Toxicology 249 (2008) 243–250

Contents lists available at ScienceDirect

Toxicology

journa l homepage: www.e lsev ier .com/ locate / tox ico l

Differentiating human NT2/D1 neurospheres as a versatile in vitro3D model system for developmental neurotoxicity testing

E.J. Hill a,∗, E.K. Woehrlinga, M. Princeb, M.D. Colemana

T, UKm B4

city isy studns clambryAM)entraationeasedn of nmark

xpresdel o

a School of Life and Health Sciences, Aston University, Aston Triangle, Birmingham B4 7Eb School of Engineering and Applied science, Aston University, Aston Triangle, Birmingha

a r t i c l e i n f o

Article history:Received 2 May 2008Received in revised form 14 May 2008Accepted 15 May 2008Available online 2 July 2008

Keywords:NT2/D1 cellsDevelopmental neurotoxicityLithiumValproic acidAcrylamideHydroxyurea

a b s t r a c t

Developmental neurotoxications. In this preliminarto known human teratogeproic acid) and strongly eAlternative Methods (ECVexpression specific to the ction of neuronal differentireduced viability and decricantly alter the expressionot affect neuronal proteinneuronal protein marker eprovide the basis for a mo

1. Introduction

The culture of human neurons in vitro can facilitate drug andtoxin screening, as well as the study of neurological disordersand CNS development. Sources of these neurons include embry-onic stem cells (ES) and embryonic carcinoma (EC) cells. Studiesusing ES/EC cells have demonstrated great potential for study-ing embryonic development (Wobus and Boheler, 2005). In thiscontext, the use of human Ntera2/clone D1 (NT2/D1) embryocarci-noma cells (EC cells) has several distinct advantages. Their humanorigin and similarity to embryonic stem cells allows for the produc-tion of various differentiated cell lineages of the CNS. In addition,neural differentiation by NT2/D1 cells parallels changes seen dur-ing cellular development in the human embryonic neural tube(Przyborski et al., 2000). There is no evidence to suggest that humanNT2/D1 derived neurons differentiate and function in an aber-rant way and on the contrary, many features are highly conserved(Horrocks et al., 2003). NT2/D1 cells have been shown to differ-entiate into post-mitotic neurons, astrocytes and oligodendrocytesupon exposure to retinoic acid (RA); which is a potent inducer ofnormal mammalian neural development (Lee and Andrews, 1986;

∗ Corresponding author. Tel.: +44 121 204 4022.E-mail address: hillej@aston.ac.uk (E.J. Hill).

0300-483X/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved.doi:10.1016/j.tox.2008.05.014

7ET, UK

a major issue in human health and may have lasting neurological impli-y we exposed differentiating Ntera2/clone D1 (NT2/D1) cell neurospheresssed as non-embryotoxic (acrylamide), weakly embryotoxic (lithium, val-otoxic (hydroxyurea) as listed by European Centre for the Validation ofand examined endpoints of cell viability and neuronal protein markerl nervous system, to identify developmental neurotoxins. Following induc-, valproic acid had the most significant effect on neurogenesis, in terms ofneuronal markers. Lithium had least effect on viability and did not signif-euronal markers. Hydroxyurea significantly reduced cell viability but dider expression. Acrylamide reduced neurosphere viability but did not affectsion. Overall, this NT2/D1-based neurosphere model of neurogenesis, mayf developmental neurotoxicity in vitro.

© 2008 Elsevier Ireland Ltd. All rights reserved.

Pleasure and Lee, 1993; Pleasure et al., 1992; Sandhu et al., 2002).NT2/D1-derived neurons (NT2-N) express functional N-methyl-d-aspartic acid (NMDA) and non-NMDA glutamate receptor channels,show glutamate induced excitotoxicity and generate low amplitudeaction potentials (Hardy et al., 1994; Younkin et al., 1993). NT2/D1

neurons cultured in the presence of astrocytes also form glutamin-ergic (excitatory) and GABAergic (inhibitory) functional synapses(Hartley et al., 1999). Indeed, so similar are NT2/D1 neurons to fullyfunctional neurons that they have been successfully transplantedinto rodent and even human brains (Nelson et al., 2002). Theseimplanted neurons have been shown to ameliorate motor and cog-nitive impairment in animal models of ischemic stroke (Nelson etal., 2002; Watson et al., 2003).

The most frequently used protocol to differentiate NT2 cells intomature neurons consists of treating adherent dividing cells withRA for up to 6 weeks and then plating them on a matrix of poly-d-lysine (PDL) and murine laminin for an additional 7 days in mediumcontaining mitotic inhibitors (Andrews, 1984). It has been demon-strated that mixed populations of neurons and astrocytes can alsobe produced using this method by decreasing the concentrationsof mitotic inhibitors used (Bani-Yaghoub et al., 1999; Woehrling etal., 2007).

Further modifications have developed a cell aggregation pro-tocol to obtain NT2 neurons within 14 days (Cheung et al., 1999;Horrocks et al., 2003; Paquet-Durand et al., 2003). Although advan-tageous in the production of pure populations of neuronal cells,

logy 2

244 E.J. Hill et al. / Toxico

these methods have not demonstrated the production of astrocytesusing the cell aggregation protocol. The processes of develop-ment, differentiation, protection and restoration of neuronal cellsis heavily dependent upon astrocytes, which are known to secretecytokines and many other factors essential to the stability of neu-ronal function (Vernadakis, 1996). Hence, it is all the more desirableto include astrocytes in a human-based model of neuronal devel-opment.

This report describes a novel method to characterise the impactof known teratogens on the differentiation of NT2/D1 cells. Cellaggregates containing neurons have been cultured and it has beendemonstrated that neuronal differentiation can be achieved withinonly 14 days of RA exposure. In addition, the development of astro-cytes has also been detected following plating of neurospheres.Furthermore, we also demonstrate the increased expression of avariety of neuronal specific genes as well as concomitant decreasein stem cell associated genes following treatment with RA usingRT-PCR. Imaging differentiated cells within the aggregates usingconfocal microscopy has facilitated both the identification of neu-rons and astrocytes in culture and the evaluation of this 3D modelusing a small range of potentially teratogenic agents to investigatetheir effects on neurogenesis.

