Development of a receptor internalization assay for measuring and analysing RGS9-2 and

palmitoyl-CoA transferase activity in HEK cells.

by

Jin Ye Yang

A thesis submitted in conformity with the requirements for the degree of Master of Science

Department of Physiology

University of Toronto

© Copyright by Jin Ye Yang (2016)

ii

Development of a receptor internalization assay for measuring and analysing RGS9-2 and

palmitoyl-CoA transferase activity in HEK cells.

Jin Ye Yang

Master of Science

Department of Physiology University of Toronto

2016

Abstract

Regulator of G-protein signalling 9-2 (RGS9-2) complex inhibits agonist-dependent

dopamine receptor D2R activity and internalization, and plays a protective role against the

development of neuro-reward circuit dysfunction. R7 binding protein (R7BP) is necessary

for RGS9-2 protein stability and trafficking. Preliminary work from our group has shown

the palmitoyl-CoA transferase, DHHC5, can facilitate R7BP trafficking, however this

function can also enhance RGS9-2 trafficking and function. The aim of this work is to

establish an in vitro assay to verify the effects of DHHC5 and R7BP on the internalization

of D2R in HEK cells. We established a modified ELISA protocol that consistently showed

~20% internalization of surface D2R, which is not ideal, possibly due to the poor

internalization properties of D2R in HEK cells. Future efforts, therefore, will require the

development of other functional assays to examine the role of DHHC5, R7BP and RGS9-

2 as a regulator of D2R signalling and function.

iii

Acknowledgements

I would like to thank Dr. Scott Heximer, for his guidance, his advice, and his patience. It

is hard to imagine how differently I would have developed as a researcher and as a person

if I didn’t enter the Heximer lab. I want to thank you especially for pushing me every step

of the way, and I am here today because of you.

I also want to thank my supervisory committee, Dr. Ali Salahpour and Dr. Evelyn Lambe.

Your counsel and advice have always been well thought, and very helpful to my project.

Thank you to the Heximer lab members. Guillaume, your passion and discipline for

scientific research is the inspiration I look to during times of hardship. Joobin, Steph, and

Alex, the times we spent discussing science and other matters were truly happy moments

of my life, and it also got me through times of hardship. GAP-A-Ball will live on forever.

Jenny, you are a rock in the lab, I hope your daughter reaches your level of expertise in

table tennis.

I want to thank all the project students, and volunteers that came into this lab during my

time here. Mustafa, Fakhri, Boyde, Rudolpho, Katie, Emily, Frank, and Justin. I believe

we both learned a lot from each other during our conversations.

I also want to thank Vincent and Pieter, for their help and time. They had no obligation to

give me advice and show me techniques, and I am forever grateful for their help, for

without it I would have had a harder time developing my assay.

Lastly, I want to thank Winnie Lam and my family for pushing me to enter the research

experience during my undergrad, and also for their unwavering support. Your belief in my

abilities keeps me going in life.

iv

Table of Contents

Pre-content Abstract ii Acknowledgements iii Table of Contents iv List of Figures and Tables vii List of Abbreviations ix

1. Introduction 1 1.1 Altered receptor desensitization in neurological signalling dysfunction 1 1.2 Heterotrimeric G-proteins – Overview 1

1.2.1 Gα subunits 2 1.2.2 Gβγ subunits 3 1.2.3 Gβ5 – a unique member of the G beta subfamily 3 1.2.4 G-protein GTPase cycle 4

1.3 Regulators of G-protein Signalling 4 1.4 G-protein coupled receptors 5

1.4.1 GPCR activation 5 1.4.2 GPCR desensitization 5

1.5 GPCR internalization 6 1.5.1 Clathrin mediated endocytosis 6 1.5.2 G-protein Receptor Kinases 6 1.5.3 Β-arrestin 6 1.5.4 Class A & Class B internalizing GPCRs 7 1.5.5 GPCR internalization process 7

1.6 Dopamine D2 receptor 9 1.6.1 Localization and function 9 1.6.2 Role in substance abuse 9 1.6.3 RGS proteins regulate dopamine receptor signalling 10

1.7 R7 RGS proteins – Overview 10 1.7.1 RGS9-2 11 1.7.2 R7 binding protein (R7BP) 12 1.7.3 Regulation of R7BP function 13

1.8 Palmitoylation – Overview 14 1.8.1 Mammalian palmitoylation enzymes 15

1.9 DHHC5 16 1.10 Rationale 19

v

1.11 Hypothesis 19

2. Materials and Methods 20 2.1 Palmitoylation – Overview 20 2.2 Preparation of solutions and chemicals 20 2.3 Plasmid constructs 21 2.4 Confocal imaging of D2L-YFP internalization 22

2.4.1 Fixed cell imaging protocol 22 2.4.2 Live cell time course protocol 22

2.5 Measuring receptor internalization using the β-Lac assay 23 2.6 Measuring receptor internalization through cell-based Enzyme Linked

Immunosorbent Assay (ELISA) 23 2.7 Measuring total HA-D2L-Rluc expression in Luciferase quantification 24 2.8 Western blot 25 2.9 Data analysis 26

3. Results 27

3.1 Overview 27 3.2 Confocal imaging of D2L localization and internalization in HEK cells 27

3.2.1 PFA fixation protocol 27 3.2.2 Live cell protocol 28

3.3 βLac-tagged quantification of D2L surface expression and internalization 29

3.3.1 Increasing doses of βLac-D2L did not generate a reproducible internalization phenotype 30

3.3.2 Increasing the loading of cells/well expressing βLac-D2L did not generate a reproducible internalization phenotype 31

3.4 Development of ELISA assay to quantify D2L surface expression 32 3.4.1 FLAG-DOR, but not FLAG-D2L, exhibits time dependent

decreases in surface expression after drug treatment in HEK201 cells under the ELISA protocol described in Celver et al 2010. 32

3.5 ELISA protocol troubleshooting with HA-D2L-Rluc 34 3.5.1 60 min 10 µM QNP treatment is the optimal drug condition

for HA-D2L-Rluc internalization 35 3.5.2 1 µg/well of HA-D2L-Rluc is the optimal plasmid dose of

D2L internalization 36 3.5.3 Coexpression of both GRK2 and βarr2 with 1 µg/well HA-

