EUKARYOTIC CELL, Mar. 2006, p. 530–543 Vol. 5, No. 31535-9778/06/$08.00�0 doi:10.1128/EC.5.3.530–543.2006Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Differential Effects of Heterochromatin Protein 1 Isoforms on MitoticChromosome Distribution and Growth in Dictyostelium discoideum

Markus Kaller,1 Ursula Euteneuer,2 and Wolfgang Nellen1*Abteilung Genetik, Kassel University, Heinrich-Plett-Str. 40, 34132 Kassel,1 and Institute for Zellbiologie,

Ludwig-Maximilians-Universitat, Schillerstr. 42, 80336 Munchen,2 Germany

Received 21 October 2005/Accepted 4 January 2006

Heterochromatin protein 1 (HP1) is a well-characterized heterochromatin component conserved from fissionyeast to humans. We identified three HP1-like genes (hcpA, hcpB, and hcpC) in the Dictyostelium discoideumgenome. Two of these (hcpA and hcpB) are expressed, and the proteins colocalized as green fluorescent protein(GFP) fusion proteins in one major cluster at the nuclear periphery that was also characterized by histone H3lysine 9 dimethylation, a histone modification so far not described for Dictyostelium. The data strongly suggestthat this cluster represents the centromeres. Both single-knockout strains displayed only subtle phenotypes,suggesting that both isoforms have largely overlapping functions. In contrast, disruption of both isoformsappeared to be lethal. Furthermore, overexpression of a C-terminally truncated form of HcpA resulted inphenotypically distinct growth defects that were characterized by a strong decrease in cell viability. Althoughgenetic evidence implies functional redundancy, overexpression of GFP-HcpA, but not GFP-HcpB, causedgrowth defects that were accompanied by an increase in the frequency of atypic anaphase bridges. Our dataindicate that Dictyostelium discoideum cells are sensitive to changes in HcpA and HcpB protein levels and thatthe two isoforms display different in vivo and in vitro affinities for each other. Since the RNA interference(RNAi) machinery is frequently involved in chromatin remodeling, we analyzed if knockouts of RNAi compo-nents influenced the localization of H3K9 dimethylation and HP1 isoforms in Dictyostelium. Interestingly,heterochromatin organization appeared to be independent of functional RNAi.

The correct organization of chromatin is an essential pre-requisite for gene regulation and chromosome function in eu-karyotes. Large blocks of heterochromatin usually specify cen-tromeres and telomeres (20). The underlying DNA sequenceat these loci mostly consists of tandem repeats and transpos-able elements and is packaged in higher order chromatin struc-tures that are believed to prevent recombination events be-tween homologous DNA sequences. Heterochromatin thusserves to maintain genomic integrity by regulating DNA acces-sibility. Heterochromatin was believed to be inaccessible fortranscription factors and, thus, is transcriptionally silent. In thelast few years, this view has significantly changed. At least insome organisms, transcriptional silencing at heterochromaticloci is reinforced by an autoregulatory feedback loop that post-transcriptionally degrades occasionally occurring transcriptsvia the RNA interference (RNAi) pathway (72). The resultingsmall interfering RNAs (siRNAs) recruit protein factors thatmediate heterochromatin formation to these loci (44, 66, 70).The RNAi machinery may thus contribute to the maintenanceof genomic integrity and, consequently, to mitotic and meioticchromosome segregation (21, 71).

Since its original discovery in Drosophila melanogaster (25)as a nonhistone heterochromatin component, HP1 and itshighly conserved homologues in other organisms have beencharacterized in detail and by now represent a paradigmaticexample for proteins involved in higher order chromatin as-sembly (59). HP1 has been linked to gene silencing events such

as position-effect variegation in Drosophila melanogaster (61),mating-type silencing in Schizosaccharomyces pombe (46), ormammalian position-effect variegation (11).

HP1-like proteins are characterized by a conserved trimod-ular structure that is crucial for their roles as adaptors con-necting different complexes involved in formation and mainte-nance of heterochromatin. The N-terminal chromodomain ofHP1 is necessary for binding to histone H3 tails methylated atresidue lysine 9 (1, 34), a characteristic heterochromatin markintroduced by site-specific histone methyltransferases (HMTs)(57). HP1 is thus an example for proteins that read the histonecode carried by specific histone modifications.

The C-terminal chromoshadow domain (CSD) is an inter-action module responsible for binding a wide range of otherproteins that in most cases contain a loosely conserved PxVxLmotif (65, 69). The pentapeptide motif is present in the CSDitself and allows formation of homo- and heterooligomers ofHP1 and its different isoforms that contribute to stability andspreading of heterochromatin domains (20). In addition,dimerization of HP1 proteins via their CSDs is required forinteraction with other protein partners (3). Although oligomer-ization is a conserved property of HP1 proteins, the significanceof isoform stoichiometry in the complexes is unclear.

The chromodomain and the CSD are separated by a less con-served linker region, the “hinge,” that contributes to heterochro-matin targeting by its ability to bind DNA and RNA (45, 76).

Many organisms, for example, Drosophila melanogaster, C.elegans, and vertebrates, have two or more different HP1 iso-forms. These are largely nonredundant, as shown by geneticanalysis or biochemical characterization (5, 42, 64). The lethal-ity of HP1 mutants further argues that at least some HP1isoforms are essential (7, 12).

* Corresponding author. Mailing address: Kassel University, FB 18,Abt. Genetik, Heinrich-Plett-Str. 40, 34132 Kassel, Germany. Phone: (49)561-804-4805. Fax: (49) 561-804-4800. E-mail: nellen@uni-kassel.de.

530

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

In several organisms, HP1 proteins are crucial for hetero-chromatin function at centromeres. For example, pericentro-meric heterochromatin in S. pombe is required for recruitmentof cohesin complexes that regulate sister chromatid cohesionand thus mitotic chromosome segregation. Consequently, aloss of the S. pombe HP1 homologue Swi6 leads to elevatedrates of chromosome loss (2, 8, 52). In addition to their cen-tromeric function, HP1 proteins are also involved in telomerecapping, which serves to protect the ends of linear chromo-somes that may otherwise be recognized by the DNA repairmachinery (54). Loss of HP1 at telomeres causes end-to-endchromosome fusions in Drosophila (10). Association of HP1proteins with telomeres was also observed in mammalian cells(16). Moreover, derepression of subtelomeric reporter genescorrelates with delocalization of HP1 proteins (31).

Apart from their function in heterochromatin, HP1 proteinsalso play a role in the repression of individual euchromaticgenes. In these cases, their function depends on interactionswith sequence-specific repressor proteins, such as retinoblas-toma protein (Rb) (51) or members of the TIF family (35, 49),and are mostly isoform specific.

Dictyostelium is a convenient model system to study various cellbiological aspects, such as signal transduction, cell differentiation,cell motility, and cytokinesis. However, little is known about thesubnuclear organization of its six chromosomes.

Although the Dictyostelium discoideum genome is com-pletely sequenced (6), the information on centromeric andtelomeric structures is limited. It is assumed that centromeresreside within clusters of repetitive DNA (e.g., transposons andretrotransposons) that are preferentially located at chromo-some ends (6). The lack of a conserved underlying DNA se-quence strongly argues that epigenetic factors probably play arole in centromere positioning, maintenance, and function inDictyostelium.

Dictyostelium has recently been introduced as a model sys-tem to study RNAi-mediated gene silencing (38). To provide abasis for investigating RNA-mediated chromatin remodelingin Dictyostelium, we characterized well-defined heterochromatincomponents in this organism. We identified three genes encodingHP1-like proteins and analyzed the two isoforms that are ex-pressed during normal growth and development.

MATERIALS AND METHODS

Plasmids. To generate C-terminally green fluorescent protein (GFP)-taggedHcpA and HcpB, the respective cDNA was amplified using primers 5� GAATTCAAAATGGGAAAAAGAGATAAGAG and 5� GGATCCACTTTGTTGACCCTTATAACC for hcpA and 5� GCTAAAAGAATTCAAAATGGGAAAAAGAG and 5� GGATCCACTTGGCTGACCACTATAACC for hcpB andcloned into the EcoRI and BamHI sites of pDd-GFP (36). For N-terminal GFPfusions, hcpA was amplified using primers 5� GTCGACATGGGAAAAAGAGATAAGAGAATAATAG and 5� GGATCCTTTTAACTTTGTTGACCCTTATAACC, and hcpB was amplified with primers 5� CAGCTAAAATTGTCGACATGGGAAAAAGAG and 5� GGATCCTTAACTTGGCTGACCACTATAACC and cloned into the SalI and BamHI sites of pdneo2-GFP (56). For theHcpA-red fluorescent protein (RFP) fusion, the GFP coding sequence of pDd-HcpA-GFP was replaced by mutant RFP (RedStar) from p415Gal1-Redstar (30)by digestion with BglII/XhoI and ligation into BamHI/XhoI-digested pDd-HcpA-GFP.

The chromoshadow domain deletions (HcpA�C-GFP and HcpB�C-GFP)were designed with primers 5� GAATTCAAAATGGGAAAAAGAGATAAGAG and 5� ATTGGATCCACCTTCAATATAAGGTACACC for hcpA and5� GCTAAAAGAATTCAAAATGGGAAAAAGAG and 5� ATTGGATCCACCTTCAATATAAGGTACACC for hcpB and cloned into the EcoRI and

BamHI sites of pDd-GFP. For these constructs, identical reverse primers forboth isoforms were used, since the primer binding sites were identical in bothcoding sequences.

Knockout constructs were generated using a blasticidin resistance cassette (68)with flanking arms of 625 bp and 501 bp for hcpA or 703 bp and 821 bp for hcpB.Primers to create recombinogenic arms were 5� ATAGGATCCGAAGACCCTTTTAAGAAATGTTGTC and 5� TTGAAGCTTTTTTCTTGTTCTCTTGAACTTTC as well as 5� GCATGCCAAATCATTTAATTGATGATG and 5� ATGGGCCCGAAGACGAATTATTTAGTAATTCTTTAAAATATG for hcpA,and 5� ATTGGGCCCGAAGACAAAATTCACCATATAAGGGG and 5� ATTGCATGCCCATGTATCTTAATCTGATG as well as 5� ATTAAGCTTCATCAACAACAGCAGCAGCACC and 5� ATTGGATCCGAAGACTTACCCCATCCAAACAATGAG for hcpB.