2. Methods

2.1. Materials

All chemicals were of molecular biology grade and were obtained fromSigma–Aldrich (Poole, UK) unless otherwise stated.

2.2. NT2/D1 cell culture and induction of differentiation

Human teratocarcinoma NT2/D1cells used in this study were originally kindlydonated by Professor P.W. Andrews (University of Sheffield, UK) and cultured inDMEM Glutamax high glucose medium, with pyruvate (Gibco Invitrogen, Paisley,UK) containing 10% (v/v) foetal bovine serum (Gibco Invitrogen), 100 units/ml peni-cillin and 100 �g/ml streptomycin. Resuspended NT2/D1 cells (2 × 106) were platedinto sterile 90 mm diameter non-adherent bacteriological Petri dishes to generateneurospheres (Starstedt, Leicester, UK). These cultures were grown for 2 days beforethe addition of all-trans-retinoic acid (RA) to a final concentration of 10 �M andtoxicants. RA induced suspension cultures were maintained for 2 weeks. Cells werereplated every 2–3 days.

To generate astrocytes, neurospheres were plated onto PDL-coated coverslipsin DMEM in the absence of retinoic acid but in the presence of mitotic inhibitors;1 �M cytosine arabinosine (for the first 7 days only); 10 �M fluorodeoxyuridine; and10 �M uridine.

2.3. Cell morphology study

Neurospheres were stained with live/dead dye (Calcein/propidium iodide,Molecular Probes, UK) at 1% (v/v) for 30 min at 37 ◦C. Live cells demonstrate a greencolour, and dead cells are a red colour. Cell morphology was observed using a ZeissLSM 510 META confocal laser-scanning microscope (CLSM). Aggregates were imagedat optimal intervals throughout the entire depth of the section and acquired as aZ-stack.

2.4. Cytotoxicity tests

Lithium chloride, acrylamide, valproic acid (VPA) and hydroxyurea were dilutedin sterile PBS to prepare a 100 mM stock solution and frozen at −20 ◦C. Frozenaliquots were used only for each change of medium. To determine the range ofnon-cytotoxic concentrations, cell viability after toxicant exposure was examinedusing an MTT assay using adherent cells. Metabolically active mitochondrial dehy-drogenases convert the tetrazolium salt MTT, to insoluble purple formazan crystals,at a rate that is proportional to cell viability (Tada et al., 1986). The undifferenti-ated NT2/D1 cells were plated in 96-well microtitre plates at a concentration of5 × 105 cells/ml, in a 100 �l volume. After incubation overnight, the medium wasremoved and the cells were incubated in the presence of 100 �l medium supple-mented with increasing concentrations of teratogens in triplicate wells. After a 24-hincubation period, 20 �l MTT solution (5 mg/ml in PBS) was added to each well for4-h, followed by 100 �l of a 10% (w/v) sodium dodecyl sulphate solution, 0.01N HCLto lyse the cells and solubilize the formazan crystals formed. The optical density(OD) was read at 590 nm using a spectrophotometer. Untreated negative controlswere run together with the treated cells. Plates with reagent only served as back-

49 (2008) 243–250

ground controls. The results are expressed as the OD after background subtraction,as a percentage of the average negative control. From this, the mean IC50 and respec-tive 95% confidence limits for each toxicant were determined using GraphPad Prismsoftware.

The viability of cells in suspension during toxin exposure was monitored usingCellTitre BlueTM assay (Promega). Overt toxicity as measured by IC50 values couldconceivably mask mechanistic actions of developmental neurotoxins. Alternatively,the action of antiproliferative toxicants on neuronal differentiation could possi-bly be overlooked by analysing developmental neurotoxicity at the no observedadverse effect level (NOAEL). Hence, we analysed the effects of neurotoxins at ≤30%reduction in cell viability as determined by the CellTiter-BlueTM assay.

During culturing, viability was usually measured every 2–3 days. For each mea-surement, the cell culture medium was completely changed and replaced withDMEM without phenol red, containing 2 mM l-glutamine (Gibco, Invitrogen), 10%(v/v) foetal bovine serum (Gibco Invitrogen), 100 units/ml penicillin and 100 �g/mlstreptomycin to which 1% (v/v) CellTitre-BlueTM (promega) solution was added. Sus-pension cultures were incubated for 4 h at 37 ◦C/5% CO2, after which time mediumwas transferred to a 96-well plate and read at 620 nm. Medium was then changed tocell culture medium DMEM Glutamax high glucose medium, with pyruvate (GibcoInvitrogen, Paisley, UK) containing 10% (v/v) foetal bovine serum (Gibco Invitrogen),100 units/ml penicillin and 100 �g/ml streptomycin, without CellTitre-BlueTM. Theresults are expressed as the OD after background subtraction, as a percentage of theaverage negative control (RA only).

2.5. Western blotting

Cell cultures were washed three times with PBS before protein extraction toremove any serum proteins. Protein samples were prepared from NT2/D1 cells andtheir RA-induced derivatives in RIPA buffer (10 mM Tris HCl pH 8.0, 100 mM NaCl,1 mM EDTA, 1% (v/v) NP40, 0.1% (v/v) SDS and 0.5% (w/v) sodium deoxycholate),plus protease inhibitors (Roche Diagnostics Ltd.). Protein concentration was deter-mined using the BCATM protein assay kit (Pierce, Rockford, USA). Sodium dodecylsulfate-PAGE gels were prepared according to the manufacturers of the Bio-Rad MiniProtean® 3 (Bio-Rad Laboratories Ltd., Hemel Hempstead, UK). Loading gels (4% poly-acrylamide) and resolving gels (10% polyacrylamide) were used for separation ofproteins. 5 �g of cell lysate was denatured in sample buffer (0.5 M Tris–HCl, pH 6.8,10% (v/v) glycerol, 1% (w/v) sodium lauryl sulphate, 5% (v/v) 2-mercaptoethanol,0.01% (w/v) bromophenol blue) for 5 min at 100 ◦C. Samples were electrophoresedfor 45 min at 200 volts (V). SDS Page Gels were immediately blotted (16 h, 30 V)onto polyvinylidene difluoride (PVDF) membranes (Amersham Pharmacia Biotech,UK Ltd.) using the Bio-Rad mini-gel transfer apparatus.

