ORIGINAL ARTICLE

Different Visible Colors and Green Fluorescence Were Obtainedfrom the Mutated Purple Chromoprotein Isolated from SeaAnemone

Cheng-Yi Chiang & Yi-Lin Chen & Huai-Jen Tsai

Received: 30 September 2013 /Accepted: 6 January 2014# Springer Science+Business Media New York 2014

Abstract Green fluorescent protein (GFP)-like proteins havebeen studied with the aim of developing fluorescent proteins.Since the property of color variation is understudied, weisolated a novel GFP-like chromoprotein from the carpetanemone Stichodactyla haddoni, termed shCP. Its maximumabsorption wavelength peak (λmax) is located at 574 nm,resulting in a purple color. The shCP protein consists of 227amino acids (aa), sharing 96 % identity with the GFP-likechromoprotein ofHeteractis crispa. Wemutated aa residues toexamine any alteration in color. When E63, the first aa of thechromophore, was replaced by serine (E63S), the λmax of themutated protein shCP-E63S was shifted to 560 nm and exhib-ited a pink color. When Q39, T194, and I196, which reside inthe surrounding 5 Å of the chromophore’s microenvironment,were mutated, we found that (1) the λmax of the mutatedprotein shCP-Q39S was shifted to 518 nm and exhibited ared color, (2) shCP-T194I exhibited a purple-blue color, and(3) an additional mutation at I196H of the mutated proteinshCP-E63L exhibited green fluorescence. In contrast, whenthe aa located neither at the chromophore nor within itsmicroenvironment were mutated, the resultant proteinsshCP-L122H, -E138G, -S137D, -T95I, -D129N, -T194V, -E138Q, -G75E, -I183V, and -I70V never altered their purplecolor, suggesting that mutations at the shCP chromophore andthe surrounding 5 Å microenvironment mostly control chang-es in color expression or cause fluorescence to develop. Ad-ditionally, we found that the cDNAs of shCP and its mutatedvarieties are faithfully and stably expressed both inEscherichia coli and zebrafish embryos.

Keywords Chromoprotein .GFP-like protein family . Proteinmutagenesis . Transgenesis

Introduction

The vivid fluorescent proteins or chromoproteins in cnidariananimals usually have a very colorful appearance (Labas et al.2002). They belong to the green fluorescent protein (GFP)-like protein family, and the identity of amino acid sequencebetween these proteins and GFP found from Aequoreavictoria (Inouye and Tsuji 1994) ranges from a high of 80–90 % (Labas et al. 2002) to a low of 25–30 % (Matz et al.1999). All proteins in the GFP-like protein family have similarstructures. They are composed of 11 β-sheets, forming abarrel structure, and a chromophore-bearing α-helix wrappedinside the barrel center. The chromophore structure is com-posed of X-Tyr-Gly, which forms an imidazolinone ring with-out other cofactors, has light-absorbing property, and is re-sponsible for the color, or fluorescence, of GFP-like proteins(Cubitt et al. 1995; Niwa et al. 1996). Based on their colorsand fluorescent properties, GFP-like proteins have wide ap-plications, including markers of gene expression, cell labelingand tracing, Förster resonance energy transfer (FRET), report-er genes, and detection of protein-protein interaction (Chalfieet al. 1994; Verkhusha and Lukyanov 2004).

The family of GFP-like protein can be categorized intodifferent groups according to their colors: GFP, cyan fluores-cent proteins (CFP), yellow fluorescent proteins (YFP), redfluorescent proteins (RFP), and purple-blue chromoproteins(CP) (Alieva et al. 2008). The various colors are determinedby chromophore composition and the neighboring aminoacids within the chromophore’s microenvironment. GFP,CFP, and YFP have a close relationship in phylogenetic anal-ysis. On the other hand, RFP and CP could be groupedtogether (Alieva et al. 2008).

C.<Y. Chiang :Y.<L. Chen :H.<J. Tsai (*)Institute of Molecular and Cellular Biology, National TaiwanUniversity, No. 1, Section 4, Roosevelt Road, Taipei 106, Taiwane-mail: hjtsai@ntu.edu.tw

Mar BiotechnolDOI 10.1007/s10126-014-9563-2

Chromophore formation is different between GFP andRFP. In GFP, the amide nitrogen of Gly67 attacks the carbonylcarbon of Ser65 and forms an initial ring structure. Thensubsequent oxidation and dehydrogenation reactions lead tothe formation of the imidazolinone ring (Heim et al. 1994). InDsRed-like CPs and RFPs, however, a further oxidation stephappens after imidazolinone ring formation, resulting, in turn,in the formation of an acylimine bond which extends theconjugation system of the chromophore and makes the absor-bance red-shifted (Wall et al. 2000; Verkhusha et al. 2004;Subach et al. 2009). The red-shifted absorbance results in thered fluorescence of RFP and the purple-blue color of CP.Moreover, the chromophore conformation of some RFPs canchange. For example, Kaede from Trachyphyllia geoffroyi(Ando et al. 2002) carries a green chromophore, but its con-formation could be converted to emit red fluorescence by UVirradiation (Mizuno et al. 2003). Also, the RFP fromBranchiostoma lanceolatum consists of a Gly-Tyr-Gly chro-mophore, but it can undergo a posttranslational modificationto form a nearly coplanar two-ring chromophore consisting ofa five-membered imidazolinone heterocycle with a p-hydroxybenzylidene substituent (Pletnev et al. 2013).