D2L-Rluc further increases the internalization rate 36

vi

3.5.4 Optimization of 4% PFA fixation conditions to minimize HEK membrane permeability 37

3.6 RGS9-2 complex and DHHC5 co-transfection with HA-D2L-Rluc in HEK cells display a trend of decreased HA-D2L-Rluc internalization following QNP treatment 37

4. Discussion 58 4.1 Overview 58 4.2 Confocal imaging of D2L-YFP was not optimal for quantifying D2L

internalization 58 4.2.1 Limitations 59

4.3 βLac-D2L displayed inconsistent internalization, and thus the βLac assay is not viable for quantifying D2L internalization. 60

4.3.1 Limitations 61 4.4 FLAG-D2L shows inconsistent internalization compared to FLAG-

DOR 62 4.4.1 Limitations 63

4.5 HA-D2L-Rluc displays consistent internalization in HEK cells 63 4.6 RGS9-2 complex and DHHC5 co-transfection display a trend of decreased

HA-D2L-Rluc internalization 64 4.6.1 Limitations 66

4.7 Conclusion and main findings from this work 67 4.8 Future Direction 68

4.8.1 Improving the D2L internalization assay 68 4.8.2 Alternate assays for quantifying D2L activity and RGS9-2

activity 70

5. References 73

vii

List of Figures and Tables

Figure 1. Clathrin-mediated internalization and subsequent sorting of GPCRs following agonist stimulation. 8

Figure 2. DHHC palmitoylation of R7BP anchors the RGS9-2 complex at the PM to mediate RGS9-2 GAP activity towards Gi/o. 17

Figure 3. Localization of GFP-R7BP and DHHC-CFP in HEK cells. 18

Table 1. Changes made in HA-D2L-Rluc ELISA compared to FLAG-DOR ELISA 35

Figure 4. Confocal imaging of D2L-YFP in HEK after drug treatment and fixed with 4% PFA 39

Figure 5 Confocal imaging of GFP-M2 in HEK after drug treatment and fixed with 4% PFA 40

Figure 6 Confocal imaging of D2L-YFP localization in the same field of HEK cells following drug treatment 41

Figure 7. Optimization of βlac-D2L plasmid dose for high βlac-D2L surface expression in HEK 42

Figure 8. Optimization of βLac-D2L plasmid dose for 10 µM QNP induced internalization of βLac-D2L in HEK 43

Figure 9. Optimization of cell loading dose for high surface expression of βLac-D2L in HEK 44

Figure 10. Optimization of cell loading dose for 10 µM QNP induced internalization of βLac-D2L in HEK 45

Figure 11. 10 µM Isoprotenerol induced internalization of βLac-β2R in HEK 46

Figure 12. Comparison of 10 µM QNP induced βLac-D2L internalization in HEK cells stably and transiently expressing βlac-D2L 47

Figure 13. ELISA quantification of FLAG-D2L and FLAG-DOR surface expression in HEK following drug treatment. 48

Figure 14. Optimization of QNP concentration and time point in agonist induced HA-D2L-Rluc internalization in HEK 50

Figure 15. Optimization of HA-D2L-Rluc plasmid dose in 10 µM QNP induced HA-D2L-Rluc internalization in HEK cells. 51

viii

Figure 16. Optimization of 10 µM QNP HA-D2L-Rluc internalization rate in HEK with transient co-expression of transient GRK2 and βarr2. 52

Figure 17. Optimization of 4% PFA fixation in potential permeablization of HEK cells. 53

Figure 18. Validation of transient transfection of HA-RGS9-2, myc-Gβ5, GFP-R7BP, and HA-DHHC5 in HEK cells. 54

Figure 19. ELISA assay quantification of DHHC5 activity in mediating RGS9-2 inhibition of HA-D2L-Rluc internalization 56

ix

List of Abbreviations

AC Adenylate cyclase

AP-2 Assembly polypeptide-2

β-arr1/2 Beta arrestin1/2

BRET Bioluminescence resonance energy transfer

cAMP Cyclic adenosine monophosphate

CCV Clathrin-coated vesicle

CNS Central nervous system

D2R Dopamine receptor 2

D2L Dopamine receptor 2 long-isoform

D2S Dopamine receptor 2 short-isoform

DAG Diacylglycerol

DAMGO [D-Ala2, N-MePhe4, Gly-ol]-enkephalin

DARPP-32 Dopamine- and cAMP-regulated phosphoprotein, Mr 32 kDa

DEP domain Dishevelled, Egl-10 and Pleckstrin domain

DNA Deoxyribonucleic acid

ER Endoplasmic reticulum

ERK Extracellular signal-regulated kinases

G-protein Guanine nucleotide-binding proteins

GAP GTPase-activating proteins

GASP G-protein coupled receptor associated sorting protein

Gβ5 G-protein beta subunit-5

GDP Guanine diphosphate

x

GFP Green fluorescence protein

GGL domain G gamma-like domain

GIRK G protein-coupled inward-rectifying potassium channel

GPCR G protein-coupled receptor

GRIP1b Glutamate receptor-interacting protein 1

GRK G protein-coupled receptor kinase

GTP Guanine triphosphate

IP3 Inositol trisphosphate

JNK c-Jun N-terminal kinases

KO Knock out

MAPK Mitogen-activated protein kinase

MEND Massive endocytosis

MOR mu-Opioid receptor

mRNA messenger ribonucleic acid

MSN Medium spiny neurons

NAc Nucleus accumbens

OPD o-Phenylenediamine dihydrochloride

PAT Palmitoyl acyl transferases

PI3K Phosphoinositide 3-kinase

PKA Protein kinase A

PKC Protein kinase C

PLCB Phospholipase B

PM Plasma membrane

xi

PSD-95 Postsynaptic density protein-95

QNP Quinpirole

R9AP RGS9 anchor protein

R7BP R7 binding protein

RGS Regulator of G-protein signalling

ROCK Rho kinase

WT Wild type

YFP Yellow fluorescence protein

1

1. Introduction

1.1 Altered receptor desensitization in neurological signaling dysfunction

The neuro-reward circuit regulates behavioural and neurological responses to reinforcing

stimuli, such as addictive drugs (1). Dopamine (DA) is a major neurotransmitter in the

reward system that activates reward-related behaviours through the mesolimbic pathway

in response to stimuli. Dysregulation of DA signalling results in serious consequences in

the reward circuit, and altered DA signalling is commonly associated with altered

desensitization of key receptors in the signalling pathway. One of the common receptors

identified in this pathway are the heterotrimeric G-protein coupled receptors (GPCR) (2;

3). For example, the striatum is a major integration site for reward signals, and

dysregulation of DA signalling in the striatum results in the disruption of the dopamine

receptor expression profile which further exacerbates DA dysregulation (1). Understanding

the underlying mechanisms of the shift in GPCR desensitization may provide the tools to

uncover new therapeutic targets against the development and complications of substance

abuse.