For both targeting constructs, the recombinogenic arms were cloned intopGEM7z-BSR, flanking the blasticidin resistance cassette. The vector pGEM7z-BSR was generated by cloning the BSR cassette (68) into the HindIII/XbaI sitesof pGEM7z (Promega).

Knockout constructs were designed to disrupt the respective open readingframes (ORFs) between the N-terminal chromodomain and the nuclear local-ization signal (NLS) within the hinge region (data not shown). The truncatedgenes should thus not generate any functional, correctly localized protein.

For disruption of both endogenous hcp genes, the BSR cassette of both tar-geting constructs was excised with XbaI and HindIII and replaced by a BSR

cassette with flanking loxP sites excised from pLPBLP (9) with BcuI and HindIII.Recombinant His-tagged HcpA and HcpB was produced by cloning the

cDNAs into the NdeI and BamHI sites of pET15b (Invitrogen). Primers used foramplification of the respective cDNAs were 5� CATATGGGAAAAAGAGATAAGAGAATAATAG and 5� GGATCCTTTTAACTTTGTTGACCCTTATAACC for hcpA and 5� GCTAAAATTGTAACATATGGGAAAAAGAG and5� GGATCCTTAACTTGGCTGACCACTATAACC for hcpB.

Induction and protein expression was performed in Escherichia coli BL21(DE3)according to the manufacturer’s instructions.

For expression of 6� His-tagged fusion proteins in Dictyostelium discoideum,the coding sequences were amplified from the respective pET-15b-derived plas-mids and cloned into the EcoRI and BamHI sites of pDEX-DnmA, from whichthe DnmA (32) coding sequence had been excised.

Strains. Transformations to generate knockout and overexpression mutantswere performed in the Ax2 parent strain. Dictyostelium transformations andcotransformations were carried out as described previously (47, 48).

Gene disruptions and subcloning were done by homologous recombination(74). Clones were analyzed by PCR as described previously (38).

For hcpA, primers 5� CAGTTACTTGTTTCATTATGGC and 5� CGCTACTTCTACTAATTCTAGA were used to verify site-specific integration of the BSR

cassette. For hcpB, primers were 5� AAAAGATATAGAATCTACAACTATCand 5� CGCTACTTCTACTAATTCTAGA.

For the generation of hcpA/hcpB double knockout strains, the Ax2 strain wasfirst transformed with the hcpA targeting construct containing a BSR cassettewith flanking loxP sites. Isolation of hcpA mutant cells was carried out as de-scribed above. Transient expression of Cre-recombinase, screening for blasticidin,and G418 sensitivity were carried out as described previously (9). The generatedhcpAlp strain was then transformed with the hcpB targeting construct or transformedwith pDEX-RH-His-HcpA prior to hcpB targeting.

RT-PCR analysis. Total cellular RNA was prepared as described previously(37). Total RNA was DNase-treated before cDNA synthesis to eliminategenomic DNA contaminations. Reverse transcription-PCR (RT-PCR) analysisusing Revert Aid H Minus M-MulV Reverse Transcriptase (MBI) was per-formed according to the manufacturer’s instructions. Primers used to analyzeexpression levels of Hcp isoforms and the unrelated thioredoxin gene in knock-out and overexpression strains were hcpA forward (for), 5�CATATGGGAAAAAGAGATAAGAGAATAATAG; hcpA reverse (rev), 5� GGATCCTTTTAACTTTGTTGACCCTTATAACC; hcpB for, 5� GCTAAAAGAATTCAAAATGGGAAAAAGAG; hcpB rev, 5� GGATCCACTTGGCTGACCACTATAACC; trxfor, 5� GAACGAGCTCCATGGCCAATAGAGTAATTCATG; and trx rev, 5�CGCGGATCCTTATTTGTTTGCTTCTAGAGTACTTC.

Cell culture. Growth curves of Ax2, hcpA mutant, and hcpB mutant were donein axenic suspension culture in HL5 medium (67) on a rotary shaker at 150 rpm.For the overexpression strains, HL5 medium supplemented with 20 �g/ml geni-ticin was used. The starting cell density was 1 � 105 to 3 � 105/ml for growth at22°C and at 15°C. Cell densities were measured with a Coulter Counter every 4to 6 h for 48 to 72 h at 22°C and every 24 h for 10 to 15 days at 15°C. All growthcurves were measured in duplicate.

In order to determine cell viability, the plating efficiency of cell suspensionsthat had been cultured for 48 h on rotary shakers was determined. Cell densities

VOL. 5, 2006 HP1-LIKE PROTEINS 531

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

were measured before serial dilution in phosphate buffer. Cells were platedtogether with Klebsiella aerogenes suspension on nonselective SM agar (67) platesand allowed to grow for 72 h. Colonies were counted, and the plating efficiencywas calculated by dividing colony number by cell density times dilution factor.

Immunodetection. Dictyostelium discoideum cells were grown on coverslips inpetri dishes containing the appropriate selective medium for 20 to 24 h. Cellswere then fixed in �20°C methanol for 20 min, washed three times in 1�phosphate-buffered saline (PBS), and blocked with PBG buffer (1� PBS with 3%bovine serum albumin and 0.045% cold water fish gelatin; Sigma) for 1 h at 37°C.Primary antibodies were applied in appropriate dilutions and incubated overnight at 4°C.

For detection of histone H3K9 dimethylation, a polyclonal rabbit antibody(Upstate Biotechnology) diluted 1:100 was used. For staining of centrosomes, theanti-DdCP224 antibody (18) was used in a 1:100 dilution. After six washes inPBG, Cy3-conjugated secondary antibodies (Dianova, Hamburg, Germany) wereapplied in a 1:1,000 dilution in PBG for 1 h at 37°C. DNA was stained with4�,6�-diamidino-2-phenylindole (DAPI) (1 mg/ml) diluted 1:15,000 in 1� PBS.

Mitotic analysis. For mitotic assays, cells were precultured in petri dishes at22°C and 15°C and then diluted to 3 � 105/ml at 22°C and 7 � 105/ml at 15°C,respectively. Cells were then grown on coverslips in petri dishes covered with 5ml of HL5 medium for 20 to 24 h and fixed as described above. Mitotic cells weredetected by anti-DdCP224 or by anti-�-tubulin staining. For determination of thefrequency of anaphase bridges, only late mitotic cells with spindles that were �5�m were counted, and the number of mitoses with DNA bridges was determined.

Statistical evaluation. To get a significance level for the observation thatoverexpression of GFP-HcpA leads to a higher frequency of anaphase bridges inlate mitotic cells, two procedures were applied.

Procedure 1. As the number of anaphase bridges also depended on the num-ber of counted cells, we adjusted the data to 90 counted cells per cell type,resulting in 11 or 12 anaphase bridges for GFP-HcpA cells and letting all othernumbers be fixed. This procedure even reduced the chance to obtain a convinc-ing level of significance. We computed the chi-squared (�2) statistics with thefollowing equation: i1

8 [ki � (m/8)]2/(m/8), where the ki is the respective numberof anaphase bridges, with k5 12 or 11 and m 29 or 28 for the total count ofanaphase bridges. The calculated value was compared with the respective valuesobtained after randomly distributing m objects in 8 boxes, the well-known urnmodel in stochastics, which represents the null hypothesis we want to reject.Thus, for k5 12, we obtained the significance value of � 0.0014; for k5 11,the significance value was � 0.0052.

Procedure 2. In each of the first seven cases, we have purely randomly chosen90 trials and noted the ki numbers of the chosen trials in each of the seven casesin which there occurred anaphase bridges. Of course, k8 3. Like the firstprocedure, we determined the significance level (�) of the obtained 8-tuple (k1

to k8). This was repeated 1,000 times. For the mean of the obtained values for thesignificance level, we obtained an �m of 0.0032 and for the median an m of 0.0009(see Table 3).

Summarizing these numerical results, our experimental observations show forthe significance level of at least 0.005 that overexpression of GFP-HcpA resultsin a higher frequency of anaphase bridges than in the other cell types.

Fluorescence microscopy. For microscopic analysis a Leica DM IRB invertedfluorescence microscope was used, and for image acquisition a Leica DC 350Fdigital camera and IM50 software were used. Images were processed in AdobePhotoshop.

Electron microscopy. Nuclei were isolated from HcpA-GFP- and HcpB-GFP-expressing cells (33) that had been treated with 100 �M thiabendazole for 4 h.The nuclei were centrifuged onto round coverslips and fixed with 2% parafor-maldehyde in modified PHEM buffer [15 mM piperazine-N,N�-bis(2-ethanesul-fonic acid), 6 mM HEPES, 10 EGTA, 0.5 mM MgCl2, pH 7] (24) for 20 min. Thepreparations were treated with 1 mg/ml bovine serum albumin, 5% fetal calfserum, and 2% cold water fish gelatin to reduce nonspecific staining and wereincubated with an anti-GFP antibody for 1 h. Five nanometer protein A gold(Department of Cell Biology, University Medical Center, Utrecht, The Nether-lands) was applied for 2 h, and after extensive washes the nuclei were postfixedwith 1% glutaraldehyde for 5 min. The subsequent fixation with 1% OsO4 incacodylate buffer, dehydration, and embedment in Epon/Araldite were carriedout according to standard procedures (27). Thin sections were cut using aReichert Ultracut E, stained with uranyl acetate and lead citrate, and observedin a Jeol EM 1200 EX II.

Pull-down assays. His-tagged HcpA and HcpB were purified on Ni-Sepharosebeads (Amersham) according to the manufacturer’s instructions.

Cell lysates from a Dictyostelium discoideum strain expressing GFP-taggedfusion proteins were prepared by sonifying 1 � 108 cells from axenic suspension

culture three times for 15 s in 10 ml lysis buffer (20 mM phosphate buffer, pH 7.5,300 mM NaCl, 10 mM imidazole, 0.5% NP-40).