The first characterized chromoprotein from marine organ-isms is the pocilloporin isolated from the Acropora corals.Pocilloporin has high absorbance of wavelength 390 nm and560~590-nm light, which results in a pink or blue color (Doveet al. 1995). In addition to Acropora corals, chromoproteinsare also found in other anthozoan anemones or corals, e.g., thepurple chromoprotein in Heteractis crispa (hcCP) (Gurskayaet al. 2001), the purple-red chromoprotein in Anemoniasulcata (asCP) (Lukyanov et al. 2000), the blue chromoproteinin Cnidopus japonicus (cjBlue) (Chan et al. 2006), and thepurple-blue chromoprotein in Goniopora tenuidens (gtCP)(Gurskaya et al. 2001). Currently, chromoproteins are mainlyused to (1) develop fluorescent proteins with far-red emission,such as the far-red fluorescent protein HcRed derived from themutated chromoprotein hcCP (Gurskaya et al. 2001; Bulinaet al. 2002), and (2) develop kindling fluorescent proteins,which can switch fluorescence between on and off states, suchas the photoswitchable red fluorescent protein KFP1 derivedfrom mutated asCP (Chudakov et al. 2003; Verkhusha andLukyanov 2004).

Previously, chromoproteins were mainly studied in order todevelop mutant fluorescent proteins with long emission wave-lengths. For instance, HcRed, which is derived from hcCP, hasa maximum emission wavelength at 640 nm (Gurskaya et al.2001), and AQ14, derived from aeCP595, has a maximumemission wavelength at 663 nm (Shkrob et al. 2005). How-ever, the effect of amino acid sequences on color alternationhas not been comprehensively studied. The carpet anemonesin the Stichodactyla species, which exhibit various colors, aresimilar to H. crispa in toxicology and are distributed in thePacific and Indian Oceans. In this study, we cloned a gene-

encoded CP from S. haddoni (shCP) and employed site-directed mutagenesis to alter the amino acid composition tofind the key amino acid sites having influence on the colora-tion of this chromoprotein.

Materials and Methods

Protein Extraction and Isolation

Samples of S. haddoni originating from the Indo-Pacific werepurchased from local aquaria (Fig. 1a). The tentacles were cutinto small pieces and ground into powder with liquid nitrogen.The sample powder was collected in a 1.5-mL tube and mixedwith 0.15 g glass beads (Sigma), 200 μL phosphate bufferedsaline (PBS), and 0.2 M phenylmethanesulfonyl fluoride(1 μL). The sample solution was vibrated at 4 °C for 2 min.Five repetitions were carried out before the homogenizedprotein sample was collected. The protein extract was centri-fuged at 13,000 rpm for 30 min at 4 °C. The supernatant wasanalyzed on 10 % native gel at 100 V for 90 min using anelectroporator (Bio-Rad Mini-PROTEAN® Tetra Cell sys-tem). The purple band shown on the native gel was excisedand continuously analyzed by sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) at 80 V for20 min on 4 % stacking gel and at 120 V for 100 min on 12 %separating gel. After SDS-PAGE, the chromoprotein bandwascut and then digested by trypsin in gel bands (Promega).Liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis was then performed on the trypsin-digestedchromoprotein.

Synthesis of shCP cDNA

Total RNAs of S. haddoni were isolated by TRI reagent kit(Ambion). Synthesis and amplification of complementaryDNA (cDNA) were performed by Superscript III cDNA syn-thesis kit (Invitrogen). During the cDNA synthesis, dT(15)-T7primer (AAACGACGGCCAGTGAATTTAATACGACTCACTATAGGCGCTTTTTTTTTTTTTTTT) and TS primer(AAGCAGTGGTAACAACGCAGAGTACGCGGG) wereadded to the 3′- and 5′-ends of cDNAs, as the templateswitching sequences. The degenerate primer shCP_deg(GCNGAYGGNCCNGTNATGAAR: N = A, C, G, or T; Y= C or T; R = A or G) was designed according to the partialpeptide sequences obtained from LC-MS/MS. The 3′-end ofshCP cDNA was determined by 3′- Rapid Amplification ofcDNA Ends (RACE) using the shCP_deg and dT(15)-T7primers. The design of the shCP_3′BamHI primer (GGATCCTCAATTTGCTTTTTCAGG) was based on the 3′-endsequence of shCP cDNA. The 5′-end of shCP cDNA wasdetermined by 5′-RACE using primers of shCP_3′BamHIand TS, and the shCP_5′NdeI primer (CATATGGCCGGT

Mar Biotechnol

TTGTTGAAAGAAAG) was designed according to the 5′-end of shCP cDNA. By combining the shCP-5′NdeI primerand the shCP_3′BamHI primer, we amplified the shCP cDNAwith NdeI and BamHI cutting sites.

Expression Plasmid Constructs

To generate plasmids expressed in Escherichia coli, weengineered shCP cDNA with NdeI and BamHI ends into thepET-15b vector to construct expression plasmid pET-15b-shCP. Primers used to construct the pET-15b-shCP-mutatedplasmids are listed in Table 1. The 5′- and 3′-ends of mutatedshCP cDNAwere obtained by PCR using primers of shCP_5′NdeI and mutant_mR and primers of shCP_3′BamHI andmutant_mF, respectively. The 5′- and 3′-ends of the mutatedsequences were put together with shCP_5′NdeI and shCP_3′BamHI primers to perform PCR for amplification of full-length mutated sequences. The full-length mutated DNA se-quences were constructed into pGEM®-T Easy Vector(Promega) by TA cloning, generating the pGEM-shCPM-N/B plasmid. The pGEM-shCPM-N/B plasmid was treated withNdeI (NEB) and BamHI (NEB) to obtain the shCPM frag-ments with NdeI and BamHI sticky ends, which wereengineered into a pET-15b vector to construct the bacterialexpression plasmid pET-15b-shCPM.

To generate plasmids expressed in zebra fish embryos, theDNA sequences of shCP, shCP-E63S, and shCP-T194I wereused as templates to perform PCR using shCP_5′AgeI primer(ACCGGTCGCCACCATGGCCGGTTTGTTGAAAG) andshCP_3′PmlI primer (CACGTGTCAATTTGCTTTTTCAGG).The shCP and shCPM fragments containing AgeI and PmlIcutting sites were constructed into pGEM®-T Easy Vector(Promega) by TA cloning, generating the pGEM-shCP(M)-A/Pplasmid. The pGEM-shCP(M)-A/P plasmid was treated withAgeI (NEB) and PmlI (NEB) to obtain the shCP(M) fragments

with anAgeI sticky end and aPmlI blunt end. Plasmid containinga zebrafish α-actin promoter (Chou et al. 2001; Lin et al. 2006)was digestedwithXhoI, filled in usingKlenowDNApolymerase(NEB), and cut withAgeI. The resultant plasmid was then ligatedwith the shCP(M) fragment to generate pZα-shCP(M) plasmid.