1.2 Heterotrimeric G-proteins - Overview

Heterotrimeric G-proteins are expressed in every known mammalian cell type, activate a

wide range of signal cascades, and play crucial roles in almost every cell process. In their

quiescent state, heterotrimeric G-proteins are found coupled to an inactive G-protein

coupled receptor in a complex comprised of three subunits, namely a Gα monomer and a

Gβγ heterodimer. The Gα subunits contain intrinsic guanosine nucleotide binding and

GTPase activity, while the Gβγ contain numerous specific protein-protein interaction

2

surfaces. Upon ligand binding to the receptor, the heterotrimeric G-protein can be activated

(see below) allowing both Gα and the Gβγ dimer to separate and regulate independent

downstream effector proteins.

1.2.1 Gα subunits

There are 16 different members of the Gα subunit superfamily that can be divided into four

main subfamilies: Gq/11, Gs, Gi/o and G12/13 (4). The key biologic activities of the different

subfamilies are described below.

Gαq/11 subfamily: The main effector target of the Gαq/11 subfamily is phospholipase-C

(PLC), which cleaves phosphatidylinositol 4,5-bisphosphate (PIP2) to produce secondary

messengers diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3). DAG stays bound

to the plasma membrane (PM) due to its hydrophobic properties, and activates protein

kinase-C (PKC). IP3 diffuses to the cytoplasm, where it binds to IP3 receptors on the

endoplasmic reticulum (ER), and facilitates calcium release from the ER. The M1, M3, and

M5 muscarinic receptors are one family of well characterized Gαq/11 coupled GPCRs that

lead to PLC activation (5).

Gαs subfamily: Gαs activates the adenylate cyclase (AC) – cAMP pathway. Activated AC

produces secondary messenger cAMP, which activates downstream effectors such as

protein kinase A (PKA) and mitogen-activated protein kinase (MAPK), which are

important protein kinases that trigger and regulate a wide range of cellular functions,

including the drug reward signalling. Gαs bound GPCRs, such as the D1 dopamine receptor,

are known activators of stimulatory signalling (5).

Gαi/o subfamily: Gαi/o is an inhibitor of the AC – cAMP pathway. In contrast to Gαs, activated

Gαi/o inhibits AC production of cAMP, which inhibits downstream activation of PKA and

3

PKC. Thus, Gαi/o coupled GPCRs such as D2R activate inhibitory pathways in the cell,

which negatively regulates the drug reward system. The Gi/o family also contains the Gz

protein, which has been implicated in cell survival and cell death (6); the Gt protein

(transducing), which couples to rhodopsin in the retina rods (7); and Ggust protein

(gustducin), which bind taste receptors (8).

Gα12/13 subfamily: Gα12/13 is an activator of another monomeric GTPase RhoA, and GTP-

bound RhoA activates downstream effector Rho kinase (ROCK) (9; 10). ROCK has been

show to activate c-Jun N-terminal kinase (JNK), an important protein kinase involved in

activating cellular responses to stress-stimuli (11; 12)

1.2.2 Gβγ subunits

The Gβγ subunit is a dimeric structure that activates Gα independent pathways after

dissociation. There are currently 5 known Gβ and 12 known Gγ subunits. The first 4 Gβ

subunits (Gβ 1, 2, 3, 4) share an 80% sequence homology, while Gβ5 shares approximately

only 50%. Canonical Gβγ effector pathways include AC activation/inhibition, PLC

activation, and opening of G-protein inward-rectifying potassium channels (GIRKs) (5).

1.2.3 Gβ5 – a unique member of the Gβ subfamily

As mentioned above, Gβ5 is a unique Gβ subunit that shares a much lower sequence

homology with the other Gβ subunits. Gβ5 exists as a long (Gβ5L) and short isoform (Gβ5S),

with the former expressed exclusively in the retinal photoreceptor cells. Gβ5S is highly

expressed in the brain, and is able to bind Gγ to activate canonical pathways such as PLC-

β and ACII in vitro (13; 14). Unlike Gβ1-4, Gβ5 also can bind to the G-gamma-like (GGL)

domains found in the R7 family of RGS proteins. This GGL domain interaction is shown

to be crucial for proper protein folding and stability of both R7 RGS proteins and Gβ5 (15;

4

16). Indeed, studies have shown that Gβ5 KO mice displayed drastic down-regulation of

only the GGL domain-containing R7 RGS proteins, and the KO mice displayed impaired

neural development, impaired neural learning, impaired motor coordination, and

hyperactivity (17; 18).

1.2.4 G-protein GTPase cycle

In the inactive state, Gα is GDP-bound and is closely associated to Gβγ. Receptor activation

promotes the exchange of GDP for GTP on the Gα subunit, and consequent dissociation of

Gα from Gβγ. Known as the active state, both Gα and Gβγ can activate their specific

downstream effectors while in this state. Termination of G-protein signalling occurs

following hydrolysis of GTP to GDP by the intrinsic Gα GTPase activity, and reassociation

of the heterotrimeric state (19). Notably, the intrinsic GTPase activity of Gα is very slow,

and is the rate-limiting step of the GTPase cycle.

1.3 Regulators of G-protein Signalling

Due to the slow intrinsic GTPase activity of Gα subunits, GTPase activating proteins

(GAP) such as regulators of G-protein signalling (RGS) are needed to catalyze GTP

hydrolysis to account for the rapid ON-OFF signalling kinetics of numerous GPCR

pathways(20). RGS proteins are a prominent family of >35 GAPs for Gα subunits. RGS

proteins accelerate the GTPase activity and shorten the duration of G-protein activation

and signal transduction (21). Proteins in this family are defined by a 120-130 amino acid

RGS domain, which binds Gα and increases the GTP hydrolysis rate by up to 2000 times,

effectively decreasing both the amplitude and duration of G-protein activity. RGS proteins

have been shown to regulate Gi, Gq, and G12/13, but not Gs, in vitro (22).