For immunoblotting, PVDF membranes were washed in Tris-buffered saline(TBS) 0.01% (v/v) Tween and placed in a blocking solution of 5% (w/v) dried milkpowder in TBS 0.01% (v/v) Tween for 2 h at room temperature. After blocking, theblots were incubated with the following primary antibodies diluted in 3% (w/v)dried milk powder in TBS 0.01% (v/v) Tween overnight at 4 ◦C (see table) anti-neurofilament 68 (clone NR4 (Sigma), 1:1000); anti-Glial fibrillary acidic protein(clone GA-5, Millipore, Watford, UK, 1:1000); rabbit anti-�-actin (A5060, Sigma,1:500); anti-�-tubulin-III, clone TU-20, Millipore, 1:2000; anti-Neuron specific eno-lase (clone MAB324, Millipore, 1:2000). Blots were subsequently washed in TBS0.01% (v/v) Tween for 5-min six times, followed by incubation with mouse IgG-horseradish peroxidase (HRP) secondary antibody (7076, Cell signalling, MA, USA,1:5000) or goat anti-rabbit HRP (P0448, Dako, Cambridgeshire, UK, 1:5000) and

six final 5-min washes in TBS 0.01% (v/v) Tween. Protein-antibody binding wasdetected on film (Hyperfilm ECL; Amersham) using enhanced chemiluminescence(ECL Western blotting analysis system; Amersham Pharmacia). The resulting blotswere photographed using the Genegenius bioimaging system (Syngene, Cambridge,UK). The package Genetools (Syngene) was then used to semi-quantify the densityof the detected protein. The signal from the protein bands was normalised againstthe signal from the ‘housekeeping’ protein �-Actin and expressed as a percentageof the control (RA), which is represented as 100% on the graph.

2.6. Immunohistochemistry

Cells cultured on glass coverslips were fixed using 4% paraformaldehyde PBS atroom temperature for 5 min and permeabilised with 0.2% Triton X-100 in PBS. Sam-ples were blocked using 0.2% Triton X-100 and 5% Bovine Serum Albumin in PBS for1 h at room temperature. Slides were incubated with anti-�-tubulin-III (MMS-435P,Covance, UK, 1:500) or anti-Glial fibriliary acidic protein (N-18, Santa Cruz, CA, USA,1:200) for 2 h at room temperature. Slides were then washed three times and incu-bated with rabbit anti-mouse FITC (315-095-003, Jackson ImmunoResearch, Europe,1:200) or rabbit anti-goat Rhodamine (305-295-003, Jackson ImmunoResearch,1:200) for 1 h at room temperature. Slides were washed three times and cover-slipped with Vectashield with DAPI (Vector Laboratories Inc., USA) and examinedusing confocal microscopy (Zeiss LSM 510 META confocal laser-scanning micro-scope). Neurospheres were fixed, permeabilised and stained in suspension andallowed to settle before each wash using identical procedures to that used for cellsgrown on coverslips. For visualization neurospheres were prepared as hanging dropson coverslips placed over a cavity slide.

logy 2

T-PCR

3′; 5′AA3′; 5CTAT

GCTGCGACTGACAT3CTACAGTCC3

3.1. Live/dead morphological inspection of neurospheres

E.J. Hill et al. / Toxico

Table 1Length of PCR products, annealing temperature and sequence of primers used for R

Gene Product (bp) Temperature (◦C) Primer sequences

Nestin 311 62 5′CCAGCTGCTACTGGATCNgn1 334 57 5′CCGACGACACCAAGCTCNeuroD 523 64 5′GCCCCAGGGTTATGAGAMATH1 261 64 5′GTGGTAGACGAGCTGGTau 512 57 5′GTAAAAGCAAAGACGGSynap 621 64 5′CCGCCAGACAGGGAAC�-Actin 841 64 5′ATCTGGCACCACACCTTOct4 81 64 5′GCTCGAGAAGGATGTG

2.7. Image acquisition and processing

Immunohistochemical studies were carried out by false colour confocal imag-ing using a Zeiss Axioplan 2 stand equipped with a Zeiss LSM 510 META confocallaser-scanning microscope (CLSM). The samples were excited with argon (488 nm)and HeNe (543 nm) laser sources and fluorescent emission images were acquiredin rhodamine red (560 nm) and FITC green (505–530 nm). Aggregates were imagedat optimal intervals throughout the entire depth of the section and acquired as a

Z-stack by CLSM. For each sample multiple optical sections were obtained usingeither a Zeiss EC Plan-Neofluar 40×/1.3 or a Plan-Apochromat 63×/1.4 oil immer-sion objective. Three-dimensional projections were generated through merging thedata from resulting Z-stacks (LSM Image Browser; Zeiss).

2.8. RT-PCR

Total RNA was isolated from neurospheres generated by plating on 90 mm Petridishes with 2 × 106 cells using Trizol reagent (Invitrogen). One microgram of DNAse(Invitrogen) treated RNA was used for first strand synthesis and was subsequentlyconverted to cDNA using ThermoscriptTM RT-PCR system (Invitrogen). FollowingRNAse treatment (Invitrogen) 1 �l of RT-PCR reaction was included in a total volumeof 50 �l reaction mixture and PCR was performed in an automated thermal cycler(Thermo Electron corporation) using GoTAQ polymerase (Promega, Southhampton,UK). For forward and reverse primer sequence, annealing temperature and productsize for each primer set see Table 1. PCR products were run on 1% (w/v) agarosegels and stained using ethidium bromide. The gels were then photographed usingthe Genegenius bioimaging system (Syngene). The package Genetools (Syngene)was then used to semi-quantify the signal of the PCR products. Gene expression isrepresented again in relation to the ‘housekeeping’ gene �-actin.

