al., 2016). Those results indicate that the expression pattern of transgenes is likely to be changed
through in vivo passage.
In addition, EGFP protein was expressed primarily in the nucleus of transfected sporozoites
under the control of actin promoter with NLS at the N-terminus of the EGFP (Liu et al., 2008),
as evidenced by the observation of fluorescence concentrated on the nucleus of parasites.
Separate expression of multiple transgenes was facilitated in a single construct through a short
2A peptide coding sequence from Thosea asigna virus (T2A) (Daniels et al., 2014; Tang et al.,
2016). By inclusion of the T2A peptide between EGFP and DHFR, we were able to achieve a
transgenic parasite capable of expressing a fluorescent protein as well as surviving exposure to a
pyrimethamine. Although considerably less numbers of transgenic oocysts were obtained from
fecal and cecal contents of infected birds with transgenic parasites than that from birds
inoculated with WT parasites due to the drug application over in vivo passage, no difference in
oocyst shedding was shown between birds infected with ∆EtMIF and control parasites.
Although we did not verify it here, the interference of its growth through genetic damage or low
number of passage could be a possible reason for the small number of transgenic oocysts, as
previously shown in Plasmodium strains (Miller et al., 2012). To confirm this aspect, further
studies are needed to determine whether the absence of MIF gene expression influences the
growth and endogenous development of parasites.
Eimeria MIF was not completely disrupted in E. tenella strain by the CRISPR system
introduced by stable transfection. Instead, MIF expression was reduced in ∆EtMIF parasites
compared to controls at the mRNA and protein levels. Although the expression level of
monomer MIF in ∆EtMIF parasites was not significantly lower compared to that of control
parasites, the expression of trimer MIF was completely interrupted among monomer and trimer
139
forms of MIF expressed in oocysts. Mammalian MIF is normally found as a homomeric trimer.
Consistent with the occurrence of oligomerization of MIF in both vertebrates and invertebrates
(Miska et al., 2007), trimeric form was detected in the lysates of WT as well as control oocysts,
but not in that of ∆EtMIF parasites. Taken together, the altered MIF expression at the molecular
level indicates a partial gene disruption occurred at the ∆EtMIF parasites by this CRISPR
system, and this partial disruption may be derived from mixture of transfected and non-
transfected parasites due to a low number of in vivo passages.
Several studies have demonstrated the potential capabilities that parasite MIFs contribute to
the pathogen persistence by dampening the host immune response using MIF-knockout parasites.
Plasmodium MIF was capable of regressing the adaptive immune response by production of
inflammatory cytokines and interfering in long-term protection by memory CD4+ T cells,
thereby facilitating parasites to evade immunological destruction against malaria (Sun et al.,
2012). MIF homologue in T. gondii triggered the recruitment of immature immune cells to the
site of infection through induction of IL-8 production by host immune cells, facilitating parasite
dissemination (Sommerville et al., 2013). In addition, disruption of Leishmania MIF enhanced
susceptibility to destruction by activated macrophages, showing the role of Leishmania MIF in
preventing parasite clearance by the host (Holowka et al., 2016). Given previous findings, it is
speculated that MIF may play an important role in creating a favorable environment for parasite
survival and dissemination. To explore this possibility, further in vitro assays were performed
using the primary chicken kidney cells (PCKCs) as they are considered the most suitable cells to
support the propagation and development of E. tenella. Consistent with previous observations, a
decrease in MIF expression from parasites contributed to host cell survival, implying a potential
role of MIF in host cell death during infection and enabling the parasites to propagate away from
140
the host immune system. However, further research needs to be designed in order to define the
precise mechanisms of a secreted parasite MIF upon infection and uncover how they influence
the death of infected cells.
Herein, we applied the CRISPR/cas9 system into E. tenella to disrupt the specific gene
associated with Eimeria infection, EtMIF. By stable transfection with the CRISPR plasmid
targeting EtMIF, MIF expression was partially disrupted from transgenic E. tenella by which the
involvement of MIF in the dissemination of infection was identified. The present study suggests
the possible use of CRISPR system in Eimeria species as well as the potential of parasite MIF as
a therapeutic target in coccidial diseases.
141
References
Abe, R., T. Peng, J. Sailors, R. Bucala and C. N. Metz. (2001). Regulation of the CTL response
by macrophage migration inhibitory factor. J Immunol. 166, 747-753.
Bera, A.K., D. Bhattacharya, D. Pan, A. Dhara, S. Kumar and S.K. Das. (2010). Evaluation of
economic losses due to coccidiosis in poultry industry in India. Agr Econ Res Rev. 23, 91-96.
Bloom, B. R. and B. Bennett. (1966). Mechanism of a reaction in vitro associated with delayed-
type hypersensitivity. Science 153, 80-82.
Calandra, T. and T. Roger. (2003). Macrophage migration inhibitory factor: a regulator of innate
immunity. Nat Rev Immunol. 3, 791-800.
Chapman, H. D. (1997). Biochemical, genetic and applied aspects of drug resistance in Eimeria
parasites of the fowl. Avian Pathol. 26, 221-244.
Chapman, H. D., T. E. Cherry, H. D. Danforth, G. Richards, M. W. Shirley and R. B. Williams.
(2002). Sustainable coccidiosis control in poultry production: the role of live vaccines. Int J
Parasitol. 32, 617-629.
Chapman, H. D. (2014). Milestones in avian coccidiosis research: a review. Poult Sci. 93, 501-
511.
Clark, J. D., K. Billington, J. M. Bumstead, R. D. Oakes, P. E. Soon, P. Sopp, F. M. Tomley and
D. P. Blake. (2008). A toolbox facilitating stable transfection of Eimeria species. Mol Biochem
Parasitol. 162, 77-86.
Clark, J. D., R. D. Oakes, K. Redhead, C. F. Crouch, M. J. Francis, F. M. Tomley and D. P.
Blake. (2012). Eimeria species parasites as novel vaccine delivery vectors: anti-Campylobacter
jejuni protective immunity induced by Eimeria tenella-delivered CjaA. Vaccine 30, 2683-2688.
Cong, L., F. A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P. D. Hsu, X. Wu, W. Jiang, L. A.
Marraffini and F. Zhang. (2013). Multiplex genome engineering using CRISPR/Cas systems.
Science 339, 819-823.
Dalloul, R. A. and H. S. Lillehoj. (2006). Poultry coccidiosis: recent advancements in control
measures and vaccine development. Expert Rev Vaccines 5, 143-163.
Daniels, R. W., A. J. Rossano, G. T. Macleod and B. Ganetzky. (2014). Expression of multiple
transgenes from a single construct using viral 2A peptides in Drosophila. PLoS One 9, e100637.
David, J. R. (1966). Delayed hypersensitivity in vitro: its mediation by cell-free substances
formed by lymphoid cell-antigen interaction. Proc Natl Acad Sci USA 56, 72-77.
Donald, R. G. and D. S. Roos. (1993). Stable molecular transformation of Toxoplasma gondii: a
selectable dihydrofolate reductase-thymidylate synthase marker based on drug-resistance
mutations in malaria. Proc Natl Acad Sci USA 90, 11703-11707.
Fohl, L. M. and D. S. Roos. (2003). Fitness effects of DHFR-TS mutations associated with
pyrimethamine resistance in apicomplexan parasites. Mol Microbiol. 50, 1319-1327.
142
Holowka, T., T. M. Castilho, A. B. Garcia, T. Sun, D. McMahon-Pratt and R. Bucala. (2016).
Leishmania-encoded orthologs of macrophage migration inhibitory factor regulate host
immunity to promote parasite persistence. FASEB J. 30, 2249-2265.
Hong, Y. H., H. S. Lillehoj, S. H. Lee, R. A. Dalloul and E. P. Lillehoj. (2006). Analysis of
chicken cytokine and chemokine gene expression following Eimeria acervulina and Eimeria
tenella infections. Vet Immunol Immunopathol. 114, 209-223.
Kim, S., C. M. Cox, M. C. Jenkins, R. H. Fetterer, K. B. Miska and R. A. Dalloul. (2014). Both
host and parasite MIF molecules bind to chicken macrophages via CD74 surface receptor. Dev
Comp Immunol. 47, 319-326.
Kleemann, R., A. Kapurniotu, R. W. Frank, A. Gessner, R. Mischke, O. Flieger, S. Juttner, H.
Brunner and J. Bernhagen. (1998). Disulfide analysis reveals a role for macrophage migration
inhibitory factor (MIF) as thiol-protein oxidoreductase. J Mol Biol. 280, 85-102.
Li, Z., X. Tang, J. Suo, M. Qin, G. Yin, X. Liu and X. Suo. (2015). Transgenic Eimeria mitis
expressing chicken interleukin 2 stimulated higher cellular immune response in chickens
compared with the wild-type parasites. Front Microbiol. 6, 533.
Liu, X., T. Shi, H. Ren, H. Su, W. Yan and X. Suo. (2008). Restriction enzyme-mediated
transfection improved transfection efficiency in vitro in Apicomplexan parasite Eimeria tenella.
Mol Biochem Parasitol. 161. 72-75.
Liu, Y., J. Zheng, J. Li, P. Gong and X. Zhang. (2013). Protective immunity induced by a DNA
vaccine encoding Eimeria tenella rhomboid against homologous challenge. Parasitol Res. 112,
251-257.
Livak, K. J. and T. D. Schmittgen. (2001). Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402-408.
Miller, J. L., A. Harupa, S. H. Kappe and S. A. Mikolajczak. (2012). Plasmodium yoelii
macrophage migration inhibitory factor is necessary for efficient liver-stage development. Infect
Immun. 80, 1399-1407.
Miska, K. B., R. H. Fetterer, H. S. Lillehoj, M. C. Jenkins, P. C. Allen and S. B. Harper. (2007).
Characterisation of macrophage migration inhibitory factor from Eimeria species infectious to
chickens. Mol Biochem Parasitol. 151, 173-183.
Miska, K. B., S. Kim, R. H. Fetterer, R. A. Dalloul and M. C. Jenkins. (2013). Macrophage
migration inhibitory factor (MIF) of the protozoan parasite Eimeria influences the components of
the immune system of its host, the chicken. Parasitol Res. 112, 1935-1944.