5

1.4 G-protein coupled receptors.

1.4.1 GPCR activation

GPCRs are helical transmembrane receptors expressed in almost every tissue type.

All GPCRs have seven transmembrane domains consisting of α helices, with an

extracellular N-terminal domain and intracellular C-terminal tail (23). Ligand binding to

the GPCR triggers guanine neucleotide exchange (exchange of GTP for GDP on the Gα

subunit), separation of the Gα and Gβ, and subsequent activation of the appropriate

downstream signal cascades. Each GPCR couples to a specific set Gα subunits (Gq/11, Gi/o,

Gs, G12/13), which determines the effector pathways that are activated by the GPCR (24).

GPCRs are estimated to be targeted by 50% of all drugs, and are important therapeutic

targets in research.

1.4.2 GPCR desensitization

Desensitization is a general term describing the negative feedback regulation of

GPCR signalling after ligand stimulation. The process of desensitization can take the form

of dissociation between the GPCR and coupled G-proteins, conformational changes in

GPCR protein structure leading to decreased specificity for ligand, and internalization of

the GPCR to the cytosol. GPCR desensitization is an important regulatory mechanism for

G-protein mediated effector signalling. Specifically, homologous GPCR desensitization is

the ligand induced down-regulation of GPCR signal transduction after activation, whereas

heterologous desensitization is the ligand induced down-regulation of an unrelated GPCR.

This thesis will focus mainly on homologous desensitization via agonist-mediated receptor

internalization.

6

1.5 GPCR internalization

1.5.1 Clathrin-mediated endocytosis

GPCR internalization is a major step in homologous receptor desensitization, which

involves endocytosis of the GPCR into the cytoplasm, where extracellular ligands do not

have access to them. Clathrin-mediated endocytosis (Figure 1) is the most well

characterized and prominent form of internalization, and its machinery and the subsequent

sorting of GPCRs will be discussed below.

1.5.2 G-protein Receptor Kinases (GRK)

GRKs are a family of multi-domain protein kinases that phosphorylate activated

GPCRs which flags them for internalization (25). There are 7 vertebrate GRKs divided into

three subfamilies, GRK1 (GRK1 & 7), GRK2 (GRK2 & 3) and GRK4 (GRK4, 5 & 6) (26;

27; 28). All GRKs share a GRK-unique 25 residue N-terminal domain, an RGS domain,

and an AGC kinase domain. GRK phosphorylates GPCRs on the intracellular loops and

also the C-terminal tails, which allows high affinity arrestin binding to the GPCR, which

is the next step of GPCR internalization (28).

1.5.3 β-arrestin

The arrestin family of scaffolding proteins is comprised of Arrestins 1, 2, 3 & 4

(29). Arrestins 2 & 3, also named β-arrestin 1 & 2, are widely expressed in virtually all

tissues, and have a low binding affinity to GPCRs until they are phosphorylated by a GRK

(30). β-arrestins bind phosphorylated GPCRs at the intracellular domain, and regulate

GPCR signalling by preventing receptor coupling to the G-protein complex, and recruiting

clathrin, AP-2 and dynamin to the GPCR to initiate clathrin-mediated internalization (31).

7

β-arrestin can also activate MAPK pathways after GPCR internalization, either at the PM,

or through internalized GPCR in the intermediate vesicles (32; 33).

1.5.4 Class A & Class B internalizing GPCR

Two types of GPCRs have been categorized based on their interaction with β-arrestin.

GPCR activation mediates ubiquitination of β-arrestin, which is necessary for GPCR

internalization (34). Class A GPCR activation mediates a transient ubiquitination of β-

arrestins, and as a result also binds β-arrestin transiently. In contrast, Class B GPCR

activation mediates a more stable ubiquitination of β-arrestin, and as a result binds β-

arrestin stably (35; 36; 37). The difference in β-arrestin binding has been shown to

determine GPCR sorting after internalization. Class A GPCRs dissociate from β-arrestin

soon after internalization, and the majority are rapidly recycled back to the PM and

reactivated. In comparison, Class B GPCRs maintain β-arrestin binding inside the CCV,

and the GPCR-β-arrestin complex can activate alternate downstream signal cascades

independent of G-proteins, such as ERK1/2. After β-arrestin dissociation, majority Class

B GPCRs are targeted for lysosomal degradation, as they display higher binding affinity to

GPCR associated sorting protein (GASP), a cellular determinant for GPCR lysosomal

degradation (29; 38).

1.5.5 GPCR Internalization process

After GPCR activation, GRKs are recruited to the PM and phosphorylate the activated

GPCRs. Subsequent β-arrestin binding to the GPCR then blocks further coupling between

GPCR and G-protein, and recruits the clathrin, AP-2 and dynamin. The GPCR is now

sequestered in a clathrin-coated pit, which then breaks off from the PM through dynamin

activity. The clathrin coated vesicle (CCV) traffics to the cytoplasm, where the GPCR can

8

be recycled to the cell surface, degraded, and/or activate G-protein independent pathways.

The exact pathway depends on the GPCR, and its specific interaction with β-arrestin and

GASP.

Figure 1. Clathrin-mediated internalization and subsequent sorting of GPCRs following agonist stimulation. After agonist stimulation and subsequent activation of G-proteins, (A) GPCRs are phosphorylated by GRKs leading to high-affinity βarr1/2 binding and sorting into clathrin-coated pits. (B) The GPCR then internalizes into the cytoplasm in clathrin-coated vesicles, and is sorted into three pathways. (C) Class A internalizing GPCRs are rapidly recycled to the PM from the clathrin-coated vesicles, while (D) Class B internalizing GPCRs are sorted to lysosomes to be degraded. (E) Both classes of GPCRs can also activate G-protein independent pathways in the intermediate vesicles.

