diabainein: Greek, “to pass through”

insipidus: Latin, “having no flavor”

•NeurogenicNeurogenic- also called - also called centralcentral or or pituitarypituitary, it , it is caused by a deficiency of the antidiuretic is caused by a deficiency of the antidiuretic hormone, vasopressin.hormone, vasopressin.

•NephrogenicNephrogenic- caused by a defect in the - caused by a defect in the receptor to the hormone, vasopressin, located receptor to the hormone, vasopressin, located in the kidneys.in the kidneys.

•GestagenicGestagenic- caused by a deficiency of the - caused by a deficiency of the antidiuretic hormone, vasopressin, during antidiuretic hormone, vasopressin, during pregnancy.pregnancy.

•DipsogenicDipsogenic- form of primary polydipsia, - form of primary polydipsia, abnormal thirst and excessive intake of abnormal thirst and excessive intake of liquids.liquids.

Nephrogenic Diabetes Insipidus (NDI) is a kidney disorder in which the kidney does not respond to the

antidiuretic hormone, arginine vasopressin (AVP) because of a mutation of the hormone receptor. The

linkage of the hormone to the receptor starts the sequence that makes kidney cells more water

permeable, allowing water to be reabsorbed by the kidney. Without the connection, the amount of water

that the body needs cannot be reabsorbed, and is excreted in large volumes of dilute urine.

•POLYURIA, chronic passage of large volumes of urine

•POLYDIPSIA, chronic, excessive thirst

•OTHER

•fever

•irritability

•constipation

•failure to thrive

•lack of appetite

•vomiting

•high blood levels of sodium

GATCCTGGGTTCTGTGCATCCGTCTGTCTGACCATCCCTCTCAATCTTCCCTGCCCAGGACTGGCCATACTGCCACCGACACGTGCACACACGCCAACAGGCATCTGCCATGCTGGCATCTCTATAAGGGCTCCAGTCCAGAGACCCTGGGCCATTGAACTTGCTCCTCAGGCAGAGGCTGAGTCCGCACATCACCTCCAGGCCCTCAGAACACCTGCCCCAGCCCCACCATGCTCATGGCGTCCACCACTTCCGCTGTGCCTGGGCATCCCTCTCTGCCCAGCCTGCCCAGCAACAGCAGCCAGGAGAGGCCACTGGACACCCGGGACCCGCTGCTAGCCCGGGCGGAGCTGGCGCTGCTCTCCATAGTCTTTGTGGCTGTGGCCCTGAGCAATGGCCTGGTGCTGGCGGCCCTAGCTCGGCGGGGCCGGCGGGGCCACTGGGCACCCATACACGTCTTCATTGGCCACTTGTGCCTGGCCGACCTGGCCGTGGCTCTGTTCCAAGTGCTGCCCCAGCTGGCCTGGAAGGCCACCGACCGCTTCCGTGGGCCAGATGCCCTGTGTCGGGCCGTGAAGTATCTGCAGATGGTGGGCATGTATGCCTCCTCCTACATGATCCTGGCCATGACGCTGGACCGCCACCGTGCCATCTGCCGTCCCATGCTGGCGTACCGCCATGGAAGTGGGGCTCACTGGAACCGGCCGGTGCTAGTGGCTTGGGCCTTCTCGCTCCTTCTCAGCCTGCCCCAGCTCTTCATCTTCGCCCAGCGCAACGTGGAAGGTGGCAGCGGGGTCACTGACTGCTGGGCCTGCTTTGCGGAGCCCTGGGGCCGTCGCACCTATGTCACCTGGATTGCCCTGATGGTGTTCGTGGCACCTACCCTGGGTATCGCCGCCTGCCAGGTGCTCATCTTCCGGGAGATTCATGCCAGTCTGGTGCCAGGGCCATCAGAGAGGCCTGGGGGGCGCCGCAGGGGACGCCGGACAGGCAGCCCCGGTGAGGGAGCCCACGTGTCAGCAGCTGTGGCCAAGACTGTGAGGATGACGCTAGTGATTGTGGTCGTCTATGTGCTGTGCTGGGCACCCTTCTTCCTGGTGCAGCTGTGGGCCGCGTGGGACCCGGAGGCACCTCTGGAAGGGGCGCCCTTTGTGCTACTCATGTTGCTGGCCAGCCTCAACAGCTGCACCAACCCCTGGATCTATGCATCTTTCAGCAGCAGCGTGTCCTCAGAGCTGCGAAGCTTGCTCTGCTGTGCCCGGGGACGCACCCCACCCAGCCTGGGTCCCCAAGATGAGTCCTGCACCACCGCCAGCTCCTCCCTGGCCAAGGACACTTCATCGTGAGGAGCTGTTGGGTGTCTTGCCTCTAGAGGCTTTGAGAAGCTCAGCTGCCTTCCTGGGGCTGGTCCTGGGAGCCACTGGGAGGGGGACCCGTGGAGAATTGGCCAGAGCCTGTGGCCCCGAGGCTGGGACACTGTGTGGCCCTGGACAAGCCACAGCCCCTGCCTGGGTCTCCACATCCCCAGCTGTATGAGGAGAGCTTCAGGCCCCAGGACTGTGGGGGCCCCTCAGGTCAGCTCACTGAGCTGGGTGTAGGAGGGGCTGCAGCAGAGGCCTGAGGAGTGGCAGGAAAGAGGGAGCAGGTGCCCCCAGGTGAGACAGCGGTCCCAGGGGCCTGAAAAGGAAGGACCAGGCTGGGGCCAGGGGACCTTCCTGTCTCCGCCTTTCTAATCCCTCCCTCCTCATTCTCTCCCTAATAAAAATTGGAGCTCATTTTCCACATGGCAAGGGGTCTCCTTGGA

[Exons are shown in alternating color]

After testing of the AVPR2 gene, located at Xq28, almost 100% of

disease-causing mutations result in individuals having NDI.