For isolation of Hcp binding proteins, recombinant His-tagged HcpA or HcpBwas immobilized on a Ni-Sepharose column. Cell lysates were mixed with pre-coated Ni-Sepharose beads and rotated for 1 to 2 h on a spinning wheel. Beadswere spun down by brief centrifugation. The supernatant was stored, and thebeads were washed with at least 20 column volumes of binding buffer. Therespective Hcp and bound proteins were then eluted with 250 mM imidazole.Eluted fractions were analyzed by sodium dodecyl sulfate–polyacrylamide (12%)gel electrophoresis. Proteins were stained with Coomassie and detected on West-ern blots by a monoclonal anti-GFP (Chemicon, Temecula, CA) or anti-Hisantibody.

The same protocol was applied for determining in vivo interactions, exceptthat extracts from His-HcpA/GFP-HcpB- and His-HcpA/GFP-HcpA-cotrans-formed cell lines were directly incubated with the Ni-Sepharose beads.

Strains. Strains used in this study were Dictyostelium discoideum Ax2, Ax2HcpA�, Ax2 HcpB�, Ax2 GFP-HcpA, Ax2 GFP-HcpB, Ax2 His-HcpA, Ax2 His-HcpB, Ax2 HcpA-GFP, Ax2 HcpB-GFP, Ax2 HcpA�C-GFP, and Ax2 HcpB�C-GFP and E. coli DH5� (Promega) and BL21(DE3) pLysS (Invitrogen).

Nucleotide sequence accession numbers. Sequences determined in the courseof this work were submitted to Dicty Base (http://dictybase.org/) under the

FIG. 1. Alignment of HP1-like proteins. HcpA, HcpB, and HcpCwere aligned with human HP1 orthologues HP1�, HP1�, and HP1�.The highly conserved chromodomain and chromoshadow domain areunderlined in black. Functionally important amino acid residues in thechromodomain are indicated as squares. Black shading indicates aro-matic residues that form a pocket required for methyl-lysine binding;light gray shading indicates additional residues required for methyl-lysine recognition; dark gray shading indicates residues required forrecognition of Ala 7 in the histone H3 N terminus (50). Functionallyimportant amino acid residues in the chromoshadow domain are in-dicated as circles. Light gray circles indicate residues that form theCSD dimer interface (3). Residues required for recognition of thePxVxL motif in HP1-interacting proteins are shown in dark gray (cen-tral valine) and black (proline and leucine) circles (69). The nuclearlocalization signals within the hinge region are underlined in gray.Note that the previously described bipartite NLS within the hingeregion of the human HP1 proteins (64) is missing in the Dictyosteliumproteins but lies adjacent to the chromodomain. Abbreviations: Dd,Dictyostelium discoideum; Hs, Homo sapiens.

532 KALLER ET AL. EUKARYOT. CELL

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

following accession numbers: hcpA, DDB0220646; hcpB, DDB0220645; andhcpC, DDB0220647.

RESULTS

HP1-like proteins in Dictyostelium discoideum. A databasesearch using the human HP1� sequence and a tBLASTN al-gorithm revealed the presence of three putative genes encod-ing HP1-like proteins in the Dictyostelium discoideum genome.All three displayed the characteristic hallmarks of HP1 pro-teins: an N-terminal chromodomain and a C-terminal chromo-shadow domain separated by a less conserved hinge region.The genes were denominated hcpA, hcpB, and hcpC (Fig. 1).HcpA displays 70% identity (77% similarity) with HcpB butonly 62% identity (75% similarity) with HcpC. Sequence anal-ysis further showed that amino acid residues within the chromo-domain that are required for function, such as methyl-lysinebinding, were highly conserved in the Dictyostelium proteins,whereas functionally important amino acid residues within thechromoshadow domain were less conserved (Fig. 1). TheHcpA chromodomain displayed highest similarity to that ofhuman HP1� (79%) and slightly less to the �- and �-isoforms(73% and 77%, respectively). For comparison, the chromo-shadow domain of HcpA displayed 52%, 48%, and 46% simi-larity to the human �-, �-, and �-isoforms, respectively.

RT-PCR analysis showed that hcpA and hcpB were ex-pressed in axenically grown cells (see below) and throughoutdevelopment (data not shown). hcpC transcripts were not de-tected under these conditions, while the gene-specific primersreadily showed a PCR product when using genomic DNA(data not shown). To see if hcpC was induced as a potentialcompensatory mechanism, we investigated its transcription inhcpA and hcpB knockout strains but could not detect any

RT-PCR signal. Apparently, hcpC is not expressed at all or hasa very restricted expression pattern. It was therefore excludedfrom further studies.

HcpA and HcpB display largely identical subnuclear local-ization. To study the subnuclear organization of Dictyosteliumheterochromatin, we used C-terminally GFP-tagged HcpA andHcpB (HcpA-GFP and HcpB-GFP). Both proteins localized toone major spot at the nuclear periphery and several minor foci(Fig. 2A). Depending on expression levels, some nucleoplas-mic staining, probably representing unbound HP1 molecules,was observed. Furthermore, coexpression of HcpA-RFP andHcpB-GFP showed that HcpA and HcpB colocalize (Fig. 2B),indicating that the subnuclear distribution of both isoforms isvery similar. Electron microscopy revealed that the fusion pro-teins colocalize with electron-dense structures at the nuclear pe-riphery close to the centrosome (shown for HcpA-GFP in Fig.2C). These structures contain the kinetochores/centromeres ofDictyostelium chromosomes (43). Centrosomes have previouslybeen characterized by electron microscopy and immuno-staining with specific monoclonal antibodies, like DdCP224(see below) (19).

Dimethylated lysine 9 of histone 3 (H3K9me2) is a furtherhallmark for heterochromatin and serves as a binding site forHP1 proteins (1, 34). To test for this association in Dictyostelium,double-labeling experiments were performed and showed thatboth HcpA-GFP and HcpB-GFP colocalized with H3K9me2(Fig. 2A). The same was true for the respective N-terminalGFP fusion proteins (termed GFP-HcpA and GFP-HcpB; datanot shown). The specificity of the H3K9me2 antibody, origi-nally raised against methylated human histone H3, was verifiedby Western blotting. It recognized a single 17-kDa protein

FIG. 2. Localization of HP1 proteins. A) HcpA-GFP and HcpB-GFP localize to one major and several minor foci at the nuclear periphery.Since the plain of the major spot is shown, only one or two minor foci are seen. Although driven by identical promoters, the fusion proteins displaysignificant differences in expression levels. Note the increased nucleoplasmic staining by HcpB-GFP. HcpA-GFP and HcpB-GFP both colocalizewith histone H3K9me2 in the majority of subnuclear foci. Bar, 5 �m. B) Cotransformed HcpA-RFP and HcpB-GFP constructs demonstratecolocalization of HP1 isoforms. In this example, both proteins are seen in one major and one minor focus at the nuclear periphery. Bar, 5 �m.C) An isolated nucleus/centrosome complex from cells expressing HcpA-GFP is shown. The centrosome is marked with an asterisk. The three darkareas represent nuclear caps (nucleoli). The image on the right shows the labeling of HcpA-GFP with 5 nm gold-coupled anti-GFP antibodies ata higher magnification. The label is predominantly found in a strictly confined area of electron-dense material close to the centrosome. The nuclearenvelope has been extracted by Triton X-100 during the isolation procedure. Bar, 200 nm.

VOL. 5, 2006 HP1-LIKE PROTEINS 533

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

which corresponds in size to the Dictyostelium histone H3 (datanot shown).

HcpA and HcpB form homo- and heterodimers in vitro andin vivo. A conserved feature of HP1 proteins is their ability toform multimeric complexes by homo- and heterodimerizationthrough their chromoshadow domains (3, 51). Since we foundlargely identical subnuclear distribution of both Hcp isoforms,we determined if HcpA and HcpB are capable of dimerizationin vitro. Bacterially expressed His-tagged HcpA or HcpB wasimmobilized on Ni-Sepharose columns. Extracts fromDictyostelium discoideum cells expressing GFP-HcpA werepassed over the matrix, and bound proteins were eluted withimidazole (Fig. 3A). Both His-HcpA and His-HcpB were ableto retain GFP-HcpA and GFP-HcpB on the column (Fig. 3B).This showed that the Dictyostelium proteins could form bothhomo- and heterodimers. Relatively, His-HcpA retained muchless GFP-HcpA than GFP-HcpB (Fig. 3B). This was reproduc-ible in multiple experiments, which always showed a faint butdefined band. The significance of the precipitation was con-firmed by control experiments where beads without coupledHcp protein were incubated with extracts from Dictyosteliumdiscoideum cells expressing GFP-HcpA or GFP-HcpB. In bothcases no band was detected in the precipitate (Fig. 3B).

GFP fusions of HcpA or HcpB lacking the chromoshadowdomain (HcpA�C-GFP and HcpB�C-GFP) could not formany detectable dimers with immobilized His-HcpA (Fig. 3C),indicating that the chromoshadow domain is required fordimerization. This is consistent with findings for HP1 homo-logues from other organisms.

To confirm that both isoforms are also capable of homo- andheterodimerization in vivo, we generated cell lines that stablyexpressed both His-tagged HcpA and either GFP-HcpA orGFP-HcpB. Ni-Sepharose beads were then incubated with cellextracts from these cell lines (Fig. 4A). For both cotransfor-mations, GFP-HcpA and GFP-HcpB could be coeluted withHis-HcpA, indicating that both isoforms form oligomeric com-plexes in vivo (Fig. 4B).

Remarkably, significantly more GFP-HcpB than GFP-HcpAwas coeluted with His-HcpA, although the expression levels ofHis-HcpA were very similar in both cell lines (Fig. 4C) and therespective GFP-fusion proteins were present in excess overHis-HcpA.

In both experiments, HcpA-homodimer formation appearedto be less favorable than HcpA-HcpB-heterodimer or HcpB-homodimer formation. This suggests that the two isoformsdifferently contribute to heterochromatin formation.