9

1.6 Dopamine D2 receptor

1.6.1 Localization and function

Dopamine D2 receptor is a Gi/o coupled prominently expressed throughout the neural

reward circuit in the brain. D2R exists in short (D2S) and long isoforms (D2L), with D2S

mainly expressed presynaptically as an autoreceptor, and D2L mainly expressed

postsynaptically (39). In the striatum, which is an important input centre for DA mediated

reward signalling, D2L is expressed post-synaptically in D2R-expressing GABAergic

medium spiny neurons (MSN). MSNs comprise 90% of all neurons in an area of the ventral

striatum named the nucleus accumbens (NAc). D2L stimulation inhibits adenylate cyclase

5 (AC5) mediated cAMP production, and subsequently inhibits PKA activity, as well as

the amplification of PKA activity by DA- and cAMP-regulated phosphoprotein of 32 kDa

(DARPP-32) (40). The cAMP – PKA – DARPP-32 is an important signalling pathway

required for DA reward signalling. In turn, D2 expressing MSNs activate the indirect

striatal signalling pathway, which has been shown to inhibit the reward pathway (41). D2L

is a Class A internalizing GPCR, and rapidly recycles to the cell surface after GRK-β-

arrestin mediated internalization (42).

1.6.2 Role in substance abuse

D2R has been shown by various studies to have a protective effect against the addictive

and stimulatory effects of cocaine, which release high concentrations of DA into the NAc.

D2R KO mice displayed an increase in cocaine self-administration, and a slight increase

in cocaine induced locomotor activity (43; 44; 45; 46). In contrast, D2R overexpression

diminished the stimulatory effects of cocaine in mice (47).

10

Under chronic conditions, extended DA exposure impairs D2R regulation of DA

signalling. Mice chronically treated with cocaine displayed a decrease in D2R modulated

neural firing, as well as a decreased ratio of D2R to D1R protein expression (48; 49).

1.6.3 RGS proteins regulate dopamine receptor signalling.

RGS proteins are highly expressed in the brain, and regulate key aspects of the central

nervous system (CNS) physiology, such as synaptic plasticity, synaptic transmission, and

neurotransmission release (50; 51; 52; 53). Among the RGS proteins, the R7 family (RGS-

6, -7, -9, -11) RGS proteins have been characterized in the regulation of dopamine

signalling (54; 55). Furthermore, RGS9-2 is a well characterized regulator of D2R

signalling (55; 56).

1.7 R7 RGS proteins - Overview

The R7 subfamily of RGS proteins (RGS6, RGS7. RGS9-1, RGS9-2, RGS11) are

defined by a GGL and DEP (Dishevelled, Egl-10 and Pleckstrin) domain, which bind Gβ5

and R7 RGS binding protein (R7BP), respectively (18; 57; 58). These two proteins are both

obligate partners for R7 RGS proteins only. The R7- Gβ5 dimer formation stabilizes both

proteins and R7 GAP function, while R7BP binding further enhances the GAP activity of

the complex and facilitates localization to the plasma membrane in proximity to Gi/o.

Without Gβ5, R7 RGS proteins are severely degraded in mice. Together with these two

obligate binding proteins, R7 family RGS proteins are all highly expressed in the brain,

while RGS9-1 is expressed exclusively in photoreceptors of the eye with Gβ5L and R9AP,

a homolog of R7BP (59; 60). All R7 RGS proteins are important regulators of neural

signalling and processes.

11

1.7.1 RGS9-2

RGS9-2, the main R7 RGS protein of this thesis, is highly expressed in the NAc MSNs,

together with RGS7 and RGS4 (61; 62), and is expressed to a lower degree throughout the

remainder of the brain and spinal cord (61; 62; 63). RGS9-2 has been identified to be an

important regulator of G-protein signalling in neurons, and has GAP activity towards Gi/o.

RGS9-2 co-expression inhibits ligand mediated D2R internalization in HEK cells, as well

as DAMGO mediated mu-opioid receptor (MOR) internalization in PC12 cells (56; 64).

RGS9-2 has also been shown to accelerate the on/off kinetics of D2R mediate GIRK

activation in oocytes. Lastly, RGS9-2 directly binds and inhibits AC5 activation by Gβγ

(65). Together this suggests RGS9-2 is an important regulator of D2R signal transduction

in the MSN.

RGS9-2 mRNA and protein expression is altered in the NAc after acute and chronic

cocaine or morphine treatment. Acute morphine administration increased RGS9-2 mRNA

levels in the NAc up to 50%, while chronic morphine treatment decreased RGS9-2

expression by 50% (66). In the same study, acute and chronic morphine treatment did not

alter protein expression of RGS7 and RGS11. Other studies show that chronic morphine

administration in mice in fact elevates RGS9-2 protein levels in the NAc significantly (67).

Chronic cocaine treatment in mice also up-regulated RGS9-2 protein levels without

affecting protein expression of RGS7 or RGS11 (65). These results indicate a possible role

for RGS9-2 in the regulation of cocaine/morphine mediated signalling in the NAc.

RGS9-2 knockout mice displayed increased sensitivity to morphine, as 0.5 mg/kg was

enough to induce a place preference response in KO mice, ten times lower than the

minimum dosage required in WT mice (66). KO mice were also more sensitive to the

12

analgesic effects of morphine, shown through a 52 °C hot plate test, and in another study a

52 °C hot water tail flick test (66; 68). Lastly, KO mice displayed delayed drug tolerance

development. Repeated hot plate testing throughout a week in KO mice showed a slower

drop off in drug efficacy than in WT mice (66). RGS9-2 displays a similar regulatory role

to cocaine response. RGS9-2 lentiviral overexpressed mice showed decreased sensitivity

to cocaine induced locomotor activity at lower dosages (10 mg/kg). In contrast, RGS9-2

KO mice displayed increased sensitivity to locomotor stimulatory effects of cocaine, as

well as an increase in cocaine self-administration, an indicator of substance dependence

(65). Together, the results indicated RGS9-2 as a regulator of drug response in the NAc.

1.7.2 R7 binding protein (R7BP)

R7BP was discovered as a brain-enriched protein that could bind to RGS9-2 – Gβ5

with sequence homology to R9AP, a previously discovered RGS9-1 interacting protein

(69; 70). R7BP is a SNARE-like protein that shuttles between the nucleus and PM. R7BP

binds and shuttles all members of R7 RGS proteins subfamily to the PM, where they can

exert GAP activity on selective G proteins (70; 71). R7BP has been shown to promote

protein stability of RGS9-2 – Gβ5 dimer by binding RGS9-2 at the DEP domain, and DEP

deletion mutation in RGS9-2 abolished R7BP binding and increased RGS9-2 protein

degradation (69; 72).