Protein Expression and Purification

The pET-15b-shCP(M) plasmids were transformed intoE. coliBL21. Expressions of His-tagged shCP and mutated shCPchromoproteins in E. coli were induced by adding 1 mMisopropyl-b-D-thiogalactopyranoside (IPTG) when OD600

was reached at 0.4. After 24 h of incubation at 20 °C and withshaking at 200 rpm, the IPTG-induced bacterial cultures werecentrifuged at 5,000 rpm for 10 min at 4 °C, and the bacterialpellets were resuspended in 1 mL desalting buffer (500 mMNaCl, 10 mM Na2HPO4, 10 mM NaH2PO4; pH 8.0). Thesuspended cultures were sonicated for 20 min on ice and thencentrifuged at 13,000 rpm for 10 min at 4 °C. The supernatantof sonicated cultures was added to His GraviTrap columns(GE Healthcare) which had been pre-equilibrated with washbuffer (20 mM imidazole, 500 mM NaCl, 10 mM Na2HPO4,10 mM NaH2PO4; pH 8.0). Subsequently, the columns werewashed with 10 mL of wash buffer. The His-taggedchromoproteins were eluted with 3 mL elution buffer(500 mM imidazole, 500 mM NaCl, 10 mM Na2HPO4,10 mM NaH2PO4; pH 8.0), followed by desalting and bufferexchange with desalting buffer via HiTrap Desalting columns(GE Healthcare). The purified chromoproteins were quanti-fied by Pierce 660nm Protein Assay kit (Thermo).

Measurements of Chromoprotein Spectral Properties

All spectra were measured under 25 °C in a 1-cm light pathquartz cuvette, and the concentration of chromoproteins was

Fig. 1 Protein analysis of Stichodactyla haddoni, the carpet sea anemo-ne. a S. haddoni specimen. The crude total protein extracts of S. haddoniwere analyzed on native PAGE (b) and on a 12 % SDS-PAGE (c). Apurple protein band was shown on the native PAGE (indicated by

arrowhead in b). The molecular weight of monomer purple chromopro-tein is around 25 kDa (indicated by arrowhead in c). M molecularmarkers, S crude total protein extracts obtained by PBS, Sg the purpleband excised from the native gel

Mar Biotechnol

0.25 mg/mL. Absorption spectra ranging from 250 to800 nm were measured via a Beckman DU640B spec-trophotometer. The excitation and emission spectra weremeasured via a fluorescence spectrophotometer (HitachiF-7000).

Expression of Chromoproteins in Zebrafish Embryos

The pZα-shCP, pZα-shCP-E63S, and pZα-shCP-T194I plas-mids were linearized by NotI (NEB) and then mixed with aninjection dye (phenol red) and sterile water to the

Table 1 Primer sets for intro-ducing site-specific mutationsinto shCP cDNA

Mutant Primer name Primer sequence (5′ to 3′)