All types of mutations, such as frameshifts and splicing can be

observed in the gene.

There are no other known phenotypes associated with AVPR2

gene mutations.

Normally, the hormone, arginine vasopressin (AVP) likes to the

receptor, vasopressin-2 receptor (V2R), located in the collecting

duct of the kindey. X-linked NDI is caused by a mutation on the AVPR2 gene that results in

defective V2Rs. The mutation inhibits the linkage of the hormone and receptor and the reabsorbtion

of water by the kidneys.

schematic representation of the V2 receptor

Color code for atoms:

grey carbon

red oxygen

blue nitrogen

yellow sulfursulfur

(hydrogen atoms are not shown)

http://www.medicine.mcgill.ca/nephros/avpr2schem.html

3-D model of the human arginine vasopressin (AVP) receptor (V2), which is encoded by the AVPR2 gene, with the AVP hormone docked

into the putative active site.

3-D model of the AVP-V2 receptor complex

Drugs useful in reducing polyuria in partial DI and NDI are various diuretics, primarily thiazides. The thiazides reduce urine volume in partial and complete DI and NDI, as a result of reducing extracellular fluid volume and increasing resorption. Urine volumes may fall by 25 to 50% during the daily use of regular doses of thiazides. Restricting salt intake may also be helpful because it reduces urine output by reducing solute load.

Prostaglandin inhibitors such as indomethacin may be effective in reducing urine volume, by decreasing renal blood flow and glomerular filtration rate. With indomethacin, restriction of sodium intake and a thiazide diuretic help reduce urine volume further in NDI.

“How do mutations in neurophysin lead to diabetes insipidus? Current evidence suggests that pathogenic mutations lead to the accumulation of misfolded neurophysin-hormone precursor in the endoplasmic reticulum, producing the death of vasopressin-producing neurons. However, it is not clear why some of the mutations should lead to significant misfolding and whether therefore other factors might not be involved. This problem is being investigated by analysis of the folding and functional properties of mutant human vasopressin-neurophysin precursors prepared by recombinant DNA technology.”

Professor of Biochemistry & Structural Biology. B.S. 1953, Cornell University; M.S. 1955, Ph.D. 1959, New York University.

http://www.med.cornell.edu/gradschool/fac/breslow.html

Most of the mutations of the AVPR2 gene causes synthesised proteins to be retained. Therefore, researchers are seeking to induce and measure the increased expression of these proteins. This gives no real insight into the action of the inductors, but it gives the possibility of new therapeutic stategies. Researchers are attempting to use “chemical chaperones” (usually AVPR2 antagonist) to regulate the folding of the AVPR2 water channel.

http://www.portfolio.mvm.ed.ac.uk/studentwebs/session2/group5/respet.htm

There are four factors that are taken into consideration when diagnosing NDI:

•Urinary concentration, measured in terms of the ratio of osmotically active particles to body water-NDI, would be low

•Plasma concentration, measured in terms of the ratio of plasma solutes to plasma solvent-NDI, would be low

•Level of antidiuretic hormone, arginine vasopressin (AVP) in plasma-NDI, would be normal to high

•Urine volume-NDI, would be high

There is no cure for inherited NDI, but it is managed by:

•ensuring ready access to water

•following a low-sodium, and sometimes a low-protein, diet

•using thiazide diuretics to reduce the volume of urine output

•NDI in infants is not always identified by

polydipsia and polyuria. Infants express other

symptoms such as vomitting, gagging, poor feeding, constipation or

diarrhea, faliure to thrive, unexplained fevers and lethargy or irritability.

•NDI in infants is not always identified by

polydipsia and polyuria. Infants express other

symptoms such as vomitting, gagging, poor feeding, constipation or

diarrhea, faliure to thrive, unexplained fevers and lethargy or irritability.

•Undiagnosed or untreated patients

with extended periods of dehydration may

have resultant symptoms. These include seizures, permanent brain

damage, developmental delay

and mental retardation.

•Undiagnosed or untreated patients

with extended periods of dehydration may

have resultant symptoms. These include seizures, permanent brain

damage, developmental delay

and mental retardation.

•Most recent prevalence estimate is 8.8/1,000,000 males in

Quebec, Canada.

•Most recent prevalence estimate is 8.8/1,000,000 males in

Quebec, Canada.

•The people with NDI have abnormal lifestyles because of their need for constant access to water and the increased frequency of urination. School and other social activities may be disrupted. Most patients are in the lower 50 percentile for height and “catch-up” growth rarely occurs.

•The people with NDI have abnormal lifestyles because of their need for constant access to water and the increased frequency of urination. School and other social activities may be disrupted. Most patients are in the lower 50 percentile for height and “catch-up” growth rarely occurs.