R7BP is of particular interest in this thesis for its unique relationship with RGS9-

2. R7BP co-expression in vitro increased the degradation half-time of RGS9-2/Gβ5 almost

6 fold, and significantly decreased ubiquitin marking (72). R7BP knockout results in the

down-regulation of RGS9-2 protein levels in mice striatal tissue, while the mRNA levels

of RGS9-2 remain unchanged (72; 73). Strikingly, protein levels of other R7 RGS proteins

13

were unaltered in the same tissue. Also, Anderson et al 2007 showed that RGS9-2 was

mainly cytosolic in R7BP-KO mice, indicated R7BP is also necessary for RGS9-2

localization (70). This suggests a unique functional relationship between RGS9-2 and

R7BP that is not present for the other R7 RGS proteins family members. Re-expression of

R7BP in R7BP KO mice restored protein levels of RGS9-2, and did not alter protein levels

of other R7 RGS proteins. R7BP also displays higher binding affinity to RGS9-2 than

RGS7 (Kd 1.1 nM vs Kd 12.7 nM) in striatal tissues, as shown through surface plasmon

resonance spectroscopy. Lastly, RGS9-2 co-expression displaces RGS7-R7BP association

more readily than RGS7 to RGS9-2 – R7BP in vitro (74). Together, these results indicate

a dynamic and unique interaction between RGS9-2 and R7BP that so far has not been

shown in any other R7 RGS protein.

R7BP KO mice performed poorly compared to WT mice on the rotarod test, a motor

coordination test, which requires mice to balance on a horizontal rotating cylinder rod (75).

Motor coordination was rescued when R7BP was re-expressed in KO mice. R7BP KO mice

displayed increased locomotor activity in response to morphine treatment. Specifically, KO

mice displayed increased locomotor activity after 5 mg/kg dose of morphine, which failed

to elicit an increased locomotor response in WT mice (75; 76). In addition, KO mice were

also more sensitive to the analgesic effects of morphine, as they stayed for a longer time in

the hot plate test (76). KO mice also displayed impaired drug tolerance, as the time spent

on the hot plate remained the same throughout 5 days of trials for KO mice, while WT

mice showed steady decrease. The similar responses of RGS9-2 KO and R7BP KO mice

to morphine treatment further suggests a unique partnership between RGS9-2 and R7BP

in regulating the drug reward pathway.

14

1.7.3 Regulation of R7BP function

R7BP cellular localization is tightly associated with palmitoylation of two cysteine residues

on the C-terminal tail (77). R7BP localizes to the PM when palmitoylated, and relocates to

the nucleus when depalmitoylated. C-S mutation of the both residues leads to accumulation

of R7BP in the nucleus (70; 77), whereas overexpression of palmitoylating enzyme

DHHC2 leads to accumulation of R7BP at the PM in vitro (78). R7BP palmitate turnover

is important for RGS9-2 function; inhibition of R7BP depalmitoylation decreased RGS9-

2 GAP activity towards Gi/o mediated GIRK channels in Neuro2A cells (79). Together, the

data presented here for R7BP suggest a possible role for R7BP in mediating RGS9-2 GAP

function towards D2R signalling and internalization, and palmitate turnover of R7BP is an

essential component of RGS9-2 mediated D2R signalling inhibition (Figure 2).

1.8 Palmitoylation - Overview

Proteins undergo various forms of post-translational modifications, such as

isoprenylation, myristolaytion, phosphorylation and palmitoylation, which mediate protein

function, localization and interactions in the cell (80). S-palmitoylation is the reversible

attachment of a 16 carbon palmitate to a cysteine residue via a thioester bond (81). N-

palmitoylation in contrast results in an amide attachment to the cysteine (82). S-

palmitoylation will be the main focus for this thesis due to its reversible nature and

regulation of GPCRs, G-proteins, RGS proteins, and R7BP. Palmitoylation can mediate

PM anchoring of GPCRs, Gα, Gβ/γ, RGS proteins and R7BP. It can also mediate protein-

protein interactions between GPCR and G-protein, and between GPCR and GRK (81; 82).

15

1.8.1 Mammalian Palmitoylation Enzymes

Palmitoylation is carried out by palmitoyl-acyl transferases (PATs), and the removal of

palmitates through thioester bond cleaving is carried out by acylprotein thioesterases

(APTs) (81; 82). The 23 protein family of mammalian PATs are named DHHC enzymes,

and they are ubiquitously expressed in all human tissue except for DHHC2, 11. 15. 19 and

20 (83). The PATs contain a conserved DHHC-CRD domain, named after a part of the

conserved sequence motif, which mediates the thioester attachment of the palmitate to a

cysteine (84). PATs are also palmitoylated through autoacylation in the presence of

palmitoyl-CoA, which allows the PATs to bind either the PM or ER/Golgi membranes

(85).

1.9 DHHC5

DHHC5 is encoded by the ZDHHC5 protein, and is mainly localized at the PM in

both HEK and neural cells, and in the post-synaptic membrane of dendrites in neurons (86;

87). DHHC5 contains two transmembrane domains with the DHHC domain in between,

and three palmitoylated cysteines in the C-terminal, which is also the binding site for its

substrates (88). DHHC5 is highly expressed throughout the brain, and has been shown to

palmitoylate proteins that play integral roles in regulating synaptic organization. The

function of DHHC5 in the brain has not been fully characterized. So far, flotillin-2,

GRIP1b, ankryin G, and δ-catenin are four PM organization proteins shown to be

palmitoylated by DHHC5, which mediated membrane localization and function of these

four proteins (87; 89; 90; 91). DHHC5 has also been shown to interact with PSD-95, but it

is unclear whether DHHC5 palmitoylates PSD-95 like other DHHC proteins (92). In the

same study, mice expressing gene trapped DHHC5 displayed deficiency in fear

16

conditioning learning. Lastly, DHHC5 has been implicated in the massive endocytosis

events in fibroblasts (93; 94). These data show DHHC5 is involved mostly with proteins

at the PM, specifically in the post-synaptic membranes of neurons. In our lab, work by Dr.

