TECHNICAL NOTE

Development of tetranucleotide microsatellite loci for the finlessporpoise (Neophocaena phocaenoides)

Lian Chen Æ Guang Yang

Received: 21 September 2007 / Accepted: 17 October 2007 / Published online: 30 November 2007

� Springer Science+Business Media B.V. 2007

Abstract The finless porpoise, Neophocaena phocaeno-

ides, is endemic to the coastal waters of the Indo-Pacific,

ranging from the Persian Gulf to Japan. Nine tetranucleo-

tide microsatellite loci were isolated from the finless

porpoise (Neophocaena phocaenoides). Polymorphism of

each locus was assessed in 39 unrelated individuals from

the Yellow Sea and the South China Sea of the Chinese

waters. The number of alleles per locus varied from 2 to 11.

The ranges of observed and expected heterozygosity were

0.154–0.795 and 0.146–0.839, respectively. Cross-species

amplification of these loci was tested in other cetacean

species. These microsatellite markers described here will

be suitable for population genetic studies of finless por-

poises and other cetacean species.

Keywords Tetranucleotide � Microsatellite loci �Neophocaena phocaenoides

The finless porpoise, Neophocaena phocaenoides, is

endemic to the coastal waters of the Indo-Pacific, ranging

from the Persian Gulf to Japan. The Yangtze River popu-

lation, distributed in the middle and lower reaches of the

Yangtze River, is classified as endangered in the IUCN Red

List of Threatened species (Hilton-Taylor 2000). To pro-

vide effective conservation and management for the finless

porpoises in Chinese waters, we need a better under-

standing of the population genetic structure of this species.

A good way to study population genetic variation is

through the use of specific molecular markers. Among

them, microsatellites or short tandemly repeated base-pair

sequences are the most useful due to the high variability

caused by changes in their repeat number (Schlotterer and

Pemberton 1998). The principal goal here was to develop

sufficient microsatellite loci that could be used to elucidate

population structure and aid management of finless por-

poises in China. Moreover, screening new markers for

cross-amplification across a range of cetacean species will

aid researchers working on different taxa. We isolated

tetranucletide motifs because they can be scored less

ambiguously and are less likely to suffer from slippage

errors than the more commonly used dinucleotide repeats

(Schlotterer and Tautz 1992).

Microsatellites were obtained from an enriched library

constructed with modifications of the protocol presented by

Gardner et al. (1999). Genomic DNA was extracted from

muscle tissue of three unrelated finless porpoise individuals

using the DNeasy Tissue Kit (QIAGEN). DNA samples

were pooled and digested with Sau3AI restriction enzyme

(New England Biolabs) and size-selected fragments (300–

700 bp) were excised from agarose and purified. The

fragments were ligated to Sau3AI adaptors: oligo A: 50-GGCCAGAGACCCCAAGCTTCG-30 and oligo B: 50-pGATCCGAAGCTTGGGGTCTCTGGCC-30. The ligated

fragments were hybridized with a 50 biotinylated probe

(GATA)6 at room temperature for 30 min and then cap-

tured by streptavidin-coated magnetic beads (Promega).

Nonspecific binding and unbound DNA were removed by

several nonstringent and stringent washes. These micro-

satellite-enriched DNA fragments were PCR-amplified

again and then ligated into pGEM-T Easy vectors (Pro-

mega) and transformed into JM109 competent cells.

Transformed cells grew at 37�C for 16 h on LB/ampicilin/

L. Chen � G. Yang (&)

Jiangsu Key Laboratory for Biodiversity and Biotechnology,

College of Life Sciences, Nanjing Normal University, 1

Wenyuan Road, Nanjing 210046, China

e-mail: gyang@njnu.edu.cn

123

Conserv Genet (2008) 9:1033–1035

DOI 10.1007/s10592-007-9443-7

IPTG/X-gal plates for blue/white selection. Twenty-five

positive clones were screened and sequenced.