Mohammed, B. R. and O. S. Sunday. (2015). An overview of the prevalence of avian coccidiosis
in poultry production and its economic importance in Nigeria. Vet Res Intl. 3, 35-45
Peek, H. W. and W. J. Landman. (2011). Coccidiosis in poultry: anticoccidial products, vaccines
and other prevention strategies. Vet Q. 31, 143-161.
Roger, T., J. David, M. P. Glauser and T. Calandra. (2001). MIF regulates innate immune
responses through modulation of Toll-like receptor 4. Nature 414, 920-924.
143
Rosengren, E., R. Bucala, P. Aman, L. Jacobsson, G. Odh, C. N. Metz and H. Rorsman. (1996).
The immunoregulatory mediator macrophage migration inhibitory factor (MIF) catalyzes a
tautomerization reaction. Mol Med. 2, 143-149.
Rosengren, E., P. Aman, S. Thelin, C. Hansson, S. Ahlfors, P. Bjork, L. Jacobsson and H.
Rorsman. (1997). The macrophage migration inhibitory factor MIF is a phenylpyruvate
tautomerase. FEBS Lett. 417, 85-88.
Shen, B., K. M. Brown, T. D. Lee and L. D. Sibley. (2014). Efficient gene disruption in diverse
strains of Toxoplasma gondii using CRISPR/CAS9. MBio. 5, e01114-01114.
Shi, T. Y., X. Y. Liu, L. L. Hao, J. D. Li, A. N. Gh, M. H. Abdille and X. Suo. (2008).
Transfected Eimeria tenella could complete its endogenous development in vitro. J Parasitol. 94,
978-980.
Sidik, S. M., C. G. Hackett, F. Tran, N. J. Westwood and S. Lourido. (2014). Efficient genome
engineering of Toxoplasma gondii using CRISPR/Cas9. PLoS One 9, e100450.
Sommerville, C., J. M. Richardson, R. A. Williams, J. C. Mottram, C. W. Roberts, J. Alexander
and F. L. Henriquez. (2013). Biochemical and immunological characterization of Toxoplasma
gondii macrophage migration inhibitory factor. J Biol Chem. 288, 12733-12741.
Sun, T., T. Holowka, Y. Song, S. Zierow, L. Leng, Y. Chen, H. Xiong, J. Griffith, M. Nouraie, P.
E. Thuma, E. Lolis, C. J. Janse, V. R. Gordeuk, K. Augustijn and R. Bucala. (2012). A
Plasmodium-encoded cytokine suppresses T-cell immunity during malaria. Proc Natl Acad Sci
USA 109, E2117-2126.
Tang, X., X. Liu, G. Tao, M. Qin, G. Yin, J. Suo and X. Suo. (2016). ""Self-cleaving" 2A
peptide from porcine teschovirus-1 mediates cleavage of dual fluorescent proteins in transgenic
Eimeria tenella. Vet Res. 47, 68.
Tang, X., X. Liu, G. Yin, J. Suo, G. Tao, S. Zhang and X. Suo. (2017). A novel vaccine delivery
model of the apicomplexan Eimeria tenella expressing Eimeria maxima antigen protects
chickens against infection of the two parasites. Front Immunol. 8, 1982.
Tillmann, S., J. Bernhagen and H. Noels. (2013). Arrest functions of the MIF ligand/receptor
axes in atherogenesis. Front Immunol. 4, 115.
Weber, C., S. Kraemer, M. Drechsler, H. Lue, R. R. Koenen, A. Kapurniotu, A. Zernecke and J.
Bernhagen. (2008). Structural determinants of MIF functions in CXCR2-mediated inflammatory
and atherogenic leukocyte recruitment. Proc Natl Acad Sci USA 105, 16278-16283.
Yan, M., S. R. Zhou and H. W. Xue. (2014). CRISPR Primer Designer: Design primers for
knockout and chromosome imaging CRISPR-Cas system. J Integr Plant Biol.
Yan, W., X. Liu, T. Shi, L. Hao, F. M. Tomley and X. Suo. (2009). Stable transfection of
Eimeria tenella: constitutive expression of the YFP-YFP molecule throughout the life cycle. Int J
Parasitol. 39, 109-117.
Yin, G., X. Liu, J. Zou, X. Huang and X. Suo. (2011). Co-expression of reporter genes in the
widespread pathogen Eimeria tenella using a double-cassette expression vector strategy. Int J
Parasitol. 41, 813-816.
144
Table 5.1. Primers used for CRISPR plasmid construction and PCR analysis.
Primer name Sequence (5’→3’) Application
Act_5U_F TTCGTTTTCTCAAATGCAATTGCCGTCACTACATCG Cloning
Act_5U_R ATCATCACCTGCAACTCCAGCCTTCACATTTCCG
Act_3U_F GTTTGCAGCAGAGTAGTTCATGACTTGCG
Act_3U_R CTTCACATGGAACCCCTGGGAGCGCCCAGATA
H4_F AAACGAACGAGCTCGTAGCTGTAGTCCCCG
H4_R GATACCCTGGATGTTGTCGCGCAACACCTT
T2A_F GAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCG
T2A_R TGGGCCAGGATTCTCCTCGACGTCACCGCATGTTAGC
Act_5U_AscI_XhoI_F GCTCTCGAGGGCGCGCCTTCGTTTTCTCAAATGCAATTGCC
Act_5U_NsiI_R GCCATGCATATCATCACCTGCAACTCCAGCCTTCACAT
Act_3U_dhfr_F TAGTTAATTAGTTTGCAGCAGAGTAGTTCATGACTTGCGAAACGGCC
Act_3U_NotI_R AATGCGGCCGCCTTCACATGGAACCCCTGGGAGCGCCCAGATA
EGFP_BamHI_F AATGGATCCGTGAGCAAGGGCGAGGAGCTGTTCACC
EGFP_t2a_R AGCAGACTTCCTCTGCCCTCCTTGTACAGCTCGTCCATGC
DHFR_t2a_F TCGAGGAGAATCCTGGCCCAATGCAGAAACCGGTGTGTCTG
DHFR_act3_R GCTGCAAACTAATTAACTAGACAGCCATCTCCATCTGG
H4_NotI_F AATGCGGCCGCAAACGAACGAGCTCGTAGCTGTAGTCC
H4_SgMIF_R CTTGGGTGTTGCACACGATCGATACCCTGGATGTTGTCGCG
Cas9 bd_SgMIF_F GATCGTGTGCAACACCCAAGGTTTTAGAGCTAGAAATAGC
Cas9 bd_AscI_PciI_R GCTACATGTGGCGCGCCAAAAAAGCACCGACTCGGT
qRT-PCR
EtMIF_F TGCGATCCTGCAGCTAGTGT
EtMIF_R GTTGGTGCGGCTGCTGAT
Et18SrRNA_F GCGATGGATCATTCAAGTTTCTG
Et18SrRNA_R GCCACGGTAGGCCAATACC
ChGAPDH_F CCTAGGATACACAGAGGACCAGGTT
ChGAPDH_R GGTGGAGGAATGGCTGTCA
- 145 -
Figure 5.1. Schematic representation of ∆EtMIF plasmid (pAct-Cas9-H4-sgMIF) carrying
double expression cassettes, sgMIF scaffold, and Cas9-EGFP-DHFR. Cas9 flanked by NLS was
fused to selectable genes including EGFP linked to DHFR-TS with T2A, which was cloned
under the regulation of actin. sgRNA targeting Eimeria MIF (sgMIF) was inserted with Cas9
binding motif under the control of histone 4 promoter. sgMIF was designed to target the first
exon among three exons and two introns that organize the Eimeria MIF gene. The underlined
sequences of sgMIF was positioned upstream of the PAM, which is framed. These
characteristics correspond to the gene elements of the control plasmid (pAct-Cas9) except the
absence of sgMIF scaffold.
- 146 -
Figure 5.2. In vitro intracellular development of transiently transfected E. tenella in PCKCs.
Transfected E. tenella sporozoites with control (A) or ∆EtMIF (B) were inoculated in PCKC
culture and observed by fluorescence microscopy following 24, 48, and 72 hr incubation.
Transgenic parasites expressing fluorescent reporter protein (GFP, green) was monitored. At the
same time point, EMIF expression (red) was detected by immunofluorescence staining with anti-
EtMIF antibody, followed by anti-rabbit IgG-680. Fluorescent expression was mainly observed
in the nucleus of sporozoites (24 hr), trophozoites (48 hr), and schizonts (72 hr), of which GFP
expression was extended to the cytosol of trophozoites in control, while appearing to be confined
to the cytosol of trophozoites in ∆EtMIF at 48 hr. The yellow bar indicates 20 μm.
- 147 -
Figure 5.3. Generation of stable transgenic E. tenella expressing GFP and lacking MIF
expression. (A) Transgenic oocysts were obtained through cloacal inoculation with transfected
sporozoites within 6-10 dpi by pyrimethamine treatment. Collected oocysts were observed
before and after sporulation using a fluorescence microscope. (B) Incorporated DNA fragments
in transgenic population were amplified by PCR using genomic DNA extracted from transgenic
E. tenella. Lane 1, ∆EtMIF plasmid as the positive control; lane 2, genomic DNA (gDNA) from
WT parasites as the negative control; lanes 3 and 4, gDNA from control or ∆EtMIF parasites,
respectively. (C) Quantification of EtMIF expression in cDNA of transgenic or WT parasites
was evaluated using qRT-PCR. The experiment was set up in triplicate and data are
representative of two independent experiments. Error bars represent SEM. (D) EtMIF protein
expression was determined using protein extracts of transgenic or WT parasites by western blot
analysis using anti-EtMIF antibody, with anti-GAPDH antibody served as the loading control.
- 148 -
Figure 5.4. Examination of PCKCs following inoculation with transgenic E. tenella. (A) The
primary cells including PCKCs and PBMCs were incubated with WT or transgenic parasites
(control or ∆EtMIF) for 24 hr and analyzed by flow cytometry after staining with anti-EtMIF
antibody followed by anti-rabbit IgG-680 staining. (B) mRNA expression of EtMIF in infected
cells with WT or transgenic parasites was measured by qRT-PCR. The experiment was set up in
triplicate and data represent mean of two independent experiments obtained from both PCKCs
and PBMCs. Errors bars represent SEM.