2.9. Statistical analysis

Results were expressed as the mean of three samples ± standard errorof the mean (S.E.M.). Comparisons between treatments were performedusing analysis of variance (ANOVA) followed by Dunnett’s post-test using

Fig. 1. Confocal image of neurospheres stained with live/dead stain. Live cells(green), dead cells (red). Images were obtained using the Zeiss LSM 510 confocallaser-scanning microscope. Scale bar 100 �m.

49 (2008) 243–250 245

References

GCCAGAAGGCTCAGCA3′ Megiorni et al. (2005)′GAATGAAACAGGGCGTT3′ Megiorni et al. (2005)

CACT3′; 5′GACAGAGCCCAGATGTAGTTCTT3′ Megiorni et al. (2005)3′; 5′TTCCCCTCCGCTGGGCGTTTG3′ Megiorni et al. (2005)G3′; 5′ATGATGGATGTTGCCTAATGAG3′ Megiorni et al. (2005)

′; 5′AGGGGGCCCACTCAAGACTG3′ Przyborski et al. (2003)ATGAG3′; 5′GACTCGTCATACTCCTGCTTGCTGATCC3′ Przyborski et al. (2003)′; 5′GTTGTGCATAGTCGCTGCT3′ Deb-Rinker et al. (2005)

GraphPad Prism Software. Differences were considered significant for p val-ues < 0.05.

3. Results

Following staining with live/dead stain, visual inspection usingconfocal microscopy revealed that only viable cells were detectedwithin the neurospheres after 2 weeks of RA treatment with a smallnumber of dead cells of the outside of the neurosphere (Fig. 1).Neurosphere diameters ranged from 200 to 300 �m after 2 weekstreatment with RA.

3.2. Stimulation with RA regulates the expression of neuralmarkers in NT2/D1 cells

Western analysis of protein expression for the neural mark-ers neuron specific enolase (NSE) and �-tubulin-III (TujIII) wasperformed on samples of NT2/D1 cells and their differentiatedderivatives. Expression of neural proteins was barely detectable inundifferentiated cultures of NT2/D1 cells. However, following expo-sure of NT2/D1 cell neurosphere cultures to RA, neuronal proteinsbecame apparent within 2 weeks. After 2 weeks in suspension someneurosphere cultures were plated onto PDL coated glass coverslips.

Fig. 2. Confocal image of plated neurospheres after 3 weeks. TujIII (green) positivecells show distinct neuronal morphology with fasciculation of neurites that radiatefrom the central aggregation of neuronal perikarya. GFAP (red) positive cells can beseen in close association with neuronal perikarya and appear in close associationwith neurites throughout the culture. Images were obtained using the Zeiss LSM 510confocal laser-scanning microscope. Scale bar 50 �m.

logy 2

246 E.J. Hill et al. / Toxico

Fig. 3. Time course of mRNA levels during 14 days of neuronal differentiation ofNT2/D1 cells. Semi quantitative RT-PCR was performed and the densitometry of

ethidium bromide gels was plotted in relation to the expression of the house keepinggene �-actin.

Neurospheres spread out and become monolayers once plated anddisplay distinct neuronal morphology with fasciculation of neuritesthat radiate from the central aggregation of neuronal perikarya.Using low concentrations of mitotic inhibitors it was possible todetect GFAP in cultures after 3 weeks plating. The presence of astro-cytes was determined by immunocytochemical staining of culturesusing the astrocytic marker GFAP (Fig. 2). Astrocytes appear inclose proximity to aggregations of neuronal perikarya and neuritesthroughout the culture.

3.3. Effects of RA on gene expression in NT2 neurospheres

The expression pattern of genes involved in the pathway of nervecell development was analysed using RT-PCR (Fig. 3). Genes inves-tigated included Oct4 (Octamer-4), which is critically involved inthe self-renewal of undifferentiated stem cells. In addition, basichelix–loop–helix (bHLH) transcription factors that promote theexpression of a cascade of genes responsible for neuronal identity

Fig. 4. MTT concentration response curves for (A) hydroxyurea, (B) lithium, (C) valproic aexperiment was repeated in three independent runs and results are shown as ±S.E.M. (n

49 (2008) 243–250

such as Ngn1 (Neurogenin-1), were also investigated. RT-PCR wasalso applied to NeuroD1 (Neurogenic differentiation-1), MATH1(Mammalian atonal homologue-1) and nestin, which is an interme-diate filament protein expressed in dividing cells during the earlystages of development in the CNS. Finally, Tau a microtubule asso-ciated protein that is abundant in neurons and synaptophysin, asynaptic vesicle glycoprotein present in cells involved in synap-tic transmission, were also processed. The expression of each genewas analysed during the differentiation of NT2/D1 neurospheresfrom day 0 (no RA) to day 14 (RA treatment). Nestin expressionwas upregulated after exposure to RA and values peaked at day10. Oct4 expression fluctuated throughout the period of differ-entiation, potentially demonstrating the retention of a pool ofstem cells within the neurosphere. MATH1 expression rose steadily

throughout the period of differentiation, whilst Ngn1 expressionwas detected at day 3 and peaked at day 6. Expression of NeuroD1and Tau was observed from day 6 onwards and finally, expressionof synaptophysin was detected from day 10.

3.4. Determination of non-cytotoxic concentrations of toxicantsof undifferentiated NT2/D1 cells

It was intended to determine cellular susceptibility through thetoxic range ranging from the NOAEL to frank cytotoxicity duringthe study. Prior to analysis of changes in protein expression inthe NOAEL range, undifferentiated NT2/D1 cells were exposed toa range of toxicants concentrations over a 24-h period. The doseresponse curve of hydroxyurea (Fig. 4A) demonstrated a plateauat around 50%; therefore a true IC50 value could not be calcu-lated. In order to detect changes in protein expression at lowcytotoxic concentrations, 0.05 mM, 0.025 mM, and 0.0125 mM wereselected as the treatment concentrations of NT2/D1 cells. Thedose response for lithium (Fig. 4B) demonstrated an IC50 valueof 74 × 10−3 M ± 0.006−3 M. In order to detect changes in pro-tein expression at low cytotoxic concentrations, 1 mM, 0.5 mM

cid, (D) acrylamide following 24-h exposure on undifferentiated NT2/D1 cells. The= 3). Values are expressed as percentage of controls (no toxin).