Although the amino acid sequences of the chromoshadowdomains of Dictyostelium and mammalian HP1 proteins aresignificantly divergent (Fig. 1), they display the characteristichallmarks of homo- and heterodimerization. This sequencedivergence possibly confers a distinct species-specific recogni-tion of interaction partners. For example, His-HcpA formedhomo- and heterodimers with the Dictyostelium isoforms butwas unable to interact with murine HP1� (data not shown).

Mitotic dynamics of Dictyostelium heterochromatin. In inter-phase cells, the major heterochromatic cluster is closely asso-ciated with the centrosome, a nucleus-associated body in Dic-tyostelium (Fig. 5, interphase; see also Fig. 2C). Since thisassociation was stable in randomly migrating or chemotaxing

cells (data not shown), this indicated a functional relationshipand was reminiscent of centromeric heterochromatin in S.pombe, which is closely connected to the nuclear membrane-embedded spindle pole body (15).

FIG. 3. Homo- and heterodimer formation of HP1-like proteins invitro. A) Scheme for pull-down analysis. Ni-Sepharose beads preloadedwith either His-HcpA or His-HcpB were incubated with Dictyosteliumdiscoideum cell lysates containing GFP-HcpA and GFP-HcpB eitheralone or in combination were treated as shown. B) GFP-HcpA and GFP-HcpB bind to both His-HcpA or His-HcpB but not to empty beads. I,input; S, supernatant; P, pellet (7- or 10-fold concentrated with respect toI and S). C) Neither HcpA�C-GFP nor HcpB�C-GFP can bind to His-HcpA. His-HcpA was immobilized on Ni-Sepharose beads and incubatedwith cell lysates containing either HcpA�C-GFP or HcpB�C-GFP. I,input; S, supernatant; P, pellet (10-fold concentrated with respect to I andS). D) Western blots showing proteins used in this study. Left, bacteriallyexpressed His-HcpA and His-HcpB stained with an anti-His antibody.Right, cell lysates from the indicated Dictyostelium discoideum overexpres-sion strains were probed with �-GFP antibody.

534 KALLER ET AL. EUKARYOT. CELL

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

To examine if the major heterochromatic cluster repre-sented Dictyostelium centromeres, we analyzed HcpA-GFPand HcpB-GFP distribution during mitotic stages in asynchro-nously growing Dictyostelium discoideum cells. Mitoses wereidentified by antibodies directed either against DdCP224, aDictyostelium XMAP215 homologue that stains the centro-some and the mitotic spindle (18, 19), or against �-tubulin (28).

During interphase, both Hcp-GFP fusion proteins localizedto one prominent cluster at the nuclear periphery directlyopposite the centrosome and colocalized with H3K9 dimethyl-ation. In prophase, when Dictyostelium centrosomes are dupli-cated, the cluster split up into several smaller foci. In somepreparations, up to six spots could be distinguished that may

represent the centromeres of the six Dictyostelium chromo-somes (Fig. 5A, b, prophase inset). This was similar to peri-centromeric heterochromatin in S. pombe that also splits upduring mitotic prophase (15, 55). In prometaphase, when theduplicated spindle poles separate and penetrate the nuclearenvelope, the majority of the nuclear HcpA-GFP and HcpB-GFP enters the cytoplasm, indicated by a significant increase incytoplasmic and loss of nucleoplasmic GFP staining (Fig. 5B, c).This probably represents passive diffusion and not an activeprocess, since a similar relocalization has been described forNLS-tagged GFP (75). Both observations argue that mitosismay not be completely closed in Dictyostelium discoideum.

In metaphase, heterochromatin localizes between a bilay-ered structure at the central spindle that is stained by theanti-DdCP224 antibody (Fig. 5A, d) and that probably repre-sents the kinetochore region (58). During anaphase, the het-erochromatic clusters divided and moved toward the spindlepoles, leading the separated DNA masses. Similar mitotic dy-namics of heterochromatin were observed for histone H3K9dimethylation (Fig. 6). Although GFP-fused Hcp proteins stayassociated with heterochromatin throughout the entire cellcycle, we reproducibly detected a significant loss of Hcp pro-teins at heterochromatin during late mitotic stages and anincrease in cytoplasmic staining compared to interphase (Fig. 5and 6). This is best demonstrated in Fig. 5B, g, where aninterphase cell with strong HcpB-GFP centromere staining isshown next to a telophase cell with very weak GFP label.Although we cannot say if this behavior represents that of theendogenous proteins, it may indicate that heterochromatic lo-calization of Hcp proteins is dynamically regulated during thecell cycle. Similar observations for HP1 dissociation from het-erochromatin during mitosis have been made in mammaliancells (13, 23). In conclusion, the colocalization data and themitotic behavior strongly suggested that the foci stained by theGFP-labeled HP1 isoforms represent centromeric heterochro-matin.

Knockout mutants of hcpA, but not of hcpB, show tempera-ture-dependent growth defects. To analyze the function of thetwo HP1 isoforms, we generated knockout strains for bothhcpA and hcpB by homologous recombination (data notshown). Under standard laboratory conditions, none of thesingle-knockout strains displayed a significant phenotype inaxenic suspension culture or during development (data notshown). However, at lower temperatures, the hcpA mutantstrain but not the hcpB mutant strain displayed a slight growthdefect in suspension culture compared to the parent Ax2 strain(Table 1).

In S. pombe, knockout of swi6 causes a similar temperature-dependent growth defect that is characterized by increasedchromosome missegregation rates and can be mimicked bymicrotubule-destabilizing drugs such as thiabendazole (8). Incontrast to that, we could not detect any defects in mitoticprogression or an obvious chromosome missegregation pheno-type. Furthermore, the temperature sensitivity of the hcpAmutant could not be mimicked by thiabendazole treatment,indicating that microtubule (dys)function was not involved(data not shown). Therefore, the reason for the temperaturesensitivity of the hcpA mutant remains unclear.

Despite subtle differences at low temperature, the lack of a

FIG. 4. Homo- and heterodimer formation of HP1-like proteins invivo. A) Scheme for pull-down analysis. Ni-Sepharose beads wereincubated with total cell lysates from Dictyostelium discoideum celllines cotransformed with His-HcpA and GFP-HcpA or GFP-HcpB. B)Both GFP-HcpA and GFP-HcpB are coeluted with His-HcpA fromNi-Sepharose beads. His-HcpA is under the control of an actin 15promoter and expressed at very low levels in the cell. It is thereforehardly detectable in the input fraction but effectively enriched in thepellet fraction. GFP-HcpB runs as a double band in this gel. C) His-HcpA is detectable in nuclear extracts of cotransformants. Nuclearextracts were subjected to sodium dodecyl sulfate-polyacrylamide gelelectrophoresis and Western blot analysis. His-HcpA was detectedwith �-His antibody. Abbreviations: I, input; S, supernatant; P, pellet.Pellet fractions were 20-fold concentrated with respect to input andsupernatant.

VOL. 5, 2006 HP1-LIKE PROTEINS 535

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

mutant phenotype under standard conditions argued for a re-dundancy of the two Hcp isoforms in most functions.

We therefore attempted to disrupt both endogenous genes tocreate double-knockout mutants. Since the gene disruption fre-quencies for the two hcp genes were reproducibly dissimilar (4%for hcpA compared to 67% for hcpB), we first created an hcpAmutant cell line that was followed by Cre-mediated excision of theblasticidin resistance cassette (Fig. 7A). Cre-mediated recombi-nation was verified by restriction fragment length polymorphismof the PCR products that were amplified from either the wild-type hcpA gene or the disrupted hcpA gene after Cre recombi-nation (Fig. 7A). The resulting cell line, termed hcpAlp, was thentransformed with the hcpB targeting construct. Remarkably, wewere not able to isolate any hcpB mutant clones in the hcpAlp

background from three independent transformations, indicatingthat disruption of the second hcp gene greatly affected viability.Ectopic overexpression of an His-HcpA protein in the hcpAlp

background (Fig. 7B) prior to hcpB targeting at least partially

restored the disruption frequencies that we had observed in theAx2 wild-type background (Table 2) and resulted in double-knockout strains. This suggested that the prior introduction of afunctional gene could rescue the presumably lethal phenotype.The genetic composition of isolated clones was confirmed byPCR on the wild-type and mutated hcpB locus by PCR on thehcpAlp locus and by Western blots showing expression of His-HcpA (Fig. 7C). No obvious phenotypic differences between thehcpAB mutant–His-HcpA and the parental hcpAlp–His-HcpAcells could be observed (data not shown). These findings indi-cated that the two Hcp isoforms were largely redundant and thatthe presence of at least one isoform was essential for cell viability.The data further confirmed that ectopically expressed His-HcpAcan functionally replace the endogenous gene, at least with re-spect to cell viability.

Overexpression of GFP-HcpA, but not of GFP-HcpB, leadsto an increased number of anaphase bridges. The C-terminalGFP fusion HcpA-GFP was consistently expressed at much

FIG. 5. Mitotic dynamics of Dictyostelium heterochromatin. A) Cells expressing HcpA-GFP; B) cells expressing HcpB-GFP. During interphase,heterochromatin localizes next to the nucleus-associated centrosome (see inset). During prophase, the heterochromatin cluster divides in up to sixspots (see inset). During prometaphase, nucleoplasmic protein enters the cytoplasm, indicated by increased cytoplasmic fluorescence. Thetelophase panel for HcpB-GFP shows a telophase and an interphase cell to illustrate the loss of nuclear fluorescence during mitosis. Centrosomesand mitotic spindles are stained with an anti-DdCP224 antibody. a, interphase; b, prophase; c, prometaphase; d, metaphase; e, early anaphase;f, late anaphase; g, telophase. Bar, 5 �m.