- 149 -
Figure 5.5. Cell viability following inoculation with transgenic E. tenella. Obtained transgenic
parasites were inoculated into the PBMCs. Following 24 hr incubation, the effects of parasites
lacking EMIF expression on the viability of PBMCs were assessed by measuring the number of
live and dead cells using flow cytometry.
- 150 -
CHAPTER VI
Epilogue
Expression of MIF homologues, not only from T lymphocytes but also by invasive
merozoites stage of Eimeria parasites following infection, has implicated the significance of host
and parasite MIFs in the inflammatory and immune responses of avian species. In general, MIF
has been regarded as a highly conserved molecule among mammals. Consistent with this notion,
high sequence homology is exhibited between MIF homologues from two closely related
Galliformes species, chicken and turkey. Based on this finding, we speculated that the functional
conservation of MIF across avian species will be similar to that of mammals. To test our
hypothesis, full-length MIF was cloned from domesticated turkey spleen and its biological
function characterized. Comparing chicken and turkey MIFs, several functional similarities were
observed including inhibition of macrophage and lymphocyte migration as well as modulation of
other inflammatory mediators, suggesting a potential cross-reactivity among the two species.
Further, conserved structure and function of MIF across avian species implied an important role
of avian MIF in immune responses.
Identified biological activities of avian MIF have raised the question of which surface
receptors engage this cytokine to mediate its function. Previously, CD74 was firstly
demonstrated to interact with ChMIF at the surface of macrophages. Considering the
chemotactic role of avian MIF in the control of cell trafficking, we hypothesized that chemokine
receptor(s) may also interact with chicken MIF, similar to mammalian MIFs. As predicted, a
subsequent study revealed that ChMIF binds to CXCR4 and promoted substantial internalization
of CXCR4 on lymphocytes. In addition, co-localization of CXCR4 and CD74 was observed
- 151 -
after experimental overexpression of these receptors, indicating the formation of heteromeric
receptor complexes. Such CXCR4/CD74 receptor complexes were shown to be essential for
ChMIF-induced biological roles in regulating cell migration, calcium influx, and cell
proliferation. The combination of two MIF receptors resulted in synergistic effect on MIF-
mediated function. Most intriguingly, Eimeria MIF (EMIF) also binds to ChMIF receptors,
CXCR4 and CD74, thereby leading to similar biological effects to those of ChMIF. To this end,
we speculated that EMIF may engage and interact with ChMIF receptors to mask the binding site
for ChMIF and limit its defensive functions thus favoring parasitic infection. Also, these results
are consistent with previous findings where Plasmodium MIF modulated host immune response
by interfering with the host MIF activity through comparative binding with the mammalian MIF
receptor, CD74.
Given the fact that EMIF was detected primarily from excretory-secretory products of
parasites following infection, EMIF is thought to be excreted into the host environment in order
to effectively modulate the host immune responses to infection, resulting in Eimeria evading host
defenses. To determine the precise role that EMIFs play in the interaction between Eimeria
parasites and host immune cells, a mutant strain of E. tenella lacking MIF was generated by
stable transfection with the CRISPR/Cas9 plasmid DNA. After confirming the presence of
transfected genes in the genome of transgenic parasites, MIF disruption was evaluated in
transgenic Eimeria parasites as well as in cells inoculated with the transgenic parasites.
Although complete disruption of MIF did not occur, diminished level of MIF expression was
observed in the transgenic parasites as well as in infected cells, indicating partial disruption of
MIF. This could be caused by the small number of transgenic parasites through few in vivo
passages. Subsequently, macrophages were incubated with transfected sporozoites for 24 hr to
- 152 -
examine how EMIF may contribute to the evasion of parasites. By in vitro infection of primary
leukocytes with transgenic E. tenella, an increased percentage of macrophages/monocytes
population was shown after infection with E. tenella lacking MIF, supporting that reduction of
parasite MIF promoted the survival of host cells, an indication of a direct role of EMIF in the
pathogenicity of the parasites during coccidiosis.
In this project, highly conserved structure and function of avian MIF are well described,
implying the evolutionary significance of MIF in avian phylogeny. Ex vivo assays showed that
EMIF shares functional properties with ChMIF by having common receptors, CXCR4 or/and
CD74. In this regard, these abilities of parasite MIF would interfere or modulate host MIF
activity through competitive interaction with the host receptors, thus manipulating the host
immune responses and enabling the parasites to evade the host defense. Also, the pathogenic
activity of EMIF was observed in vivo. Based on previous findings that avian MIF is
constitutively expressed but not significantly induced by activated immune cells, while abundant
parasite MIF was detected in merozoite following infection, it would be reasonable to speculate
that the relatively high level of parasite MIF expression may exert a deleterious effect on the
host. In general, the pro-inflammatory effect of MIF can possibly be beneficial or detrimental to
the host, as it is capable of not only controlling pathogenic organism but also promoting tissue
damage through an increase of inflammation. Indeed, high expression of MIF triggers a Th1
response, which is essential to protective immunity against coccidiosis, but may induce excessive
inflammation therefore increasing disease severity. Taken together, this MIF project helps us
better understand the biological/cellular role and receptor-dependent mechanism of both avian
and parasite MIFs, further suggesting the potential of parasite MIF as a therapeutic target in the
inflammatory response following parasite infection.
- 153 -
Appendix A: Supplementary Data
Figure S4.1. Relative transcription of MIF receptor components during Eimeria infection.
mRNA expression level of putative MIF receptors (CD74, CD44, CXCR2, and CXCR4) in the
intestinal tract of Eimeria-infected chickens (Duo, duodenum; Jeju, jejunum; CT, cecal tonsil)
was measured by qRT-PCR. Neg and Pos indicate non-challenged control and Eimeria-
challenged group, respectively,
- 154 -
Figure S4.2. Endogenous expression of CXCR4 and CD74 in chicken cells. (A) CXCR4 and
CD74 expression was evaluated in primary chicken cells including PBMCs, heterophils,
splenocytes, and bursal cells by flow cytometry (A) and qRT-PCR analysis (B). (C) mRNA
expression of CXCR4 and CD74 was measured in chicken macrophage (HTC and HD11) and
fibroblast (DF-1) cell lines.
- 155 -
Appendix B
Identification and functional characterization of the house finch interleukin-1
Park M, Kim S, Leon AE, Adelman JS, Hawley DM, Dalloul RA.
Developmental & Comparative Immunology 69:41-50. 2017.
Identification and functional characterization of the house finchinterleukin-1b
Myeongseon Park a, Sungwon Kim a, b, James S. Adelman c, Ariel E. Leon d,Dana M. Hawley d, Rami A. Dalloul a, *
a Avian Immunobiology Laboratory, Department of Animal and Poultry Sciences, Virginia Tech, Blacksburg, VA 24061, USAb The Roslin Institute and R(D)SVS, University of Edinburgh, Easter Bush, Midlothian EH25 9RG, UKc Department of Natural Resource Ecology and Management, Iowa State University, Ames, IA 50011, USAd Department of Biological Sciences, Virginia Tech, Blacksburg, VA 24061, USA
a r t i c l e i n f o
Article history:Received 22 September 2016Received in revised form15 December 2016Accepted 15 December 2016Available online 18 December 2016
Keywords:IL-1bHouse finchCytokinesAcute phase proteinAvian
a b s t r a c t
Interleukin-1b (IL-1b), an inflammatory cytokine of the IL-1 family, is primarily produced as a precursorprotein by monocytes and macrophages, then matures and becomes activated through proteolyticcatalysis. Although the biological characteristics of avian IL-1b are well known, little information isavailable about its biological role in songbird species such as house finches that are vulnerable tonaturally-occurring inflammatory diseases. In this study, house finch IL-1b (HfIL-1b) was cloned,expressed, and its biological function examined. Both precursor and mature forms of HfIL-1b consistingof 269 and 162 amino acids, respectively, were amplified from total RNA of spleen and cloned intoexpression vectors. HfIL-1b showed high sequential and tertiary structural similarity to chicken homo-logue that allowed detection of the expressed mature recombinant HfIL-1b (rHfIL-1b) with anti-ChIL-1bantibody by immunoblot analysis. For further characterization, we used primary splenocytes and he-patocytes that are predominant sources of IL-1b upon stimulation, as well as suitable targets to stimu-lation by IL-1b. Isolated house finch splenocytes were stimulated with rHfIL-1b in the presence andabsence of concanavalin A (Con A), RNA was extracted and transcript levels of Th1/Th2 cytokines and achemokine were measured by qRT-PCR. The addition of rHfIL-1b induced significant enhancement of IL-2transcript, a Th1 cytokine, while transcription of IL-1b and the Th2 cytokine IL-10 was slightly enhancedby rHfIL-1b treatment. rHfIL-1b also led to elevated levels of the chemokine CXCL1 and nitric oxideproduction regardless of co-stimulation with Con A. In addition, the production of the acute phaseprotein serum amyloid A and the antimicrobial peptide LEAP2 was observed in HfIL-1b-stimulated he-patocytes. Taken together, these observations revealed the basic functions of HfIL-1b including thestimulatory effect on cell proliferation, production of Th1/Th2 cytokines and acute phase proteins byimmune cells, thus providing valuable insight into how HfIL-1b is involved in regulating inflammatoryresponse.
© 2016 Elsevier Ltd. All rights reserved.
1. Introduction
Interleukin-1beta (IL-1b) is the most studied prototypical pro-inflammatory cytokine because of its crucial role in the initiationof inflammation and regulation of innate and adaptive immuneresponses (Netea et al., 2015). IL-1b lacks a signal peptide and isprimarily expressed by activated macrophages, monocytes, and
dendritic cells as an inactive precursor form and remains in thecytosol, requiring proteolytic processing at its N-terminal region foroptimal bioactivity (Black et al., 1988; Thornberry et al., 1992; Arendet al., 2008). Subsequently, it is cleaved by either an intracellularcysteine protease caspase-1 activated by inflammasome(Thornberry et al., 1992; Martinon et al., 2002) or byinflammasome-independent enzymatic processes such asneutrophil-derived serine proteases and pathogen-released en-zymes (Netea et al., 2010). This cleaved IL-1b is secreted into theextracellular milieu, where it can induce its own transcription asmature and bioactive IL-1b. By binding to IL-1 type I receptor (IL-* Corresponding author.
E-mail address: [email protected] (R.A. Dalloul).
