Dhara Desai- thesis

“STUDY THE EFFECTS OF PESTICIDES ON NEMATOPHAGOUS

FUNGI AND ITS MOLECULAR CHARACTERISATION”

A

Dissertation Thesis

Submitted for

The Partial Fulfillment of the Requirement for

The Award of the Degree of

Master of Science in

INTEGRATED BIOTECHNOLOGY

(GENERAL BIOTECHNOLOGY)

of

Sardar Patel University

November’2013

Submitted by:

DHARA DESAIARIBAS

Supervisor:

ANJU KUNJADIA

Associate Professor in Biotechnology,

Ashok & Rita Patel Institute of Integrated Study &

Research in Biotechnology and Allied Sciences

(ARIBAS) New Vallabh Vidyanagar.

CERTIFICATE

This is to certify that the work presented in the dissertation project report entitled

“Study the effects of Pesticides on Nematophagous Fungi and its molecular

characterization”submitted by Miss Dhara P. Desai of Ashok and Rita Patel Institute of

Integrated Study and Research in Biotechnology & Allied Sciences, New Vallabh

Vidyanagar comprises the results of independent and original work carried out under my

supervision for the partial fulfillment of the award of the degree of M. Sc. Integrated

Biotechnology of Sardar Patel University, Vallabh Vidyanagar.

I further certify that this work did not form a part of any other work published or

unpublished.

Dr. Anju Kunjadia,

Associate Professor,

Biotechnology.

24/10/2013

Forwarded by

Dr. Nilanjan Roy,

Director,ARIBAS.

UNDERTAKING

I, Miss Dhara P. Desai, of Ashok and Rita Patel Institute of Integrated Study and Research in

Biotechnology & Allied Sciences, New Vallabh Vidyanagar hereby undertake that the work presented

in the dissertation project report entitled “Study the effect of Pesticides on Nematophagous Fungi

and its molecular characterization”comprises the results of independent and original work carried

out by me under the supervision of Dr. Anju Kunjadia for the partial fulfillment of the award of the

degree of M. Sc. Integrated Biotechnology of Sardar Patel University, Vallabh Vidyanagar.

I further declare that this work did not form a part of any other work published or

unpublished.

Miss Dhara P. Desai

24/10/2013

Acknowledgement

My resolve towards the aim of designing and conducting a de novo dissertation has finally borne conclusive and desired results. Although the journey was full of uncertainties and difficulties, I was able to strive through the phase and achieve this important academic feat in my life owing to contribution of a few enterprising people who stepped in to give their valuable guidance and support.

I would like to express my deepest gratitude to my guide Dr. Anju Kunjadia for giving me an opportunity to do my dissertation work under her coveted mentorship. It has indeed been a resourceful and privileged experience to work under the guidance of a researcher of this stature and rich experience and getting to know, practice and imbibe the investigative, logical and knack of systematic working that is demanded of a newly up taken research project. I indeed thank you madam, for obliging me with this unique opportunity

I convey my heartfelt thanks to research scholar Ramesh Pandit. It was because of his consistent support and prudent solutions given at the time when I got stuck at certain places, that I was able to carry out the work hitch free. I indeed thank him for being approcachable and ready to help always. I will be ever indebted to him for his support extended in the need of hour.

Most respectfully I submit my acknowledgment to Dr. Nilanjan Roy for continuously being involved in raising the standards of education in the institute and effectively teaching students to imbibe a professional work culture, sincerity towards work, clarity of thought so as to is utilized upto the best of the potential to develop skills at par with international standards.

My most humble and sincere thanks are to Dr. C.L. Patel, and CVM(Charutar Vidhya Mandal)for providing such help and giving the opportunity to study this course.

I am thankful to all the lab assistants and peons Arvindbhai and Dineshbhai and for helping me in whenever I need in anyway

My friends Vatsal, mittal, sheel stood always there for me during my entire work and I am very much thankful to them for understanding my things and for sharing their important point of view and correct me in my experiment work.

Lastly and most importantly I would like to thank my parents for their constant support and encouragement that kept me sailing and triumphing out of challenging phases of life, this dissertation being one of the same. I am indeed ever indebted to them.

Dhara P. Desai

INDEX

1. INTRODUCTION & REVIEW LITERATURE

1.1 Nematode infection in plants and animals…………………………………2 1.1.1 Plant parasitic nematode………………………………………………3 1.1.2 Animal parasitic nematode……………………………………………5

1.2 Harmful effects of parasitic nematodes on crop yield……………………..6 and live stock production

1.2.1 Loss of agriculture due to parasitic nematodes………………………..7

∑ Lesion nematode infection

∑ Root-knot disease

∑ Potato crop diseases ∑ Foliar nematode disease

1.2.2 Effect on live stock production………………………………………..10

1.3 Control strategies for nematodes…………………………………………..11 1.3.1 For plant parasitic nematodes………………………………………….11

(1) Crop rotation (2) Chemical controls (3) Use of resistant plants (4) Use of biological agents

1.3.2 For animal parasitic nematodes………………………………………..13

1.4 Biocontrol for nematodes……………………………………….………….14 1.5 Nematophagous fungi as biocontrol of nematodes………………………...15

1.5.1 Nematode trapping fungi……………………………………………....16 1.5.2 The endo-parasitic fungi……………………………………………….17 1.5.3 The egg and cyst parasitic fungi……………………………………….17

1.6 Nematode fungus interaction mechanism………………………………….18 1.6.1 Recognition and host specificity……………………………………….18 1.6.2 Attraction………………………………………………………………19 1.6.3 Adhesion……………………………………………………………….19 1.6.4 Penetration……………………………………………………………..19

1.7 Non-targeted effect of pesticides…………………………………………..20 1.7.1 Pesticides and environmental effects…………………………………..20 1.7.2 Why to study effects of pesticides on growth of nematophagous fungi..21

1.8 Importance of serine protease in performing predatory activity…………...22 2. OBJECTIVES……………………………………………………………….……..25 3. MATERIALS AND METHODS

3.1 MATERIALS………………………………………………………………26 3.2 METHODS…………………………………………………………………30

3.2.1 Maintenance of fungal cultures…………………………………………30 3.2.2 Preparation of media……………………………………………………30 3.2.3 Microscopic study of fungi………………………...…………………...30 3.2.4 Optimization of growth conditions…………………………………….30

(1) Optimization of media (2) Optimization of pH and Temperature

3.2.5 Effect of Pesticides on the growth of isolates………………………….31 (1) Effect of Fungicides (2) Effect of herbicide (3) Effect of insecticide

3.2.6 Fungal DNA isolation……………………………………………….32 3.2.7 Agarose gel electrophoresis………………………………………….33 3.2.8 Quantification of DNA………………………………………………33 3.2.9 PCR amplification of 18s rRNA and Serine Protease gene…………33 3.2.10 Identification of fungi……………………………………………….33

4. RESULTS AND DISCUSSION

4.1 Morphological characterization of isolates by microscopic study…….37 4.2 Optimization of growth media………………………………………....39 4.3 Optimization of pH………………………………………………….…40 4.4 Optimization of temperature…………………………………………...41 4.5 Effect of fungicide……………………………………………………..42

4.5.1 Effect of carbendazi………………………………………….…….42 4.5.2 Effect of tebucanazo……………………………………………….42 4.5.3 Effect of mencozeb….……………………………….…………….42

4.6 Effect of herbicide……………………………………….…………….44 4.6.1 Effect of glyphosate………………………………………………..44 4.6.2 Effect of methsulfuryl methyl………………………………………45

4.7 Effect of insecticides………………………………………………..,…46 4.7.1 Effect of Ethion…………………………………………………….46 4.7.2 Effect of prophenofos………………………………..…………….47

4.8 DNA Isolation……………………………………………………….…48 4.9 PCR product of 18s rRNA & Serine Protease…...…………………..…49

4.10 Identification and phylogenetic analysis of isolates based on 18s rRNA gene and Serine Protease gene sequencing……………………………..……50

5. CONCLUSION 6. REFRENCES 7. APPENDIX

LIST OF FIGURES

Figure 1 Plant parasitic nematode life cycle

Figure 2 Animal parasitic nematode life cycle

Figure 3 Trapping structure of nematodes bynematophagous fungi

Figure 4 Morphological characterization of isolatesGS1

Figure 5 Morphological characterization of isolatesGS2

Figure 6 % Growth inhibition of fungal isolates onvarious media

Figure 7 Growth of fungal isolates at various pH

Figure 8 Growth of fungal isolates at varioustemperatures

Figure 9 Effect of mencozeb on growth of GS 1 andGS 2

Figure 10 Effect of Glyphosate on growth of GS1 andGS2

Figure 11 Effect of Methsulfuryl methyl on growth ofGS1 and GS2

Figure 12 Effect of Ethion on growth of isolates

Figure 13 Effect of prophenofos on growth of GS1 andGS2

Figure 14 DNA bands observed under UVtransilluminator

Figure 15 Amplified 18s RNA gene with 1Kb ladder

Figure 16 Amplified Serine Protease gene with 1kbledder on 1% agarose gel

Figure 17 Neighbour-joining tree based on 18s rRNagene sequence using MEGA5.1

Figure 18 Neighbour joining tree of Serine Proteasegene using CLCv4.9

Figure 19 Pairwise alignment of Serine Protease geneusing ClustalW in CLC4.9

LIST OF TABLES

Table 1 Reaction mixtureTable 2 Primer sequence for 18s rRNATable 3 PCR cycling condition for 18s rRNATable 4 Primer sequence for Serine ProteaseTable 5 PCR cycling condition for Serine Protease

gene

ABBREVIATIONS

% Per cent

bp Base pair

ºC Centigrade/Degree celcius

CMA Corn Meal Agar

PDA Potato Dextrose Broth

DNA Deoxyribonucleic acid

DNTPs Dinucleotide(s) troposphere

EDTA Ethylenediaminetetraacetic acid

et al. et alit

EtBr Ethidium Bromide

Fig Figure

BCAs Biological control agents

Gms Grams

RKN Root knot nematode

i.e. id est. ( that is )

l Liter

M Molar

Min Minute

ml Milliliter

mM Milimolar

PCR Polymerase chain reaction

PPM Parts Per Million

psi Per square inch

Rpm Revolution per minute

SDS Sodium Dodecyl Sulfate

Sec. Seconds

Sp. Species

STD Standard

TBE Tris Borate EDTA

TE Tris EDTA

g Micro gram

l Micro liter

Introduction & Review of Literature

1. INTRODUCTION & REVIEW OF LITERATURE

There is increasing interest in the exploitation of fungi for the control of invertebrate

pests, weeds and diseases, as evidenced by the number of commercial products available

and under development. Fungal biological control is an exciting and rapidly developing

research area with implications for plant productivity, animal and human health and food

production. This area includes a number of important disciplines, such as pathology,

ecology, genetics, physiology, mass production, formulation and application strategies.

The research, development and final commercialization of fungal biological control

agents (BCAs) continue to confront a number of obstacles, ranging from elucidating

important basic biological knowledge to socio-economic factors. Considerable advances

have been made in separate areas (Butt et al, 1998; Butt and Copping, 2000; Butt and

Goettel, 2000 and Butt et al, 2001).

There is considerable interest in the exploitation of naturally occurring organisms, such as

bacteria, viruses and fungi, for the control of crop pests, weeds and diseases. It is

generally recognized that some chemical pesticides contaminate groundwater and enter

food-chains that have an impact on a wide range of organisms. Furthermore, pesticides

can pose hazards to animal health and to the user spraying the chemical. Consumer

perceptions worldwide are that chemical usage in agricultural production needs to be

significantly reduced. In order to satisfy this demand, biological control strategies,

especially for the growing organic market, are urgently required. Unfortunately, there is

relatively little investment in the research and development of microorganisms compared

with that spent on the discovery of chemical pesticides (Whipps and Lumsden,1989). Two

reasons for this are that BCAs usually have a narrow host range and often give

inconsistent and poor control in field trials.

One major factor to consider is the market potential of BCAs. Currently, only specialized,

niche markets exist. Their full potential has not been realized because of the following:

a) Absence of strong incentives to develop these agents and/or discourage

chemical Pesticides.

b) Availability of new, biodegradable chemical pesticides.

c) Absence or breakdown of the infrastructure, which facilitates transfer of new

technologies

d) And research knowledge to the end-user (i.e. grower).


e) Absence of a universally acceptable registration procedure.

f) Restrictions in the use of exotic BCAs.

g) Lack of robust and reliable field effects.

h) Very few growers or extension workers know how to use BCAs.

Agricultural practice is changing as a result of demands to reduce the use of chemical

pesticides, including fungicides, and to provide abundant feed, food and fibre using

environmentally friendly, sustainable systems. IPM is defined as a systems approach to

pest management that combines multiple crop production practices with careful

monitoring of pests (including plant pathogens) and their natural enemies (such as fungal

antagonists). IPM as it relates to plant pathology is reviewed by Jacobsen, 1997. The

concept of IPM was first introduced in relation to insect pest control through integrating

the use of pesticides and biological control organisms. This is particularly important as

often the current need to resort the chemical treatment for disease control disrupts. One

strategy of IPM is to develop fungal BCAs with tolerance to fungicides or to incorporate

fungicide resistance into antagonists (Locke et al, 1985; Locke and Lumsden, 1989;

O’Neill et al, 1996).

With keep this concept in mind we have made an effort to study the effect of some widely

used pesticides on our nematophagous fungal isolates. Nematophagous fungi are natural

antagonist of nematodes and control nematode populations. Before going to this we have

to understand some of the concepts of ecology, pathology, infection strategies, how they

affect agriculture and livestock production, control measurements of plant and animal

parasitic nematodes. Further it is also important to understand some key concepts of

nematophagous fungi i.e. type, how they kills nematodes etc.