536 KALLER ET AL. EUKARYOT. CELL

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

lower levels than HcpB-GFP, with almost no nucleoplasmicfluorescence (Fig. 2A). Although both constructs were drivenby an actin 15 promoter, this difference could also be detectedin cotransformants expressing HcpA-RFP and HcpB-GFP fu-sion proteins (Fig. 2B). In contrast, N-terminal GFP fusions ofHcpA and HcpB showed approximately equal expression levelswith similar nucleoplasmic background (Fig. 8A). Because ofthe almost identical expression levels, which were confirmed byWestern blots (data not shown), we used the N-terminal GFPfusions for functional analysis.

Interestingly, when studying mitotic heterochromatin dynam-ics, we observed striking phenotypes that were particularly en-riched in cell lines expressing GFP-HcpA.

Compared to the control transformation, we found a morethan fourfold increase in DNA bridges between the separatedDNA masses in late mitotic cells (Table 3).

Statistical evaluation of the data (see Materials and Meth-ods) showed on the significance level of a maximum of 0.005that overexpression of GFP-HcpA resulted in a higher fre-quency of anaphase bridges than in the other cell types.

Anaphase bridges were reminiscent of the abnormal separationof dicentric chromosomes in, for example, Drosophila melano-gaster. GFP-HcpA fluorescence frequently localized to theseDNA bridges (Fig. 8C), indicating that heterochromatin was in-volved in these structures. Furthermore, overexpression of GFP-HcpA caused pronounced growth defects in axenic suspensionculture compared to control transformants (Table 1).

Overexpression of GFP-HcpB did not increase the numberof anaphase bridges but still caused growth defects that wereeven more severe than those observed for GFP-HcpA-express-ing strains (Tables 1 and 2). The results were reproduced withseveral independent clones, but the reason for slow growthcould not be elucidated. In order to show that the recombinantproteins were indeed overexpressed compared to the wild type,we performed semiquantitative RT-PCR analysis of both

strains. This showed that the mRNA levels of the respectiveHcp isoforms were significantly increased in comparison to theendogenous transcripts (Fig. 8B). Although we could not testfor expression levels of the endogenous protein, it is very likelythat the recombinant Hcp isoforms were also more abundantthan the respective wild-type proteins.

In order to gain further insight into the function of HP1proteins in heterochromatin, we overexpressed truncatedHcpA or HcpB protein lacking the C-terminal chromoshadowdomain (HcpA�C-GFP and HcpB�C-GFP). We assumed thatthese proteins still localize to heterochromatin (73) but pre-vent the formation of higher order chromatin structures, sinceHcpA�C-GFP was not able to dimerize in vitro (Fig. 3C).Hence, the mutant proteins should compete with both Hcpwild-type forms for binding sites and result in a dominant-negative loss-of-function phenotype when expressed in suffi-cient amounts.

The truncated proteins were, at least in part, localized to thesame major heterochromatic focus as the full-length proteins.This was confirmed by colocalization with H3K9me2 stainingand close proximity to the centrosome as identified by tubulinstaining (data not shown). Staining of the minor subnuclearfoci was, however, strongly reduced (Fig. 8A), suggesting dis-tinct CSD-dependent and CSD-independent targeting of HP1proteins in Dictyostelium. Overexpression of the truncatedHcpA protein led to severe growth defects in axenic suspen-sion culture (Table 1). Microscopic analysis of cells in suspen-sion culture revealed that approximately half of the cells, com-pared to less than 5% of the control transformant, wereabnormally rounded and had aberrantly condensed DNA.However, these did not represent prometaphase cells, since nosignificant mitotic defects could be detected (data not shown).Moreover, the plating efficiency on bacterial lawns of theHcpA�C-GFP strain was more than threefold reduced com-pared to the control strain (Fig. 8D). Interestingly, overexpres-sion of HcpA�C-GFP, although expressed at levels similar tothose of full-length GFP-HcpA, did not elicit increased numbersof anaphase bridges as seen for full-length HcpA (Table 2). It

TABLE 1. Generation times of knockout andoverexpression strainsa

Temp and strain Generation time( SD)

22°CAx2....................................................................................... 9.3 ( 0.2)hcpA mutant ....................................................................... 8.7 ( 0.1)hcpB mutant ....................................................................... 8.8 ( 0.1)Vector*................................................................................ 9.3 ( 1.1)GFP-HcpA*........................................................................13.5 ( 0.4)GFP-HcpB* ........................................................................21.8 ( 0.6)Vector*................................................................................ 9.7 ( 0.1)HcpA�C-GFP* ..................................................................28.4 ( 0.4)HcpB�C-GFP*...................................................................13.2 ( 1.7)

15°CAx2.......................................................................................47.0 ( 0.2)hcpA mutant .......................................................................62.2 ( 5.4)hcpB mutant .......................................................................44.2 ( 8.1)

a Mean generation times (in hours) and standard deviations from severalindependent clones are shown. Growth curves were measured in axenic suspen-sion culture in HL5 medium or in HL5 medium supplemented with 20 �g/mlgeniticin (indicated by asterisks).

FIG. 6. Mitotic dynamics of HcpB-GFP and histone H3K9me2.Whereas H3K9me2 is stable during mitosis, the fluorescence intensityof HcpB-GFP at the putative centromeres and in the nucleoplasmsignificantly decreases. Images in vertical rows were captured withidentical exposure times. a, interphase; b, prophase; c, early anaphase;d, telophase. Bar, 5 �m.

VOL. 5, 2006 HP1-LIKE PROTEINS 537

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

FIG. 7. Disruption of endogenous genes of both Hcp isoforms. A) Scheme for hcpA gene targeting and subsequent Cre-mediated excision ofthe BSR cassette. Gene disruption and Cre recombination introduced restriction sites flanking the remaining loxP site at the endogenous locus. Therecombinant hcpA allele (hcpAlp) is similar in size to the wild-type hcpA gene but can be distinguished from the wild-type allele by restrictiondigestions with the enzymes indicated. Restriction fragment analysis of PCR products derived from either wild-type (Ax2) or different recombinantclones was used to verify Cre-mediated recombination. Only the PCR products derived from the hcpAlp locus, but not from the wild-type hcpAlocus, can be digested with BamHI. B) Expression of His-HcpA in hcpAlp cells. Nuclear extracts from hcpAlp–His-HcpA or Ax2 cells were probedwith �-His antibody. C) Disruption of the hcpB gene. Clonal isolates of hcpAB mutant–His-HcpA cells transformed with the hcpB disruptionconstruct were screened by PCR (see Materials and Methods) for either homologous recombination of the targeted construct (hcpB knockout[KO]) or an intact hcpB gene (hcpB wild type [WT]). Results for several independent knockout clones are shown in comparison to Ax2 wild-typecells and the single hcpB knockout cell line. The same clones were tested for presence of the Cre recombinant hcpAlp allele by PCR and restrictionfragment analysis with NcoI as depicted for PCR product b in panel A. This PCR product that is longer than PCR product a (panel A) covers the5� noncoding region of the endogenous hcpA locus and allows us to distinguish it from the His-HcpA transgene, which only contains the codingsequence. Expression of His-HcpA was confirmed by Western blot analysis with an anti-His antibody (bottom panel).

538 KALLER ET AL. EUKARYOT. CELL

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

appears that overexpression of functional HcpA, which is able tointeract with other proteins via its CSD, is required for this defect.

The decrease in cell viability of the HcpA�C-GFP over-expression strain supported our assumption that the truncatedprotein had a dominant-negative function. This was, however,

not as severe as a complete loss-of-function mutation in bothHcp isoforms.

RNAi-mediated heterochromatin formation in Dictyostelium?In Drosophila melanogaster (62) and S. pombe (22), HP1 loss-of-function mutants influence H3K9 methylation levels andtheir subnuclear distribution. In Dictyostelium discoideum, theknockout mutants of individual HP1 genes did not cause sig-nificant changes in histone H3K9me2 subnuclear distribution(Fig. 9). This indicated that either the two isoforms are redun-dant for recruiting histone methyltransferases (HMTs) or thatHMTs act upstream of HP1.

The RNAi machinery and their products, short interferingRNAs (siRNAs), are implicated in DNA methylation and inchromatin organization (22, 41). In Dictyostelium there is atleast a correlation between the RNAi pathway and the silenc-ing of a major heterochromatin component, the retrotranspo-

TABLE 2. Frequencies of hcpB gene disruptions in differentbackground strainsa

Strain % Disrupted

Ax2...............................................................................................67 (28/42)hcpAlp .......................................................................................... 0 (0/200)hcpAB mutant–His-HcpA ..........................................................23 (9/40)

a Number of homologous recombinations detected and total number of testedclones are given in parentheses.

FIG. 8. Distinct phenotypes of cells expressing Hcp fusion proteins. A) Live-cell images of GFP-HcpA-, GFP-HcpB-, HcpA�C-GFP-, andHcpB�C-GFP-expressing cells. All images were taken with identical exposure times. Both truncated fusion proteins lacking the CSD stilllocalize to the major heterochromatic cluster but do not form additional smaller foci. B) Expression levels of hcpA, hcpB, and thioredoxinin different background strains determined by semiquantitative RT-PCR. hcpA and hcpB transcript levels are significantly enriched in strainsoverexpressing GFP-HcpA or GFP-HcpB, respectively, but are not detectable in the knockout strains. Due to partial cross-sensitivity,primers used for hcpB can also bind to hcpA. Note the increase in signal intensity but slightly lower size of the PCR product in the GFP-HcpAoverexpression strain. Numbers of PCR cycles for amplification were 32 (hcpA, hcpB) and 27 (thioredoxin). �RT, minus reverse transcrip-tion. C) Anaphase-bridge phenotype in the GFP-HcpA strain. A late mitotic cell, as identified by a long mitotic spindle, is shown. DAPI stainshows a DNA bridge between the main DNA masses. GFP-HcpA is found in small foci on the DNA bridge. The asterisk indicates the areaof magnification in the upper right corner. Bar, 5 �m. D) Cell viability, as determined by plating efficiency, is significantly impaired byoverexpression of HcpA�C-GFP compared to the control transformant.