Contents lists available at ScienceDirect
Developmental and Comparative Immunology
journal homepage: www.elsevier .com/locate/dci
http://dx.doi.org/10.1016/j.dci.2016.12.0040145-305X/© 2016 Elsevier Ltd. All rights reserved.
Developmental and Comparative Immunology 69 (2017) 41e50
1R1), secreted IL-1b exerts its biological activities including T cellactivation, B cell proliferation, and antigen recognition along withthe induction of inflammatory genes, chemokines, and cell adhe-sion molecules (Burns et al., 2003; Dinarello, 2009). In mammals,IL-1b induces the development of Th17 cells in combination withIL-6 or TGF-b, while the production of IL-23 is IL-1b dependent inmonocytes which contributes tomaintenance of Th17 cells (Weaveret al., 2007; Dong, 2008; van de Veerdonk et al., 2009). IL-1b alsoinduces synthesis of cyclooxygenase type 2 (COX-2), type 2 phos-pholipase A, and inducible nitric oxide synthase (iNOS), leading tothe production of prostaglandin-E2 (PGE2), platelet activating fac-tor (PAF), and nitric oxide (NO) that causes fever, lower painthreshold, vasodilatation, and hypotension (Dinarello, 2009).Additionally, IL-1b is responsible for triggering the synthesis of theacute phase protein serum amyloid A (SAA), IL-6, neutrophil-se-lective CXC chemokines, and macrophage inflammatory protein-2(McColl et al., 2007). An abnormal increase of IL-1b secretion isassociated with the pathogenesis of auto-inflammatory diseasessuch as cryopyrin-associated periodic syndromes, which is relatedto an over-activation of caspase-1 (Campbell et al., 2016).
In avian species, chicken IL-1b (ChIL-1b) was first identified andcloned from the chicken macrophage cell line HD11 stimulatedwith LPS (Weining et al., 1998). ChIL-1b has a similar gene structureto mammalian homologues (Giansanti et al., 2006) with 34% and33% amino acid identity with the respective human and mouseorthologs; however, it lacks a conserved aspartic acid residue thuspreventing the caspase-1 cleavage. Nonetheless, N-terminallytruncated ChIL-1b lacking the predicted pro-domain exhibitssignificantly enhanced biological activity suggesting that precursorcleavage is critical for its maximal activity (Gyorfy et al., 2003).Another phylogenetically conserved aspartic acid residue was laterdiscovered by cleavage of avian proIL-1b with either sea bass orhuman caspase-1, which is distinct from the cleavage site ofmammalian homologues (Reis et al., 2012). Consistent withmammalian homologues, ChIL-1b expression is significantlyenhanced following viral, bacterial, and protozoal infections. ChIL-1b mRNA expression was induced in the gut following Eimeriainfection (Laurent et al., 2001; Hong et al., 2006a,b), enhancedmRNA level was also observed in macrophages from turkeyssuffering from poult enteritis and mortality syndrome (PEMS), aswell as in bursal cells from IBDV-infected chickens (Heggen et al.,2000; Eldaghayes et al., 2006). Salmonella spp. led to up-regulation of IL-1b mRNA in chicken cell lines and heterophils(Iqbal et al., 2005; Kogut et al., 2005). Macrophages exposed toeither Escherichia coli or Mycoplasma synoviae increased IL-1btranscription (Lavric et al., 2008). These reports further highlightthe important role of IL-1b in controlling the pathogenesis of manydiseases.
The properties of IL-1b have been well studied in domesticpoultry but not in wild birds, which are in close contact withdomesticated animals and may act as natural reservoirs for manyzoonotic pathogens. The house finch, Haemorhous mexicanus, is asmall passerine songbird that originally inhabited western NorthAmerica and later expanded to the eastern U.S. (Hill, 1993). Housefinches are relatively easy to capture and examine in captivitymaking them ideal organisms for studying the ecology of wildlifediseases, and they favored over domesticated birds to study the co-evolutionary relationship between host and pathogen duringemergence of other diseases (Hurtado, 2012). Most recently, dif-ferential mRNA expression of IL-1b across populations followingexperimental Mycoplasma gallisepticum (MG) infection was docu-mented (Adelman et al., 2013). However, the biological role of IL-1bin wild house finches still needs to be elucidated. To clarify thismatter, we first cloned the precursor and mature forms of housefinch IL-1b (HfIL-1b), then investigated its basic function by
measuring immune cell proliferation and differential mRNAexpression of Th1/Th2 response elements, acute phase protein andantimicrobial peptide by activated immune cells.
2. Materials and methods
2.1. Birds and tissue collection
House finches were captured in either July of 2012 or JuneeJulyof 2015 using cage traps and mist nets in Montgomery County, VAunder permits from VDGIF (044569/2012 and 050352/2015) andUSFWS (MB158404-1). All finches were housed at constant daylength and temperature, and were fed an ad libitum pelleted dietprior to and throughout experiments (Daily Maintenance Diet,Roudybush Inc. Woodland, CA). Following capture, adult in-dividuals from both sexes were identified based on their plumagecharacteristics and tested for the exposure to the pathogen asdescribed in Park et al. (Data in Brief, submitted). After testing, onlyhealthy birds that showed no clinical signs of disease and had nopathogen load (Grodio et al., 2008) were randomly selected for thesubsequent experiments. All tissue samples, including brain, heart,liver, small intestines (duodenum, jejunum, ileum), spleen, thymus,bursa, lung, proventriculus and gizzard were collected from twoindividuals to assess HfIL-1b tissue distribution. Additionally, theprimary cells were isolated from spleens and livers of 10 randomlyselected birds for further biological experiments.
2.2. Sequence and structural analyses
Nucleotide and amino acid sequences of HfIL-1b were alignedwith other orthologous sequences obtained by BLAST search usingClustal Omega (Sievers and Higgins, 2014). The phylogenetic treewas constructed from the alignment using the neighbor joining (NJ)method within the MEGA4 program, with Poisson correction andcomplete deletion of gaps (Tamura et al., 2007). The stability of thebranching order was confirmed by performing 1000 bootstrapreplicates. The theoretical molecular weight (MW) and isoelectricpoint (pI) were estimated using a Compute pI/MW tool fromExPASy (http://www.expasy.org). The three-dimensional structureof HfIL-1bwas built by comparative modeling at the Robetta server(http://robetta.bakerlab.org) (Kim et al., 2004). The model wassuperimposed with the X-ray structure of ChIL-1b using DiscoveryStudio 2.0 (Accelrys Inc., CA) and PyMOL (DeLano Scientific, CA).
2.3. Construction of recombinant HfIL-1b (rHfIL-1b) expressionplasmid
Both precursor and mature forms of HfIL-1b genes wereamplified from total RNA extracted from house finch spleen usingthe primers designed based on partial genomic sequences of housefinch (provided by D. Hawley) (Table 1). Using 1 mg of total RNA, thefirst-strand cDNAwas synthesized using iScript cDNA Synthesis Kit(Bio-Rad, CA). The full-length HfIL-1b was amplified using thefollowing conditions: initial denaturation at 92 �C for 2 min, 35cycles of denaturation at 92 �C for 15 s, annealing at 54 �C for 15 sand extension at 72 �C for 30 s, with a final extension at 72 �C for7 min. Synthesized precursor and mature forms of HfIL-1b weredirectly inserted into pCR2.1-TOPO vector (Invitrogen, CA) andtransformed into E. coli TOP10 (Invitrogen). Transformants con-taining recombinant plasmid were selected by a combination ofPCR screening and endonuclease digestion with EcoR I (New En-gland Biolabs, MA), and confirmed by sequencing (BiocomplexityInstitute at Virginia Tech, VA). For sub-cloning into a prokaryotic oreukaryotic expression vector, mature and precursor forms of HfIL-1b were digested with endonucleases Bgl II and Xma I (New
M. Park et al. / Developmental and Comparative Immunology 69 (2017) 41e5042
England Biolabs) and ligated into pQE-30 (Novagen, CA) andpcDNA3.1 (Invitrogen), respectively. By colony PCR screening,positive clones including HfIL-1b were selected and verified bysequencing.
2.4. Expression of rHfIL-1b and immunoblot analysis
HfIL-1b in pQE30 plasmid was introduced into E. coli BL21 (NewEngland Biolabs) and cultured at 30 �C overnight. The expression ofHfIL-1b was induced by adding 1 mM IPTG (Gold Biotechnology,MO) and shaking incubation for 5 h at 25 �C. The cells were har-vested by centrifugation and resuspended with 50 mM Tris (pH7.5), 240 mM NaCl and 1 mg/ml lysozyme buffer. After cell lysis bysonication, soluble fraction containing HfIL-1b was collected bycentrifugation, followed by purification using Niþ-resin (Bioline,MA). After endotoxin removal using the ProteoSpin EndotoxinRemoval Micro Kit (Norgenbiotek, ON, Canada), the purified rHfIL-1b was quantified using BCA protein assay and used in subsequentassays. To examine the binding reactivity of anti-ChIL-1b antibody,1 mg of the purified rHfIL-1b, and rChIL-1b (Bio-Rad) as a positivecontrol were loaded on SDS-PAGE gel under reducing conditionsand transferred to PVDF membrane (Millipore, MA). The blot wasincubated with anti-polyhistidine conjugated with HRP (Sigma,MO) or anti-ChIL-1b polyclonal antibody (Thermo Scientific, MA) ina 1: 1000 dilution as the primary antibody and goat anti-rabbit IgGconjugated with HRP (Santa Cruz Biotechnology, CA) in a 1: 2000dilution as the secondary antibody. After washing, the blot wasincubated with the SuperSignal West Pico chemiluminescentSubstrate (Pierce, IL), and developed using a gel imaging system(Bio-Rad).