shCP-Q39S Q39S_mF TACAGGTACGTCTAGCATGAGGATTC

Q39S_mR GAATCCTCATGCTAGACGTACCTGTA

shCP-E63A E63A_mF ACCGTGTTGTGCATACGGCAGCAG

E63A_mR CTGCTGCGTATGCACAACACGGT

shCP-E63C E63C_mR ACCGTGTTGTTGTTACGGCAGCAG

E63C_mF CTGCTGCCGTAACAACAACACGGT

shCP-E63N E63N_mF ACCGTGTTGTAATTACGGCAGCAG

E63N_mR CTGCTGCCGTAATTACAACACGGT

shCP-E63W E63W_mF ACCGTGTTGTTGGTACGGCAGCAG

E63W_mR CTGCTGCCGTACCAACAACACGGT

shCP-E63D E63D_mF ACCGTGTTGTGATTACGGCAGCAG

E63D_mR CTGCTGCCGTAATCACAACACGGT

shCP-E63S E63S_mF ACCGTGTTGTTCTTACGGCAGCAG

E63S_mR CTGCTGCCGTAAGAACAACACGGT

shCP-E63L E63L_mF ACCGTGTTGTCTTTACGGCAGCAG

E63L_mR CTGCTGCCGTAAAGACAACACGGT

shCP-E63Q E63Q_mF CACCGTGTTGTCAGTACGGCAGCAG

E63Q_mR CTGCTGCCGTACTGACAACACGGTG

shCP-I70V I70V_mF GCAGAACCTTTGTGCACCATACGG

I70V_mR CCGTATGGTGCACAAAGGTTCTGC

shCP-G75E G75E_mF CCACCATACGGCAGAAATTCCCGATTTC

G75E_mR GAAATCGGGAATTTCTGCCGTATGGTGG

shCP-T95I T95I_mF GGAAAGAACCACAATCTATGAAGATGGAGG

T95I_mR CCTCCATCTTCATAGATTGTGGTTCTTTCC

shCP-Q106S Q106S_mF CTTACTGCTCATTCTGACACAAGCC

Q106S_mR GGCTTGTGTCAGAATGAGCAGTAAG

shCP-D129N D129N_mF CAACTTTCCTGCGAATGGCCCCGTG

D129N_mR CACGGGGCCATTCGCAGGAAAGTTG

shCP-S137D S137D_mF GAAGAACAAAGACGAAGGATGGGAG

S137D_mR CTCCCATCCTTCGTCTTTGTTCTTC

shCP-E138Q E138Q_mF GAAGAACAAATCACAGGGATGGGAGC

E138Q_mR GCTCCCATCCCTGTGATTTGTTCTTC

shCP-E138G E138G_mF GAAGAACAAATCAGGCGGATGGGAGC

E138G_mR GCTCCCATCCGCCTGATTTGTTCTTC

shCP-I183V I183V_mF GTCCAAGAAAGCAGTGCGTGCCTTGAC

I183V_mR GTCAAGGCACGCACTGCTTTCTTGGAC

shCP-T194I T194I_mF GGATTTCACTTTATAGACATCCGCC

T194I_mR GGCGGATGTCTATAAAGTGAAATCC

shCP-I196T I196T_mF CACTTTACAGACACACGCCTTCAGATG

I196T_mR CATCTGAAGGCGTGTGTCTGTAAAGTG

shCP-Y64L/I196H I196H_mF CACTTTACAGACCATCGCCTTCAGATG

I196H_mR CATCTGAAGGCGATGGTCTGTAAAGTG

Mar Biotechnol

concentration of 25 ng/μL. The linearized expression plas-mids were microinjected into one-celled zebrafish embryos byNANOLITER INJECTOR (ZGene Biotech Co. Ltd.).

Results

Extraction and Analysis of Novel Purple Chromoprotein

When we separated crude protein extracts from S. haddoni bynative PAGE, a purple band was observed in the gel (Fig. 1b).We cut this purple band and analyzed it on SDS-PAGE tomeasure the molecular weight of the purple chromoproteinshCP. Results showed that the monomer of shCP was 25 kDa(Fig. 1c), similar to that of other GFP-like family proteins. Toobtain the partial amino acid sequence of shCP, we analyzedthis 25-kDa band by LC-MS/MS, which revealed four distinctpartial peptide sequences that shared 28 % sequence coveragewhen compared to the chromoprotein HcRed of H. crispa inthe NCBInr protein database (Fig. 2). Based on an analysis ofthe degeneracy of these four partial peptide sequences ofshCP, we chose the fragment spanning amino acid residues128 to 134, i.e., Ala-Asp-Gly-Pro-Val-Met-Lys. Since theyhad the lowest degeneracy among all sequences, we designedthe degenerated primers based on this fragment for RACE.

Characterization of shCP and In Vivo Expressionof Recombinant shCP

The full-length cDNA of shCP obtained by RACE consistedof 684 bp encoding 227 amino acid residues. We aligned theshCP protein sequence with some proteins belonging to theGFP-like protein family, such as DsRed, hcCP, Rtms5, andcjBlue. The multiple sequence alignment of shCP revealedthat shCP shares 96 % sequence identity with hcCP andbelongs to the DsRed subfamily, according to phylogeneticanalysis (Fig. 3). This analysis also indicated that the chromo-phore of shCP locates at residues Glu63-Tyr64-Gly65,

affording the purple color. The 3-D structure of shCP, aspredicted by (PS)2: protein structure prediction server (Chenet al. 2006) and implemented by using HcRed structure(Wilmann et al. 2005) as a template, is demonstrated inFig. 4. We then produced recombinant shCP protein fusedwith 6× His-tag by the pET expression system. Interestingly,the transformed bacteria colonies turned purple (Fig. 5), indi-cating that the shCP protein was expressed in prokaryoticcells. By nickel column purification, we obtained purifiedrecombinant shCP (Fig. 6a), which was quantified by Pierce660nm Protein Assay. Next, by absorption spectroscopy, itwas determined that the peak absorption was located at574 nm, indicating that most absorption of shCP was in twodifferent visible light spectra: yellow and orange (Fig. 6b). Incontrast, no apparent excitation peak existed when shCP wasirradiated with light ranging from 200 to 700 nm.

In Vitro Expression of Mutated Chromoproteins

Using site-directed mutagenesis, the first amino acid of theshCP chromophore, E63, was substituted by other aminoacids with different charges or hydrophobicity side chains,including Gln (E63Q), Asp (E63D), Trp (E63W), Asn(E63N), Ala (E63A), Ser (E63S), and Cys (E63C). All thesemutated proteins were expressed by the pET system, and theircolors were observed under visible light or fluorescent emis-sion under 400- to 450-nm short-wavelength light. Resultsshowed that the mutated proteins shCP-E63Q, shCP-E63D,and shCP-E63W were colorless under either visual or lumi-nescent light (data not shown). The mutated protein shCP-E63N exhibited a dark red color and emitted green fluores-cence immediately after purification. However, we noticedthat this mutated protein turned purple and lost its fluorescentcharacter after 24 h of incubation at 25 °C (Fig. 7a, b), indi-cating that the coloration of this mutated protein is unstable.The mutated proteins shCP-E63A (Fig. 7a) and shCP-E63S(Fig. 6a) appeared as nonfluorescent pink. The mutated pro-tein shCP-E63C had a purple-red look (Fig. 7a), and its color

Fig. 2 Peptide mapping of purplechromoprotein of S. haddoni. The25-kDa band of crude proteinextracts was specifically analyzedby LC-MS/MS. The partialpeptide sequences of shCP areshown, and the peptides matchingthe chromoprotein of H. crispaare presented in bold red. Thematching score exceeds 52,indicating an extensive homology(p<0.05). Arrow indicates thepredictive result

Mar Biotechnol

appeared 12 h earlier than that of wild-type shCP (data notshown).

In addition to site-directed mutation at the chromophoredomain, we also studied whether the amino acids within thesurrounding 5 Å of the chromophore’s microenvironmentwould, once mutated, result in altering the color of shCP. To

accomplish this, we analyzed the residues located within thesurrounding microenvironment and mutated those aminoacids most likely to interact with such chromophores asGln39 and Thr194. After mutagenesis, the mutated proteinsshCP-E39S and shCP-T194I exhibited a red color and purple-blue color, respectively (Fig. 6a), indicating that mutation ofthe amino acids within the surrounding 5 Åmicroenvironmentof the chromophore might also affect the color of shCP.Additionally, the mutated protein shCP-Y64L/L196H, con-taining a mutated amino acid at the second residue of thechromophore and a mutated amino acid within the surround-ing 5 Å microenvironment of the shCP chromophore, exhib-ited a yellow color under visible light but green fluorescenceunder luminescent light (Fig. 7a, b), suggesting that doublemutations at the chromophore and its nearby microenviron-ment might cause shCP to generate a fluorescence activity.