Guillaume Bastin has shown that DHHC5 overexpression in HEK cells resulted in R7BP

aggregation in the PM (Figure 3), while overexpression of the dominant negative mutation

DHHS5 lead to R7BP accumulation in the nucleus, displaying that DHHC5 palmitoylation

can also mediate the shuttling function of R7BP in a similar fashion as DHHC2.

Considering the expression of endogenous DHHC5, R7BP, RGS9-2 and D2R in the NAc,

these results suggest DHHC5 can possibly mediate RGS9-2 GAP activity towards D2R in

a HEK cell model (Figure 2).

17

Figure 2. DHHC palmitoylation of R7BP anchors the RGS9-2 complex at the PM to mediate RGS9-2 GAP activity towards Gi/o. (A) R7BP is palmitoylated at two cysteine resides at the C-terminal by DHHC enzymes, which leads to RGS9-2 complex anchoring at the PM. (B) RGS9-2 accelerates GTP hydrolysis by activated Gi/o, which (C) shuts down Gi/o and Gβγ mediated pathways and reassembly of the G protein subunits. In this thesis, an important pathway inhibited by the RGS9-2 complex is GPCR internalization, as described in Figure 1. It is therefore hypothesized by us that DHHC5 palmitoylating activity can enhance RGS9-2 inhibition of D2R internalization, as described in the Rationale and Hypothesis section.

18

Figure 3. Localization of GFP-R7BP and DHHC-CFP in HEK cells. Images were captured with Olympus Images were captured with Olympus Fluoview 1000 confocal microscope, excitation wavelength 515 nm and 405 nm, 60x oil magnification. A. GFP-R7BP expressed transiently in HEK cells. B GFP-R7BP co-expressed with DHHC5 transiently in HEK cells. C. GFP-R7BP co-expressed with DHHS5 dominant negative mutant. D. DHHC5-CFP transiently expressed in HEK cells. Work credit: Dr. Guillaume Bastin.

19

1.10 Rationale:

RGS9-2 is a negative regulator of D2R signalling internalization. RGS9-2 requires obligate

partners Gβ5 and R7BP for protein folding, protein stability, localization, and GAP

function. Indeed, deletion of R7BP severely down-regulates RGS9-2 protein expression in

the NAc. Recent studies and results from our lab have shown that palmitoylating enzymes

DHHC2 and DHHC5 promote R7BP PM localization through palmitoylation of two C-

terminal cysteine, and study has shown that alteration of the R7BP palmitate cycle inhibits

RGS9-2 GAP activity towards Gi/o. No studies have yet shown whether DHHC5 can

mediate RGS9-2 regulation of D2R internalization via R7BP localization.

1.11 Hypothesis:

(A) A cell culture-based D2R internalization assay would be a viable functional assay for

quantifying the effect of DHHC5 palmitoyl CoA-transferase activity on R7BP localization

and RGS9-2 GAP function. (B) Specifically, DHHC5 will inhibit D2R internalization in

HEK cells by regulating R7BP trafficking, an important component of the RGS9-2

complex.

20

2. Materials and Methods

2.1 Cell culture

HEK201 cells were cultured in 10 cm cell culture dishes (BD Falcon Canada,

Catalog #353003) in culture media with 50% +L-Glutamine F12 (Gibco Canada, Catalog

#11330032) and 35% DMEM (Gibco Canada, Catalog #11995073), 10% FBS (Gibco

Canada, Catalog #12483020) and 5% Penicillin/Streptomycin (Gibco Canada, Catalog

#15140122). To increase HEK cell adhesion to multi-well plates, 24 well plates (Costar

Canada, Catalog #3526), 48 well plates (Grenier Canada, Catalog #677180) and 96 well

plates (Sarstedt Canada, Catalog #83.3924) were treated with Poly-L-Lysine (Sigma

Aldrich Canada, Catalog #P4707) for 10 minutes, air dried for 30 minutes, and washed

with MilliQ water prior to cells seeding. For transfection, HEK cells were seeded at 60-

70% in 6 well plates (BD Falcon Canada, Catalog #353046), incubated at 37°C and 5%

CO2 with the X-tremeGene transfection reagent mixture containing 150 µL Opti-MEM

(Gibco Canada, Catalog #31985070), 2.5 µL X-tremeGene HP DNA transfection reagent

(Roche Canada, Catalog #06366236001), and up to 2 µg total plasmids according to the

manufacturer’s instructions. For transfection of 3 µg of total plasmids, everything in the

transfection mixture was scaled up 1.5 times. The transfection mixture was added to pre-

plated HEK cells in 6 well plates.

2.2 Preparation of solutions and chemicals

Quinpirole (QNP, Sigma Aldrich Canada, Catalog #Q102) was prepared as a 10 mM maser

stock in MilliQ water, and 100 µM QNP stocks were prepared from the master stock. For

drug treatment, old media was aspirated, and 500 µL serum free media buffered with

21

HEPES was added to each well. 55 µL of 100 µM stock QNP was added to each well to

make a final concentration of 10 µM QNP in each well, and for vehicle 55 µL of MilliQ

water was added. Dopamine (DA, Sigma Aldrich Canada, Catalog #H8502) was prepared

as a 100 µM stock solution in MilliQ with ascorbic acid (500 µM) (95). 10X PBS stock

was prepared in the lab (1.37 M NaCl, 27 mM KCl, 100 mM Na2HPO4, 18 mM KH2PO4)

and adjusted to 7.4 pH. 1X PBS was made by diluting 10X PBS as 1:10 in MilliQ. 5%

bovine serum (BSA, Bioshop Canada, Catalog #ALB001.250) in PBS was made by

dissolving the BSA in 1X PBS and adjusting to 7.4 pH. 4% paraformaldehyde (PFA) was

made by dissolving 2 g of paraformaldehyde (Sigma Aldrich Canada, Catalog #158127) in

50 mL 1X PBS heated to 60°C on a hot plate stirrer, adjusting to 7.4 pH after cooling to

room temperature, and filtering with 0.22 µm filters (Millipore Canada, Catalog

#SLGP033RS). Fresh 4% PFA was made for each new experiment. OPD peroxidase

substrate (o-Phenylenediamine dihydrochloride, Sigma Aldrich Canada, Catalog #P9187)

was prepared by dissolving the OPD tablet and OPD buffer tablet in 50 mL MilliQ through

vortex.