2.5. HfIL-1b expression analysis in tissue
The expression of HfIL-1b in house finch tissues was determinedby qRT-PCR and immunoblotting. In order to investigate HfIL-1bmRNA expression, various tissues were collected from two healthyhouse finches including brain, heart, liver, spleen, thymus, bursa,lung, proventriculus, gizzard and each small intestinal section. TotalRNAwas extracted using RNeasy Mini Kit (Qiagen, CA), followed bysynthesis of the first-strand cDNA using High-Capacity cDNAReverse Transcription Kit (Applied Biosystems, CA). SynthesizedcDNAwas mixed with 5 ml of Fast SYBR Green Master Mix (Applied
Biosystems) and 0.1 mM primers in 10 ml final volume of qRT-PCRreaction. The following thermal cycling conditions were used:95 �C for 20 s as initial denaturation, followed by 40 cycles ofdenaturation at 95 �C for 3 s, and annealing/extension at 57 �C for30 s. Transcription of HfIL-1b was normalized against the expres-sion of GAPDH, followed by calibration using brain transcript leveland 2�DDCT method (Livak and Schmittgen, 2001). To examine HfIL-1b protein expression level, 50 mg of tissues were collected fromsame birds that we used for RNA extractionwere homogenized andsonicated in RIPA buffer (Cayman Chemical, MI) supplementedwith protease inhibitor cocktail (Sigma) and phosphatase inhibitors(1 mM NaF and 1 mM Na3Vo4). After centrifugation at 10,000 � gfor 30 min, the supernatant was collected and protein concentra-tion determined using BCA assay (Thermo Scientific), then a 20 mgprotein extract was resolved on SDS-PAGE gel under reducingconditions and analyzed by immunoblotting with anti-ChIL-1bantibody as previously described. In parallel, anti-GAPDH antibody(1:4000; Millipore) was used as a reference for protein loading andfor quantification of relative protein expression.
2.6. Isolation of splenocytes and hepatocytes
To isolate splenocytes, house finch spleens were excised andpassed through a 0.22 mm cell strainer (BD, CA). Cell debris waswashed out of cell suspension with Hank's Salt Solution (HBSS;HyClone, UT), which was overlaid onto Histopaque-1077 (Sigma).After centrifugation at 400 � g for 30 min, mononuclear cells fromthe interphase were collected and mixed with PBS. By centrifuga-tion, cells were collected and washed with RPMI-1640 (Mediatech,VA), and counted using a hemocytometer. Freshly isolated sple-nocytes were resuspended with RPMI-1640 containing 20% fetalcalf serum (FCS; Atlanta Biologicals, GA) and 1% penicillin/strep-tomycin, and cultured in a 24-well plate at a cell density of1� 106 cells/well overnight at 39 �C with 5% CO2 humidified air. Forthe isolation of hepatocytes, the livers were excised and cut intosmall pieces. After washing with HBSS, the pieces were incubatedwith 0.25% trypsin in Dulbecco's Modified Eagle Medium (DMEM;Mediatech) for 18 h at 4 �C and then placed at 37 �C for 30 min. Thetissue pieces were passed through a 0.22 mm cell strainer and thecollected cells were washed with DMEM. After determining cellviability and concentration by a hemocytometer, the cells wereresuspended with DMEM supplemented with 10% FCS and 1%penicillin/streptomycin and seeded at 1 � 106 cells/well in a 24-well plate and then cultured overnight at 39 �C with 5% CO2 hu-midified air.
2.7. Cell proliferation assay
The role of HfIL-1b on cellular proliferation was investigatedwith either splenocytes or hepatocytes using CellTiter 96® Non-Radioactive Cell Proliferation Assay Kit (Promega, WI) accordingto manufacturer's protocol. Briefly, 2 � 105 cells were seeded in a96-well plate and incubatedwithmedium alone, rHfIL-1b (0.01 and0.1 mg/ml) with or without Con A in the presence and absence ofanti-ChIL-1b antibody at 39 �C with 5% CO2 for 12 h. Incubated cellswere treated with Dye Solution (15 ml) for 3 h at 39 �C with 5% CO2,followed by addition of Solubilization Solution/Stop Mix. After 1 hincubation at 39 �C, the absorbance was measured at 570 nm and630 nm using a microplate reader. The readings were corrected bysubtracting the background value at 630 nm.
2.8. Cytokine transcripts analysis upon cell stimulation
Isolated splenocytes (1 � 106 cells/well) were cultured in a 24-well plates and treated with medium alone, Con A (10 mg/ml),
Table 1Primers used for gene cloning and qRT-PCR analysis.
Primer name Nucleotide sequence (50/30) Application
pHfIL-1b_F AGATCTATGGCATTTGTCCCTGATTTGGAC Gene cloningmHfIL-1b_F AGATCTGCACCTGTTTTCCGCTACACTHfIL-1b_R CCCGGGTCAGCGCCCACTCAGCTCATA qRT-PCRIL-1b_FIL-1b_R
GGAGGAAGCTGACATCAGTGTCCAGGCGGTAAAAGATG
IFN-gamma_F CAAAGGACCATGTCAGGAACAIFN-gamma_R TGAGCCATCAGAAAGGTTTGCIL-2_F TCTTGACTTTTACACACCGAATGACIL-2_R TCCTCCTCTTCCACATCTTGTTTCIL-10_F AGCACCAGCGCAGCATGAIL-10_R TCATCGTGGCTCTCAGGTTCAiNOS_F TGCCACAAACAATGGTAATATAAGGiNOS_R TGTTCCACACACGGAAATCGCXCL1_F CTGCGAGATGGCAGAGAAGTGCXCL1_R GGCCTTGTCCAGAATTGTCTTGSAA_F TGGGTCTGCATCGCATTGSAA_R TGCATCCCGGACAAACTGTLEAP2_F ATGCACTGGTGGAAAGTGALEAP2_R GACACTCCTCTCCAGAAGGAPDH_F GGAGCGTGACCCCAGCAACAGAPDH_R CACACGCTTGGCACCACCCT
M. Park et al. / Developmental and Comparative Immunology 69 (2017) 41e50 43
rHfIL-1b (0.1 mg/ml), or rHfIL-1b (0.1 mg/ml) with Con A (10 mg/ml)for 6 and 12 h. Cell supernatants were collected for quantification ofNO production and total RNA was extracted from the treated cellsusing RNeasy Mini Kit (Qiagen). Extracted RNA (1 mg) was reversetranscribed into cDNA using High-Capacity cDNA reverse transcriptkit (Applied Biosystems). The transcript levels of Th1/Th2 cytokines(IFN-g, IL-1b, IL-2, IL-10), iNOS and a chemokine (CXCL1) weremeasured by qRT-PCR. The primers used for qRT-PCR analysis weredesigned within the conserved regions of the multiple sequencealignment of closely-related bird species including zebra finch,canary, and chicken. To measure hepatic gene expression by HfIL-1b treatment, isolated liver hepatic cells (1 � 105 cells/well) werecultured in 24-well plates, followed by treatment with mediumalone, Con A (10 mg/ml), rHfIL-1b (0.01 and 0.1 mg/ml) or rHfIL-1b(0.01 and 0.1 mg/ml) with Con A for 6 h. After incubation, the cellsupernatants were collected to measure NO production and totalRNAwas extracted as described earlier. ThemRNA levels of the SAA,LEAP2, and IL-1b were analyzed. With the collected cell superna-tants, NO production was measured using a Griess Reagent System(Promega).
2.9. Statistical analyses
All data were expressed as the means ± SEM and analyzed byStudent's t-test or one-way ANOVA using JMP software (Ver 11).Differences between groups assessed by Tukey Kramer multiplecomparison test were considered to be statistically significant atP < 0.05 (*), P < 0.01 (**), or P < 0.001 (***).
3. Results
3.1. Sequence analyses of HfIL-1b
The full-length HfIL-1b was predicted to encode a precursorform of 269 amino acids with a theoretical molecular weight of30 kDa and isoelectric point of 6.74. Multiple sequence alignment ofthe deduced amino acid sequence with other orthologs revealedthat the precursor form of HfIL-1b shares 76% and 94% similaritywith chicken and zebra finch, respectively, while it has 28% and 27%similarity with human and mouse, respectively. Sequence com-parison revealed that HfIL-1b lacks the conserved aspartic acid(Asp/D) as the IL-1b-converting enzyme (ICE) cut site, and itsmature form starts alanine at amino acid residue 108 producing a162 amino acid peptide with a predicted molecular weight of18 kDa and isoelectric point of 8.52. This mature form has 32% and34% similarity with the respective human and mouse sequences,and 84% and 97% similarity with the chicken and zebra finch,respectively. Phylogenetic analysis indicated that the IL-1b encod-ing region evolved into two distinct lineages among avian speciesand HfIL-1b being evolutionary closer to zebra finch and pigeon IL-1bs than to that of any domestic avian including chicken, turkey,duck, goose and quail (Fig. 1A). Computational analysis revealedthat HfIL-1b retains six cysteine residues, and Cys25 and Cys27 aswell as Cys187 and Cys241 are predicted to form disulfide bonds. Thecrystal structure of HfIL-1b revealed 15 b-strands and an a-helix.The house finch and chicken IL-1b (PDB entry, 2wry) structuresshare a very similar structural fold with a root mean square devi-ation (RMSD) of 0.53 Å (Fig. 1B). Based on high level of sequentialand structural identity between house finch and chicken IL-1b, wepredicted that cross-reactivity would exist based on the anti-ChIL-1b antibody used in further biological assays.
3.2. Immunoblot analysis of rHfIL-1b
For biological function characterization, rHfIL-1b with a
polyhistidine tag fused at the N-terminus was purified from E. coliBL21 as a soluble form. The endotoxin concentration was 0.07endotoxin units (EU) per mg protein, which was acceptable forfurther cellular assay. Prior to the initiation of the biological assays,purified rHfIL-1b was confirmed by immunoblot analysis usinganti-polyhistidine antibody as well as verified binding reactivity ofanti-ChIL-1b antibody made against rHfIL-1b. As shown in Fig. 2A,two bands were detected approximately 19 kDa, the predicted sizeof HfIL-1b containing polyhistidine tag (1.1 kDa) along with 25 kDausing anti-polyhistidine antibody under reducing conditions.Blotting with anti-ChIL-1b antibody resulted in a single 25 kDa ofrHfIL-1b, which is higher than the calculated size but identical tothat of rChIL-1b (positive control), which is the mature form con-taining a polyhistidine tag expressed from E. coli under the sameconditions (Fig. 2B).