1.1 Nematode infection in plants and animals

In the field of agriculture the demand of new varieties of crops are increasing as per the

need of growing population. Along with that it is now become much more difficult to

manage the yielding varieties in presence of various insects and other microorganisms.

Nematodes are roundworms that belong to the phylum Nematoda. They are the most

abundant creatures on earth, occupying different ecological niches and living as parasites

of humans, animals and plants. Parasitic nematodes can cause a large-scale multiplication

and invasion of their hosts (Olsen, 2000). In modern era different types of pesticides are

used as per the requirement but most of them are unaffected on pests now, as pests


become resistance towards the chemical pesticides. These issues have increased

awareness of soil ecology and the importance of maintaining soil health is become crucial

now.

Pesticides cover other host specific chemicals like fungicide, insecticide and herbicides.

They have the beneficial effect on their targets. But due to the changes in environmental

conditions and increased resistivity of the insects these pesticides are less worth to use.

Other than that these pesticides are sometimes harmful for non-targeted crops and it leads

to unwanted reactions, which can change the originality of crop and its repeated

application of pesticides causes loss of biodiversity (Ellis & Rhodes, 2008). Else most

pesticides are not degradable and they can produce toxic compounds in soil which can

change the soil texture, lead to water pollution and can influence the human health

(Kiontke & Fitch, 2013).

1.1.1 Plant parasitic nematodes

Nematodes are microscopic organisms ranging in size from 0.25 mm to 3.0 mm long and

they are generally cylindrical in shape, whitish, transparent and non-segmented (lambert

& Bekal, 2002). Each year nematodes causes billion dollars of crop loss. They are highly

capable to survive in any environment. They are mainly known as plant parasitic

nematodes as they infect tones of plant every year and counting of numerous amount of

damage is uncountable. It is important to gain information about nematode identifications

to agriculture, the nematode problems and diseases on major crops, its symptoms and

diagnosis, identification of new and potentially harmful species of nematodes for the

success of agriculture and aids in the development and evaluation of qualitative or

regulatory procedures to minimize their spread, to obtain action against them and to know

the activity of nematode (Zafar, 1998).

Phytoparasitic nematodes can devastate several economically important crops, causing

significant losses in yield. These nematodes are obligate parasites, and they have

developed different parasitic strategies and relationships with their hosts to attain enough

nutrients for development and reproduction. The groups of phytoparasitic nematodes that

have great economical importance are the sedentary endoparasites, which include the

genera Heterodera and Globodera (cyst nematodes) and Meloidogyne, or RKN.

They live inside plants and they feed on all parts of the plant, including roots, stems,

leaves, flowers and seeds. Like they move between soil particles, between folded leaves

of plant buds, in air spaces of leaves and stems or in plan tissues themselves. Nematode


infection till now observed in several of plants and they act specifically according to the

plant size and plant age like soyabean cyst nematodes, corn parasitic nematodes, sugar-

beet cyst nematodes, potato cyst nematodes, tomato root-knot nematode and etc.

Nematodes can form problems as they can act like (1) vectors (e.g. for several viruses),

(2) wounding agents, (3) host modifiers, and (4) resistance breakers. Nematode infection

varies according plant species and their ages (Al, 2008). To develop soil ecosystem

management strategies to protect it against the damage caused by plant-parasitic

nematodes, ultimately leading to improvements in plant health and its become major

concern to find the solutions against its resistivity towards chemicals to save plant and

animal flora (Wang & McSorley, 2005 & Al, 2008)

The root feeding nematodes act on plant by 3 ways:

1. Endoparasites- feed from inside

2. Ectoparasites- feed from outside

3. Semi-endoparasitic- feed by partially inserting their anterior part into plant

(Niblack., 2005)

Most species of plant parasitic nematodes have a relatively simple life cycle. Nematodes

develop from eggs through four juvenile stages to adults and molt consisting of the egg,

four larval stages, and the adult male and female. Female nematodes produce eggs that

hatch into young nematodes called juveniles. If females and males are both present, they

mate and produce eggs. Females can produce from as many as a few to 500 or more eggs

depending on the species. Motile adults move in a wavelike motion in the soil searching

for suitable host plant roots on which to feed. Ectoparasitic nematodes feed during all life

stages once they hatch from the egg. In about half of the species, adults mate and females

lay fertilized eggs. They typically complete their life cycles in 30-60 days, however, some

adults may survive for or two year (Noling.,1999 and Ectoparasitic & Of, 1997).


http://www.sardi.sa.gov.au/pestsdiseases/plant_soil_health/nematology/nematodes_in_so

uth_australia

Figure 1: Plant parasitic nematode life cycle

1.1.2 Animal parasitic nematodes

Nematodes are as harmful for animals as it is for plants. Livestock industry worldwide is

severely affected by a number of infectious diseases caused by parasites mainly by

parasitic nematodes (Eysker and Ploeger, 2000). They are considered to be one of the

most economically harmful groups of parasites affecting the animal productivity around

the world. The most frequent one is gastrointestinal parasitic nematodes. In this group of

parasites the nematodes have a remarkable status as the main pathogens causing severe

damage to their hosts. The main parasites that affects small ruminants includes

Strongyloides papillosus, Haemonchus contortus, Muellerius capillaries, Nematodirus sp.

Trichostrongylus sp., Ostertagia sp. etc. Among these Haemonchus contortus which

cause Haemonchosis is probably the most important constraint to small ruminant

production on both commercial farms and resource-poor production systems (Waruiru et

al., 1993 and Amarante et al., 2009).

http://www.sardi.sa.gov.au/pestsdiseases/plant_soil_health/nematology/nematodes_in_south_australia



Nematodes belonging to the group of trichostrongylids is also a major concern because its

blood-sucking feeding habits cause anemia that can be so severe resulting in the death of

the animal. This group of parasites is widespread in almost all tropical and sub-tropical

countries and they are responsible for deteriorating animal health and productivity.

(Gives, Eugenia, & Arellano, 2010). The principal gastrointestinal nematodes infects and

affects small ruminants (sheep and goats). The life cycles of these nematodes follow a

similar pattern. Sexually dimorphic adults are present in the digestive tract, where

fertilized females produce large numbers of eggs that are passed in the feces. Strongly lid

eggs usually hatch within 1–2 days.

(Florian Roeber et al 2013)

Figure 2: Animal parasitic nematode life cycle

The severity of disease is mainly influenced by factors such as the parasite species

present, the number of worms present in the gastrointestinal tract, the general health and

immunological state of the host, and environmental factors, such as climate and pasture

type, stress, stocking rate, management and/or diet.

1.2 Harmful effects of parasitic nematodes on crop yield and live stock production

Parasitic nematode causes great damage to crops and live stock, in both the cases it

ultimately affects the productivity. For the control plant nematodes chemicals are used,

similarly in case of animals anihelmanthic drugs are used. Both of them have drawback

that is their residual effect and nematodes getting resistant. Due to the residual effect it

may cause damage to other lives. Similarly when the antihelmanthic drug are used in case


of animals the nematodes get resistant to the dosage of drugs used. So, the dosage of the

drug is required to be increased. This may lead to the increase in the level of drug in the

bovine milk sample.

1.2.1 Loss of agriculture due to parasitic nematodes

Nematode infection is now major concern in all over the world and major issue to discuss

about is to how to save crop losses which occurs due to nematode infection. Crop-loss

due to phytoparasitic nematodes for selected crops on a worldwide basis were estimated

reported in 1987. Michigan and North Carolina maintained comprehensive estimates of

crop losses in response to nematodes. Progress has been made in determining damage

functions, conducting surveys on the distribution of plant-parasitic nematodes, and

developing the methodology for obtaining loss estimates (Duncan and Noling, 1998 and

Koenning et al, 1999) Estimates on potential and actual losses despite the current crop

protection practices are there for wheat, rice, maize, potatoes, soybeans, and cotton for

the period 2001–03 on a regional basis (19 regions) as well as for the global total. Among

crops, the total global potential loss due to pests varied from about 50% in wheat to more

than 80% in cotton production. The responses are estimated as losses of 26–29% for

soybean, wheat and cotton, and 31, 37 and 40% for maize, rice and potatoes, respectively

(Oerke, 2005).

Typical symptoms of nematode injury can involve both above ground and below ground

plant parts. They secrete enzymes into individual root cells, and ingest the partially

digested cell contents. Primary symptoms of nematode infection of roots generally

involve premature wilting, leaf yellowing, nutrient deficiency and drought are visible

damage by nematodes, roots may appear discolored. A gradual decline in yield over a

period of years often indicates a nematode problem.

In plant parasitic root- knot nematodes second-stage juveniles hatch from eggs, move

through the soil and invade roots near the tips. These juveniles affect the plant cell

differentiations and form giant cell formation, after that nematodes can feed on that giant

cells (W.S.Cranshaw 2013)

The presence of nematodes in the root stimulates the surrounding tissues to enlarge and

produce the galls which are the typical symptom of infection by root knot nematode.

Galling restricts root volume and hinders the normal translocation of water and nutrients


within the plant, so that plants exhibit above-ground symptoms of stunting, wilting and

chlorosis.

There are numerous diseases occurring by nematodes and they produce specific

symptoms which studied by scientist, helpful to identify it as nematode infection. There

are specific root knot disease, potato crop disease, foliar nematode disease, lesion

nematode disease.

∑ Lesion nematode infection- The head of the nematode can be recognized by the

presence of a short, dark spear with basal knobs (the "stylet"), helps in penetrating

plant tissues. Lesion nematodes penetrate plant roots completely and migrate

throughout the root tissue, mainly the cortex, as they feed. They can penetrate

anywhere along the roots, but they show some preference for the region near the

start of the root hair zone. They penetrate the root epidermis either intra- or

intercellularly, but once inside, they migrate intracellularly. The nematodes feed

on cells within the root, usually until the cells lyses and cavities are formed, and

then the nematodes move forward within the root to feed on healthy plant cells.

Lesion nematodes produce characteristic necrotic lesions (darkened areas of dead

tissue) on the surface and throughout the cortex of infected roots. The lesions turn

from reddish-brown to black and are initially spotty along the root surface. As the

nematodes continue to migrate and feed within the roots, the lesions can coalesce

to become large necrotic areas of tissue that may eventually girdle the root. Severe

damage from high populations of lesion nematodes can result in a stunted and

necrotic plant root system (Davis & MacGuidwin, 2000).

∑ Root-knot disease- Nematodes of the genus Meloidogyne are also known as

RKN, because they develop knots in the roots of infected plants during their

parasitic life-cycle. They infect some other staple crops, such as cereals (rice,

maize, soybean, banana, plantains, sweet potato, yam), as well as to industrial

crops, such as tobacco, coffee, sugar cane, sugar beet, cotton, and black pepper.

Economic losses have also been reported in fruit crops, such as guava, pineapple,

papaya, and grapes (Lamberti, 1997). Root-knot nematodes were first reported in

1855 by Berkeley, who observed them causing damage on cucumbers (Kiontke &

Fitch, 2013) As a result of nematode feeding, large galls or "knots" can form

8


throughout the root system of infected plants. Severe infections result in reduced

yields. The degree of root galling generally depends on four factors like nematode

population density, species type, race and host plant species. As the density of

nematodes increases in a particular field, the number of galls per plant also will

increase. Large numbers of nematodes penetrating roots in close proximity also

will result in larger galls. Each crop responds differently to root-knot nematode

infection. Most root-knot nematodes have a very wide host range. While the most

diagnostic root-knot nematode damage occurs below ground, numerous symptoms

can also be observed above ground. Severely affected plants will often wilt

readily. Plants also may exhibit nutrient deficiency symptoms because of their

reduced ability to absorb and transport nutrients from the soil. Stunting is

frequently observed on host crops grown in root-knot nematode-infested fields,

and crop yields are reduced. At high densities, root-knot nematodes can actually

kill host plants (Mitkkowski, 2011).

∑ Potato crop disease- Occur by potato cyst nematodes. Nematode infection on a

potato crop results in tuber yield decline and/or reduction in quality, thereby

contributing economic loss to the industry. They live on the roots of plants of the

Solanaceae family, such as potatoes and tomatoes. The estimates for actual losses

due to nematodes are 11%. Nematode then invades the tips of the root and

establishes a feeding site. Both susceptible and resistant potato varieties will

suffer from major problems at low and medium population densities. Symptoms

are deficient growth, stunting, yellowing, and early senescence. (Lima, 1996.,

Oerke, 2005., & Department of Environment, 1999.)

∑ Foliar nematode disease- The foliar nematodes, also known as bud and leaf

nematodes, attack plant parts that are above ground. The symptoms foliar

nematodes cause are often diagnostic. The nematodes penetrate through open

stomata and feed on the spongy mesophyll tissue inside the leaf. They cannot

penetrate between cells that are packed tightly together and are thus restricted to

areas in the leaf that are demarcated by main leaf veins. As the nematodes feed

and reproduce inside leaf tissues, these areas begin to turn pale green, yellow, and

eventually brown (Nematode & Of, 2000). Foliar nematodes are microscopic

9


roundworms that live in leaf tissue and cause significant injury to many

ornamental plants (Hartman, 1993).

It is clear that nematode infection can be a serious threat to the producer. Nematodes can

vector many plant viruses or create wounds that allow the entry of other root pathogens.

There are multiple ways to handle these insects most of them are also gives the negative

effects over killing it. There are certain ways like crop rotation, fumigation, sanitation,

increase the resistivity of plants, infected root destruction and much more but they come

out with many disadvantages and there are no countable results in crop improvement so,

many biological ways are used from which one of the method is to use Nematophagous

fungi. Nematophagous fungi is the type of a fungi which prey on nematodes with

specialized structure and effective predatory mechanism.

1.2.2 Effect on live stock production

This growing demand for livestock products offers an opportunity to the 675 million rural

poor who depend on livestock to improve their livelihoods. Globally, parasitic and other

endemic diseases continue to be a major constraint on profitable livestock production.