E.J. Hill et al. / Toxicology 249 (2008) 243–250 247

were treated with: acrylamide (A), hydroxyurea (B), lithium (C), VPA (D). The experiment< 0.05 (*), P < 0.01 (**), P < 0.001 (***). Values are expressed as percentage of controls (RA

3.6. Effects of retinoic acid and toxicants on the morphogenesis ofneurospheres

Following treatment with RA, morphological examination ofTujIII positive cells revealed the extension of neurites through-out the neurosphere (Fig. 8). Neurospheres treated with lithiumincreased in size and also showed neurite outgrowth. However,treatment with both acrylamide and VPA resulted in altered mor-phology and little neurite outgrowth at higher concentrations,although some recovery occurred at lower concentrations (Fig. 8).

Fig. 5. CellTiter Blue viability assay of toxin treated neurospheres. The neurosphereswas repeated in three independent runs and results are shown as ±S.E.M. (n = 3). Ponly).

and 0.25 mM were selected as the treatment concentrationsof NT2 D1 cells. VPA (Fig. 4C) demonstrated an IC50 value of23 × 10−3 M ± 0.004 × 10−3 M. In order to detect changes in pro-tein expression at low cytotoxic concentrations, 0.5 mM, 0.25 mMand 0.125 mM were selected as the treatment concentrations ofNT2/D1 cells. Finally, acrylamide (Fig. 4D) demonstrated an IC50value of 19.98 × 10−3 M ± 0.002 × 10−3 M. In order to detect changesin protein expression at low cytotoxic concentrations, 0.025 mM,0.0125 mM and 0.006 mM were selected as the treatment concen-trations of NT2 D1 cells. These concentrations also demonstrated≤30% reduction in cell viability during the 14-day period of differ-entiation using CellTitre BlueTM assay (Fig. 5).

3.5. Effects of teratogens on cell viability and neuronal markerexpression

The expression of specific proteins was analysed by Westernblotting (Fig. 6) and densitometry (Fig. 7). To analyse the effectsof hydroxyurea, lithium, valproic acid (VPA) and acrylamide, neu-rospheres were grown in the presence of three concentrations oftoxicant over 14 days. Treatment with hydroxyurea significantlyreduced the number of viable cells over the period of differentia-tion (Fig. 6). However, NSE and TujIII did not show any significantchanges in expression (Fig. 7). Neurospheres treated with lithiumshowed some decrease in viability over the period of differentiation(Fig. 6). However, expression of NSE and TujIII was not significantlyaltered (Fig. 7). In contrast, cell viability was significantly reduced atall concentrations of VPA tested (Fig. 6). In addition, NSE expressionwas decreased at 0.5 mM (Fig. 7) whereas expression of TujIII wassignificantly reduced at all three concentrations (Fig. 7). This largereduction in neuronal protein expression indicates specific neu-rotropic embryotoxicity. Although cell viability was significantlyaltered following acrylamide treatment (Fig. 6), only TujIII expres-sion was affected at 0.025 mM (Fig. 7).

Fig. 6. Representative immunoblots showing the effects of RA + hydroxyurea(5 × 10−5 M, 2.5 × 10−5 M, and 125 × 10−5 M), RA + lithium (1 × 10−3 M, 0.5 × 10−3 Mand 0.25 × 10−3 M), RA + VPA (0.5 × 10−3 M, 0.25 × 10−3 M and 0.125 × 10−3 M),and RA + acrylamide (0.025 × 10−3 M, 0.0125 × 10−3 M and 0.006 × 10−3 M) on theexpression of NSE and TujIII. The experiment was repeated in three independentruns and results are shown as ±S.E.M. (n = 3). P < 0.05 (*), P < 0.01 (**), P < 0.001 (***).Values are expressed as percentage of controls (RA only).

logy 2

248 E.J. Hill et al. / Toxico

Fig. 7. Densitometry analysis of immunoblots showing the effects of RA + hydroxyurea (and 0.25 × 10−3 M), RA + VPA (0.5 × 10−3 M, 0.25 × 10−3 M and 0.125 × 10−3 M), and RA + aof NSE (A) and TujIII (B). The experiment was repeated in three independent runs and resexpressed as percentage of controls (RA only).

4. Discussion

The applications of stem cell technology include developmentalbiology, drug/toxin evaluation as well as tissue regeneration andtransplantation (Wobus and Boheler, 2005). Indeed, in vitro stemcell chemical assessment models are predictive of in vivo toxicity(Davila et al., 2004; Rohwedel et al., 2001). However, many of theexisting human ES cell lines are reliant for their growth and mainte-nance upon murine embryonic fibroblast feeder cells or expensivecocktails of cytokines. Furthermore, suboptimal culture conditionscan lead to spontaneous differentiation of ES cells, potentially lead-ing to the introduction of contaminating cell types (Draper et al.,2004). Human EC cells are a viable alternative to ES cells as theyprovide a robust, well-characterised and simple model to studyaspects of pluripotency and cellular differentiation; this has facili-

Fig. 8. Representative images of neurosphere morphology following toxicant treatment. IScale bar 100 �m.

49 (2008) 243–250

5 × 10−5 M, 2.5 × 10−5 M, and 125 × 10−5 M), RA + lithium (1 × 10−3 M, 0.5 × 10−3 Mcrylamide (0.025 × 10−3 M, 0.0125 × 10−3 M and 0.006 × 10−3 M) on the expressionults are shown as ±S.E.M. (n = 3). P < 0.05 (*), P < 0.01 (**), P < 0.001 (***). Values are

tated the study of the mechanisms by which cells commit to lineageselection (Przyborski et al., 2004). Therefore, we attempted to char-acterise the developmental neurotoxicity of a range of toxicants byanalysing specific neuronal protein expression, viability and mor-phogenesis of differentiating NT2/D1 EC cell neurospheres.