3.3. Tissue distribution of HfIL-1b
The relative abundance of HfIL-1b in tissues was examined atthe mRNA and protein levels using qRT-PCR and immunoblotting,respectively. The mRNA expression of HfIL-1b was normalized totranscript of GAPDH as an endogenous reference gene and calcu-lated as a fold change relative to the lowest level of brain (arbitrarilyset at 1.0). HfIL-1b was expressed at varying levels in all testedtissues with the highest expression in the lung and proventriculusand the lowest level in the brain and heart (Fig. 3A). Since mRNAexpression does not necessarily predict protein expression, tissue-specific expression pattern of HfIL-1b proteins was determined byimmunoblotting using anti-ChIL-1b antibody (Fig. 3B). Prominentexpression of HfIL-1b protein was observed approximately 35 kDain the liver, bursa and gizzard, which is slightly higher molecularweight than the theoretical size of precursor HfIL-1b of 30 kDa.Also, less intense bands are shown in the lung and proventriculus;however, no such band was detected in the brain, which isconsistent with its lowest mRNA expression. In addition to the35 kDa band, a very weak 60 kDa band was observed in the gizzard(data not shown).
3.4. Effect of HfIL-1b on cell proliferation
The proliferative effects of the HfIL-1b on primary cells wereinvestigated, resulting in a small but statistically significant in-duction of splenocyte proliferation following treatment with0.01 mg/ml rHfIL-1b for 12 h (Fig. 4), although there was no sig-nificant difference after 24 h (data not shown). The enhancedsplenocyte proliferation was abolished when adding anti-ChIL-1bantibody thus neutralizing HfIL-1b; in contrast, control IgG had noeffect. However, co-stimulation of HfIL-1b with Con A had anegligible effect on splenocyte proliferation relative to Con A alone(data not shown). Contrary to splenocytes, there was no significantproliferation in HfIL-1b-stimulated hepatocytes.
3.5. Modulation of gene expression and nitric oxide production byHfIL-1b in splenocytes
The effect of HfIL-1b on Th1/Th2 cytokine expression wasevaluated in splenocytes stimulated with rHfIL-1b for 6 and 12 h(Fig. 5). The most pronounced induction of cytokine expressionwasshown at 12 h post-stimulation. Treatment with HfIL-1b aloneenhanced its own gene transcription by > 2 fold. Of the Th1 cyto-kines, IL-2 was remarkably increased approximately 383-fold byaddition of rHfIL-1b compared to Con A alone, while no significantdifference of IFN-g expression was observed. The addition of rHfIL-1b alone induced IL-10 production, a Th2 cytokine. rHfIL-1b also ledto elevated iNOS level (3-fold), irrespective of Con A stimulation.
M. Park et al. / Developmental and Comparative Immunology 69 (2017) 41e5044
Up-regulation of iNOS mRNA expression results in the productionof NO by splenocytes treated with 0.1 mg/ml rHfIL-1b both in theabsence and presence of Con A for 6 h (Fig. 6) and 12 h (data notshown). Transcription of chemokine CXCL1 was increased 10-foldand 18-fold in the presence and absence of Con A stimulation,respectively.
3.6. Expression of SAA, LEAP2, and IL-1b in hepatocytes
Induction of an acute phase protein (SAA) and an antimicrobialpeptide (LEAP2) in hepatocytes stimulated with HfIL-1b wasobserved (Fig. 7). HfIL-1b treatment induced transcripts of SAA andLEAP2 by incubation with 0.1 and 0.01 mg/ml rHfIL-1b, respectively,both in the presence and absence of Con A. The transcription of SAAwas enhanced 2.2-fold, which was further enhanced by 8.8-fold inthe presence of Con A. In contrast to the induction of IL-1b instimulated splenocytes, IL-1b transcription was not changed inhepatocytes. With induction of acute phase and antimicrobial re-sponses, significant production of NO by hepatocytes was observedwhen treated with 0.1 mg/ml rHfIL-1b both in the presence andabsence of Con A (Fig. 6).
4. Discussion
Although many reports described the potency of IL-1b in im-mune responses following viral, bacterial, and protozoal infections,little is known regarding the role of house finch IL-1b in the hostimmune system. In this study, we identified and cloned the full-length HfIL-1b from house finch spleen and demonstrated thebiological functions of its active form. Phylogenetic analysisrevealed the evolutionary relationships among avian IL-1bs whereHfIL-1b clustered with homologues of flying birds (zebra finch andpigeon), while separated from that of land-based birds (chicken,turkey, and quail) as well as waterfowl (duck and goose). Despiteconsiderable phylogenetic distance between house finch andchicken IL-1b in the avian clade the tertiary structure of HfIL-1bwashighly similar to that of ChIL-1b, with the b-strands and a-helixlocated in almost identical regions. Sequence analysis revealed thatHfIL-1b lacks the aspartic acid residue that is critical to form activeHfIL-1b as a result of proteolytic cleavage, but retains conservedalanine at position 108 that represents the initial residue forexpression of mature form similar to other avian IL-1bs (Wu et al.,2007). These high sequential and structural identities suggest thatHfIL-1b is likely cross-reactive with anti-ChIL-1b antibody as
Fig. 1. Phylogenetic and structural analysis of HfIL-1b. (A) A phylogenetic tree was constructed using multiple alignments with amino acid sequences encoded precursor form ofHfIL-1b within MEGA 4 program. The clades were validated by 1.000 bootstrap replications, which were represented by percentage in branch nodes. The scale bar represents agenetic distance of 0.2. (B) Ribbon diagram of HfIL-1b and the superimposed HfIL-1b and ChIL-1b. A ribbon diagram of the three-dimensional structure of HfIL-1b has shown (left).The a-helix and b-strands indicate as helix and arrows, respectively, and the N- and C- termini are labeled. The X-ray structure of HfIL-1b (yellow) is superimposed onto that of ChIL-1b (blue, right). (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
M. Park et al. / Developmental and Comparative Immunology 69 (2017) 41e50 45
substantiated by immunoblot analysis showing that chicken-specific antibody recognized HfIL-1b. Purified rHfIL-1b was detec-ted at higher molecular weight (25 kDa) than its theoretical value(19 kDa) which could be caused by unfolding in the presence of areducing agent. Such unfolding under reducing conditions would
be expected from the potential intra-chain disulfide bond formedbetween Cys187 and Cys241 that is likely to be predominantlydetected by anti-ChIL-1b antibody. Since precursor HfIL-1b con-tains two potential disulfide bonds, Cys25 and Cys27 as well asCys187 and Cys241, its molecular weight would be higher than
Fig. 2. Immunoblot analysis of purified rHfIL-1b. (A) rHfIL-1b expressed from E.coli BL21 was detected with polyhistidine antibody. (B) Immunoblot analysis of purified rHfIL-1bwasperformed using anti-ChIL-1b antibody, M, protein molecular weight marker (kDa); lane 1, ChIL-1b (1 mg) as a positive control; lane 2, purified rHfIL-1b (1 mg).
Fig. 3. Expression pattern of mRNA and protein of HfIL-1b in various tissues of clinically healthy house finches. (A) mRNA expression of HfIL-1b in the different tissues wasdetermined by qRT-PCR. Data was normalized to the expression level of GAPDH and represented as fold change relative to that of brain. Error bars indicate the SEM. (B) HfIL-1bprotein expression from various healthy house finch tissues was assessed by immunoblotting using anti-ChIL-1b antibody, with GAPDH used as a loading control. (Duo, duodenum;Jej, jejunum; Ile, ileum; Proven, proventriculus).
M. Park et al. / Developmental and Comparative Immunology 69 (2017) 41e5046
calculated under reducing conditions, as 35 kDa shown in Fig. 3.This possibility has been experimentally confirmed by detectingthe expected size of mature HfIL-1b (19 kDa) in the absence of areducing reagent (data not shown), which is consistent with earlierstudies reporting that disulfide bond of murine IL-1b resulted invarying gel mobility depending on the presence of a reducing re-agent (Gunther et al., 1991).
IL-1b is primarily produced by monocytes, macrophages, anddendritic cells as well as B lymphocytes and natural killer (NK) cellsin low amounts. Due to an instability element in the coding regionof IL-1b, mRNA would be poorly translated into protein (Bufleret al., 2004). The present study showed that HfIL-1b is expressedin a broad range of tissues, mainly in the digestive tract (proven-triculus, gizzard, duodenum, and ileum), immune tissues (liver,
Fig. 4. The effect of HfIL-1b on house finch cell proliferation in vitro. Splenocytes (2 � 105 cells/well) were incubated with medium alone, rHfIL-1b (0.01 and 0.1 mg/ml), rHfIL-1b(0.01 and 0.1 mg/ml) with anti-ChIL-1b antibody for 12 h (left). Corresponding proliferation assay was conducted on hepatocytes (right). Anti-ChIL-1b antibody alone was used as anegative control. Data represent the mean ± SEM of two independent experiments performed in triplicate and asterisks indicate statistically significant differences (p < 0.05).
Fig. 5. mRNA expression of Th1/Th2 cytokines and chemokine following stimulation of splenocytes with HfIL-1b. Splenocytes (1 � 106 cells/well) were stimulated with mediumalone, rHfIL-1b (0.1 mg/ml) alone, Con A (10 mg/ml) alone, Con A plus rHfIL-1b (0.1 mg/ml) for 6 and 12 h. The expression of Th1/Th2 cytokines and a chemokine was evaluated byqRT-PCR. Data are presented as the mean ± SEM of two independent experiments performed in triplicate. Asterisks indicate significant differences (*p < 0.05, **p < 0.01).
M. Park et al. / Developmental and Comparative Immunology 69 (2017) 41e50 47
bursa, and spleen) and respiratory (lung) tract. However, the levelsof IL-1b mRNA expression were not congruent with changes of itsprotein production similar to previous reports of human IL-1b(Schindler et al., 1990a). LPS rapidly increased IL-1b transcript for ashort timewhile the administration of IL-1b itself sustained its ownproduction long term (Schindler et al., 1990b). Although we did notmeasure its continuous production through 24 h, a small but sig-nificant induction of IL-1b transcript was observed in splenocytesstimulated with HfIL-1b alone at 12 h post-stimulation, but notwith Con A. These results are in accordance with a relatively short
half-life of IL-1bmRNA and a rate-limiting step in the processing ofIL-1b to prevent its continuous and overwhelming activationwhichwould result in deleterious effect on the host.