Going a step further, we also mutated several other aminoacids residing outside the chromophore and its nearby micro-environment to examine the effects of these sites on shCPcoloration, including L122H, E138G, S137D, T95I, D129N,T194V, E138Q, G75E, I183V, and I70V. We found that noneof these mutated proteins changed color or fluorescence,presenting, instead, a purple coloration similar to that of theoriginal shCP (Fig. 7a, b). Nevertheless, similar to the mutatedproteins shCP-L122H, -E138G, -S137D, -T95I, -D129N, -T194V, -E138Q, -G75E, -I183V, and -I70V, we noticed thatthe mutated protein shCP-Q106S did not alter its originalcolor, even though Q106 is located within the chromophore’ssurrounding 5 Å microenvironment (Fig. 7a). When takentogether, these results suggest that mutations at the first aminoacid of the shCP chromophore have the highest impact on itscolor properties.

Spectral Characterization of Mutated shCP Chromoproteins

After producing the recombinant proteins of mutatedshCP, we chose those having largely varied colors forspectral characterization. All the measurements werecompared on the basis of protein concentration at3 mg/mL. The protein solution of wild-type shCP,shCP-E63S, shCP-Q39S, and shCP-T194I was purple,pink, red, and purple-blue, respectively (Fig. 6a). Theabsorption spectra of each mutated protein were ana-lyzed by a spectrophotometer. The maximum absorbancepeak of shCP-E63S located at 560 nm, and it hadanother slight peak at 520 nm (Fig. 6b). Compared toshCP, shCP-E63S had less absorbance of red light andmore absorbance of blue and red light, resulting in apink look (Fig. 6b). Meanwhile, the absorption spectrumof shCP-Q39S had two peaks: a higher peak located at518 nm and another located at 569 nm (Fig. 6b). Com-pared to shCP, shCP-Q39S had more absorbance of blueand green light, resulting in a red look.

Fig. 3 Sequence alignments of shCP with other GFP-like protein familymembers. The conserved residues are shaded in gray. The chromophoresof each protein are in bold. NCBI accession numbers of each protein usedin the alignment are DsRed (1GGX_A), hcCP (Q95W85), Rtms5(P83690.2), and cjBlue (CAL49526.1)

Fig. 4 The predicted 3-D structure of shCP. The red region represents α-helix, the yellow region represents β-sheets, and the green region repre-sents loops. The chromophore of shCP is shown in labeled sticks in thecenter of β-barrel

Mar Biotechnol

Expressions of shCP cDNA and Its Mutant Formsin Transgenic Zebrafish

To study whether the chromoprotein cDNA could be faithfullyexpressed in transgenic fish, we engineered shCP, shCP-E63S, or shCP-T194I cDNA individually into an expressionvector containing zebrafish α-actin promoter. Each plasmidwas microinjected into 2,000 zebrafish eggs and then bred tomaturation. After 30 days, some of the transgenic embryostransiently exhibited heterogeneous chromoprotein in muscle

tissue (Fig. 8a). When these transgenic embryos grew toadults, the chromoprotein was expressed mosaically in themuscle. Compared to wild type (Fig. 8b), the shCP-transferred zebrafish exhibited purple-red color in some mus-cle parts, the shCP-E63S-transferred zebrafish exhibited apink color, and the shCP-T194-transferred zebrafish exhibiteda purple-blue color (Fig. 8c–e). The colors displayed in trans-genic zebrafish confirmed that shCP cDNA and its mutatedsequences are faithfully expressed in higher eukaryotic organ-isms. Furthermore, we selected 15 pairs of shCP-transgeniczebrafish and 15 pairs of shCP-E63S-transgenic zebrafish tooutcross with wild type individually. We generated threeshCP-transgenic lines whose offspring could ubiquitouslyexpress purple-red chromoprotein in the skeletal muscle(Fig. 8f), and one shCP-E63S-transgenic line was generatedwhose offspring could also evenly express pink chromopro-tein in the skeletal muscle (Fig. 8g).

Discussion

Chromophores of GFP-like fluorescent proteins can changetheir fluorescent properties as a result of mutation at the firsttwo amino acids (Heim et al. 1995). It has also been reportedthat mutations in a chromoprotein’s sequence may change itinto a fluorescent protein. Examples include the far-red fluo-rescent protein AQ143 from the blue chromoprotein aeCP597(Shkrob et al. 2005) and the yellow fluorescent proteincjBlue(Y64L) from the cjBlue chromoprotein (Chan et al.2006). However, no studies have thus far demonstrated howmutations in chromoprotein sequences cause color changes.

The Effect of Different Amino Acid Mutations at the FirstAmino Acid Residue of Chromophore on Changes in ColorExpression of shCP

To understand whether the first amino acid residue of theshCP chromophore affects its color properties, we substitutedGlu63 with another amino acid having different charges andhydrophobicity to observe any changes in color.