Primers were designed for 13 microsatellite containing

sequences using the software PRIMER 3 (Rozen and

Skaletsky 2000). An estimate of the variability at each

locus was evaluated in 39 individuals collected from the

Yellow Sea and the South China Sea. Genomic DNA from

these individuals was extracted by a standard phenol/

chloroform protocol (Sambrook and Russell 2001). Fluo-

rescent dye labelling of PCR fragments was performed

with three primers: a sequence-specific forward primer

with M13 tail at its 50end (50-CACGACGTTGTAAAAC-

GAC-30), a sequence-specific reverse primer, and the

fluorescent labelled M13 primer (either IRD700 or IRD800

(LI-COR)). PCR amplifications were conducted in 25-ll

volumes containing 100 ng template DNA, Ex Taq premix

buffer 12.5 ll (Takara), 5 pm of each primer, 0.5 pmol of

fluorescently labelled M13 primer. The conditions for

amplification were 5 min at 95�C followed by 30 cycles of

30 s at 95�C, 30 s at the annealing temperature (Table 1)

and 30 s at 72�C with a final extension time of 10 min at

72�C. PCR products were separated on 6.5% polyacryl-

amide gels using a LI-COR 4300 automated DNA

sequencer and analysed using LI-COR SAGAGT software.

Of the 13 characterized loci, two failed to amplify a

consistent product, one (Np429) appeared to be mono-

morphic, one generated a single PCR band but PCR

product was undetected using the LI-COR 4300 automated

DNA sequencer, and the rest nine were found to be poly-

morphic. Calculations of observed and expected

heterozygosities were performed in Cervus2.0 software

(Marshall et al. 1998) (Table 1). The number of alleles per

polymorphic locus ranged from 2 to 11, while the observed

and expected heterozygosities ranged from 0.154 to 0.795

and from 0.146 to 0.839, respectively. Tests for departure

from Hardy–Weinberg equilibrium (HWE) and for linkage

disequilibrium (LD) at each locus were conducted with

GENEPOP 3.4 (Raymond and Rousset 1995). After

sequential Bonferroni correction (Rice 1989), only Np427

showed significant departures from Hardy–Weinberg

equilibrium. The heterozygote deficiency could be due to

the presence of null alleles, as suggested by Micro-Checker

(Van Oosterhout et al. 2004). Two out of 36 pairwise

comparisons exhibited significant linkage disequilibrium

(Np407 and Np426, Np409 and Np427) following

sequential Bonferroni correction.

In order to assess interspecific amplification, all primer

pairs were tested with the same PCR conditions on four

Table 1 Characteristics of nine polymorphic nuclear microsatellite loci and one monomorphic microsatllite locus for the finless porpoise

Locus Repeat motif Primer sequences (50–30) Size

range (bp)

Ta (�C) A Ho He Accession no.

Np403 (GATA)7 F: GGCACAGGCAGGTTGGAC 200*232 62 8 0.744 0.839 EF654673

R: GGTGTTTACGCAGGGGAG

Np404 (GATA)3GAT(GATA)9 F: GGTCAGAACAAGAACACAG 177*193 60 5 0.590 0.607 EF654674

R: CTCCTCCTAATACAGAAATAC

Np407 (GATA)2GAT(GATA)2AATA

(GATA)4

F: TATCCCATCAGCATTCCT 204*224 55 3 0.154 0.146 EF654675

R: CCAGAGAAACAGAACCAG

Np409 (AGAT)3(GATA)9—(GGAA)10 F: TGGGAGAGGTATAAGTGGCT 225*273 60 11 0.641 0.686 EF654676

R: TGGATGGGTGGAAGTAGTT

Np417 (GATA)10(GACA)3TATA

(GATA)4(GACA)2

F: GGTCCCACAACTACAGAACT 180*208 60 8 0.718 0.814 EF654677

R: GGTCCTCCAGAGAAACAG

Np426 (GATA)6(GGTA)2 F: GCAAGGATAAAGAGAATAGAG 120*124 60 2 0.513 0.506 EF654678

R: CTAAGCCTGGAGTGTTCAT

Np427 (GATA)5GATG(GATA)3 F: CAGGACAGTTGTGACCAT 196*220 60 6 0.410 0.625* EF654679

R: GCTGAGGCAAAGAGAGTA

Np428 (GATA)8(GACA)4 F: CCAGAGAATCAGAACCAATAG 134*166 60 8 0.795 0.813 EF654680

R: CCAGAATCACACGAGCCT

Np429 (GATA)4GGA(GATA)