IL-1b is involved in a variety of cellular activities as both agrowth factor for B cell proliferation and stimulator for the gener-ation of Th17 cells which also co-stimulate T cell proliferation(Dinarello, 2009). Accordingly, we observed the effect of a lowconcentration of HfIL-1b (0.01 mg/ml) in promoting the prolifera-tion of splenocytes in vitro. Whereas TNF-a and IL-6 are importantfactors in the priming phase of liver regeneration, IL-1b is known to
Fig. 6. Nitric oxide release from HfIL-1b-stimulated splenocytes and hepatocytes. Splenocytes or hepatocytes (1 � 106 cells/well) were stimulated with medium alone, r HfIL-1b(0.01 and 0.1 mg/ml) alone, Con A (10 mg/ml) alone, Con A plus rHfIL-1b (0.01 and 0.1 mg/ml) for 6 h. The levels of NO were determined by Griess assay. Data are presented as themean ± SEM of two independent experiments performed in triplicate and statistically significant difference indicated by asterisks (p < 0.05).
Fig. 7. Production of acute phase protein and antimicrobial peptide by rHfIL-1b-stimulated hepatocytes. Hepatic cells (1 � 105 cells/well) were treated with medium alone, Con A(10 mg/ml) alone, rHfIL-1b (0.01 and 0.1 mg/ml) or rHfIL-1b (0.01 and 0.1 mg/ml) with Con A for 6 h. mRNA expression was measured with qRT-PCR and then values were normalizedto GAPDH and graphed relative to medium alone. Data are presented as the mean ± SEM of two independent experiments performed in triplicate and significant differencesindicated by asterisks (*p < 0.05, **p < 0.01, ***p < 0.001).
M. Park et al. / Developmental and Comparative Immunology 69 (2017) 41e5048
be a potent inhibitor of liver regeneration and hepatocyte prolif-eration (Sparna et al., 2010). In contrast to previous reports, we didnot observe significant changes with proliferation of hepatocytesafter culture with HfIL-1b. Further work is needed to elucidate theregulatory function of HfIL-1b in the proliferation and regenerationof hepatocytes which may reveal the role that IL-1b plays in thepathogenesis of acute inflammatory liver injuries.
Through high affinity interaction with cell surface receptor, IL-1b induces Th1 adaptive cellular responses and triggers the pro-duction of acute phase proteins as well as other pro-inflammatorycytokines (Dinarello, 1996, 1999; Chung et al., 2009). In the currentstudy, production of the Th1 cytokine IL-2 was elevated by HfIL-1btreatment in Con A-stimulated splenocytes indicating that it wouldstimulate T cell proliferation in conjunction with IL-2 release(Schultz, 1987). Previous studies have shown that IL-1b inhibits IL-10 production by memory T cells in vitro and in vivo while IL-10counter-regulates the action of IL-1b (Zielinski et al., 2012). Con-trary to previous findings, transcript of IL-10 was enhancedfollowing stimulation with HfIL-1b which may indirectly occur viaPGE2 production by IL-1b (Benbernou et al., 1997). This induction ofIL-10 transcript may consequently result in B cell proliferation andantibody production (Itoh and Hirohata, 1995). Enhancement ofiNOS was observed after HfIL-1b treatment both in the presenceand absence of Con A, which is also associated with PGE2 activation(Benbernou et al., 1997). Further, increased NO production wasaccompanied by the expression of iNOS mRNA. In accordance withprevious findings (Nogawa et al., 1998), NO produced by iNOS maynot only modulate the formation of PGE2, but also enhance COX-1activity thereby facilitating the development of fever as well asacting as a mediator of inflammation. These data are indicative ofthe molecular mechanisms that regulate the balance in theexpression of Th1 and Th2 cytokines providing the fundamentalaspects of the immune response of wild birds. Consistent withprevious findings where ChIL-1b stimulation induced the expres-sion of CXCL1 in a dose-dependent manner in the chicken fibroblastcell line CEC-32 (Weining et al., 1998), chemokine CXCL1 wasmarkedly upregulated regardless of Con A stimulationwhich is ableto attract neutrophils and lymphocytes thereby contributing toinflammatory processes (Batra et al., 2012).
The administration of HfIL-1b also augmented the production ofacute phase protein in hepatocytes, similar to previous reportsdemonstrating that IL-1b, IL-6, and TNF-a circulate to the liver andinduce an acute phase response which is a systemic inflammatoryreaction to disrupt the host's homeostasis (Gabay and Kushner,1999; Bresnahan and Tanumihardjo, 2014). Interestingly, theexpression of antimicrobial peptides (AMPs) is generally regulatedby inflammatory factors such as IL-1b, TNF-a and LPS (Bando et al.,2007). Of the AMPs, LEAP2 (liver expressed antimicrobial peptide-2) was initially described to be predominantly produced in the liverand inhibited bacteria and fungi in vitro (Krause et al., 2003). In ourstudy, LEAP2 was upregulated by HfIL-1b-stimulated hepatocytessuggesting that HfIL-1bmodulates the expression of LEAP2 directlyor indirectly thus perhaps controlling innate cellular immunity. Inaddition, our data corroborate previous findings demonstratingthat IL-1b is a major component of NO production by hepatocytes(Kitade et al., 1996).
In addition to the gene expression profiling of HfIL-1b-stimu-lated immune cells, the expression pattern of IL-1b in the serafollowing infection with MG is provided (Park et al. Data in Brief,submitted). Based on the previously reported data regarding up-regulation of IL-1b mRNA expression after MG infection, IL-1bproduction would be an expected pro-inflammatory response tothe pathogenesis of MG infection. However, IL-1bmRNA expressionlevels do not necessarily reflect the secretion of biologically activeprotein. The data (Fig. 1 in Park et al., submitted) revealed two
forms (35 and 60 kDa) of putative precursor IL-1bs in sera of controlbirds, while more intense bands (25 and 60 kDa), possibly repre-senting mature and dimeric precursor of IL-1bs, appeared in sera ofMG-infected birds. These results raise the question of how pre-cursor IL-1b is secreted in the blood. Although precursor IL-1b re-mains primarily cytosolic and its cleavage is an obligatory step torelease precursor IL-1b in the extracellular milieu, the precursor IL-1b can also be released into extracellular space independent ofprocessing by enzymes in the presence of some ICE inhibitors (Chinand Kostura, 1993). Given the elevated production of IL-1b as wellas secretion of its bioactive form after MG infection, these dataindicate that IL-1bmay be a key cytokine in the pathogenesis of theinflammatory response and in mediation of host immune re-sponses against MG in house finches. In this context, furtherinvestigation regarding the processing mechanisms leading to theproduction of active HfIL-1b and associated enzymatic counterpartsthat are relevant to the pathogenesis of MG infection is necessary.
In conclusion, we cloned and expressed HfIL-1b, and exploredits basic functions including proliferative effect on splenocytes andhepatocytes, differential mRNA expression profiles of not only Th1/Th2 cytokines and chemokine but also acute phase protein andantimicrobial peptide by activated immune cells. Furthermore, theadditional data extend previous findings by demonstrating that up-regulation of IL-1b mRNA expression after MG infection is accom-panied by the bioactive form of IL-1b. Collectively, this study willhelp us to better understand the functional role of HfIL-1b in thehost immune response along with its biological importance in theinflammatory response of wild birds against MG infection.
Acknowledgements
We would like to thank Laila Kirkpatrick (Virginia Tech,Blacksburg) for helping collect the tissue samples.
References
Adelman, J.S., Kirkpatrick, L., Grodio, J.L., Hawley, D.M., 2013. House finch pop-ulations differ in early inflammatory signaling and pathogen tolerance at thepeak of Mycoplasma gallisepticum infection. Am. Nat. 181, 674e689.
Arend, W.P., Palmer, G., Gabay, C., 2008. IL-1, IL-18, and IL-33 families of cytokines.Immunol. Rev. 223, 20e38.
Bando, M., Hiroshima, Y., Kataoka, M., Shinohara, Y., Herzberg, M.C., Ross, K.F.,Nagata, T., Kido, J., 2007. Interleukin-1alpha regulates antimicrobial peptideexpression in human keratinocytes. Immunol. Cell Biol. 85, 532e537.
Batra, S., Cai, S., Balamayooran, G., Jeyaseelan, S., 2012. Intrapulmonary adminis-tration of leukotriene B(4) augments neutrophil accumulation and responses inthe lung to Klebsiella infection in CXCL1 knockout mice. J. Immunol. 188,3458e3468.
Benbernou, N., Esnault, S., Shin, H.C., Fekkar, H., Guenounou, M., 1997. Differentialregulation of IFN-gamma, IL-10 and inducible nitric oxide synthase in human Tcells by cyclic AMP-dependent signal transduction pathway. Immunology 91,361e368.
Black, R.A., Kronheim, S.R., Cantrell, M., Deeley, M.C., March, C.J., Prickett, K.S.,Wignall, J., Conlon, P.J., Cosman, D., Hopp, T.P., et al., 1988. Generation of bio-logically active interleukin-1 beta by proteolytic cleavage of the inactive pre-cursor. J. Biol. Chem. 263, 9437e9442.
Bresnahan, K.A., Tanumihardjo, S.A., 2014. Undernutrition, the acute phase responseto infection, and its effects on micronutrient status indicators. Adv. Nutr. 5,702e711.
Bufler, P., Gamboni-Robertson, F., Azam, T., Kim, S.H., Dinarello, C.A., 2004. Inter-leukin-1 homologues IL-1F7b and IL-18 contain functional mRNA instabilityelements within the coding region responsive to lipopolysaccharide. Biochem. J.381, 503e510.
Burns, K., Martinon, F., Tschopp, J., 2003. New insights into the mechanism of IL-1beta maturation. Curr. Opin. Immunol. 15, 26e30.
Campbell, L., Raheem, I., Malemud, C.J., Askari, A.D., 2016. The relationship betweenNALP3 and autoinflammatory syndromes. Int. J. Mol. Sci. 17.
Chung, Y., Chang, S.H., Martinez, G.J., Yang, X.O., Nurieva, R., Kang, H.S., Ma, L.,Watowich, S.S., Jetten, A.M., Tian, Q., Dong, C., 2009. Critical regulation of earlyTh17 cell differentiation by interleukin-1 signaling. Immunity 30, 576e587.
Chin, J., Kostura, M.J., 1993. Dissociation of IL-1 beta synthesis and secretion inhuman blood monocytes stimulated with bacterial cell wall products.J. Immunol. 151, 5574e5585.