Fig. 5 Expression of shCP and shCP-E63S cDNA in E. coliBL21 strain.The shCP and shCP-E63S cDNAwere subcloned into a pET-15b expres-sion vector. In contrast to noninduced bacteria, purple and pink were

presented in the colonies of transformed bacteria having shCP and shCP-E63S cDNA, respectively, after induction for 24 h

Fig. 6 The color and absorbance spectra of shCP protein and its mutatedderivatives. a shCP wild-type protein and shCP-derived mutated proteins(Q39S, E63S, and T194I) were individually purified at pH 7.0 and 25 °C.The colors of shCP, Q39S, E63S, and T194I are purple, red, pink, andpurple-blue, respectively. λmax indicates the maximum absorbance peakof each protein. b The absorbance spectra of shCP and its mutatedvariants were measured under the concentration of 0.25 mg/mL, pH7.0, and at 25 °C

Mar Biotechnol

Substitution by Amino Acids Having Similar Structureand Charge or Bulky Side Chain

When Glu63, which is hydrophilic and has a negative chargeand bulky side chain (R group = –C2H4COOH), was replacedby Gln (R group = –C2H4CONH2) or Asp (R group = –

CH2COOH), the mutated proteins of shCP-E63Q and shCP-E63D became colorless. Therefore, when Glu63 is substitutedfor an amino acid having either similar structure or the samecharge, no color can be formed. Similarly, when Glu63 wasreplaced by Trp (R group = –CH2-indole), whose side chainhas a more bulky aromatic structure, the mutated protein

Fig. 7 Chromoprotein solutions of shCP and its mutated derivatives.Chromoprotein solutions exhibit various colors under avisible light and bluminescence. The shCP protein solution exhibits purple-red color andhas no fluorescence under luminescence. The shCP-Y64L/I196H (L/H)exhibits a yellow color and is excited to emit slight green fluorescence.The shCP-E63S and shCP-E63Amutated proteins exhibit a similar color,

but shCP-E63S is closer to pink. Twelve mutated chromoproteins, in-cluding shCP-L122H, -E138G, -S137D, -E63C, -T95I, -Q106S, -D129N,-T194V, -E138Q, -E63N, -G75E, and -I183V, all exhibit purple color andshow little difference in coloration from the original shCP. However, threechromoproteins, shCP-I196T, T194I, and I70V, are more bluish thanshCP. The shCP-Q39S possesses a red color

Fig. 8 The expression of cDNAsof shCP and its mutatedderivatives in zebrafish. aWild-type shCP cDNAwas transientlyexpressed in albino zebrafishembryos at the 30-daypostfertilization (dpf) stage.Purple-red was presented in themuscle. b The nontransgenicwild-type zebrafish exhibitedgolden yellow when they grew at90 dpf. cThe shCP cDNA, whichwas driven by zebrafish α-actinpromoter, was mosaicallyexpressed in purple-red in thetransgenic zebrafish. dThe shCP-E63S-injected zebrafishmosaically exhibited pink color. eThe shCP-T194I-injectedzebrafish mosaically exhibitedpurple-blue color. f The matureindividuals derived from F1 of theTg(α-actin:shCP) transgenic lineubiquitously exhibited purple-redin the muscle. g The matureindividuals derived from F1 of theTg(α-actin:shCP-E63S)transgenic line uniformlyexhibited pink in the muscle

Mar Biotechnol

shCP-E63W exhibited no color, suggesting that the morebulky side chain may block the chromophore’s cyclization,resulting in the inhibition of color formation.

Substitution by Amino Acids Having Shorter Side Chain

When Glu63 was replaced by the nonpolar amino acid Ala (Rgroup = –CH3) or the polar amino acids Ser (R group = –CH2OH) and Cys (R group = –CH2SH), these mutated pro-teins did show changes in color. Specifically, the mutatedproteins shCP-E63A and shCP-E63S became pink. However,the color of shCP-E63S was brighter than that of shCP-E63A,suggesting that the hydroxyl group of the Ser side chain mayhave affected the chromophore’s light absorption ability. Also,the mutated protein shCP-E63C had a purple look similar tothat of wild-type shCP, but the rate of color formation ofshCP-E63C protein was faster than that of wild-type shCPwhen brought to protein expression, suggesting that the thiolgroup of the Cys side chain may have assisted the chromo-phore’s cyclization.

Substitution by the Polar Amide of Asp

When Glu63 was replaced by Asn (R group = –CH2CONH2),the mutated protein shCP-E63N had an unstable property,exhibiting a dark red color and green fluorescence simulta-neously. However, after 24 h of incubation under room tem-perature, the dark red color changed to purple and the greenfluorescence disappeared. This suggested that the E63N mu-tation may have extended chromophore formation. We spec-ulated that the lone pair on the amide group of the Asn sidechain may have extended the chromophore’s autocatalyzationtime, allowing the color and fluorescent intermediates to existsimultaneously. As time progressed, the chromophore tendedto exhibit a purple color.

The Effect of Different Amino Acid Mutationsin the Chromophore’s Microenvironment on Changesin Color Expression of shCP

Since amino acid residues in the surrounding 5 Å microenvi-ronment of the shCP chromophore might affect its colorproperties, we designed many amino acid substitutions atdifferent locations to observe any change in color. First, themutated protein of shCP-Q39S exhibits a red color, havinghigher absorption efficiency of blue and green light than shCP,suggesting that the amino acid at the 39th residue interactswith Glu63. When original Gln39 is mutated to Ser, thehydroxyl group of Ser39 may elevate the chromophore’selectron density to accommodate higher energy, causing theblue-shifted absorption spectrum of shCP-Q39S. Second, themutated protein of shCP-T194I exhibits a purple-blue color.When Thr194 is mutated to Ile, the microenvironment