Parasitic nematodes cause serious infections in small ruminants and, as one of the greatest

causes for loss of productivity plus compromised welfare in grazing ruminants throughout

the world, constitute a serious problem for small ruminant livestock producers (Perry &

Randolph 1999). Beside the direct losses due to drop in production and deaths of animals,

most of the economic losses are due to sub-clinical effects and although not immediately

noticed by the owner, these can be substantial. Lanusse and Prichard (1993) estimated

that worldwide 1.7 billion US$ is spent annually to combat helminth parasites in cattle.

The systematic use of relatively inexpensive pesticide agents that are effective and easy to

apply has made it possible to control pests which affect wide range of production systems

but at the same time worrying, because of the possibilities of developing parasite

resistance, creating ecological imbalances and leaving residues in food. In developing

countries a sustainable and economically viable program to combat parasitic diseases in

general and resistance in particular, has become ever more crucial. Parasitic nematodes

(roundworms) of small ruminants and other livestock have major economic impacts

worldwide. Despite the impact of the diseases caused by these nematodes and the

discovery of new therapeutic agents (anthelmintics), there has been relatively limited

progress in the development of practical molecular tools to study the epidemiology of


these nematodes. Parasites of livestock cause diseases of major socio-economic

importance worldwide. The current financial and agriculture losses caused by parasites

have a substantial impact on farm profitability (Animal & Paper., 2002). Nematodes

mostly effect to pigs, sheeps, cattles and goats.

Sheep- Infection is normal in sheep and the number of nematodes found in individual

animals varies with essentially all animals having some nematodes. Most infections result

in minimal damage unless conditions change that alter the ability of the host to maintain

control, and then damage can become more severe, possibly leading to death depending

on the nematode species present (Miller & Horohov, 2006) sheep gazing rotation or other

grazing management strategies are used to control infections (Kelly., & Kahn, 2010)

Pig- . Internal parasites can kill, but loss of appetite, reduced daily rate of gain, poor

feed conversion, and increased susceptibility to other pathogens are the more common

results of parasitism observed on pigs (Lee & Coordinator, 2012)

Goats- The life cycle includes small ruminants as definitive hosts and numerous

terrestrial snails as intermediate hosts. Infected sheep and goats shed first-stage larvae

with their faeces and once within the intermediate host will grow and develop into second

and then third-stage larvae ,which are in turn infective for the definitive hosts. Infection

of small ruminants occurs through ingestion of infected snails or just by eating released

larvae with grass.(Paraud, & Chartier, 2005)

Cattle- Nematodes have severe effect on cattle as it has on sheep it has come from

gazing all over. Nematodes strike on cattle and infect its intestine which leads to failing in

eating and increase mortality (Kloosterman et al., 1992 and Stromberg; Waruiru et

al.,1998 and Averbeck,1999).

1.3 Control strategies for nematodes

1.3.1 For plants parasitic nematodes

Since 1950, the control of phytoparasitic nematodes has been based on chemical

pesticides, although several of them are being withdrawn from the market due to issues

related to the environment and public health. Methyl bromide was widely used against

nematodes, but now it has been withdrawn from the market because of its adverse effects

on the ozone layer. Nematodes also developed resistance against most of the known


pesticides, and this triggered worldwide research for new alternative agents and methods

for nematode control (Fernandez et al., 2001).

(1) Crop rotation

This is an important method for maintenance and improvement of soil fertility, and for

enhancing yield. In crop rotation, various crops are followed in a certain order in the same

soil. Crop rotation is used to starve nematodes by growing crops on which they cannot

feed and/or reproduce. Rotation programs have an advantage like the treatment can

provide some income, depending on the value of the rotational crop (Crow & Dunn,

2012) and (Nyczepir., 2008.)

(2) Chemical Controls

The goal is to protect plants early in the growing season allowing them to produce deep,

healthy root systems.

ÿFumigants. These are non-selective materials that vaporize when applied in thesoil. As gases, they move up through air spaces in the soil, killing nematodes and

other microorganisms. After applying most fumigants, a waiting period is required

before planting.

ÿNon-fumigants. These are available in liquid or granular forms. They are appliedeither in a band or in the seed furrow at planting. These materials move down

through the soil killing nematodes directly, or by interfering with feeding and

reproduction. ÿ

Seed treatments

These are the products applied to the seed coat. They may kill nematodes directly

or interfere with feeding and reproduction. It seems to be the popular method due

to ease of application.

(3) Use of resistant plants

Plants are resistant to nematodes when they have a reduced level of reproduction.

Nematode resistance genes are present in several crops, and are an important

component of various multiplication programs in tomatoes, potatoes, cotton,

soybean, and cereals. Resistance to nematodes can be either broad with action

against several species of nematodes or narrow against only selected specific

biotypes (Williamson and Hussey, 1996).


(4) Use of Biological agents

These are living organism that interferes with growth and reproduction of some species of

nematodes. Many fungi and bacteria are natural antagonist of nematodes and suppresses

nematode population. And Nematophagous is one of the known biological control agents

which kills nematodes efficiently (Stirling et al., 1991; Weibelzahl-Fulton et al. 1996;

Whipps, 1997; Alabouvette, 1999; Westphal and Becker 2001; Waller et al., 2002;

Mazzola, 2007 and Noel et al. 2010 ).

1.3.2 Control strategies for animals parasitic nematodes

(1) Rotational grazing

In rotational grazing systems the area is divided into a series of fields or paddocks

which are grazed in sequence (Hcc, 2011).

(2) Vaccination

Alternative check up and vaccination at the primary stage of disease is necessary

(3) Increase the host resistivity

By genetic manipulation and by using drug, resistivity of the animals can be

increased.

(4) Biological treatment

Using nematophagous fungi.

1.4 Biocontrol of nematodes

An eco-friendly pest management strategy draws the attention and it deliberately

introduced to kill natural enemies and to lower the population level of a target pest

(Delfosse, 2005). These enemies are commonly referred to as BCAs, which must

demonstrate some characteristics for success in the field, including ability for rapid

colonization of the soil, persistence, virulence, predictable control below economic

threshold, easy production and application, good viability under storage, low cost of

production, compatibility with agrochemicals, and safety (Kerry, 2000). In nature, it

is observed that many natural enemies, such as viruses, bacteria, fungi, and others,

can attack plant parasitic nematodes, but in the search for suitable BCAs more

attention has been given to fungi and bacteria. Biological control can be either

natural (i.e., when a natural population of a particular organism inhibits the growth

and development of nematodes), or induced (i.e., when BCAs have been introduced


artificially). There are two approaches for introduction: microbial pesticide application

for rapid control of a pest, and the introduction or mass release of a biocontrol agent to

provide long lasting control. The suppression can be specific or non specific, when only

one or two organisms are involved (Davies, 1991; Akhtar and Malik, 2000). Nematode

can be controlled by various biocontrol agents. This method is safe in comparison to

using chemical methods, as biocontrol agents are target specific and they does not

contain any harmful effects over plants and animals. Biocontrol agents are directly

applied on the host. Bacterial and fungal species can grow well over the nematodes, as

nematodes work as a nutrient source for them.

(1) Bacterial parasites- Bacterial insecticides have been found useful in controlling

nematodes. Researchers have made several attempts to utilize bacteria for

nematode control. Nematicidal bacteria are of two types: nematode parasites and

rhizobacteria. The most studied bacteria are Pasteuria penetrans, an obligate

endoparasite of Meloidogyne, followed by strains of Pseudomonas (Payne, 1992;

Dabier et.al, 2001; Ali et al, 2002 and Siddiqui and Shaukat, 2003). The infective

stage was initiated by attachment of endospores to the surface of a bacterial

larva. A germ tube then penetrated the nematode cuticle and filamentous

microcolonies of the bacterium formed in the pseudocoelum (Sayre, 1986).

(2) Fungal parasites of nematodes- Parasitic fungi are members of the kingdom

fungi, which thrive by latching on to other organisms and taking nutrients from

them. They are a type of symbiotic fungi, but they are not mutualistic because

they do not tend to give anything of value back to their host in return for

sustenance. The effective natural control of specific nematode pests in intensive

agricultural systems has been well documented and the causal microbial parasites

and pathogens have often been identified (Kerry, 1987; Dickson et al., 1994).

Fungi can be separated into distinct groups, based on how they interact with their

hosts. One group of natural enemies of nematodes are nematophagous fungi.

Fungal parasites act effectively, their effects are easily visible and they can be

easily cultured. Currently, over 200 or more fungal species have been identified

which attack or have been associated with egg, adult stages or larvae of

nematodes. There are thousands of species of fungi that are parasitic, and some

have adapted to be extremely specialized (Sayre, 1986).


1.5 Nematophagous fungi as biocontrol of nematodes

One of the most recommended idea to control nematodes in biological way, without

harming other non-targeted host is to use nematophagous fungi. Nematophagous fungi

are carnivorous fungi that have developed methods and structures that enable them to

successfully trap and consume prey nematodes. They are mainly known as natural

enemies of nematodes. These groups of fungi are responsible for keeping the nematode

population in check and are an important part of the subsoil ecosystem. These fungi

contain the potential biocontrol agents against plant- and animal-parasitic nematodes.

They have unique ability to kill the nematodes either by attack and feed on living

nematodes by their specialized structure or their eggs

The nematophagous fungi are found in all major taxonomic groups of fungi, and they

occur in all sorts of soil environments. They comprise more than 200 species of

taxonomically diverse fungi including lower and higher fungi. They are commonly found

in soils and decaying leaf litter, decaying wood, dung, compost and mosses. When grown

in soils, nematode-trapping fungi can grow as saprophytes as mycelium. The nematode-

trapping fungi develop special mycelial structures in the form of traps in response to the

presence of nematodes in the soil. Several species of microfungi are able to trap and kill

the developing larval stages of parasitic nematodes in a fecal environment. After passing

through the intestine, spores of this fungus germinate in feces, forming specialized, three-

dimentional networks that trap the parasite larvae (Larsen et al., 1997). Research on

cattle, horses, pigs, and sheep has demonstrated the potential of this organism as a

biological control agent against the free-living stages of parasitic nematodes in livestock

under both experimental and natural conditions. (Handrawathania, & Arsend., 2002

Roeber, & Gasser, 2013).

Nematophagous fungi present a high diversity not only in respect of taxonomic

distribution but also in respect of the trapping structures formed (Niblack, 2005.) These

fungi more useful in killing nematodes than chemical method as adding fungi to the host

does not arises any environmental impact, else nematodes become more resistance

towards chemical substances. Else low toxicity to humans and wildlife, low residues in

food, genetic stability and compatibility with integrated pest management are also the

major advantages of using nematophagous fungi.


The mechanisms behind the capture process, including attraction, adhesion, penetration

and digestion of nematodes. The ability to capture nematodes is connected with a specific

developmental phase of the fungal mycelium. The type of nematode-trapping structures

formed depends on species or even strains of species as well as on environmental

conditions, both biotic and abiotic conditions. The most important biotic factor is living

nematodes, which not only induce the formation of trapping structures by interacting with

fungi but also serve as a food source for the fungi after they have been invaded by the

fungi.

(Koon-hui wang et.al., 2013) (Davis, E.L. and A.E. MacGuidwin. 2000)

Figure 3: Trapping structure of nematodes by nematophagous fungi

Nematophagous fungi comprise three main groups:

1. The nematode trapping fungi

2. The endoparasitic fungi-that attack nematodes by using specialized structures, and

3. The egg- and cyst-parasitic fungi-that attack various life stages of nematodes with

their specialized structures.(Niblack,.2001., Tholander, 2007., Philip, 2002).

1.5.1 Nematode trapping fungi

The nematode-trapping fungi are the best known group among the nematophagous fungi

probably due to their remarkable morphological adaptations and their effective infection

of nematodes. They enter into the parasitic stage of nematodes by developing special

hyphal structures called traps, such as nets, knobs, branches or rings, in which nematodes

are captured mechanically or by adhesion. The killed nematodes provide the fungi with

an additional nutrient source that is rich in nitrogen. Other method used by fungi to trap

nematodes is the fungal ring. The fungus produces hyphae that end in an open


constricting loop. When a nematode swims through this loop, the loop suddenly fills with

water. This sudden change in the physiology of the loop causes the diameter of the inside

of the loop to narrow and in turn constricts around the nematode. Within 24 hours,

hyphae form from within the loop and penetrate the nematode as it begins to digest it. The

fungus creates such structures in order to trap the nematode within the structure.Examples

of this group are Arthrobotrys spp., such as A. oligospora, A. conoides, A. musiformis and

A. superba, which all form three-dimensional adhesive nets, whereas A. dactyloides uses

constricting rings to capture nematodes mechanically by the swelling of the ring cells.

Adhesive branches and adhesive knobs appear in the genus Monacrosporium. M.

haptotylum (Dactylaria candida) produces both adhesive knobs and no constricting rings.

(Nordbring-hertz, 2001).

1.5.2 The endoparasitic fungi

The endoparasitic fungi are often obligate parasites and are dependent on nematodes for

their survival. They infect nematodes with adhesive or non-adhesive spores which are

swallowed by the nematode or adhere to the nematode surface fungi develop an adhesive

bud on their conidia with which they infect the nematode. Fungi produce spores with

special shapes, which are ingested by the nematodes. Because of their shapes, the spores

get stuck in the nematodes and from there initiate infection of the nematodes. Examples

of this group are D. coniospora , H. rhossoliensis and C. anguillulae are the examples of

endoparasitic nematodes (Nordbring-hertz, 2001).