VOL. 5, 2006 HP1-LIKE PROTEINS 539

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

son DIRS-1 (32). We therefore examined if RNA-directedRNA polymerases (RdRP), which are involved in RNA-medi-ated gene silencing, were required for heterochromatin forma-tion in Dictyostelium. No obvious defects could be detected inH3K9 methylation (Fig. 9) or localization of the HP1 proteins(data not shown) in either of the three knockout strains of theRdRP genes rrpA, rrpB, and rrpC (38). Although we cannotrule out that in Dictyostelium RdRPs play a minor or a redun-dant role in heterochromatin formation, it is possible that, likein other organisms, there are parallel pathways for heterochro-matin formation, including RNAi-independent ones (26).

DISCUSSION

Even though centromeric sequences have not yet beenclearly defined in the Dictyostelium discoideum genome, weprovide cytological indications that centromeres are clusteredduring G2 phase in a single domain at the nuclear periphery,where H3K9 dimethylation and the majority of HP1 proteinscolocalize. The mitotic behavior of this cluster and its localiza-tion next to the centrosome strongly support this conclusion.Interestingly, DIRS retrotransposons that are believed to con-stitute the Dictyostelium centromeres also cluster during inter-phase and mitosis (6). Telomeres may also cluster near thespindle pole body in meiotic prophase (60), but this is notnecessarily the case in mitotic cells. In mitotically cycling cellsof S. pombe (15), S. cerevisiae (17), and Plasmodium falciparum(14), telomeres form clusters at the nuclear periphery. Sincecentromeres are probably subtelocentric in Dictyostelium, themain heterochromatic cluster may also contain the proximaltelomeres. The distal telomeres may be located elsewhere atthe nuclear periphery and could be represented by the addi-tional minor heterochromatic foci. Alternatively, these maycontain other heterochromatic domains of unknown function.

Both HP1 isoforms, when expressed as GFP fusion proteins,are very similar with regard to subnuclear localization andassociation with heterochromatin during the cell cycle. Despitetheir likely centromeric localization, we did not detect anymitotic defects that could be assigned to centromere or kinet-ochore function in either knockout strain. This suggests thatthe HP1 isoforms are either redundant or, what we believe tobe less likely, not at all required for centromere function. Nullmutants of a single HP1 isoform are fully viable under standardgrowth conditions and only display subtle growth phenotypes

at lower temperatures. This was rather surprising, since singleHP1 isoforms in other organisms such as Drosophila melano-gaster are essential for viability or have at least distinct impor-tant functions that cannot be fully compensated for by theother isoforms.

We were not able to generate viable double-knockout strainsin the wild-type background, but we readily obtained themwhen a rescue construct expressing HcpA had previously beenintroduced into the cells. This strongly suggested that HcpAand HcpB were redundant in terms of viability. Further sup-port came from the observation that overexpression of a C-terminally truncated HcpA, assumed to display a dominant-negative effect, led to severe growth defects and significantlyreduced cell viability.

Although the two HP1 isoforms are very similar in sequenceand single knockouts did not display obvious phenotypes, over-expression of full-length HcpA and HcpB had distinguishableeffects on growth of mitotically cycling cells. The aberrantchromosome configurations found in the HcpA overexpressionstrain resembled those in HP1 null strains of Drosophila mela-nogaster (10), where they are caused by telomere fusions. Inmammals, overexpression of HP1 isoforms as N-terminal GFPfusions has been reported to cause telomere fusions andchanges in telomere length by disturbed interaction of telome-rase with telomeric sequences (63).

Dictyostelium telomeres appear not to be composed of spe-cific hexanucleotide repeats, and a homolog for a telomerasegene was not found in the genome. Intriguingly, rRNA genesequences from the extrachromosomal rRNA gene copies canbe found at the ends of Dictyostelium chromosomes (6). It istherefore likely that telomeres in Dictyostelium are maintainedby a DNA recombination mechanism that fuses rRNA genesequences to the chromosome ends. We suggest that over-expression of HcpA leads to alterations in chromatin structure;at telomeres, these may impair proper telomere maintenanceby interfering with DNA recombination or with the resolutionof aberrant recombination intermediates. Since we did notobserve these phenotypes in cells expressing C-terminally trun-cated forms of HcpA, only overexpression of functional HcpA

FIG. 9. H3K9me2 localization in hcp and rrp knockout mutants.Knockout of either hcpA or hcpB has no effect on H3K9me2 levels or itssubnuclear distribution. Similarly, knockouts of the RNA-dependentRNA polymerase genes rrpA, rrpB, or rrpC that are involved in RNA-mediated posttranscriptional gene silencing do not affect H3K9me2 levelsand distribution. DAPI is in blue and H3K9me2 is in red. Bar, 5 �m.

TABLE 3. Frequencies of anaphase bridgesa

Strain % Anaphase bridges

Ax2...................................................................................... 3.2 (3/94)hcpA mutant ...................................................................... 4.1 (4/98)hcpB mutant ...................................................................... 1.9 (2/107)Vector................................................................................. 2.9 (3/103)GFP-HcpA.........................................................................12.9 (14/108)GFP-HcpB ......................................................................... 0.9 (1/108)HcpA�C-GFP ................................................................... 1.1 (1/95)HcpB�C-GFP.................................................................... 3.3 (3/90)

a Cells were grown on coverslips for 20 to 24 h and fixed. Mitotic cells wereidentified by anti-DdCP224 or anti-tubulin staining. Late mitotic cells with mi-totic spindles of �5 �m were counted (see Fig. 8C). In parentheses, absolutenumbers of abnormal mitoses per number of counted mitoses are given. Resultswere reproduced with at least two independent clones of each strain.

540 KALLER ET AL. EUKARYOT. CELL

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

can elicit the defect in chromosome distribution. Furthermore,overexpression of full-length GFP-HcpB has no effects onchromosome segregation. This argued for a specific (mal)func-tion of HcpA that was not elicited by HcpB. The two isoformsdiffer especially in their dimerization preferences. With over-expression of HcpA, the stoichiometry of the proteins may bedisturbed and possibly lead to abnormally high concentrationsof HcpA in the oligomers. Also, the unbalanced oligomer com-position probably changes the interaction with other proteinpartners and may alter the formation and the dynamics ofchromatin structure.

The functionality of the GFP-tagged HcpA and HcpB pro-teins was supported by the observations that the fusion pro-teins maintained their ability to specifically form homo- andheterodimers in vitro and in vivo and, as expected, colocalizedwith H3K9me2. Furthermore, it has been shown that N-termi-nal GFP fusions of HP1 maintain their functions in variousother organisms (4, 29, 73).

The observed phenotype of HP1 overexpression strains ar-gues that additional binding occurred at sites that are notcovered in the wild type. This could be due to spreading out ofheterochromatic loci as observed in position-effect variegation.Alternatively, other parts of chromatin may be aberrantly tar-geted by excess HP1, since overexpression resulted in in-creased nucleoplasmic staining.

H3K9 dimethylation serves as a binding site for HP1 pro-teins (1, 34), and binding of HP1 feeds back on histone meth-ylation. However, no change in the H3K9 methylation patternwas observed in any of the mutant strains. This was in contrastto Drosophila melanogaster, where a knockout of HP1 causesectopic H3K9 methylation in euchromatin (62). Our analysissuggests that both isoforms can equally contribute to histonemethyltransferase (HMT) activity or that the functional inter-action between HMT and HP1 proteins is not required inDictyostelium. Alternatively, HMT is acting upstream of HcpAand HcpB.

Heterochromatic regions are, at least in part, controlled bythe RNA interference machinery (39, 40, 53, 72). However, inDictyostelium, single knockouts of RrpC, RrpB, and the strictlyrequired RNAi component RrpA had no influence on thelocalization of the heterochromatic markers (HcpA, HcpB,and H3K9) dimethylation. Similar to other organisms, sev-eral pathways may exist to establish and maintain hetero-chromatin. Alternatively, fluorescence microscopy was notsensitive enough to detect subtle changes in chromatin or-ganization.

In Dictyostelium discoideum, we have recently shown thatepigenetic gene silencing of transposable elements requirescomponents of the RNAi machinery and/or DNA methylation(32). Our analysis thus introduces a new model system toelucidate the involvement of RNAi in epigenetic gene silencingby histone modification and/or DNA methylation.

ACKNOWLEDGMENTS

This work was supported by a grant from the Deutsche Forschungs-gemeinschaft (Ne 285/8, SPP1129 “Epigenetics”).

Ralf Graf (Munich University) is acknowledged for antibodies, IngoSchubert and Zuzana Jasencakova (IPK Gatersleben) are acknowl-edged for help with the first immunostaining experiments, and MarkusManiak (Kassel University) is acknowledged for support with micros-copy and for generously providing diverse reagents. H. Ziezold (FB 17,

University of Kassel) is acknowledged for expert support with thestatistical evaluation. We thank P. A. Silver (Harvard MedicalSchool, Boston, Mass.) for providing the anti-GFP antibody andIngo Schubert (IPK Gatersleben) for discussions and comments onthe manuscript.

REFERENCES

1. Bannister, A. J., P. Zegerman, J. F. Partridge, E. A. Miska, J. O. Thomas,R. C. Allshire, and T. Kouzarides. 2001. Selective recognition of methylatedlysine 9 on histone H3 by the HP1 chromo domain. Nature 410:120–124.

2. Bernard, P., J. F. Maure, J. F. Partridge, S. Genier, J. P. Javerzat, and R. C.Allshire. 2001. Requirement of heterochromatin for cohesion at centro-meres. Science 294:2539–2542.

3. Brasher, S. V., B. O. Smith, R. H. Fogh, D. Nietlispach, A. Thiru, P. R.Nielsen, R. W. Broadhurst, L. J. Ball, N. V. Murzina, and E. D. Laue. 2000.The structure of mouse HP1 suggests a unique mode of single peptiderecognition by the shadow chromo domain dimer. EMBO J. 19:1587–1597.

4. Cheutin, T., A. J. McNairn, T. Jenuwein, D. M. Gilbert, P. B. Singh, and T.Misteli. 2003. Maintenance of stable heterochromatin domains by dynamicHP1 binding. Science 299:721–725.