hydrophobicity increases, which, in turn, causes more com-pact β-sheet alignment and, hence, a more stable chromo-phore. This mutation causes the light absorption efficiencyabove 570 nm to rise, which, in turn, results in the purple-bluecoloration exhibited by shCP-T194I. Third, an amino acidmutation at the chromophore combined with an amino acidmutation at the chromophore’s microenvironment, such asshCP-Y64L/L196H, causes a visible protein to become agreen fluorescent protein. We speculate that these two muta-tions might alter the conjugation system of shCP, resulting inintroducing a fluorescent character to the chromoprotein.Fourth, the mutated proteins shCP-L122H, -E138G, -S137D,-T95I, -Q106S, -D129N, -T194V, -E138Q, -G75E, and -I183V all exhibited purple coloration similar to the originalwild-type shCP, while shCP-I196T, -T194I, and -I170V pre-sented as more bluish than wild-type shCP. These point mu-tation sites were selected according to amino acid sites thathad already been studied in other fluorescent proteins andchromoproteins, such as asFP595 (Lukyanov et al. 2000),cgCP (Gurskaya et al. 2001; Pakhomov et al. 2006), hcCP(Gurskaya et al. 2001), gtCP (Gurskaya et al. 2001), amilCP(Alieva et al. 2008), aeCP597 (Shkrob et al. 2005), and cjBlue(Chan et al. 2006). All of the amino acid residues we studiedhere, except Q106, are located outside the surrounding 5 Åmicroenvironment of the shCP chromophore. Based on thecolors presented by the purified proteins, we found that nomutated amino acid residues lying outside the nearby micro-environment of the shCP chromophore cause it to changecolor. Although Q106, which was mutated to Ser, is locatedinside the 5 Å boundary lines of the chromophore’s microen-vironment, it did not cause shCP to change color. This resultsuggested that the coloration of shCP is strictly attributed tothe character of the replaced amino acids. Therefore, it can beconcluded that mutations at the shCP chromophore and itssurrounding 5 Å microenvironment control most changes incolor expression or cause the development of fluorescence.

The Molecular Size of shCP Shown on Gel

In this study, the purple protein bandwas separated from crudeproteins and visualized on native PAGE. The purple band wasthen excised from native gel and loaded directly on the SDSgel for further electrophoresis. We noticed that the molecularsize of the purple chromoprotein band shown on the SDS gelwas less than 25 kDa, which is the typical molecular size ofGFP-like protein family. However, the shCP protein is com-posed of 227 amino acid residues, and the molecular weight ofthe shCP monomer is 25.56 kDa if calculated on the basis ofthe ExPASy Compute pI/Mw Tool (Artimo et al. 2012).Bringing it into sequence alignment, we found the proteinsequence of shCP to be similar to that of other chromoproteinsequences. Because chromoproteins possessing a similar colorwould have high sequence homology and could be

Mar Biotechnol

categorized within the same phylogenetic group (Alieva et al.2008), we believe the protein we studied is a purple chromo-protein and that its molecular weight is around 25 kDa. Re-garding the discrepancy in molecular size between the datacalculated from bioinformatics and the data observed from thegel, we reason that the purple band is not fully denatured whenthe gel slice containing this purple protein is loaded on SDS-PAGE.

The Application of shCP and Its Derivatives in Organisms

Proteins belonging to the GFP-like protein family are normal-ly used as biomarkers, tracking agents, or reporter genes(Shaner et al. 2007). The induction condition of shCP wouldbe at 20 °C and at least 40 h when using a bacterial expressionsystem. Upon expressing shCP in zebrafish driven by α-actinpromoter, the fish had no apparent color change at earlierdevelopmental stage. However, when the developmental stagereached 30 days postfertilization, a mosaical chromoproteinaccumulation could be observed. These results suggested thatthe chromoprotein could fold and express properly in differentorganisms but that the observed color might be affected by itsoriginal host color. The promoter driving chromoproteincDNA activity also affects the rate of chromoproteinaccumulation. For instance, when chromoprotein cDNAis transcribed by T7 promoter in bacteria, which hashigh transcription efficiency, chromoprotein accumulatesin large quantities after 40 h. In contrast, when chro-moprotein cDNA is transcribed by α-actin promoter,whose activity is regulated at different developmentalstages, no short-term accumulation of chromoproteinoccurs. In addition, we did not alter codon preferencewhen we conducted protein expression in bacteria andzebrafish. Instead, we used the original chromoproteincDNA sequence to perform gene transfer, which mightresult in a lower expression rate in species differentfrom sea anemones.

On the basis of in vitro and in vivo chromoproteinexpressions, we suggested that chromoprotein is a valu-able biomarker. Chromoproteins can be correctlyexpressed in other organisms, even if cDNA is notmodified to proper codon preference, and the color ofchromoprotein can be observed by the naked eye. If thechromoprotein cDNA sequence is modified to suit dif-ferent codon preference in different organisms, the chro-moprotein might be applied as a convenient selectionbiomarker for transgenic organisms.

Acknowledgments We thank the NTU Center of Genomic Medicinefor providing the LC-MS/MS service. We also thank TC3 Proteomics,Technology Commons, College of Life Science, NTU, for providing theprotein analysis tools. This work was supported by the Council ofAgriculture, Executive Yuan, Taiwan, R.O.C., under grant 102AS-11.3.3-FA-F3.

References

AlievaNO, Konzen KA, Field SF, Meleshkevitch EA, HuntME, Beltran-Ramirez V, Miller DJ, Wiedenmann J, Salih A, Matz MV (2008)Diversity and evolution of coral fluorescent proteins. PLoS One 3:e2680

Ando R, Hama H, Yamamoto-Hino M, Mizuno H, Miyawaki A (2002)An optical marker based on the UV-induced green-to-redphotoconversion of a fluorescent protein. Proc Natl Acad Sci U SA 99:12651–12656

Artimo P, Jonnalagedda M, Arnold K, Baratin D, Csardi G, de Castro E,Duvaud S, Flegel V, Fortier A, Gasteiger E, Grosdidier A,Hernandez C, Ioannidis V, Kuznetsov D, Liechti R, Moretti S,Mostaguir K, Redaschi N, Rossier G, Xenarios I, Stockinger H(2012) ExPASy: SIB bioinformatics resource portal. Nucleic AcidsRes 40:W597–W603

Bulina ME, Chudakov DM, Mudrik NN, Lukyanov KA (2002)Interconversion of Anthozoa GFP-like fluorescent and non-fluorescent proteins by mutagenesis. BMC Biochem 3:7

Chalfie M, Tu Y, Euskirchen G, Ward WW, Prasher DC (1994) Greenfluorescent protein as amarker for gene expression. Science 263:802–805