1.5.3 The egg and cyst parasitic fungi

Egg and cyst parasitic fungi that parasitize these non-motile stages of nematodes with

their hyphal tips. Hyphae of fungi grow towards the eggs and hyphal tips penetrate the

eggshell. The fungi then digest the contents of the egg and by this way they kill the

insects. Several fungi are capable of penetrating nematode eggs. The fungus Dactylella

oviparasitica grows rapidly through egg-masses of the root-knot nematode Meloidogwe

sp. and hyphae of the fungus penetrate egg-shells (Stirling & Mankau, 1979). Fungal egg-

parasites, isolated from eggs of the cyst nematode Heterodera avenae, were investigated

with respect to their ability to infect cyst nematode eggs of H. scbachtii by Dackman e t

al. (1989). Another widely studied egg parasitic fungi is Paecilomyces Lilacinus (Jatale et

al., 1980; Cabanillas and Barke, 1989; Gaspard et al., 1990; Siddiqui Mahmood, 1994;

Ciarmela et al., 2005 ; Kiewnick and Sikora, 2006; Anastasiadis et al., 2008; Carvalho et

al., 2010 and Sun et al., 2011).


Thus, the relationship of Nematophagous fungi to nematodes is also beneficial to it in two

way; first, nematodes may induce the formation of the structures in which they are later

captured (help in structural growth) and, second after invasion of the nematodes by the

fungus they serve as an additional food source to fungi. Many of the fungi do not form

traps spontaneously but the fungi are dependent on environmental conditions, especially

the presence of nematodes for induction of traps. There are evidences which suggest that

nematophagous fungi had to adapt this kind of parasitic habit of nematode killing due to

the nitrogen limiting habitat, which is more or less required for fungi growth. In such

crisis nematophagous fungi start attracted towards nematodes as they are rich of nitrogen

sources. Plant parasitic nematodes have shown that the level of fungal parasitism is

dependent on the nematode density. Most of all the fungi can be used for the control of

plant parasitic nematodes which global pests in agriculture and horticulture, causing

severe yield losses as nematodes widely attack on plants, mainly on plant roots for their

nutrient requirement. Therefore, the ability of the nematophagous fungi to grow in the

rhizosphere is of great importance for their capacity to control these nematodes.

Nematophagous fungi have the capacity to colonize plant roots (Monfort et al., 2005).

1.6 Nematode fungus interaction mechanism

Nematophagous fungi-nematode interactions provide excellent model system for

interaction study. (Nordbring-hertz, 2001., Tholander, 2007, &Al, 2008). There is cell -

cell interactions observed between the fungus and nematodes includes multiple steps that

could cause the final biochemical, physiological or morphological response. Nematodes

are attracted by compounds released from the mycelium and traps of nematode-trapping

fungi, and the spores of endoparasites. Both the morphology and consequently the

saprophytic/parasitic ability strongly influence the attractiveness of the fungi. After

contact, fungal nets are surrounded by a layer of extracellular fibrils. These fibrils

facilitate the anchoring and further fungal invasion of the nematode. The adhesion of the

traps to the nematode results in a differentiation of the fungi. A penetration tube forms

and pierces the nematode cuticle. After that the nematode is digested by the infecting

fungus. Fungus form a ring like structure. When a nematode moves into the ring, it

triggers a response such that the ring rapidly swell inward and close around the nematode.

1.6.1 Recognition and host specificity

(Nordbring-hertz, 2001)


The question of how nematophagous fungi recognize them is interesting part of study to

know nematode-fungus interaction. There are recognition events in the cell–cell

communication at several steps of the interaction between fungus and nematode, which

can produce a defined biochemical, physiological or morphological response. Nematodes

are attracted to the mycelia of the fungi in which they may induce trap formation and they

are attracted even more to fully developed traps and spores. This is followed by contact

communication or say adhesion. This step may involve an interaction between a

carbohydrate-binding protein in the fungus and a carbohydrate receptor on the nematode.

Recognition of the host is probably also important for the subsequent steps of the

infection, including penetration of the nematode cuticle (Swe et al., 2011)

1.6.2Attraction

Nematodes are attracted by compounds released from the mycelium and traps of

nematode-trapping fungi, and the spores of endoparasites. The structure and consequently

the parasitic ability strongly influence the attractiveness of the fungi. Fungi that are more

parasitic appear to have a stronger attraction than the other ones.

1.6.3 Adhesion

Nets are surrounded by a layer of extracellular fibrils even before the interaction with the

nematodes. After contact, these fibrils become directed perpendicularly to the host

surface, probably to facilitate the anchoring and further fungal invasion of the nematode.

The endoparasites show a completely different type of adhesive that seems to be

composed of fibrils. Spore adheres to the head of the nematode, thereby blocking

nematode attraction.

1.6.4 Penetration

The adhesion of the traps to the nematode results in a differentiation of the fungi. A

penetration tube forms and pierces the nematode cuticle. This step probably involves both

the activity of enzymes solubilizing compounds of the cuticle and the activity of a

mechanical pressure generated by the penetrating growing fungus. The nematode cuticle

is composed mainly of proteins including collagen, and several proteases have been

isolated from nematophagous fungi that can hydrolyse proteins of the cuticle. Following

penetration, the nematode is digested by the infecting fungus. Fungal ultrastructure

become change and the dense bodies are degraded in the trap cells and in that. The trap


structure typically contain normal cell organelles, helps in storage of nutrients obtained

from the infected nematode ad it support the growth of the fungus.

Thus, by this specialized mechanism of trapping of nematodes, Nematophagous fungi helps

to improve the plant health in efficient way. By applying various pesticides on insects along

with Nematophagous fungi may increase the activity of fungi to work better.

1.7 Non targeted effects of pesticides

1.7.1 Pesticides & environmental effects.

Pesticides are meant to kill the pests. They are purposely applied on field to suppress the

activity of pests. Pesticides contain sub specific compounds like fungicide; herbicide and

insecticide, each of them are specified for a perticulae pest. Pesticides have both

advantages and disadvantages but it is used from long old times and for farmer it becomes

necessity to fight against it. Increased demand for food and verity has lead to the

chemicalization of agriculture and we have reached on such a stage that modern

agriculture depends on high yielding varieties, which can only be grown under the

presence of pesticides as they are not susceptible to sustain against the pests. Majority of

these pesticides are beneficial when used for specific purpose, handled properly and

applied in proper amount. These modernization and industrialization act of human has

added pollution to the environment and it is a threat for ecology and life. Many pesticides

have the potential to harm non-target organisms, especially if the organisms are exposed

to high levels or for a long period of time (Breen, & Patterson, 1974). Pesticides form

negative impact after long duration of its usage. It causes changes in soil microbial genes

which lead to change in activity of microbes. They start doing breakdown of organic

matter, influence nutrient cycling and increase the resistivity towards pesticides.

(Sciences,. 2004) Pesticides affect the structure of ecosystem as when they applied to

ground they contaminate soil, air and water systems, which is harmful for healthy crop

yield. Organism develop tolerance to chemicals by frequent application of pesticides as

genetic adaptation, regulation at the rate at which chemical is taken up, excrete toxic

product in response of chemicals and many more. The levels of pesticides are found much

higher than expected level because of heavy contamination of environment. Nematodes

have broad range of activity which can change the natural soil flora and fauna. It is

studied that because of the all day use of pesticides in farms, required beneficial

microorganisms get reduced. Bacterial genera and species get decreased. Additionally,


changes in plant growth occur and originality of soil system vanished. Management of

plant-parasitic nematodes in crop production systems currently relies primarily on

nematicides, host-plant resistance and crop rotation. Still with the help of some successful

nematicides it is possible to control nematodes.

1.7.2 Why to study effects of pesticides on growth of nematophagous fungi

Pesticides are used to control nematodes but it carries as equal number of disadvantages

as it has advantages. Pesticides are chemical compounds which are way better effective

than biocontrol agents but pesticides can harm non-targeted host, they form harmful

contamination in soil, water and air. It inhibits the growth of beneficial non target fungi.

(Meyer, & Huettel, 1991)

Over the years many chemical pesticides has been invented which allows many

improvements in agriculture and horticulture yields. But most of these chemicals are

powerful and indiscriminate poisons and produce many adverse environmental effects.

Fungi proves very effective creature for controlling nematodes (Expos, Fungi, & York,

2001). field experiments are carried out, products are developed and successfully

marketed but then the fungal products are replaced by more effective chemical

insecticides.

By studying effects of various pesticides we get to know the resistivity of the

Nematophagous fungi towards the pesticides so, farmers can use it to more beneficial

purpose. If fungi are more resistant towards pesticides, both they can applied on field

together and it can increase the crop productivity. It can increase the activity of fungi if

the fungi are genetically engineered, by applying the pesticides the gene of fungi activates

and it is helpful for the a better activity of fungi. it can decrease the use of chemicals and

so the cost get decreases of using chemicals. Moreover, the harmful effects of pesticides

can be decreased. More the resistant fungi, more it is useful in agriculture field (Affairs,

1997).

∑ CARBENDAZIM- Carbendazim is widely used broad-spectrum benzimidazole

fungicide and a metabolite of benomyl. It is a systematic fungicide used on fruits,

vegetables, field crops, ornamentals, and turf. It has low toxicity and available

commercially in the form of a wettable powder and concentrated suspensions.

There is no specific treatment for carbendazim poisoning in animals. Symptomatic

treatment is applied to promote excretion. Inhibition of mitosis and cell division.

21


∑ MANCOZEB- mancozeb is a fungicide belonging to the class of the

dithiocarbamates. It is useful against a broad spectrum of fungal diseases. Acts by

distrupting lipid metabolism. Mancozeb inhibits enzyme activity by complexing

with meatl-containing enzymes including those involved with the production of

ATP.

∑ TEBUCANAZOL- Tebuconazol is a triazol fungicide used in agricultural to treat

plant pathogenic fungi. Its acute toxicity is moderate. Broad spectrum fungicide

and cause disruption of membrane function and inhibitors.

∑ ETHION- Ethion is an organophosphate pesticides used to kill aphides, mites,

scales, thrips and foliar feeding larvae. These chemicals act by interfearing with

the activities of cholinesterase, an enzyme that is essential for the proper working

of the nervous systems of both humans and insects. It may be used on a wide

variety of food, fiber and ornamental crops, including greenhouse crops.

∑ PROFENOFOS- It is an organophosphate insecticides. Profenofos was first

registered by the Agency in 1982 for use as an insecticide. Its chemical name is O-

(4-bromo-2-chlorophenyl) O-ethyl S-propyl phosphorothioate. Profenofos mainly

used to control tobacco budworm, cotton bollworm, armyworms (States &

Protection, 2006)

∑ GLYPHOSATE- Glyphosate is a widely popular herbicide known for its

effective control of competing vegetation, rapid inactivation in soil and low

mammalian toxicity. It is a broad-spectrum systematic herbicide used to kill

weeds. Mode of action of this herbicide is to inhibit Glyphosate's mode of action

is to inhibit an enzyme involved in the synthesis of the aromatic amino acids:

tyrosine, tryptophan and phenylalanine. It is absorbed through foliage and

translocated to growing points. Because of this mode of action, it is only effective

on actively growing plants; it is not effective as a pre-emergence herbicide (Busse,

& Powers, 2001)

1.8 Importance of Serine Protease and its association with Predatory activity of

nematophagous fungi

Parasitic nematodes cause great damage to crops and livestock. During the past 50 years,

nematicides have been used extensively to control nematodes in both plants and animals,

but their use has become increasingly restricted due to public health and environmental

22


concerns. Nematophagous fungi are natural enemies of nematodes and its role is

interesting to study infection biology and biochemistry associated with the capturing,

cuticle penetration and colonization process. Nematophagous fungi have attracted much

attention due to the use many enzymes, mainly extracellular proteases have been

implicated in the penetration and digestion of host tissues by many plant and animal

parasitic fungi. For genetic improvement of these organisms, it is necessary to understand

the molecular basis of biological control and to identify the different genetic components

that play a role during the process of nematode predation (Nagee., & Aich, 2008)

This is an important virulence factor of nematophagous fungi to produce extracellular

proteases and most of these proteolytic enzymes belong to the family of serine proteases

(Lopez-Llorca et al., 2010) During the infection of nematodes, nematophagous fungi must

penetrate the nematode cuticle, which is a rigid and flexible exoskeleton composed

mainly of proteins, including collagens (Cox et al 1981, Maizels et al 1993). Although the

proteinaceous nematode cuticle is an effective barrier against most pathogens,

nematophagous fungi can breach it using these enzymes. Several extracellular proteases

isolated from nematophagous fungi belong to serine proteases, and it has been

demonstrated that they have high homology to members of the subtilase family (Segers et

al 1994, Tunlid et al 1994, Bonants et al 1995). The importance of serine proteases during

the infection of nematodes has been indicated by treating nematophagous fungi with

various protease inhibitors (Tunlid and Jansson 1991) by localizing the protease during

the infection of eggs (Minglian,& Keqin, 2004) The dynamic structural features of a

classical serine protease were investigated using molecular dynamics (MD) simulation

technique. It has different degree of flexibility of the substrate binding region and it can

increase substrate binding affinity and catalytic activity (Shu-Qun Liu et al., 2009)

Understanding the 3-dimensional structures of these proteins can provide crucial

information for improving the effectiveness of these fungi in biocontrol applications, e.g.,

by targeted protein engineering. One way to improve the biocontrol potential of

nematophagous fungi is to increase the pathogenicity by increasing the number of copies

of cuticle-degrading genes in nematophagous fungi, using genetic engineering techniques.