Dinarello, C.A., 1996. Biologic basis for interleukin-1 in disease. Blood 87,
M. Park et al. / Developmental and Comparative Immunology 69 (2017) 41e50 49
2095e2147.Dinarello, C.A., 1999. IL-18: a TH1-inducing, proinflammatory cytokine and new
member of the IL-1 family. J. Allergy Clin. Immunol. 103, 11e24.Dinarello, C.A., 2009. Immunological and inflammatory functions of the interleukin-
1 family. Annu. Rev. Immunol. 27, 519e550.Dong, C., 2008. IL-23/IL-17 biology and therapeutic considerations.
J. Immunotoxicol. 5, 43e46.Eldaghayes, I., Rothwell, L., Williams, A., Withers, D., Balu, S., Davison, F., Kaiser, P.,
2006. Infectious bursal disease virus: strains that differ in virulence differen-tially modulate the innate immune response to infection in the chicken bursa.Viral Immunol. 19, 83e91.
Gabay, C., Kushner, I., 1999. Acute-phase proteins and other systemic responses toinflammation. N. Engl. J. Med. 340, 448e454.
Giansanti, F., Giardi, M.F., Botti, D., 2006. Avian cytokinesean overview. Curr. Pharm.Des. 12, 3083e3099.
Grodio, J.L., Dhondt, K.V., O'Connell, P.H., Schat, K.A., 2008. Detection and quanti-fication of Mycoplasma gallisepticum genome load in conjunctival samples ofexperimentally infected house finches (Carpodacus mexicanus) using real-timepolymerase chain reaction. Avian Pathol. 37, 385e391.
Gunther, C., Rollinghoff, M., Beuscher, H.U., 1991. Formation of intrachain disulfidebonds gives rise to two different forms of the murine IL-1 beta precursor.J. Immunol. 146, 3025e3031.
Gyorfy, Z., Ohnemus, A., Kaspers, B., Duda, E., Staeheli, P., 2003. Truncated chickeninterleukin-1beta with increased biologic activity. J. Interferon Cytokine Res. 23,223e228.
Heggen, C.L., Qureshi, M.A., Edens, F.W., Barnes, H.J., 2000. Alterations inmacrophage-produced cytokines and nitrite associated with poult enteritis andmortality syndrome. Avian Dis. 44, 59e65.
Hill, G.E., 1993. Male mate choice and the evolution of female plumage coloration inthe house finch. Evolution 47, 1515e1525.
Hong, Y.H., Lillehoj, H.S., Lee, S.H., Dalloul, R.A., Lillehoj, E.P., 2006a. Analysis ofchicken cytokine and chemokine gene expression following Eimeria acervulinaand Eimeria tenella infections. Vet. Immunol. Immunopathol. 114, 209e223.
Hong, Y.H., Lillehoj, H.S., Lillehoj, E.P., Lee, S.H., 2006b. Changes in immune-relatedgene expression and intestinal lymphocyte subpopulations following Eimeriamaxima infection of chickens. Vet. Immunol. Immunopathol. 114, 259e272.
Hurtado, P.J., 2012. Within-host dynamics of mycoplasma infections: conjunctivitisin wild passerine birds. J. Theor. Biol. 306, 73e92.
Iqbal, M., Philbin, V.J., Withanage, G.S., Wigley, P., Beal, R.K., Goodchild, M.J.,Barrow, P., McConnell, I., Maskell, D.J., Young, J., Bumstead, N., Boyd, Y.,Smith, A.L., 2005. Identification and functional characterization of chicken Toll-like receptor 5 reveals a fundamental role in the biology of infection withSalmonella enterica serovar Typhimurium. Infect. Immun. 73, 2344e2350.
Itoh, K., Hirohata, S., 1995. The role of IL-10 in human B cell activation, proliferation,and differentiation. J. Immunol. 154, 4341e4350.
Kim, D.E., Chivian, D., Baker, D., 2004. Protein structure prediction and analysisusing the Robetta server. Nucleic Acids Res. 32, W526eW531.
Kitade, H., Sakitani, K., Inoue, K., Masu, Y., Kawada, N., Hiramatsu, Y., Kamiyama, Y.,Okumura, T., Ito, S., 1996. Interleukin 1 beta markedly stimulates nitric oxideformation in the absence of other cytokines or lipopolysaccharide in primarycultured rat hepatocytes but not in Kupffer cells. Hepatology 23, 797e802.
Kogut, M.H., He, H., Kaiser, P., 2005. Lipopolysaccharide binding protein/CD14/TLR4-dependent recognition of Salmonella LPS induces the functional activation ofchicken heterophils and up-regulation of pro-inflammatory cytokine and che-mokine gene expression in these cells. Anim. Biotechnol. 16, 165e181.
Krause, A., Sillard, R., Kleemeier, B., Kluver, E., Maronde, E., Conejo-Garcia, J.R.,Forssmann, W.G., Schulz-Knappe, P., Nehls, M.C., Wattler, F., Wattler, S.,Adermann, K., 2003. Isolation and biochemical characterization of LEAP-2, anovel blood peptide expressed in the liver. Protein Sci. 12, 143e152.
Laurent, F., Mancassola, R., Lacroix, S., Menezes, R., Naciri, M., 2001. Analysis ofchicken mucosal immune response to Eimeria tenella and Eimeria maximainfection by quantitative reverse transcription-PCR. Infect. Immun. 69,2527e2534.
Lavric, M., Maughan, M.N., Bliss, T.W., Dohms, J.E., Bencina, D., Keeler Jr., C.L.,
Narat, M., 2008. Gene expression modulation in chicken macrophages exposedto Mycoplasma synoviae or Escherichia coli. Vet. Microbiol. 126, 111e121.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25,402e408.
Martinon, F., Burns, K., Tschopp, J., 2002. The inflammasome: a molecular platformtriggering activation of inflammatory caspases and processing of proIL-beta.Mol. Cell. 10, 417e426.
McColl, B.W., Rothwell, N.J., Allan, S.M., 2007. Systemic inflammatory stimuluspotentiates the acute phase and CXC chemokine responses to experimentalstroke and exacerbates brain damage via interleukin-1- and neutrophil-dependent mechanisms. J. Neurosci. 27, 4403e4412.
Netea, M.G., Simon, A., van de Veerdonk, F., Kullberg, B.J., Van der Meer, J.W.,Joosten, L.A., 2010. IL-1beta processing in host defense: beyond the inflam-masomes. PLoS Pathog. 6, e1000661.
Netea, M.G., van de Veerdonk, F.L., van der Meer, J.W., Dinarello, C.A., Joosten, L.A.,2015. Inflammasome-independent regulation of IL-1-family cytokines. Annu.Rev. Immunol. 33, 49e77.
Nogawa, S., Forster, C., Zhang, F., Nagayama, M., Ross, M.E., Iadecola, C., 1998.Interaction between inducible nitric oxide synthase and cyclooxygenase-2 aftercerebral ischemia. Proc. Natl. Acad. Sci. U. S. A. 95, 10966e10971.
Park, M., Kim, S., Adelman, J.S., Leon, A.E., Hawley, D.M., Dalloul, R.A., 2016.Expression analysis of house finch interleukin-1b after Mycoplasma gallisepti-cum infection. Data in Brief , submitted.
Reis, M.I., do Vale, A., Pereira, P.J., Azevedo, J.E., Dos Santos, N.M., 2012. Caspase-1and IL-1beta processing in a teleost fish. PLoS One 7, e50450.
Schindler, R., Clark, B.D., Dinarello, C.A., 1990a. Dissociation between interleukin-1beta mRNA and protein synthesis in human peripheral blood mononuclearcells. J. Biol. Chem. 265, 10232e10237.
Schindler, R., Ghezzi, P., Dinarello, C.A., 1990b. IL-1 induces IL-1. IV. IFN-gammasuppresses IL-1 but not lipopolysaccharide-induced transcription of IL-1.J. Immunol. 144, 2216e2222.
Schultz, R.M., 1987. Interleukin 1 and interferon-gamma: cytokines that providereciprocal regulation of macrophage and T cell function. Toxicol. Pathol. 15,333e337.
Sievers, F., Higgins, D.G., 2014. Clustal Omega, accurate alignment of very largenumbers of sequences. Methods Mol. Biol. 1079, 105e116.
Sparna, T., Retey, J., Schmich, K., Albrecht, U., Naumann, K., Gretz, N., Fischer, H.P.,Bode, J.G., Merfort, I., 2010. Genome-wide comparison between IL-17 andcombined TNF-alpha/IL-17 induced genes in primary murine hepatocytes. BMCGenomics 11, 226.
Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionarygenetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596e1599.
Thornberry, N.A., Bull, H.G., Calaycay, J.R., Chapman, K.T., Howard, A.D., Kostura, M.J.,Miller, D.K., Molineaux, S.M., Weidner, J.R., Aunins, J., et al., 1992. A novel het-erodimeric cysteine protease is required for interleukin-1 beta processing inmonocytes. Nature 356, 768e774.
van de Veerdonk, F.L., Gresnigt, M.S., Kullberg, B.J., van der Meer, J.W., Joosten, L.A.,Netea, M.G., 2009. Th17 responses and host defense against microorganisms: anoverview. BMB Rep. 42, 776e787.
Weaver, L.K., Pioli, P.A., Wardwell, K., Vogel, S.N., Guyre, P.M., 2007. Up-regulation ofhuman monocyte CD163 upon activation of cell-surface Toll-like receptors.J. Leukoc. Biol. 81, 663e671.
Weining, K.C., Sick, C., Kaspers, B., Staeheli, P., 1998. A chicken homolog ofmammalian interleukin-1 beta: cDNA cloning and purification of active re-combinant protein. Eur. J. Biochem. 258, 994e1000.
Wu, Y.F., Liu, H.J., Chiou, S.H., Lee, L.H., 2007. Sequence and phylogenetic analysis ofinterleukin (IL)-1beta-encoding genes of five avian species and structural andfunctional homology among these IL-1beta proteins. Vet. Immunol. Immuno-pathol. 116, 37e46.
Zielinski, C.E., Mele, F., Aschenbrenner, D., Jarrossay, D., Ronchi, F., Gattorno, M.,Monticelli, S., Lanzavecchia, A., Sallusto, F., 2012. Pathogen-induced humanTH17 cells produce IFN-gamma or IL-10 and are regulated by IL-1beta. Nature484, 514e518.
M. Park et al. / Developmental and Comparative Immunology 69 (2017) 41e5050