The expression of several neural genes and proteins were anal-ysed during NT2/D1 differentiation. The expression pattern ofneural genes including those of the basic helix loop helix (bHLH)family of genes was in accordance with normal development(Megiorni et al., 2005; Przyborski et al., 2000, 2003). The neuralectodermal marker nestin was decreased and bHLH genes (Ngn1,NeuroD and MATH1) were activated as differentiation progressed.In addition, expression of the microtubule associated protein Tauand the synapse associated protein synaptophysin, indicated thepresence of mature neurons and also highlighted the potential for

mages were obtained using the Zeiss LSM 510 confocal laser-scanning microscope.

logy 2

E.J. Hill et al. / Toxico

synapse formation within the neurospheres (Hartley et al., 1999).Combined with the results of Western blot analysis, these resultsconfirm that mature neurons were present after 14 days of RA treat-ment (Megiorni et al., 2005). The potential for the development ofastrocytes in this model, which are essential to neuronal function,adds to the complexity of the model.

Morphologic differentiation of neurons involves a series of com-plex and dynamic processes. Neurons extend axons and dendrites,as well as establishing and discontinuing synaptic contacts duringneuronal circuit maturation. In this report, we have shown thatin vitro, neuronal specific proteins can be detected by fluorescentantibodies in order to explore these processes. These preliminarystudies using fluorescence microscopy with the NT2/D1 model ofneural differentiation have illustrated neuronal morphogenesis interms of neurite extension, within only 14 days.

The antiepileptic drug VPA is considered a moderate humanteratogen and developmental neurotoxin and this agent has beenreported to inhibit the transcriptional repressor histone deacety-lase (HDAC). VPA has been reported to inhibit the transcriptionalrepressor Histone deacetylase (HDAC). Hyperacetylation of his-tones is associated with increased transcriptional activity (Phiel andZhang, 2001). The concentration range of VPA used in this report(<1 mM) was within the range of patient plasma levels (Brodieand Dichter, 1996). Interestingly, foetal concentrations of VPA mayactually be higher than the maternal plasma levels (Pacifici andNottoli, 1995). In this NT2/D1 model, VPA had the strongest neg-ative impact on neurogenesis in comparison with the other testagents. The effects of VPA provide an opportunity to compare howteratogens behave in different model systems. In the present study,we report that VPA caused a reduction in cell proliferation as well asthe expression of the neuronal proteins TujIII and NSE within theneurospheres. This is in agreement with previous studies, whereVPA inhibited neural differentiation in the Multiple Molecular End-point Embryonic Stem cell Test (MME-EST) (zur Nieden et al., 2004)and also abolished the RA-induced differentiation of NT2/D1 cells(Skladchikova et al., 1998). Although its exact mechanisms of actionremain to be elucidated, VPA mediated decreases in the neurogenicresponse to seizure activity are linked with inhibition of HDACsand subsequent normalization of HDAC-dependent gene expres-sion (Jessberger et al., 2007).

Conversely, there is evidence to suggest that VPA is capableof promoting neurogenesis in certain circumstances (Hao et al.,2004; Hsieh and Gage, 2004). Using the ES cell differentiation sys-tem (Murabe et al., 2007), it was shown that VPA promoted the

neuronal differentiation of the same murine ES cells as used inthe MME-EST. Hence, the effects of VPA on neurogenesis appearto be highly cell context specific. Other HDAC inhibitors like VPAenhance the expression of muscle specific genes in undifferenti-ated skeletal myoblasts, but block expression in the same cells,once induced to differentiate (Iezzi et al., 2002). Skladchikova etal. (1998) used RA to induce neuronal differentiation in NT2/D1cells, whilst in the MME-EST, a cocktail of cytokines and growthfactors was employed (zur Nieden et al., 2004). In contrast, cellsused in the ES cell differentiation system (Murabe et al., 2007)were not induced to differentiate other than with VPA. As such,the differences in the induction of neurogenesis between modelsmay explain the apparently diverse effects of VPA in these sys-tems.

Lithium’s major clinical application is in Bipolar Disorder andmay be of benefit in other CNS injuries and chronic neurodegen-erative diseases (Wada et al., 2005). It is also considered to be amoderate human teratogen. The majority of patients can be main-tained at satisfactorily at levels between 0.5 and 0.8 mM, althoughsome require doses exceeding 1 mM (Johnson, 1998). When appliedto NT2/D1 neurosphere cultures, lithium increased the prolifer-

49 (2008) 243–250 249

ation of NT2 cells with no significant effects on neural proteinexpression. Chronic treatment of lithium, up-regulates cell survivalmolecules such as Bcl-2, cyclic AMP-responsive element bindingprotein, brain-derived neurotrophic factor, Grp78, Hsp70, and �-catenin, whilst down-regulating pro-apoptotic mediators such as.p53, Bax, caspase, cytochrome c release and �-amyloid peptide pro-duction, leading to preventions or even reversal of neurogenesisretardation and cell death (Wada et al., 2005).

Acrylamide human neurotoxicity is characterized by ataxia,skeletal muscle weakness and numbness of the hands and feet(LoPachin, 2004) although it is usually considered to be non-embryotoxic. Based on the acrylamide content of various foods,it has been estimated that the average consumer is exposed to0.8–3 �g/(kg day) (LoPachin, 2004). However, as this agent is alsoan environmental toxicant it is difficult to assess overall exposureto this compound. In the present report, acrylamide did not affectthe differentiation of human neuronal precursors, although it didinfluence TujIII expression at high levels. LoPachin et al. (2004)proposed that nerve terminal degeneration is the primary actionof acrylamide. This effect may involve the inhibition of key pro-teins that regulate membrane vesicle fusion; e.g. N-ethymaleimidesensitive factor (NSF) and SNAP-25. It is therefore conceivable thatas these processes are involved in neurite extension, acrylamidecould affect neurite outgrowth, which is an essential part of neuro-genesis. This highlights the need for analysis of multiple endpointsin studying the potential developmental neurotoxicity profile ofcompounds. Future work will study the effects of developmentalneurotoxins on neurite extension within the neurosphere.