Another way is to change the key amino acid residues of protease or other virulence

factors using site-directed mutagenesis. some fungi can infect both nematodes and insects,

and opportunistically infect human patients. Thus, the role of proteases during the

interaction between nematophagous fungi and nematodes could be an ideal model to

study the general roles of these proteases in fungi-host interaction. Solving the structures


of cuticle degrading proteases will thus not only facilitate virulence improvements for

fungi against nematodes or insects, but will also provide potential therapeutic drug targets

against fungi in clinical treatment (Liang et al., 2009)

Objectives

2. OBJECTIVES:

The present work was aimed to study the effect of some commercially available

pesticides on growth of our two isolates of nematophagous fungi. Objectives of the

present study were

1. Optimization of growth conditions i.e. media, pH and Temperature

2. To study the effect of fungicides on growth of isolates

3. To study the effect of herbicides and insecticides on growth of isolates

4. Amplification of Serine protease gene and its sequencing

5. Bioinformatics analysis

6. Identification of isolates by 18S rRNA gene sequencing

Materials & Methods

3.MATERIALS & METHODS

3.1 MATERIALS

FUNGAL ISOLATS:

Nematophagous fungal isolates GS1 and GS2 that were used in present study

were previously isolated and provided to me by my guide.

1. GLASS WARES

∑ Petri plates

∑ Conical flasks (250ml and 500ml)

∑ Sugar tubes

∑ Slides and cover slips

∑ Mortar and pestle

2. PLASTIC WARES

∑ Microfuge tubes (1.5ml and 2ml)

∑ Microtips (0.5 to 10µl, 20-200µl, 200-1000µl)

∑ PCR tubes (0.2ml)

∑ Centrifuge tubes (50ml)

∑ Measuring cylinder (100ml, 1000ml)

∑ Tip box

3. MEDIA

∑ Corn meal agar (17g/L, HI MEDIA)

∑ Czapak dox broth (35.01g/L,HI MEDIA)

∑ Sabouraud dextrose agar

∑ Jensen’s medium (24.1g/L,HI MEDIA)

∑ Martin’s medium

∑ Yeast extract peptone soluble starch medium

∑ Richard’s medium

∑ Nutrient agar medium(HI MEDIA)

∑ Potato dextrose agar (24g/L,HI MEDIA)

26

Materials & Methods

4. ANTIBIOTICS

∑ Tetracyclin

5. STAIN AND DYES:

∑ Bromo Pheno Bule (BPB)

∑ Lacto phenol blue

∑ Ethium bromide (EtBr)

6. PESTICIDES

(1) FUNGICIDES

∑ Tebucanazol (25%, Folicure)

∑ Carbendazim (50%, Bavistin)

∑ Memcozeb (75%, Dithane M-45)

(2) HERBICIDES

∑ Glyphosate (41%,Roundup )

∑ Methsulfuron methyl (20%, Algrip)

(3) INSECTICIDES

∑ Profenofos (40%, Profex Super)

∑ Ethion (50%, )

% concentration of active ingredient and Trade names are given in bracket.

7. CHEMICALS:

1) FOR FUNGAL DNA ISOLATION and GEL ELECTROPHORESIS

∑ Phenol

∑ Tris Base

∑ EDTA

∑ β- mercapto ethanol

∑ Boric acid

∑ Chloroform

∑ Ethanol

27

Materials & Methods

∑ Bromophenol blue

∑ Tris-Hcl

∑ SDS (Sodium dodicyl sulphate)

∑ Agarose

2) FOR PCR

∑ 2x PCR master mix, ( Genei, Banglore)

∑ Sterile mili q water

∑ Template DNA (100 ng)

∑ Agarose ( Hi-Media)

∑ Gel loading dye (BPB)

∑ 1X TBE buffer (dilute from 10X stock)

∑ Ethidium Bromide ( Hi-MediA)

∑ Serine protease gene specific forward and reverse primer

3) Buffer used

∑ Cell lysis buffer ÿ

50mM Tris chloride (pH-7.1) ÿ

300mM EDTA(pH-8)

ÿ1% SDS

∑ TBE buffer (10X) (pH-8) ÿ

Tris base- 108g/L ÿ

Boric acid- 55g/L

ÿEDTA- 40ml of 0.5M EDTA (pH-8.0)

8. INSTRUMENTS

∑ Autoclave (big-BLS)

∑ Incubator (NOVA)

∑ Micropipettes (BIOSYSTEM, ACCUPIPETTE)

∑ Laminar air flow (SELE)

∑ pH meter (SYSTRONIC)

∑ Gel-electrophoretic unit(APELEX)

∑ Shaker(NOVA)

Materials & Methods

∑ Nano drop (THERMO SCIENTIFIC)

∑ Waterbath (CINTEX DIGITAL)

∑ Electrophoretic power pack (APELEX)

∑ Hot air oven (BLS)

∑ Microscope (RADIAL)

∑ Weighing machine (SCALE-TEC)

∑ Magnetic stirrer (REMI)

∑ Refrigerator (SAMSUNG)

∑ Glass distillery

∑ Centrifuge (MPW)

∑ UV transilluminator (LABNET)

∑ Thermocycler (NYX TECHNIK)

∑ PCR workstation (AIRCLEAN)

9. SOFTWARE USED

∑ MEGA (Molecular Evolutionary Genetics Analysis) v5.1

∑ CLC genomics workbench v4.9

29

Materials & Methods

3. 2 METHODS

3.2.1. Maintenance of fungal cultures

Fungal isolates were maintained by inoculating CMA slant and incubating at 28º

C for 7days. Slants were stored at 4ºC until used.

3.2.2 Preparation of media

Readymade formulation of dehydrated media from the maker of ‘HI MEDIA’ was used

for preparing solid as well as liquid media. Media that were not available as readymade

were prepared by dissolving extra pure chemicals purchased from Hi media. All solid and

liquid media were amended with Tetracycline 30µg/ml to prevent bacterial

contamination.

3.2.3. Microscopic study of fungi

Fungal mycelia picked form 7 days old were stained with lacto phenol blue and observed

under 10X and 40X in light microscope. Conidia spores of nematophagous fungi were

harvested by washing a fully grown plate with 2ml sterile distilled water and using 10µl

of it for slides were prepared. Conidaio spores were also observed directly on Czapk Dox

Agar plates. Similarly trapping structures were also directly observed on plates under 40X

in light microscope(RADIAL) and photographs were taken.

3.2.4. Optimization of growth conditions

Different growth parameters i.e. Media, pH and Temperature were optimized form

luxurious growth of fungi.

(1) Optimization of media: Nine different media (Corn meal agar, czapak dox broth,

Jenson’s media, Richard’s media, nutrient agar media, potato dextrose agar, Martin’s

media, Sabouraud dextrose agar, Yeast extract peptone soluble starch media), were used

to show which media promotes luxurious growth of isolates. CMA plates were inoculated

centrally with 8mm diameter agar block from previously grown for 14 days. Plates were

prepared in triplicate for all the media for each fungus. Plates were incubated at 28º C for

7 days. Growth diameters in cm were measured, mean value was calculated and graph

was plotted.

Materials & Methods

(2) Optimization of pH and Temperature

For determination of optimum pH, isolates were grown on cornmeal agar with different

pH that is 4, 5, 6, 7, 8 and 9. For temperature, isolates were allowed to grow on cornmeal

at different temperatures that is 15, 25, 30, 37, 45 and 55ºC. All these studies were

performed in triplicate by inoculating plates centrally with 8 mm diameter agar block

from 15 days old CMA plates. For optimizing media and pH plates were incubated at

28ºC for 7 days. After 7 days mean value of growth diameter in cm was calculated and

graphs were plotted.

3.2.5 Effect of pesticides on the growth of isolates

(1) Effect of fungicides on growth of isolates

Corn meal agar (CMA) was prepared and autoclaved at 121 ºC at 15psi. Stock solutions

of the fungicides, mencozeb, tebucanazole and carbendazim were prepared in sterilized

distilled water. Appropriate volumes from the stock solutions of were added into corn

meal agar flask to achieve the final concentration of 0.5µg/ml, 1µg/ml, 2µg/ml, 3µg/ml,

4µg/ml and 5µg/ml. Plates were inoculated centrally with 8mm mycelia disc, taken from

the edge of an actively growing 7 days-old culture of isolates from CMA. CMA without

pesticides was used as control. The inoculated petri plates were incubated at 28ºC for 7

days. The diameter of growth in test and control was measured and % growth inhibition

was calculated.

(2) Effect of herbicides on growth of isolates

Corn meal agar (CMA) was prepared and autoclaved at 121ºC at 15psi. Stock solutions of

the herbicides were prepared in sterilized distilled water. Appropriate volumes from the

stock solutions of glyphosate and methsulfuron methyl were added into media to achieve

the final concentration of 50µg/ml, 100µg/ml, 500µg/ml, 1000µg/ml. Plates were

inoculated centrally with 8mm agar dick taken from the edge of an actively growing 7

days-old culture of isolates. The inoculated petri plates were incubated at 28ºC for 7 days.

The diameter of growth in test and control was measured and % growth inhibition was

calculated.

(3) Effect of insecticides on growth of isolates

Corn meal agar (CMA) was prepared and autoclaved at 121ºC at 15psi. Stock solutions of

the insecticides were prepared in sterilized distilled water. Appropriate volume from the

Materials & Methods

stock solutions of Ethion and Profenofos were added into CMA flask to achieve the final

concentration of 50µg/ml, 100µg/ml, and 500µg/ml. Plates were inoculated centrally with

8mm mycelia disc, taken from the edge of an actively growing fungus. Plates without

insecticide were serves as control. The inoculated petri plates were incubated at 28ºC for

7 days. The diameter of growth in test and control was measured and % growth inhibition

was calculated.

Percentage of fungal growth inhibition = (C-T)/C×100

Where: C= growth of the fungus in control and

T= growth of the fungus in media containing pesticides

3.2.6 Fungal DNA isolation

(1) Growth of fungi in liquid media

Spore suspension was prepared by pouring 5ml sterile distilled water on previously grown

CMA plates. 50ml potato dextrose broth containing 30µg/ml of tetracycline was

inoculated with 2ml of above spore suspension and was allows growing at 28ºC under

shaking conditions at 120rpm for 6days. Mycelia were harvested by centrifugation broth

at 10000rpm for 15min.

(2) Isolation of the genomic DNA

∑ Fungi were grown in 50ml PDB medium containing tetracycline(30µg/ml) for 7

days.

∑ Fungal mycelia were collected from broth and 200mg were taken for DNA

isolation.

∑ Mycelia were crushed in chilled mortar.

∑ To this 4ml of cell lysis buffer (pH 8) was added and further crushed to

homogeneity and transferred to 2ml sterile microfuge tubes.

∑ 50µl of 0.1% of β-mercaptoethanol was added, mixed thoroughly and incubated at

65ºC in water bath for 1hour. Samples were mixed gentally at an interval of

10mins.

∑ After incubation samples were centrifuged at 10,000 rpm for 10 minutes.

32

Materials & Methods

∑ Supernatant was transferred to another microfuge tubes and protein were

precipitated with equal volume of equilibrated phenol and further centrifuged at

10,000 rpm for 10 minutes.

∑ To the supernatant equal volume of phenol: chloroform added, mixed and

centrifuged at 10,000 rpm for 10 mins.

∑ Again to the supernatant chilled chloroform was added and centrifuged at 10,000

rpm for 10 minutes.

∑ DNA from aqueous phase were precipitation using double the volume of chilled

ethanol (70%) added and incubated at 4ºC for overnight.

∑ tubes were centrifuged at 12,000 rpm for 15 min, supernatant was decant off and

pellets were allowed to air dry.

∑ Finally pellets were suspended in 20µl of milliQ water.

3.2.7 Agarose gel electrophoresis

∑ 1% agarose gel was prepared in 1X TBE buffer with ethidium bromide. 4µl of

DNA and 2µl of loading dye (BPB) were mixed and loaded into wells.

Electrophoresis was carried out at 100mA for 30 min and gel was observed for

bands of genomic DNA on UV transilluminator and photographed.

3.2.8 Quantification of DNA

DNA was quantified by using ND-1000 Spectrophotometer

(NanoDropTechnologies Inc.) using the convention that 1 absorbance unit at 260

nm equals 50µg DNA/ml. The U.V. absorbance was measured at 260 and 280 nm

for determination of sample concentration and purity. Purity of DNA was judged

on the basis of absorbance ratio at 260/280 and 230/260.

3.2.9 Amplification of 18S r RNA gene and Serine Protease gene by Polymerase

Chain Reaction:

18S rRNA gene was amplified by using universal forward and reverse primers.

The reaction mixture was prepared as given below and the cycling conditions are

also given below.

33

Materials & Methods

Table 1: Reaction Mixture:

Reagent Quantity (µl)

TaqA Buffer (10X) 2.5

dNTPs Mix (2.5mM each) 2.5

Forward Primer (10µM) 1.0

Reverse Primer (10µM) 1.0

Genomic DNA (70-100ng/µl) 1.0

Taq polymerase (5U/ µl) 0.2

MiliQ water 16.8

Total 25.0

Table 2: Primer sequence for 18s rRNA

FR 5’AGGGTTCGATTCCGGAGA3’

RE 5’TTGGCAAATGCTTTCGC3’

Table 3: PCR cycling condition for 18s rRNA

Temperature Time (min) Cycle

(˚C)

Initial denaturation 94 5 -

Denaturation 94 1

Annealing 58 135

Extension 72 1

Final extension 72 7 -

Hold 4 -

Materials & Methods

Table 4: Primer sequence for serine protease

FR 5’GACCGTATCTCCCACGAGGA3’

RE 5’TGCCGTCAGAGTCGGTATTG3’

Table 5: PCR cycling condition for serine protease gene

Temperature Time (min) Cycle

(˚C)

Initial denaturation 94 5 -

Denaturation 94 1

Annealing 60 135

Extension 72 1

Final extension 72 7 -

Hold 4 -

(1) Agarose gel electrophoresis of Amplified PCR Products:

1% agarose gel was prepared in 1X TBE buffer. Then it was cooled nearly to 45

°C and 3µl of ethidium bromide solution was added. The prepared agarose gel

was poured into the gel casting stand with comb. After having a rigid gel, combs

were taken out to have wells for loading. 3 μl of PCR products and 2μl of loading

dye were mixed and loaded into well with 1kb DNA ladder. Electrophoresis was

carried out at 100 mA for 30 min and visualized in a UV transilluminator.