2—(GATA)5

F: CAGAGAAACAGAACCAGTAG 187 60 – – – EU219350

R: CTCAGCTTCCATAATCAG

Np430 (GATA)4GAT(GATA)

3GAT(GATA)3

F: TTCAATGAGAGAGAGCAAG 167*183 55 3 0.154 0.213 EF654681

R: AGAAGCATAGTGTAGTGGTG

Ta, annealing temperature; A, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity; *, indicates significant deviations

from Hardy–Weinberg equilibrium after sequential Bonferroni correction

1034 Conserv Genet (2008) 9:1033–1035

123

other cetacean species: harbour porpoise (Phocoena pho-

coena) (n = 4), Dall’s porpoise (Phocoenoides dalli)

(n = 4), Chinese white dolphin (Sousa chinensis) (n = 6),

and striped dolphin (Stenela coeruleoalba) (n = 3). Cross-

species amplification was successful in most of the species

tested indicating their potential utility for population

genetic studies of other cetacean species (Table 2). In

conclusion, the microsatellite markers described here will

be useful for investigating the genetic diversity, genetic

structure and gene flow within populations of finless por-

poises which in turn should help improve management

strategies and conservation efforts for this species.

Acknowledgements We wish to acknowledge that this work was

supported by the National Natural Science Foundation Commission of

China (NSFC) grants nos 30470253 and 30670294, and the Program

for New Century Excellent Talents in University (NCET), the Min-

istry of Education of China.

References

Gardner MG, Cooper SJB, Bull CM, Grant WN (1999) Isolation of

microsatellite loci from a social lizard, Egernia stokesii, using a

modified enrichment procedure. J Hered 90:301–304

Hilton-Taylor C (2000) 2000 IUCN red list of threatened species.

IUCN-The World Conservation Union, Gland, Switzerland

Marshall TC, Slate J, Kruuk LEB, Pemberton JM (1998) Statistical

confidence for likelihood—based paternity inference in natural

populations. Mol Ecol 7:639–655

Raymond M, Rousset F (1995) GENEPOP (version 1.2): population

genetics software for exact tests and ecumenicism. J Hered

86:248–249

Rice WR (1989) Analyzing tables of statistical tests. Evolution

43:223–225

Rozen S, Skaletsky HJ (2000) PRIMER 3 on the WWW for general

users and for biologist programmers. In: Krawetz S, Misener S

(eds) Bioinformatics methods and protocols: methods in molec-

ular biology. Humana Press, Totowa, New Jersey, pp 365–386

Sambrook J, Russell DW (2001) Molecular cloning, 3rd edn. Cold

Spring Harbour Laboratory Press, New York

Schlotterer C, Tautz D (1992) Slippage synthesis of simple sequence

DNA. Nucleic Acids Res 20:211–215

Schlotterer C, Pemberton J (1998) The use of microsatellites for

genetic analysis of natural populations—a critical review. In:

Desale R, Schierwater B (eds) Molecular approaches to ecology

and evolution. Birkhauser Verlag, Basel, pp 71–86

Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004)

MICRO-CHECKER: software for identifying and correcting

genotyping errors in microsatellite data. Mol Ecol Notes 4:535–

538

Table 2 Results obtained from cross-species amplification tests on other cetacean species

Species Np403 Np404 Np407 Np409 Np417 Np426 Np427 Np428 Np430

Phocoena phocoena + + + + + + + + +

Phocoenoides dalli - - + + + + + + -

Sousa chinensis - + + + + + + + +

Stenela coeruleoalba - - + - + - + - +

+, successful amplification; -, unsuccessful amplification

Conserv Genet (2008) 9:1033–1035 1035

123