5. Couteau, F., F. Guerry, F. Muller, and F. Palladino. 2002. A heterochroma-tin protein 1 homologue in Caenorhabditis elegans acts in germline andvulval development. EMBO Rep. 3:235–241.

6. Eichinger, L., J. A. Pachebat, G. Glockner, M. A. Rajandream, R. Sucgang,M. Berriman, J. Song, R. Olsen, K. Szafranski, Q. Xu, B. Tunggal, S.Kummerfeld, M. Madera, B. A. Konfortov, F. Rivero, A. T. Bankier, R.Lehmann, N. Hamlin, R. Davies, P. Gaudet, P. Fey, K. Pilcher, G. Chen, D.Saunders, E. Sodergren, P. Davis, A. Kerhornou, X. Nie, N. Hall, C. Anjard,L. Hemphill, N. Bason, P. Farbrother, B. Desany, E. Just, T. Morio, R. Rost,C. Churcher, J. Cooper, S. Haydock, N. van Driessche, A. Cronin, I. Good-head, D. Muzny, T. Mourier, A. Pain, M. Lu, D. Harper, R. Lindsay, H.Hauser, K. James, M. Quiles, M. Madan Babu, T. Saito, C. Buchrieser, A.Wardroper, M. Felder, M. Thangavelu, D. Johnson, A. Knights, H.Loulseged, K. Mungall, K. Oliver, C. Price, M. A. Quail, H. Urushihara,J. Hernandez, E. Rabbinowitsch, D. Steffen, M. Sanders, J. Ma, Y. Kohara,S. Sharp, M. Simmonds, S. Spiegler, A. Tivey, S. Sugano, B. White, D.Walker, J. Woodward, T. Winckler, Y. Tanaka, G. Shaulsky, M. Schleicher,G. Weinstock, A. Rosenthal, E. C. Cox, R. L. Chisholm, R. Gibbs, W. F.Loomis, M. Platzer, R. R. Kay, J. Williams, P. H. Dear, A. A. Noegel, B.Barrell, and A. Kuspa. 2005. The genome of the social amoeba Dictyoste-lium discoideum. Nature 435:43–57.

7. Eissenberg, J. C., G. D. Morris, G. Reuter, and T. Hartnett. 1992. Theheterochromatin-associated protein HP-1 is an essential protein in Drosoph-ila with dosage-dependent effects on position-effect variegation. Genetics131:345–352.

8. Ekwall, K., J. P. Javerzat, A. Lorentz, H. Schmidt, G. Cranston, and R.Allshire. 1995. The chromodomain protein Swi6: a key component at fissionyeast centromeres. Science 269:1429–1431.

9. Faix, J., L. Kreppel, G. Shaulsky, M. Schleicher, and A. R. Kimmel. 2004. Arapid and efficient method to generate multiple gene disruptions in Dictyo-stelium discoideum using a single selectable marker and the Cre-loxP system.Nucleic Acids Res. 32:e143.

10. Fanti, L., G. Giovinazzo, M. Berloco, and S. Pimpinelli. 1998. The hetero-chromatin protein 1 prevents telomere fusions in Drosophila. Mol. Cell2:527–538.

11. Festenstein, R., S. Sharghi-Namini, M. Fox, K. Roderick, M. Tolaini, T.Norton, A. Saveliev, D. Kioussis, and P. Singh. 1999. Heterochromatinprotein 1 modifies mammalian PEV in a dose- and chromosomal-context-dependent manner. Nat. Genet. 23:457–461.

12. Filesi, I., A. Cardinale, S. van der Sar, I. G. Cowell, P. B. Singh, and S.Biocca. 2002. Loss of heterochromatin protein 1 (HP1) chromodomain func-tion in mammalian cells by intracellular antibodies causes cell death. J. CellSci. 115:1803–1813.

13. Fischle, W., B. S. Tseng, H. L. Dormann, B. M. Ueberheide, B. A. Garcia, J.Shabanowitz, D. F. Hunt, H. Funabiki, and C. D. Allis. 2005. Regulation ofHP1-chromatin binding by histone H3 methylation and phosphorylation.Nature 438:1116–1122.

14. Freitas-Junior, L. H., E. Bottius, L. A. Pirrit, K. W. Deitsch, C. Scheidig, F.Guinet, U. Nehrbass, T. E. Wellems, and A. Scherf. 2000. Frequent ectopicrecombination of virulence factor genes in telomeric chromosome clusters ofP. falciparum. Nature 407:1018–1022.

15. Funabiki, H., I. Hagan, S. Uzawa, and M. Yanagida. 1993. Cell cycle-depen-dent specific positioning and clustering of centromeres and telomeres infission yeast. J. Cell Biol. 121:961–976.

16. Garcia-Cao, M., R. O’Sullivan, A. H. Peters, T. Jenuwein, and M. A. Blasco.2004. Epigenetic regulation of telomere length in mammalian cells by theSuv39h1 and Suv39h2 histone methyltransferases. Nat. Genet. 36:94–99.

17. Gotta, M., T. Laroche, A. Formenton, L. Maillet, H. Scherthan, and S. M.Gasser. 1996. The clustering of telomeres and colocalization with Rap1, Sir3,and Sir4 proteins in wild-type Saccharomyces cerevisiae. J. Cell Biol. 134:1349–1363.

VOL. 5, 2006 HP1-LIKE PROTEINS 541

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

18. Graf, R., C. Daunderer, and M. Schliwa. 2000. Dictyostelium DdCP224 is amicrotubule-associated protein and a permanent centrosomal resident in-volved in centrosome duplication. J. Cell Sci. 113(Part 10):1747–1758.

19. Graf, R., U. Euteneuer, T. H. Ho, and M. Rehberg. 2003. Regulated expres-sion of the centrosomal protein DdCP224 affects microtubule dynamics andreveals mechanisms for the control of supernumerary centrosome number.Mol. Biol. Cell 14:4067–4074.

20. Grewal, S. I., and D. Moazed. 2003. Heterochromatin and epigenetic controlof gene expression. Science 301:798–802.

21. Hall, I. M., K. Noma, and S. I. Grewal. 2003. RNA interference machineryregulates chromosome dynamics during mitosis and meiosis in fission yeast.Proc. Natl. Acad. Sci. USA 100:193–198.

22. Hall, I. M., G. D. Shankaranarayana, K. Noma, N. Ayoub, A. Cohen, andS. I. Grewal. 2002. Establishment and maintenance of a heterochromatindomain. Science 297:2232–2237.

23. Hirota, T., J. J. Lipp, B. H. Toh, and J. M. Peters. 2005. Histone H3 serine10 phosphorylation by Aurora B causes HP1 dissociation from heterochro-matin. Nature 438:1176–1180.

24. Hitt, A. L., J. H. Hartwig, and E. J. Luna. 1994. Ponticulin is the major highaffinity link between the plasma membrane and the cortical actin network inDictyostelium. J. Cell Biol. 126:1433–1444.

25. James, T. C., and S. C. Elgin. 1986. Identification of a nonhistone chromo-somal protein associated with heterochromatin in Drosophila melanogasterand its gene. Mol. Cell. Biol. 6:3862–3872.

26. Jia, S. T., K. Noma, and S. I. S. Grewal. 2004. RNAi-independent hetero-chromatin nucleation by the stress-activated ATF/CREB family proteins.Science 304:1971–1976.

27. Kalt, A., and M. Schliwa. 1996. A novel structural component of the Dic-tyostelium centrosome. J. Cell Sci. 109(Part 13):3103–3112.

28. Kilmartin, J. V., B. Wright, and C. Milstein. 1982. Rat monoclonal antitu-bulin antibodies derived by using a new nonsecreting rat cell line. J. Cell Biol.93:576–582.

29. Kirschmann, D. A., R. A. Lininger, L. M. Gardner, E. A. Seftor, V. A. Odero,A. M. Ainsztein, W. C. Earnshaw, L. L. Wallrath, and M. J. Hendrix. 2000.Down-regulation of HP1Hsalpha expression is associated with the metastaticphenotype in breast cancer. Cancer Res. 60:3359–3363.

30. Knop, M., F. Barr, C. G. Riedel, T. Heckel, and C. Reichel. 2002. Improvedversion of the red fluorescent protein (drFP583/DsRed/RFP). BioTech-niques 33:592–598.

31. Koering, C. E., A. Pollice, M. P. Zibella, S. Bauwens, A. Puisieux, M.Brunori, C. Brun, L. Martins, L. Sabatier, J. F. Pulitzer, and E. Gilson. 2002.Human telomeric position effect is determined by chromosomal context andtelomeric chromatin integrity. EMBO Rep. 3:1055–1061.

32. Kuhlmann, M., B. E. Borisova, M. Kaller, P. Larsson, D. Stach, J. Na, L.Eichinger, F. Lyko, V. Ambros, F. Soderbom, C. Hammann, and W. Nellen.2005. Silencing of retrotransposons in Dictyostelium by DNA methylationand RNAi. Nucleic Acids Res. 33:6405–6417.

33. Kuriyama, R., C. Sato, Y. Fukui, and S. Nishibayashi. 1982. In vitro nucle-ation of microtubules from microtubule-organizing center prepared fromcellular slime mold. Cell Motil. 2:257–272.

34. Lachner, M., D. O’Carroll, S. Rea, K. Mechtler, and T. Jenuwein. 2001.Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins.Nature 410:116–120.

35. Lechner, M. S., G. E. Begg, D. W. Speicher, and F. J. Rauscher. 2000.Molecular determinants for targeting heterochromatin protein 1-mediatedgene silencing: direct chromoshadow domain-KAP-1 corepressor interactionis essential. Mol. Cell. Biol. 20:6449–6465.

36. Maniak, M., R. Rauchenberger, R. Albrecht, J. Murphy, and G. Gerisch.1995. Coronin involved in phagocytosis: dynamics of particle-induced relo-calization visualized by a green fluorescent protein Tag. Cell 83:915–924.

37. Maniak, M., U. Saur, and W. Nellen. 1989. A colony-blot technique for thedetection of specific transcripts in eukaryotes. Anal. Biochem. 176:78–81.