Materials & Methods

3.2.10 Identification of fungi

Fungi were identified based on 18S rRNA gene. For that amplified products were

sent to Xcleris Labs Ahmadabad for sequencing. Sequences were blast against nr

data base of NCBI using BlastX.

(1) Identification and phylogenetic analysis of isolates based on 18S rRNA and

Serine Protease gene sequencing

Nucleotide sequences of 18S rRNA genes of different nematophagous fungi with

different trapping mechanisms were downloaded from NCBI

(http://www.ncbi.nlm.nih.gov/). Phylogenetic tree was constructed using MEGA V5.1

(Tamura et al., 2011). The evolutionary history was inferred using the Neighbor-Joining

method (Saitou and Nei, 1987). Pairwise alignment of sequences was performed using

ClustalW in built feature of MEGA, with default parameters. The bootstrap consensus

tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa

analyzed (Felsenstein, 1985). Branches corresponding to partitions reproduced in less

than 30% bootstrap replicates are collapsed. The percentage of replicate trees in which the

associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to

the branches. The evolutionary distances were computed using the Maximum Composite

Likelihood method (Tamura K., Nei, 2004).

(2) Molecular analysis of serine protease gene

Primers that were used to amplify the serine protease genes were provided by my guide.

The following conditions were applied. Further a Neighbor-Joining tree was constructed

using CLC genomic work bench (CLC Bio4.9) (http://www.clcbio.com/) with bootstrap

value1000.

http://www.ncbi.nlm.nih.gov/

http://www.ncbi.nlm.nih.gov/

http://www.clcbio/

Results And Discussion

4. RESULTS AND DISCUSSION

4.1 Morphological characterization of isolates

Pattern of trapping structure and conidia and chlamydospores were used to identify fungi

on the base of morphology (Cook and Godfrey 1964; Schenck et al., 1977 and Rubner,

1996). Typical radial growth on CMA of both the fungi is shown in Figure 4(a) and 5(a).

Both the isolates were forming single septet on erect conidiophores Figure 4(b) and 5(b).

Similarly isolates were forming forming walled chlamydospores figure 4(c) and figure

5(c). Chlamydospores are highly resistant structure as stated previously can survive gut

passage of ruminants. Isolates were producing three dimensional ring networks figure

4(d) and 5(d). Nematodes are captured by these trapping devices. On the basis of

morphology both the fungi were identified to Duddingtonia flagrans.

(a) (b)

Trapping structure of GS1

(C) (d)

Figure 4: Morphological characterization of isolates GS1, (a) Fungus growth on

CMA after 7 days b) Single septed conidiospore under 40X c) Chlamydospores

under 40X (d) Trapping structure.


Septa

(a) (b)Septa

Trapping structure of GS2

(C) (d)

Figure 5: Morphological characterization of isolates GS2. (a) Typical Fungus growth

on CMA after 7 days b) Single septed conidiospore under 40X c) Chlamydospores

under 40X (d) Characteristic ring like trapping structure.


4.2 Optimization of growth media

Fungal isolates were grown on nine different media to evaluate which media support

maximun growth(Potato dextrose broth,Corn Meal agar,Czapak dox agar,Jenson’s

broth,Richard’s media,Yeast extract peptone soluble media,Sabouraud dextrose

agar,Martin’s edia,Nutrient agar). Results shows that Czapak dox agar and Jenson’s

medium support healthy growth of both the isolates. This was followeed by PDA and

CMA. Marition’s medium and Nutrient agar supports comparatelty poor growth (Figure

6).On other media isolates were growing moderately.

PDB

GS1 GS2

inhi

bitio

n

12

10

8

6

Gro

wth

4

2

% 0

Media

Figure 6: % Growth inhibition of fungal isolates on various media.


4.3 Optimization of pH :

The fungus is to be used in the field as well as will be used to feed the animals. In both

the case the pH variation will be there. So efforts were made to study the pH at which the

fungus can grow as ultimately to perform its job its very much required.cm

Avg

gro

wth

mea

sure

men

t in

10

8

6

4

2

0

GS1 GS2

4 5 6 7 8 9

pH

Figure 7: Growth of fungal isolates at various pH.

Fungi were grown on CMA with different pH. From the figure it is clear that neutral to

basic pH supports luxurious growth of both the isolates. Acidic pH was found to growth

inhibitory, at pH 4 very stunted growth was observed. At pH 6 fungi were growing

moderately.


4.4 Optimization of Temperature

Different regions have different temperature. So it’s required to check the effect of

different temperature on the growth of fungi. From this we get idea that in which season it

will be good if we use it for biological control and if it’s found that it can grow at broad

range of temperature then we can use it any time.

cmA

vg g

row

th m

easu

rem

ent i

n

10

8

6

4

2

0

GS1 GS2

15 25 30 37 45 55

Temp.

Figure 8: Growth of fungal isolates at various temperatures.

Results of temperature optimization are shown in figure. Temperature 25 ºC was found to

optimum for the growth. Fungi were failed to grow at 15, 45 and 55ºC. Comparatively

poor growth was observed at 30 and 37ºC .


4.5 EFFCT OF FUNGICIDE

Both fungi were sensitive to all the fungicide tested.

4.5.1 Effect of carbendazim (systematic fungicide) on growth of GS1 and GS2.

Carbendazim cause 100% inhibition of both the fungi at all the concentrations i.e. 10, 20,

30, 40 and 50µg/ml. This, indicate that the growth of all isolates were completely

inhibited by carbendazim even at its very low concentration (10µg/ml). So, application of

this fungicide is not suitable in field where Nematophagous fungi used as biocontrol

agent for plant parasitic nematodes.

Its been already reported by Goltapeh & Pakdaman that carbendazim causes complete

fungal growth inhibition at significant concentration in comparison to other fungicide

(Goltapeh & Pakdaman, 2008a).

4.5.2 Effect of Tebucanazole (systematic fungicide) on growth of GS1 and GS2

All isolates were sensitive to Tebucanazole at concentration event at 5µg/ml. So

application of this fungicide will have negative impact on our fungal isolates when

applied to field together.

Tebucanazol were used in fields by Sarkar and co-workers and this fungicide shows

complete growth inhibition upto the level of 200µg/ml. (Sarkar, et.al 2010)

4.5.3 Effect of mencozeb (contact fungicide) on growth of GS1 and GS2

Mencozeb causes 100% growth inhibition of GS1 and GS2 at 10 µg/ml concentration.

We have further analyze effect of mancozeb at low concentrations. Results show both the

isolates were partially resistant at 0.5-5 µg/ml concentration. It causes 28.4% growth

inhibition of GS1 and 21.48% growth inhibition of GS2 at 5µg/ml.

Goltapeh and co-worker reported mencozeb shows partial inhibition of fungal growth,

lesser than other fungicide that is observed (Goltapeh & Pakdaman, 2008b) at higher

conc.(500µg/ml) it inhibits the growth but at lower conc. it does not show its effect and it

is completely similar with the experiment done here, as it can be observed from the

graph(fig.9)


As avowed previously, one strategy of Integrated Pest Management (IPM) is to develop

fungal BCAs with tolerance to fungicides or to incorporate fungicide resistance into

antagonists. But our fungal isolates are not resistant to fungicides studied. So it is clear

that if we use these two fungi for the field application, these fungicides should not be

applied together.

The results of our study proves that our isolates of nematophagous fungus were partially

resistant to tested fungicides upto 5-10 µg/ml, so when these fungi applied in the field as

a biocontrol agent, such fungicides should be used upto a certain level of concentration

otherwise it may interfere with the performance of both the fungi.

% G

row

th in

hibi

tion

GS1 GS230

25

20

15

10

5

00.5 1 2 3 4 5

Conc. µg/ml

Figure 9: Effect of Mencozeb on growth of GS1 and GS2.


4.6 EFFECT OF HERBICIDE- Isolated Nematophagous fungi were found to resistant to

tested herbicide up to certain concentrations.

4.6.1 Effect of Glyphosate (systematic herbicide) on growth of GS1 and GS2.

Both the isolates were partially resistant to glyphosate as only 67.4% and 68.1% growth of

GS1 and GS2 respectively was inhibited at 500µg/ml concentration. Up to 300µg/ml

concentration only about 50% growth was inhibited, it shows that isolates are resistant to

Glyphosate (Busse et al., 2001) Herbicides are mainly for herbs and weeds. Here, it is

observed from the graph that Glyphosate has very low inhibitory effect on nematophagous

fungi and it shows same result in (Schuster, 1990) So, herbicides are preferable to use

along with nematophagous fungi in field.

% G

row

th in

hibi

tion

GS1 GS2

80

70

60

50

40

30

20

10

050 100 200 300 400 500

Conc. µg/ml

Figure 10: Effect of Glyphosate on growth of GS1 and GS2.


4.6.2 Effect of Methsulfuryl methyl (systematic herbicide) on growth of GS1 and

GS2

Same as Gylphosat, Methsulfuryl methyl doesn’t inhibit the growth of both the isolates. At

500µg/ml only about 50% growth of both isolates was inhibited.

To conclude the effect of herbicides it can be said that GS1 and GS2 are resistant to herbicides and that they can be used along with the fungi. Thus, in field both herbicides and nematophagous

fungi will perform their activity without interfering each other avidity.

50µg/ml 100µg/ml

% g

row

th in

hibi

tion

70

GS1 GS2

500µg/ml

6050

40

3020

100

200µg/ml 50 100 200 300 l 400 500500µg/ml

Conc. µg/ml

Figure 11. Effect of Methsulfuryl methyl on growth of GS1 and GS2.

200µg/ml

50µg/ml 100µg/ml

45


4.7 EFFECT OF INSECTICIDES

4.7.1 Effect of Ethion on growth of GS1 and GS2

Isolates were moderately sensitive to Ethion at 200-500µg/ml concentration. Nearly 50%

growth of both the isolates was observed up to 100µg/ml conc. Only 43.4 and 37.4 % growth

was inhibited at 50µg/ml concentration.

% G

row

th in

hibi

tion

GS1 GS2

80 70

60

50

40

30

20

10

050 100 200 300 400 500

Conc. µg/ml

Figure 12. Effect of Ethion on growth of isolates.

500µg/ml


4.7.2 Effect of Profenophos on growth of GS1 and GS2

Both isolates were comparately more sensitive to profenophose than ethion. Complete

inhibition of growth was found at 300µg/ml concentration. Even at 5µg/ml a very stunted

growth was observed. This showes that the isolates are very sensitive to profenophose.

To conclude it can be said that both isolates are sensitive to profenophose while resistant to

ethion up to certain concentartion. Our study demonstrate that profenophose cannot be

applied to field together with our fungal isolates.

Profenophos act differently on different nematphagous fungi, in general it has moderate

effect on fungi. But in our cases it has more toxic effect (Amutha et.al, 2010)

% G

row

th in

hibi

tion

90 GS1 GS2

80

7060

50

40

30

20

10

05 10 20 30 40 50 100 200

Conc. µg/ml

Figure 13: Effect of Profenophos on growth of GS1 and GS2


4.8 DNA Isolation

Fungal Genomic DNA was isolated by standard protocol. The DNA was visualised by gel

electrophoresis by running on 1% (w/v) agarose gel. The gel was visualised in UV

transilluminator and photographed subsequently. Isolated DNA was appeared as a faint

band below the wells.

Isolation of DNA was done to perform 18s rRNA gene amplification in order to do

identification of the isolaes at the molecular level. Also the amplification of the seriane

protease gene was done, the gene which is reported to play inmportant role in predation.

Figure 14: DNA bands observed under UV transilluminatorGS2


4.9 PCR product of 18s rRNA & Serine Protease

Both 18s rRNA and serine proease gene specific primer were used. DNA of isolates GS1 and GS2

were amplified and around 550 bp of amplified products were obtained with 18s rRNA primer and

224bp of amplified products were obtained with serine protease that resolved by 1.0% agarose gel.

Amplified products was appeared as single intact band under UV transillumiator. 18s rRNA

amplification is done to identify the fungal isolates at the molecular level. Serine protease is the

extracellular enzyme produced by the fungi which is involved in the degradation of the cuticle wall

of the nematodes which is very much required when the fungi is performing its predatory activity,

Figure 15. Amplified 18s rRNA gene Figure 16. Amplified Serine protease gene with

with 1kb ladder on 1% agarose gel. 1kb ledder on 1% agarose gel.


4.10 Identification of fungal isolates: The amplified 18s rRNA DNA sample was send for

sequencing. The sequence obtain were BLAST in order to know the identity of the fungal

isolates. Based upon this information the isolates were identified below:

∑ GS1:

AAAACGGGAAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAG

GTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAA

TGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGT

GCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGC

AGTTAAAAAGCTCGTAGTTGAATTTTGGGTTTGGCTGCTCGGTCCGCCTAA

CCGCGTGCACTGATGCGGCCGGATCTTTCTTTCTGGCTAACCTCATGCCCTT

CACTGGGTGTGCTGGGGATCCAGGACATTTACTTTGAAAAAATTAGAGTGT

TCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAAAATAAGA

CGGGGGTGTCTATTTTGTTGGTTTCTAGAGCCACCGTAATGATTAATAGGG

ATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTA

TTGAAGACTAACTACTGCGAAAGATTTTGCCAAAAAAA

Sequence shows 99% similarity with Duddingtonia flagrans sp.