Hydroxyurea is an antineoplastic drug used in haematologicalmalignancies and the treatment of HIV. Hydroxyurea is stronglyteratogenic and its mechanism of action is believed to be due toinhibition of DNA replication, which interrupts the cell cycle at theG1 and S-phases (Yarbro, 1992). Studies examining the antiretrovi-ral effects of hydroxyurea have demonstrated serum levels rangingfrom 0.01 to 0.13 mM. When applied to neurosphere cultures in thisreport, hydroxyurea significantly inhibited cell proliferation at allthe concentrations tested, although the relative expressions of NSEand TujIII were not significantly reduced.

New methods for the assessment of developmental neurotox-icity are needed urgently (Coecke et al., 2007). Current cellularmethods of developmental toxicity testing include the MME-ESTtest, which analyses changes in marker gene expression in neu-ronal, chondrogenic, osteogenic as well as cardiomyocyte culturesderived from murine stem cells (zur Nieden et al., 2004). Future

work will aim to compare the results obtained using specific devel-opmental neurotoxins on the NT2/D1 model with those obtainedfrom other developing cell types such as those used in the MME-EST. In addition, the effects of toxicants on the morphogenesisof neurons and astrocyte development within the neurospherewill also be studied. The model described in this report mir-rors proliferation, differentiation and morphological development,specifically in human-sourced neuronal cells. Following furtherevaluation, this work is intended to complement current methodsin the ‘triage’ evaluation of the human teratogenic potential of newchemicals.

Conflict of interest

The authors declare that there are no conflicts of interest.

Acknowledgements

This work was supported by the Humane Research Trust, UK(United Kingdom Regd. Charity: 267779). We would also like to

logy 2

250 E.J. Hill et al. / Toxico

thank Professor Zhanfeng Cui, Drs Ann Vernallis and Uday Tirlapurfor their valued assistance and technical advice during this project.

Funding: Humane Research Trust

References

Andrews, P.W., 1984. Retinoic acid induces neuronal differentiation of a clonedhuman embryonal carcinoma cell line in vitro. Dev. Biol. 103, 285–293.

Bani-Yaghoub, M., Felker, J.M., Naus, C.C., 1999. Human NT2/D1 cells differentiateinto functional astrocytes. Neuroreport 10, 3843–3846.

Brodie, M.J., Dichter, M.A., 1996. Antiepileptic drugs. N. Engl. J. Med. 334, 168–175.Cheung, W.M., Fu, W.Y., Hui, W.S., Ip, N.Y., 1999. Production of human CNS neurons

from embryonal carcinoma cells using a cell aggregation method. Biotechniques26, 946–948, 950-2, 954.

Coecke, S., Goldberg, A.M., Allen, S., Buzanska, L., Calamandrei, G., Crofton, K., Hareng,L., Hartung, T., Knaut, H., Honegger, P., Jacobs, M., Lein, P., Li, A., Mundy, W., Owen,D., Schneider, S., Silbergeld, E., Reum, T., Trnovec, T., Monnet-Tschudi, F., Bal-Price, A., 2007. Workgroup report: incorporating in vitro alternative methodsfor developmental neurotoxicity into international hazard and risk assessmentstrategies. Environ. Health Perspect 115, 924–931.

Davila, J.C., Cezar, G.G., Thiede, M., Strom, S., Miki, T., Trosko, J., 2004. Use and appli-cation of stem cells in toxicology. Toxicol. Sci. 79, 214–223.

Deb-Rinker, P., Ly, D., Jezierski, A., Sikorska, M., Walker, P.R., 2005. Sequential DNAmethylation of the Nanog and Oct-4 upstream regions in human NT2 cells duringneuronal differentiation. J. Biol. Chem. 280, 6257–6260.

Draper, J.S., Moore, H.D., Ruban, L.N., Gokhale, P.J., Andrews, P.W., 2004. Cultureand characterization of human embryonic stem cells. Stem Cells Dev. 13, 325–336.

Hao, Y., Creson, T., Zhang, L., Li, P., Du, F., Yuan, P., Gould, T.D., Manji, H.K., Chen,G., 2004. Mood stabilizer valproate promotes ERK pathway-dependent corticalneuronal growth and neurogenesis. J. Neurosci. 24, 6590–6599.

Hardy, M., Younkin, D., Tang, C.M., Pleasure, J., Shi, Q.Y., Williams, M., Pleasure, D.,1994. Expression of non-NMDA glutamate receptor channel genes by clonalhuman neurons. J. Neurochem. 63, 482–489.

Hartley, R.S., Margulis, M., Fishman, P.S., Lee, V.M., Tang, C.M., 1999. Functionalsynapses are formed between human NTera2 (NT2N, hNT) neurons grown onastrocytes. J. Comp. Neurol. 407, 1–10.

Horrocks, G.M., Lauder, L., Stewart, R., Przyborski, S., 2003. Formation of neuro-spheres from human embryonal carcinoma stem cells. Biochem. Biophys. Res.Commun. 304, 411–416.

Hsieh, J., Gage, F.H., 2004. Epigenetic control of neural stem cell fate. Curr. Opin.Genet. Dev. 14, 461–469.

Iezzi, S., Cossu, G., Nervi, C., Sartorelli, V., Puri, P.L., 2002. Stage-specific modulationof skeletal myogenesis by inhibitors of nuclear deacetylases. Proc. Natl. Acad.Sci. U.S.A. 99, 7757–7762.

Jessberger, S., Nakashima, K., Clemenson Jr., G.D., Mejia, E., Mathews, E., Ure, K.,Ogawa, S., Sinton, C.M., Gage, F.H., Hsieh, J., 2007. Epigenetic modulation ofseizure-induced neurogenesis and cognitive decline. J. Neurosci. 27, 5967–5975.

Johnson, G., 1998. Lithium—early development, toxicity, and renal function. Neu-ropsychopharmacology 19, 200–205.