38. Martens, H., J. Novotny, J. Oberstrass, T. L. Steck, P. Postlethwait, and W.Nellen. 2002. RNAi in Dictyostelium: the role of RNA-directed RNA poly-merases and double-stranded RNase. Mol. Biol. Cell. 13:445–453.

39. Mathieu, O., and J. Bender. 2004. RNA-directed DNA methylation. J. CellSci. 117:4881–4888.

40. Matzke, M., W. Aufsatz, T. Kanno, L. Daxinger, I. Papp, M. F. Mette, andA. J. Matzke. 2004. Genetic analysis of RNA-mediated transcriptional genesilencing. Biochim. Biophys. Acta 1677:129–141.

41. Matzke, M. A., and J. A. Birchler. 2005. RNAi-mediated pathways in thenucleus. Nat. Rev. Genet. 6:24–35.

42. Meehan, R. R., C. F. Kao, and S. Pennings. 2003. HP1 binding to nativechromatin in vitro is determined by the hinge region and not by the chro-modomain. EMBO J. 22:3164–3174.

43. Moens, P. B. 1976. Spindle and kinetochore morphology of Dictyosteliumdiscoideum. J. Cell Biol. 68:113–122.

44. Motamedi, M. R., A. Verdel, S. U. Colmenares, S. A. Gerber, S. P. Gygi, andD. Moazed. 2004. Two RNAi complexes, RITS and RDRC, physically inter-act and localize to noncoding centromeric RNAs. Cell 119:789–802.

45. Muchardt, C., M. Guilleme, J. S. Seeler, D. Trouche, A. Dejean, and M.Yaniv. 2002. Coordinated methyl and RNA binding is required for hetero-chromatin localization of mammalian HP1alpha. EMBO Rep. 3:975–981.

46. Nakayama, J., A. J. Klar, and S. I. Grewal. 2000. A chromodomain protein,Swi6, performs imprinting functions in fission yeast during mitosis and mei-osis. Cell 101:307–317.

47. Nellen, W., S. Datta, C. Reymond, A. Sivertsen, S. Mann, T. Crowley, andR. A. Firtel. 1987. Molecular biology in Dictyostelium: tools and applica-tions. Methods Cell Biol. 28:67–100.

48. Nellen, W., and R. A. Firtel. 1985. High-copy-number transformants andcotransformation in Dictyostelium. Gene 39:155–163.

49. Nielsen, A. L., J. A. Ortiz, J. You, M. Oulad-Abdelghani, R. Khechumian, A.Gansmuller, P. Chambon, and R. Losson. 1999. Interaction with members ofthe heterochromatin protein 1 (HP1) family and histone deacetylation aredifferentially involved in transcriptional silencing by members of the TIF1family. EMBO J. 18:6385–6395.

50. Nielsen, P. R., D. Nietlispach, H. R. Mott, J. Callaghan, A. Bannister, T.Kouzarides, A. G. Murzin, N. V. Murzina, and E. D. Laue. 2002. Structureof the HP1 chromodomain bound to histone H3 methylated at lysine 9.Nature 416:103–107.

51. Nielsen, S. J., R. Schneider, U. M. Bauer, A. J. Bannister, A. Morrison, D.O’Carroll, R. Firestein, M. Cleary, T. Jenuwein, R. E. Herrera, and T.Kouzarides. 2001. Rb targets histone H3 methylation and HP1 to promoters.Nature 412:561–565.

52. Nonaka, N., T. Kitajima, S. Yokobayashi, G. Xiao, M. Yamamoto, S. I.Grewal, and Y. Watanabe. 2002. Recruitment of cohesin to heterochromaticregions by Swi6/HP1 in fission yeast. Nat. Cell Biol. 4:89–93.

53. Pal-Bhadra, M., B. A. Leibovitch, S. G. Gandhi, M. Rao, U. Bhadra, J. A. Birchler,and S. C. Elgin. 2004. Heterochromatic silencing and HP1 localization in Drosoph-ila are dependent on the RNAi machinery. Science 303:669–672.

54. Perrini, B., L. Piacentini, L. Fanti, F. Altieri, S. Chichiarelli, M. Berloco, C.Turano, A. Ferraro, and S. Pimpinelli. 2004. HP1 controls telomere capping,telomere elongation, and telomere silencing by two different mechanisms inDrosophila. Mol. Cell. 15:467–476.

55. Pidoux, A. L., S. Uzawa, P. E. Perry, W. Z. Cande, and R. C. Allshire. 2000.Live analysis of lagging chromosomes during anaphase and their effect onspindle elongation rate in fission yeast. J. Cell Sci. 113(Part 23):4177–4191.

56. Rauchenberger, R., U. Hacker, J. Murphy, J. Niewohner, and M. Maniak.1997. Coronin and vacuolin identify consecutive stages of a late, actin-coatedendocytic compartment in Dictyostelium. Curr. Biol. 7:215–218.

57. Rea, S., F. Eisenhaber, D. O’Carroll, B. D. Strahl, Z. W. Sun, M. Schmid, S.Opravil, K. Mechtler, C. P. Ponting, C. D. Allis, and T. Jenuwein. 2000.Regulation of chromatin structure by site-specific histone H3 methyltrans-ferases. Nature 406:593–599.

58. Rehberg, M., and R. Graf. 2002. Dictyostelium EB1 is a genuine centrosomalcomponent required for proper spindle formation. Mol. Biol. Cell. 13:2301–2310.

59. Richards, E. J., and S. C. Elgin. 2002. Epigenetic codes for heterochromatinformation and silencing: rounding up the usual suspects. Cell 108:489–500.

60. Scherthan, H. 2001. A bouquet makes ends meet. Nat. Rev. Mol. Cell. Biol.2:621–627.

61. Schotta, G., A. Ebert, R. Dorn, and G. Reuter. 2003. Position-effect varie-gation and the genetic dissection of chromatin regulation in Drosophila.Semin. Cell Dev. Biol. 14:67–75.

62. Schotta, G., A. Ebert, V. Krauss, A. Fischer, J. Hoffmann, S. Rea, T.Jenuwein, R. Dorn, and G. Reuter. 2002. Central role of Drosophila SU-(VAR)3–9 in histone H3–K9 methylation and heterochromatic gene silenc-ing. EMBO J. 21:1121–1131.

63. Sharma, G. G., K. K. Hwang, R. K. Pandita, A. Gupta, S. Dhar, J. Parenteau,M. Agarwal, H. J. Worman, R. J. Wellinger, and T. K. Pandita. 2003. Humanheterochromatin protein 1 isoforms HP1(Hsalpha) and HP1(Hsbeta) inter-fere with hTERT-telomere interactions and correlate with changes in cellgrowth and response to ionizing radiation. Mol. Cell. Biol. 23:8363–8376.

64. Smothers, J. F., and S. Henikoff. 2001. The hinge and chromo shadow domainimpart distinct targeting of HP1-like proteins. Mol. Cell. Biol. 21:2555–2569.

65. Smothers, J. F., and S. Henikoff. 2000. The HP1 chromo shadow domainbinds a consensus peptide pentamer. Curr. Biol. 10:27–30.

66. Sugiyama, T., H. Cam, A. Verdel, D. Moazed, and S. I. Grewal. 2005.RNA-dependent RNA polymerase is an essential component of a self-en-forcing loop coupling heterochromatin assembly to siRNA production. Proc.Natl. Acad. Sci. USA 102:152–157.

67. Sussman, M. 1987. Cultivation and synchronous morphogenesis of Dictyo-stelium under controlled experimental conditions, p. 9–29. In J. A. Spudich(ed.), Methods in cell biology, vol. 28. Academic Press, Orlando, Fla.

68. Sutoh, K. 1993. A transformation vector for Dictyostelium discoideum witha new selectable marker bsr. Plasmid 30:150–154.

69. Thiru, A., D. Nietlispach, H. R. Mott, M. Okuwaki, D. Lyon, P. R. Nielsen,M. Hirshberg, A. Verreault, N. V. Murzina, and E. D. Laue. 2004. Structuralbasis of HP1/PXVXL motif peptide interactions and HP1 localisation toheterochromatin. EMBO J. 23:489–499.

70. Verdel, A., S. Jia, S. Gerber, T. Sugiyama, S. Gygi, and S. I. Grewal. 2004.RNAi-mediated targeting of heterochromatin by the RITS complex. Science28:127–132.

542 KALLER ET AL. EUKARYOT. CELL

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

71. Volpe, T., V. Schramke, G. L. Hamilton, S. A. White, G. Teng, R. A.Martienssen, and R. C. Allshire. 2003. RNA interference is required fornormal centromere function in fission yeast. Chromosome Res. 11:137–146.

72. Volpe, T. A., C. Kidner, I. M. Hall, G. Teng, S. I. Grewal, and R. A.Martienssen. 2002. Regulation of heterochromatic silencing and histone H3lysine-9 methylation by RNAi. Science 297:1833–1837.

73. Wang, G., A. Ma, C. M. Chow, D. Horsley, N. R. Brown, I. G. Cowell, andP. B. Singh. 2000. Conservation of heterochromatin protein 1 function. Mol.Cell. Biol. 20:6970–6983.

74. Witke, W., W. Nellen, and A. Noegel. 1987. Homologous recombination inthe Dictyostelium alpha-actinin gene leads to an altered mRNA and lack ofthe protein. EMBO J. 6:4143–4148.

75. Zang, J. H., G. Cavet, J. H. Sabry, P. Wagner, S. L. Moores, and J. A. Spudich. 1997.On the role of myosin-II in cytokinesis: division of Dictyostelium cells under adhe-sive and nonadhesive conditions. Mol. Biol. Cell. 8:2617–2629.

76. Zhao, T., T. Heyduk, C. D. Allis, and J. C. Eissenberg. 2000. Heterochro-matin protein 1 binds to nucleosomes and DNA in vitro. J. Biol. Chem.275:28332–28338.

VOL. 5, 2006 HP1-LIKE PROTEINS 543

on August 21, 2020 by guest

http://ec.asm.org/

Dow

nloaded from