∑ GS2:

ATCCCACGCAGGCAGCAGGCGCGCAAATTACCCAATCCCGATACGGGGAG

GTAGTGACAATAAATACTGATACAGGGCTCTTTTGGGTCTTGTAATTGGAA

TGAGTACAATTTAAATCCCTTAACGAGGAACAATTGGAGGGCAAGTCTGGT

GCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGC

AGTTAAAAAGCTCGTAGTTGAATTTTGGGTTTGGCTGCTCGGTCCGCCTAA

CCGCGTGCACTGATGCGGCCGGATCTTTCTTTCTGGCTAACCTCATGCCCTT

CACTGGGTGTGCTGGGGATCCAGGACATTTACTTTGAAAAAATTAGAGTGT

TCAAAGCAGGCCTTTGCTCGAATACATTAGCATGGAATAATAAAATAAGA

CGGGGGTGTCTATTTTGTTGGTTTCTAGAGCCACCGTAATGATTAATAGGG

ATAGTCGGGGGCATCAGTATTCAATTGTCAGAGGTGAAATTCTTGGATTTA

TTGAAGACTAACTACTGCGAAAAATTTGTTGCCAAAAAAA

Sequence shows 99% similarity with Duddingtonia flagrans sp.


Sample ID Organism identified Sequence length (bp) % similarity with

NCBI Subject

sequence

GS1 Duddingtonia flagrans 547 99%

GS2 Duddingtonia flagrans 549 99%

GenBank Accession no.

∑ GS1 KF741374

∑ GS2 KF741375

Figure 17: Neighbor-Joining tree based on 18S RNA gene sequence using

MEGA5.

4.11 Molecular analysis of serine protease gene

224bp gene fragment was amplified using the primer mentioned in the material and

methods. Sequence was 99% similar to D. flagrans serine protease PII. Further we

have aligned the nucleotide sequence our gene with the serine protease gene

sequences of nematophagous fungi and Neighbor-Joining tree was constructed

using CLC genomic work bench V4.9. Serine protease gene of our fungi was very

similar to the cuticle degrading serine protease (PII) gene of D. flagrans

(AY444725) and A. oligospora (AY444607) Figure 18. Pairwise alignment of

conserved region is shown similarity between the three serine protease nucleotide

sequences Figure 19.


∑ GS1 (using serine protease primer)

CCAACAAACATTCCTTATGAAAACGAAGAAATGCCGCCGGCGCTGGCACC

ACCGTCTACGTCATCGACACCGGTATCCGCATTACCCACGATGTAAGTTCC

CTTGTCTCCTAAAACGAATTGATCAATTTATTAACCATATTGTAGGAATTCA

AAACCTCCAACGGCACAAGCCGAGCTACTTGGGGATTCAACTCTGTCGACA

ATACCGACTCTGACGGCAAA

99% similrity with serine protease PII of D. flagrans strain 1351

Sample ID Organism identified Sequence length (bp) % similarity with

NCBI Subject

sequence

Serine protease Extra cellular serine 224 99%

D1 protease gene (partial)

Figure 18: Neighbour Joining tree of serine protease gene using CLC v4.9.


Figure 19: Pair wise alignment of serine protease gene using ClustalW in CLCv4.9.

Conclusion

Parasitic nematode cause huge loose in agriculture and livestock production. To protect

agriculture crop and livestock from the attack of nematode is very much needed as it affects

the economics of any nation. Use of pesticide is very common method to control pest but due

to resistant against pesticides, environment pollution and presence of pesticide in the food

residues is of concern. Hence an alternative methods is very much required which could be

applied . Use of nematophagous fungi as a biocontrol agent is one of the most prominent

strategy. However for it to be successfully implemented in to the field, the fungi must be

resistant to the fungicide, herbicide and insecticide applied to field. In the present study

efforts were mane to study their effect on our isolates. Before this the isolates were

characterized morphologically, nutrient requirements wise and physiologically. On Czapak

Dox agar the optimal growth was observed and in case of pH, neutral to slight alkaline (7-9)

was optimum for growth. While in case of temperature, 25°C was optimum temperature for

the growth of the isolates. Both the isolates were sensitive to very low concentration of

fungicides, where as in case of herbicides, isolates were resistant upto 100 µg/ml

concentration but sensitive to higher concentration i.e. 500µg/ml. Both isolates were partially

resistant to Glyphosate and Methsulfuron methyl at 500µg/ml.. Similar type of effects were

also seen with insecticides Ethion, it did not affect growth of isolates at lower concentration

and were found partially resistant to Ethion at higher concentration. However insecticide

Profenophose affect growth of both the isolates of nematophagous fungi even at low

concentration. So we can say that insecticide Ethion can be used but not Profenophose along

with the nematophagous fungi as it does not affect the nematophagous activity. Overall

results indicate that except fungicides and some insecticides at higher concentration i.e.

500µg/ml, isolated fungi can

be used for the control of nematodes. Both the isolates were identified base 18S rRNA

gene sequencing as Duddingtonia flagrans, showing 99% homology. Neighbor-Joining

tree using MEGA 5 shows that both the isolates were showing homology with nematode

trapping fungi. In addition to this we have also studied serine protease gene form isolate,

blast search shows 99% similarity with serine protease (PII) gene of D. flagrans

(AY444725). Further N-J tree using CLC genomic work bench V9 shows that serine

protease gene of D. flagrans-1 was homologous to serine protease (PII) gene of D.

flagrans (AY444725) and A. oligospora(AY444607).

References

Affairs, S. (1997). Health & Environmental Effects of Pesticides How does Toronto

Public Health weigh the risks ? take preventive action. How does science help us

understand the health effects of pesticides ?, 9–16.

Akhtar, M. and A. Malik.,(2000). Roles of organic soil amendments and soil organisms in

the biological control of plant-parasitic nematodes: a review. Bioresource Technol. 74:

35-47.

Al, M. (2008). In vitro Studies on Nematode Interactions with their Antagonistic Fungi in

the Rhizosphere of Various Plants.

Alabouvette C (1999) Fusarium wilt suppressive soils: an example of disease-suppressive

soils. Australas Plant Pathol 28:57–64

Ali, N. I., I. A. Siddiqui, S. S. Shaukat and M. J. Zaki.,(2002) Nematicidal activity of

some strains of Pseudomonas spp. Soil Biol. Biochem. 34:1051-1058.

Amarante, A.F.T., Susin, I., Rocha, R.A., Silva, M.B., Mendes, C.Q., Pires, A.V., (2009).

Resistance of Santa Ines and crossbred ewes to naturally acquired gastrointestinal

nematode infections. Vet. Parasitol. 165, 273–280.

Amutha, M., Banu, J. G., Surulivelu, T., & Gopalakrishnan, N. (2010). Effect of

commonly used insecticides on the growth of white Muscar dine fungus , Beauveria

bassiana under labor ator y conditions, 3, 143–146.

Animal, F. A. O., & Paper, P. (2002). Biological control of nematode parasites of small

ruminants in Asia.

Bonants PJM, Fitters PFL, Thijs H, Den-Belder E, Waalwijk C, Henfling JWDM., (1995).

A basic serine protease from Paecilomyces lilacinus with biological activity against

Meloidogyne hapla eggs. Microbiology 141:775–784.

Breen, K. J., Wentz, D. A., & Patterson, G. (1974). Pesticides used to control weeds,

insects, and other pests on farms and in urban areas can be harmful to humans and the

environment if they contaminate our water resources, 56–79.

References

Busse, M. D., Ratcliff, A. W., Shestak, C. J., & Powers, R. F. (2001). Glyphosate toxicity

and the effects of long-term vegetation control on soil microbial communities, 33.

Butt, T.M. and Copping, L.,(2000) Fungal biological control agents. Pesticide Outlook

11,186–191.

Butt, T.M. and Goettel, M.S.,(2000) Bioassays of entomogenous fungi. In: Navon, A. and

Ascher, K.R.S. (eds) Bioassays of Entomopathogenic Microbes and Nematodes. CAB

International, Wallingford, UK, pp. 141–195.

Butt, T.M., Carreck, N.L., Ibrahim, L. and Williams, I.H., (1998) Honey bee mediated

infection of pollen beetle (Meligethes spp.) by the insect-pathogenic fungus, Metarhizium

anisopliae.Biocontrol Science and Technology 8, 533–538.

Cabanillas, E. & Barker, K. R.,(1989). Impact of Paecilomyces lilacinus inoculum level

and application time on control of Meloidogyne incognita on tomato. J Nematol21, 115-

120.

Crow, W. T., & Dunn, R. A. (2012). Introduction to Plant Nematology 1, 1–12.

Cox GN, Kusch M, Edgar RS., (1981). Cuticle of Caenorhabditis elegans: its isolation

and partial characterization. J Cell Biol 90:7–17.

Dabiré, K. R., R. Duponnois and T. Mateille.,(2001).Indirect effects of the bacterial soil

aggregation on the distribution of Pasteuria penetrans,an obligate bacterial parasite of

plant-parasitic nematodes. Geoderma 102: 139-152.

Dackman, C., Chet, 1. & Nordbring-Hertz, B., (1989). Fungal parasitism of the cyst

nematode Heterodera schachtii: infection and enzymatic activity. Microb Ecol62,

201-208.

Davies, K. G., F. A. A. M. De Leij and B. R. Kerry.,(1991). Microbial agents for the

biological control of plant-parasitic nematodes in tropical agriculture. Trop. Pest Manag.

37: 303-320.

References

Davis, E.L. and A.E. MacGuidwin. (2000). Lesion nematode disease. The Plant Health

Instructor. DOI: 10.1094/PHI-I-2000-1030-02

Delfosse, E. S., (2005) Risk and ethics in biological control. Biol. Control 35: 319-329.

Dickson, D.W., Oostendorp, M., Giblin-Davis, R.M. and Mitchell, D.J., (1994) Control of

plant-parasitic nematodes by biological antagonists. In: Rosen, D., Bennett, F.D.

andCapinera, J.L. (eds) Pest Management in the Subtropics Biological Control –

a Florida. Perspective. Intercept, Andover, UK, pp. 575–601.

E. Monfort, L.V. Lopez-Llorca, H-B. Jansson, J. Salinas, Ja On Park, K.

Sivasithamparam; (2005) Colonisation of seminal roots of wheat and barley by egg

parasitic nematophagous fungi and their effects on Gaeumannomyces graminis var.

tritici and development of root-rot Soil Biology and Biochemistry, Volume 37, Issue 7,

July 2005, Pages 1229-1235

Ectoparasitic, T. H. E., & Of, N. (1997). Plant disease,Department of crop sciences

(1106).

Ellis, S. D., Boehm, M. J., & Rhodes, L. H. (2008). Nematode Diseases of Plants, 1–3.

Expos, A., Fungi, K., & York, N. (2001). Beauveria bassiana, 1–7.

Eysker, M., Ploeger, H.W., (2000). Value of present diagnostic methods for

gastrointestinal nematode infections in ruminants. Parasitological 120, S109-S119.

Fernandez, C., R. Rodríguez-Kabana, P. Warrior and J. W. Kloepper., (2001). Induced

soil suppressiveness to a root-knot nematode species by a nematicide. Biol. Control 22:

103-114.

Gaspard, J. T., Jaffee, B. A. & Ferris, H., (1990). Meloidogyne incognita survival in soil

infested with Paecilomyces lilacinus and Verticillium cblamydosporium. J Nematol22,

176-1 81.

Gives, P. M. De, Eugenia, M., & Arellano, L. (2010). Plant Extracts : A Potential Tool for

Controlling Animal Parasitic Nematodes.

http://www.sciencedirect.com/science/article/pii/S0038071704004493





References

Goltapeh, E. M., & Pakdaman, B. S. (2008a). Sensitivity of the Nematophagous Fungus

Arthrobotrys oligospora to Fungicides , Insecticides and Crop Supplements Used in the

Commercial Cultivation of Agaricus bisporus, 10, 383–389.

Handrawathania, P. C., Amnaha, O. J., Allerb, P. J. W., Öglundc, J. H., & Arsend, M. L.

(2002). Original article Nematophagous fungi as a biological control agent for nematode

parasites of small ruminants in Malaysia : a special emphasis on Duddingtonia flagrans,

33, 685–696. doi:10.1051/vetres

Hartman, J. (1993). Foliar Nematodes of Ornamentals, (July). page 1

Hcc, L. D.-. (2011). Impact of grazing management on cattle and sheep parasites,

(March).

I.A. Anastasiadis, I.O. Giannakou, D.A. Prophetou-Athanasiadou, S.R. Gowen; (2008)

The combined effect of the application of a biocontrol agents, Paecilomyces lilacinus

with various practices for the control of root-knot nematodes Crop Protection, Volume

27, Issues 3–5, March–May 2008, Pages 352-361

J.W.Noling. (1999). ENY-032 NG032 Nematode Management in Tomatoes, Peppers, and

Eggplant. (n.d.).

Jacobsen, B.J.,(1997) Role of plant pathology in integrated pest management. Annual

Review of Phytopathology 35, 373–391.

Jatala, P., Kaltenbach, R., Bocangel, M., Devaux, J. & Campos, R.,(1980). Field

application of Paecilomyces lilacinus for controlling Meloidogyne incognita on potatoes.

J Nematoll2, 226.

Kelly, G. a., Kahn, L. P., & Walkden-Brown, S. W. (2010). Integrated parasite

management for sheep reduces the effects of gastrointestinal nematodes on the Northern

Tablelands of New South Wales. Animal Production Science, 50(12), 1043.

doi:10.1071/AN10115

Kerry, B.R., Brown, R.H. and Kerry, B.R.,(1987) Biological control. (eds) Principles and

Practice of Nematode Control in Crops. Academic Press,New York, pp. 233–263.





References

Kerry, B. R.,(2000). Rhizosphere interactions and the exploitation of microbial agents for

the biological control of plant parasitic nematodes. Ann. Rev. Phytopathol. 38: 423-441.