Lee, V.M., Andrews, P.W., 1986. Differentiation of NTERA-2 clonal human embryonalcarcinoma cells into neurons involves the induction of all three neurofilamentproteins. J. Neurosci. 6, 514–521.

LoPachin, R.M., 2004. The changing view of acrylamide neurotoxicity. Neurotoxicol-ogy 25, 617–630.

Megiorni, F., Mora, B., Indovina, P., Mazzilli, M.C., 2005. Expression of neuronal mark-ers during NTera2/cloneD1 differentiation by cell aggregation method. Neurosci.Lett. 373, 105–109.

Murabe, M., Yamauchi, J., Fujiwara, Y., Hiroyama, M., Sanbe, A., Tanoue, A., 2007.A novel embryotoxic estimation method of VPA using ES cells differentiationsystem. Biochem. Biophys. Res. Commun. 352, 164–169.

49 (2008) 243–250

Nelson, P.T., Kondziolka, D., Wechsler, L., Goldstein, S., Gebel, J., DeCesare, S.,Elder, E.M., Zhang, P.J., Jacobs, A., McGrogan, M., Lee, V.M., Trojanowski,J.Q., 2002. Clonal human (hNT) neuron grafts for stroke therapy: neu-ropathology in a patient 27 months after implantation. Am. J. Pathol. 160,1201–1206.

Pacifici, G.M., Nottoli, R., 1995. Placental transfer of drugs administered to themother. Clin. Pharmacokinet. 28, 235–269.

Paquet-Durand, F., Tan, S., Bicker, G., 2003. Turning teratocarcinoma cells into neu-rons: rapid differentiation of NT-2 cells in floating spheres. Brain Res. Dev. Brain.Res. 142, 161–167.

Phiel, C.J., Zhang, F., 2001. Histone deacetylase is a direct target of valproic acid,a potent anticonvulsant, mood stabilizer, and teratogen. J Biol Chem 276 (39),36734–36741.

Pleasure, S.J., Lee, V.M., 1993. NTera 2 cells: a human cell line which displays charac-teristics expected of a human committed neuronal progenitor cell. J. Neurosci.Res. 35, 585–602.

Pleasure, S.J., Page, C., Lee, V.M., 1992. Pure, postmitotic, polarized human neuronsderived from NTera 2 cells provide a system for expressing exogenous proteinsin terminally differentiated neurons. J. Neurosci. 12, 1802–1815.

Przyborski, S.A., Christie, V.B., Hayman, M.W., Stewart, R., Horrocks, G.M., 2004.Human embryonal carcinoma stem cells: models of embryonic developmentin humans. Stem Cells Dev. 13, 400–408.

Przyborski, S.A., Morton, I.E., Wood, A., Andrews, P.W., 2000. Developmental regu-lation of neurogenesis in the pluripotent human embryonal carcinoma cell lineNTERA-2. Eur. J. Neurosci. 12, 3521–3528.

Przyborski, S.A., Smith, S., Wood, A., 2003. Transcriptional profiling of neuronal dif-ferentiation by human embryonal carcinoma stem cells in vitro. Stem Cells 21,459–471.

Rohwedel, J., Guan, K., Hegert, C., Wobus, A.M., 2001. Embryonic stem cells as an invitro model for mutagenicity, cytotoxicity and embryotoxicity studies: presentstate and future prospects. Toxicol. In Vitro 15, 741–753.

Sandhu, J.K., Sikorska, M., Walker, P.R., 2002. Characterization of astrocytes derivedfrom human NTera-2/D1 embryonal carcinoma cells. J. Neurosci. Res. 68,604–614.

Skladchikova, G., Berezin, V., Bock, E., 1998. Valproic acid, but not its non-teratogenicanalogue 2-isopropylpentanoic acid, affects proliferation, viability and neuronal

differentiation of the human teratocarcinoma cell line NTera-2. Neurotoxicology19, 357–370.

Tada, H., Shiho, O., Kuroshima, K., Koyama, M., Tsukamoto, K., 1986. An improvedcolorimetric assay for interleukin 2. J. Immunol. Methods 93, 157–165.

Vernadakis, A., 1996. Glia-neuron intercommunications and synaptic plasticity.Prog. Neurobiol. 49, 185–214.

Wada, A., Yokoo, H., Yanagita, T., Kobayashi, H., 2005. Lithium: potential therapeuticsagainst acute brain injuries and chronic neurodegenerative diseases. J. Pharma-col. Sci. 99, 307–321.

Watson, D.J., Longhi, L., Lee, E.B., Fulp, C.T., Fujimoto, S., Royo, N.C., Passini,M.A., Trojanowski, J.Q., Lee, V.M., McIntosh, T.K., Wolfe, J.H., 2003. Geneti-cally modified NT2N human neuronal cells mediate long-term gene expressionas CNS grafts in vivo and improve functional cognitive outcome follow-ing experimental traumatic brain injury. J. Neuropathol. Exp. Neurol. 62,368–380.

Wobus, A.M., Boheler, K.R., 2005. Embryonic stem cells: prospects for developmentalbiology and cell therapy. Physiol. Rev. 85, 635–678.

Woehrling, E.K., Hill, E.J., Coleman, M.D., 2007. Development of a neurotoxicitytest-system, using human post-mitotic, astrocytic and neuronal cell lines inco-culture. Toxicol. In Vitro 21, 1241–1246.

Yarbro, J.W., 1992. Mechanism of action of hydroxyurea. Semin. Oncol. 19, 1–10.Younkin, D.P., Tang, C.M., Hardy, M., Reddy, U.R., Shi, Q.Y., Pleasure, S.J., Lee, V.M.,

Pleasure, D., 1993. Inducible expression of neuronal glutamate receptor channelsin the NT2 human cell line. Proc. Natl. Acad. Sci. U.S.A. 90, 2174–2178.

zur Nieden, N.I., Kempka, G., Ahr, H.J., 2004. Molecular multiple endpoint embry-onic stem cell test—a possible approach to test for the teratogenic potential ofcompounds. Toxicol. Appl. Pharmacol. 194, 257–269.