Chan MCY, Karasawa S, Mizuno H, Bosanac I, Ho D, Prive GG,Miyawaki A, Ikura M (2006) Structural characterization of a bluechromoprotein and its yellow mutant from the sea anemoneCnidopus japonicus. J Biol Chem 281:37813–37819

Chen CC, Hwang JK, Yang JM (2006) (PS)2: protein structure predictionserver. Nucleic Acids Res 34:W152–W157

Chou CY, Horng LS, Tsai HJ (2001) Uniform GFP-expression in trans-genic medaka (Oryzias latipes) at the F0 generation. Transgenic Res10:303–315

Chudakov DM, Feofanov AV, Mudriku NN, Lukyanov S, Lukyanov KA(2003) Chromophore environment provides clue to “kindling fluo-rescent protein” riddle. J Biol Chem 278:7215–7219

Cubitt AB, Heim R, Adams SR, Boyd AE, Gross LA, Tsien RY (1995)Understanding, improving and using green fluorescent proteins.Trends Biochem Sci 20:448–455

Dove SG, Takabayashi M, HoeghGuldberg O (1995) Isolation and partialcharacterization of the pink and blue pigments of pocilloporid andacroporid corals. Biol Bull 189:288–297

Gurskaya NG, Fradkov AF, Terskikh A, Matz MV, Labas YA, MartynovVI, Yanushevich YG, Lukyanov KA, Lukyanov SA (2001) GFP-like chromoproteins as a source of far-red fluorescent proteins.FEBS Lett 507:16–20

Heim R, Prasher DC, Tsien RY (1994) Wavelength mutations and post-translational autoxidation of green fluorescent protein. Proc NatlAcad Sci U S A 91:12501–12504

Heim R, Cubitt AB, Tsien RY (1995) Improved green fluorescence.Nature 373:663–664

Inouye S, Tsuji FI (1994) Aequorea green fluorescent protein. Expressionof the gene and fluorescence characteristics of the recombinantprotein. FEBS Lett 341:277–280

Labas YA, Gurskaya NG, Yanushevich YG, Fradkov AF, Lukyanov KA,Lukyanov SA,MatzMV (2002) Diversity and evolution of the greenfluorescent protein family. Proc Natl Acad Sci U S A 99:4256–4261

Lin CY, Yung RF, Lee HC, Chen WT, Chen YH, Tsai HJ (2006)Myogenic regulatory factors Myf5 and Myod function distinctlyduring craniofacial myogenesis of zebrafish. Dev Biol 299:594–608

Lukyanov KA, Fradkov AF, Gurskaya NG, Matz MV, Labas YA,Savitsky AP, Markelov ML, Zaraisky AG, Zhao XN, Fang Y, TanWY, Lukyanov SA (2000) Natural animal coloration can be deter-mined by a nonfluorescent green fluorescent protein homolog. J BiolChem 275:25879–25882

Matz MV, Fradkov AF, Labas YA, Savitsky AP, Zaraisky AG, MarkelovML, Lukyanov SA (1999) Fluorescent proteins fromnonbioluminescent Anthozoa species. Nat Biotechnol 17:969–973

Mar Biotechnol

Mizuno H, Mal TK, Tong KI, Ando R, Furuta T, Ikura M, Miyawaki A(2003) Photo-induced peptide cleavage in the green-to-red conver-sion of a fluorescent protein. Mol Cell 12:1051–1058

NiwaH, Inouye S, Hirano T,Matsuno T, Kojima S, KubotaM,OhashiM,Tsuji FI (1996) Chemical nature of the light emitter of the Aequoreagreen fluorescent protein. Proc Natl Acad Sci U S A 93:13617–13622

Pakhomov AA, Pletneva NV, Balashova TA, Martynov VI (2006)Structure and reactivity of the chromophore of a GFP-like chromo-protein from Condylactis gigantea. Biochemistry 45:7256–7264

Pletnev VZ, Pletneva NV, Lukyanov KA, Souslova EA, Fradkov AF,Chudakov DM, Chepurnykh T, Yampolsky IV,Wlodawer A, DauterZ, Pletnev S (2013) Structure of the red fluorescent protein from alancelet (Branchiostoma lanceolatum): a novel GYG chromophorecovalently bound to a nearby tyrosine. Acta Crystallogr D BiolCrystallogr 69:1850–1860

Shaner NC, Patterson GH, Davidson MW (2007) Advances in fluores-cent protein technology. J Cell Sci 120:4247–4260

ShkrobMA, Yanushevich YG, Chudakov DM, Gurskaya NG, Labas YA,Poponov SY, Mudrik NN, Lukyanov S, Lukyanov KA (2005) Far-

red fluorescent proteins evolved from a blue chromoprotein fromActinia equina. Biochem J 392:649–654

Subach FV, Subach OM, Gundorov IS, Morozova KS, Piatkevich KD,Cuervo AM, Verkhusha VV (2009) Monomeric fluorescent timersthat change color from blue to red report on cellular trafficking. NatChem Biol 5:118–126

Verkhusha VV, Lukyanov KA (2004) The molecular properties andapplications of Anthozoa fluorescent proteins and chromoproteins.Nat Biotechnol 22:289–296

Verkhusha VV, Chudakov DM, Gurskaya NG, Lukyanov S, LukyanovKA (2004) Common pathway for the red chromophore formation influorescent proteins and chromoproteins. Chem Biol 11:845–854

Wall MA, Socolich M, Ranganathan R (2000) The structural basis for redfluorescence in the tetrameric GFP homolog DsRed. Nat Struct Biol7:1133–1138

Wilmann PG, Petersen J, Pettikiriarachchi A, Buckle AM, Smith SC,Olsen S, Perugini MA, Devenish RJ, Prescott M, Rossjohn J (2005)The 2.1A crystal structure of the far-red fluorescent protein HcRed:inherent conformational flexibility of the chromophore. J Mol Biol349:223–237

Mar Biotechnol