Kiontke, K., & Fitch, D. H. a. (2013). Nematodes. Current biology : CB, 23(19), R862–4.

doi:10.1016/j.cub.2013.08.009

Kloosterman, A., Parmetier, H.K. and Ploeger, H.W., (1992). Breeding cattle and sheep

for resistance to gastrointestinal nematodes. Parasitology Today 8, 330-5.

Koenning, S. R., Overstreet, C., Noling, J. W., Donald, P. a, Becker, J. O., & Fortnum, B.

a. (1999). Survey of crop losses in response to phytoparasitic nematodes in the United

States for 1994. Journal of nematology, 31(4S), 587–618. Retrieved from

http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2620402&tool=pmcentrez&r

endertype=abstract

Koon-Hui Wang, Robert McSorley., (2013) key to commonly occurring nematophagous

fungi in Hawai and Florida. http://www.ctahr.hawaii.edu/WangKH/fungi.html

Lamberti, F, B. Kerry and M. A. Maqbool., (1997). Plant nematology in developing

countries: problems and progress. In: Plant Nematode Problems and their Control in the

Near East Region. FAO Plant Production andProtection Paper 144. Eds.;. Food and

Agriculture Organization of the United Nations, Rome.

Lanusse, C.E. and Prichard, R.K., (1993). Relationship between pharmacological

properties and clinical efficacy of ruminant anthelmintics. Veterinary Parasitology 49,

123-158.

Larsen., (1997) Alternative strategies to prevent and control endoparasite diseases in

organic sheep and goat farming systems – a review of current scientific knowledge –

,1997)

Lee, A., & Coordinator, P. H. (2012). Internal parasites of pigs, (May).

http://www.ctahr.hawaii.edu/WangKH/fungi.html

References

Liang, L., Meng, Z., Ye, F., Yang, J., Liu, S., Sun, Y., Zhang, K. (2009). The crystal

structures of two cuticle-degrading proteases from nematophagous fungi and their

contribution to infection against nematodes, 1–10. doi:10.1096/fj.09-136408

Lima, Peru.,(2006) Major Potato Diseases, Insects, and Nematodes — International

Potato Center, 1996. III p. Press run: 2,000

Locke, J.C. and Lumsden, R.D., (1989) Interaction of the biocontrol agent, Gliocladium

virens, with several soil drench fungicides in a zinnia damping-off system, 1989.

Biological and Cultural Control Tests 4, 85.

Locke, J.C., Marois, J.J. and Papavizas, G.C., (1985) Biological control of Fusarium wilt

of greenhouse-grown chrysanthemums. Plant Disease 69, 167–169.

Lopez-Llorca, L. V, Gómez-Vidal, S., Monfort, E., Larriba, E., Casado-Vela, J., Elortza,

F.,Martín-Nieto, J. (2010). Expression of serine proteases in egg-parasitic nematophagous

fungi during barley root colonization. Fungal genetics and biology : FG & B, 47(4), 342–

51. doi:10.1016/j.fgb.2010.01.004

Lanusse, C.E. and Prichard, R.K., (1993). Relationship between pharmacological

properties and clinical efficacy of ruminant anthelmintics. Veterinary Parasitology 49,

123-158.

M.L. Ciarmela, P. Sanchez Thevenet, H.M. Alvarez, M.C. Minvielle, J.A. Basualdo

Effect of on the Paecilomyces lilacinus on the viability of oncospheres of Taenia

hydatigena Veterinary Parasitology, Volume 131, Issues 1–2, 15 July 2005, Pages 61-64

Mazzola M., (2007) Manipulation of rhizosphere bacterial communities to induce

suppressive soils. J Nematol 39:213–220

Ming Sun, Qiaoyun Ren, Guiquan Guan, Zhijie Liu, Miling Ma, Huitian Gou, Ze Chen,

Youquan Li, Aihong Liu, Qingli Niu, Jifei Yang, Hong Yin, Jianxun Luo., (2011)

Virulence of Beauveria bassiana, Metarhizium anisopliae and to Paecilomyces lilacinus







References

the engorged female Hyalomma anatolicum anatolicum tick (Acari: Ixodidae) Veterinary

Parasitology, Volume 180, Issues 3–4, 25 August 2011, Pages 389-393

Meyer, S. L., Sayre, R. M., & Huettel, R. N. (1991). Benomyl Tolerance of Ten Fungi

Antagonistic to Plant-parasitic Nematodes. Journal of nematology, 23(4), 402–8.

http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2619191&tool=pmcentrez&r

endertype=abstract

Miller, J. E., & Horohov, D. W. (2006). Immunological aspects of nematode parasite

control in sheep. Journal of animal science, 84 Suppl, E124–32. Retrieved from

http://www.ncbi.nlm.nih.gov/pubmed/16582083

Minglian, Z., Minghe, M., & Keqin, Z. (2004). Characterization of a neutral serine

protease and its full-length cDNA from the nematode-trapping fungus Arthrobotrys

oligospora. Mycologia, 96(1), 16–22. Retrieved from

http://www.ncbi.nlm.nih.gov/pubmed/21148823

Mitkowski, N.A. and G.S. Abawi., (2003). Root-knot nematodes. The Plant Health

Instructor. DOI:10.1094/PHI-I-2003-0917-01

Nagee, A., Acharya, A., Shete, A., Mukhopadhyaya, P. N., & Aich, B. A. (2008).

Molecular characterization of an expressed sequence tag representing the cuticle-

degrading serine protease gene ( PII ) from the nematophagous fungus Arthrobotrys

oviformis by differential display technology, 7(4), 1200–1208.

Niblack, T. (2005). Nematodes,Department of crop sciences 209–218.

Noel GR, Atibalentja N, Bauer SJ., (2010) Suppression of Heterodera glycines in a

soybean field artificially infested with Pasteuria nishizawae. Nematropica 40:41–52

Westphal A, Becker JO (2001) Components of soil suppressiveness against Heterodera

schachtii. Soil Biol Biochem 33:9–16

Nordbring-hertz, B. (2001). eLS, 1–11. doi:10.1038/npg.els.0004293


References

Nyczepir, A. P. (2008). Andrew P. Nyczepir. Southeastern Fruit and Tree Nut Research

Laboratory Reproduction and development of Meloidogyne incognita and M. javanica on

Guardian peach rootstock. J. Nematol. 31: 334-340.

O’Neill, T.M., Elad, Y., Shtienberg, D. and Cohen, A.,(1996) Control of grapevine grey

mould With Trichoderma harzianum T39. Biocontrol Science and Technology 6, 139–

146.

Oerke, E.-C. (2005). Crop losses to pests. The Journal of Agricultural Science, 144(01),

31. doi:10.1017/S0021859605005708

Olsen, M. W. (2000). Root-knot Nematode, 1–3.

Philip Jecob., (2002)

Nematophagous%20fungi%20%20An%20Illustrated%20Overview.html

Paraud, C., Cabaret, J., Pors, I., & Chartier, C. (2005). Impact of the nematophagous

fungus Duddingtonia flagrans on Muellerius capillaris larvae in goat faeces. Veterinary

parasitology, 131(1-2), 71–8. doi:10.1016/j.vetpar.2005.04.016

Payne, J. M.,(1992). Isolates of Bacillus thuringiensis that are active against nematodes.

U.S.A. patent n° 5151363 (www. patft.uspto.gov/netacgi).

Perry B.D. and Randolph T.F.,(1999). Improving the assessment of the economic impact

of parasitic diseases and of their control in production animals. Veterinary Parasitology

84, 145-168.

R.O. Carvalho, J.V. Araújo, F.R. Braga, J.M. Araujo, C.D.F. Alves.,(2010) Ovicidal

activity of Pochonia chlamydosporia and Paecilomyces lilacinus on Toxocara canis eggs

Veterinary Parasitology, Volume 169, Issues 1–2, 19 April 2010, Pages 123-127

S. Kiewnick, R.A. Sikora.,(2006) Biological control of the root-knot

nematode Meloidogyne incognita by paecilomyces lilacinus strain 251. Biological

Control, Volume 38, Issue 2, August 2006, Pages 179-187












References

Sarkar, S., Narayanan, P., & Divakaran, A. (2010). The in vitro effect of certain

fungicides , insecticides , and biopesticides on mycelial growth in the biocontrol fungus

Trichoderma harzianum, 34, 399–403. doi:10.3906/biy-0812-4

Sayre, R. M. (1986). Pathogens for biological control of nematodes, 5(January 1985),

268–276.

Schuster, E. V. I. (1990). % I, 22(3), 375–383.

Siddiqui, I. A. and S. S. Shaukat.,(2003). Effects of Pseudomonas aeruginosa on the

diversity of culturable microfungi and nematodes associated with tomato: impact on root-

knot disease and plant growth. Soil Biol. Biochem. 35:1359-1368.

States, U., & Protection, E. (2006). Washington d.c., 20460, (1).

Stirling GR., (1991) Biological control of plant-parasitic nematodes: progress, problems

and prospects. CAB International, Wallingford

Stirling, G. R. & Mankau, R., (1979) Mode of parasitism of Meloidogyne and other

nematode eggs by Dactylella oviparasitica. J Nematol 11, 282-288.

Swe, A., Li, J., Kq, Z., Sb, P., Jeewon, R., & Kd, H. (2011). Nematode-Trapping Fungi,

1–26.

Tariq M. Butt, Chris Jackson and Naresh Magan., (2001) Fungal Biological Control

Agents: Progress, Problems and Potential.

The, F. O. R., Of, M., & Insects, D. (2005). For the management of soil-.Department of

entomology

Tholander, M. (2007). Transcriptome Analyses of the Nematode-trapping Fungus

Monacrosporium haptotylum.

W.S.Cranshaw, R.Zimmerman.,(2013). Insect Parasitic Nematodes; Colorado state

university; page 1

References

Wang, K.-H., & McSorley, V. (2005). Effects of Soil Ecosystem Management on

Nematode Pests, Nutrient Cycling, and Plant Health. APSnet Feature Articles.

doi:10.1094/APSnetFeatures/2005-0105

Waruiru, R.M.,(1998). Epidemiology and control of gastrointestinal parasite infections of

dairy cattle in Kiambu district, Kenya and in Denmark with emphasis on parasitic

gasteroenteritis. Ph.D thesis Uni. Nairobi, Kenya, pp. 294.

Waruiru, R.M., Ayuya, J.M., Weda, E., Kimoro, C.O., (1993). Fatal haemonchosis in

heifers in Kiambu District, Kenya: a case study. Bulletin of Animal Health and

Production in Africa 41, 263-265.

Weibelzahl-Fulton E, Dickson DW, Whitty EB., (1996) Suppression of Meloidogyne

incognita and M. javanica by Pasteuria penetrans in field soil. J Nematol 28:43–49

Weller DM, Raaijmakers JM, McSpadden Gardner BB et al., (2002) Microbial

populations responsible for specific soil suppressiveness to plant pathogens. Annu Rev

Phytopathol 40:309–348

Westphal A, Becker JO.,(2001) Components of soil suppressiveness against Heterodera

schachtii.Soil Biol Biochem 33:9–16

Whipps JM., (1997) Developments in the biological control of soil-borne plant

pathogens. Adv Bot Res 26:1–134

Whipps, J.M. and Lumsden, R.D. (eds) (1989) Biotechnology of Fungi for Improving

Plant Growth. Cambridge University Press, Cambridge, UK.

Williamson, V. M. and R. S. Hussey. (1996).,Nematode pathogenesis and resistance in

plants. Plant Cell 8: 1735-1745.

http://www.sardi.sa.gov.au/pestsdiseases/plant_soil_health/nematology/nematodes_in_so

uth_australia




Appendix

BUFFERS AND STOCK SOLUTIONS FOR MOLECULAR

CHARACTERIZATION

∑ Lysis buffer:

50 mM Tris cl (pH 7.2)

300 mM EDTA (pH 8.0)

1% SDS

Take 60ml of D/W add 8.675gm of EDTA in that and make a pH 8.0 (A)

↓

Add 0.788gm of Tris HCL in 20ml of distilled water and make pH 7.2 (B)

↓

Mix solution (A) & (B)

↓

Add 1gm of SDS in 10ml distilled water and heat it to dissolve

↓

Mix all chemicals above and set the pH 8.0

∑ TBE buffer (10X)

Take 4ml of 0.5 M EDTA (pH 8.0)

↓

Add 10.8gm of Tris base and 5.5gm of Boric acid in 95ml of distilled water

↓

Mix above two solution and autoclave it.

Appendix

∑ Tris Saturated Phenol (100ml)

100ml of phenol and 100ml of Tris Hcl(pH 8.0)

↓

Saturate it for 4-5hrs

↓

Separate it and add 100ml of 0.1M tris(pH 8.0)

↓

Put it overnight on stirrer

↓

Final pH of Phenol is 8.0

∑ Chemicals

Phenol Chloroform

Equal volume of equilibrated phenol and chloroform(1:1) were taken and stored in

amber bottle.

∑ Composition of culture media: (gm/l)

1)Sabouraud dextrose Agar

Dextrose - 6gm/L

Peptone - 1.5gm/L

2)Nutrient Agar

Beef extract - 3.0 gm/L

Peptone - 5.0 gm/L

NaCl - 5.0 gm/L

Appendix

3)Richard’s Medium

Sucrose - 7.5 gm/L

K2HPO4 - 5.0gm/L

Fecl3 - 0.02gm/L

KNO3 - 10.0gm/L

MgSO4.7H2O - 0.5gm/L

4)Jenson’s Medium

Dextrose - 10gm/L

K2HPO4 - 0.5gm/L

Fecl3.6H20- trace

Peptone - 5.0gm/L

MgSO4.7H20 - 0.2gm/L

5)Martin’s Medium

Dextrose - 10gm/L

K2HPO4 - 0.5gm/L

Peptone - 5.0gm/L

MgSO4.7H20 - 0.5gm/L

Appendix

Documents

Dhara Desai- thesis