2.3 Plasmid constructs

HA-RGS9-2, FLAG-Gβ5, GFP-R7BP WT/SS were kindly provided by Dr. K. Blumer. HA-

DHHC5 was kindly provided by the Fukata Lab. HA-DHHS5 mutant was generated using

site-directed mutagenesis by Kaveesh Dissanayake in the Heximer Lab. D2L-RFP was

provided by Dr. J. Baik. GFP-M2 was kindly provided by Dr. J. Wells. FLAG-DOR and

FLAG-D2R were kindly provided by Dr. A. Kovoor. βLac-D2L was kindly provided by

Dr. M. Beaulieau. βLac-β2R and HA-D2L-Rluc was kindly provided by Dr. A. Salahpour.

22

D2L-YFP was created by cutting out the D2L insert in D2L-RFP at the 5’ BglII and

3’EcoRI site and inserting the gene cassette into PEYFP-N1 digested with the same

enzymes. Myc-Gβ5 was cloned out of FLAG-Gβ5 through PCR with primers

(Forward:5’GATCGCTCTTCCATGGAACAAAAACTCATCTCAGAAGAGGATCTG

ATGGCAACCGAGGGGCT 3’.

Reverse: 5’GATCGCTCTTCCTCATTAGGCCCAGACTCTGAG 3’). The insert was

then reinserted into a non-tagged vector. The new vector was verified with colony screen,

DNA sequencing, and western blotting.

2.4 Confocal Imaging of D2L-YFP Receptor Internalization

2.4.1 Fixed cell imaging protocol

HEK cells were seeded at 60-70% confluence in 35 mm confocal dishes (Ibidi Canada,

Catalog #81158). 24 hours after transfection, cells were stimulated with 10 µM DA or

vehicle. After treatment cells were washed three times with ice cold 1X PBS, fixed with

ice-cold 4% PFA for 3 min on ice, and washed three more times with ice cold PBS. 1 ml

of PBS was then added to each dish, and the cells were viewed with the Olympus FluoView

1000 laser scanning confocal microscope in the AOMF microscopy facility in Max Bell

Research Centre. Image analysis is described in the Data Analysis section below.

2.4.2 Live cell time course protocol

HEK cells were prepared in the same manner as the fixed cell imaging protocol. 24 hours

after transfection, old cell media was replaced with 1 ml fresh media, and the dish was

viewed under the Olympus FluoView 1000 laser scanning confocal microscope. After

choosing a field of cells, 10 µL of 1 mM DA was added into the media, and the same field

23

of cells were viewed at various time points after DA administration. Image analysis is

described in the Data Analysis section below.

2.5 Measuring receptor internalization using the “β-Lac” assay

Receptor internalization studies were performed using the “β-Lac” assay essentially as

previously described by the Salahpour laboratory (96). HEK cells were seeded in 6 well at

60-70% confluence. βLac-D2L was transiently expressed in each well with X-tremeGene.

6 hours after transfection, the cells were trypsinized and each experiment condition was

seeded in triplicates in Poly-L-lysine coated clear 48 well plates. 24 hours after

transfection, the media in the 48 well plates were aspirated, and 500 µL of FBS serum free

DMEM/F12 media buffered with 17 mM HEPES was added in each well. 30 minutes after

serum starvation, 55 µL of 100 µM QNP or MilliQ water was added in each well. After

treatment the wells were washed 3 times with 1X PBS on ice. 200 µL of 100 µM Nitrocefin

(EMD Millipore Canada, Catalog #484400) diluted in PBS was then added to each well,

and the plate was read immediately in 1 min intervals at 486 nm for 30 minutes in an

EPOCH microplate spectrophotometer (Biotek). Calculation of βLac-D2L surface

expression and internalization rate is described in the Data Analysis section.

2.6 Measuring receptor internalization through cell-based Enzyme Linked

Immunosorbent Assay (ELISA)

Celver et al 2010 previously used a cell culture-based ELISA assay to quantify agonist-

induced FLAG-D2L internalization in HEK cells (56). HEK cells were seeded in 6 well

plates at 60-70% confluence. FLAG-D2L was transiently expressed in each well with X-

24

tremeGene. 6 hours after transfection, the cells were seeded in triplicates for each condition

in Poly-L-Lysine coated cell culture treated 48 well clear bottom white plates (200,000

cells/well). 24 hours after transfection, the media was aspirated, and 200 µL of serum free

media was added in each well. 30 minutes after serum starvation, 20 µL of 100 µM QNP

or MilliQ water was added in each well. After drug treatment the plate was placed on ice

and washed once with ice-cold PBS. Then each well was treated with ice cold 4% PFA for

5 minutes, and afterwards washed three times with PBS at room temperature. Each well

was then blocked with 5% BSA in PBS for at least 45 minutes, and then blotted with HRP-

conjugated anti-FLAG M2 (Sigma Aldrich Canada, Catalog # A8592) in 5% BSA (1:1000

dilution) for at least an hour. The wells were then blocked again for at least an hour, then

blotted with secondary anti-mouse antibody (GE Healthcare Canada, Catalog #NA931-

1ML) in 5% BSA (1:1000 dilution) for at least an hour, and then washed 3 times with 5%

BSA, then 2 times with 1X PBS. OPD and enhanced chemiluminescence (ECL, Thermo

Scientific Canada, Catalog #WP20005) were two substrates used to quantify HRP signal,

and were loaded at 500 µL/well in 24 well plates, and 200 µL/well in 48 well plates. D2L

internalization rate quantification is described in Data Analysis section.

2.7 Measuring total HA-D2L-Rluc expression with Luciferase quantification.

HEK cells were transfected with HA-D2L-Rluc in 6 well plates, and seeded in white 96-

well plates at 10,000 cells/well, and 24 hours after transfection the media was replaced

with 90 µL PBS, and 10 µL of H-Coelenterazine (Nanolight USA, Catalog #301-500)

prediluted in PBS (1:40) was added to each well. The plate was then read under the Mithras

LB940 microplate reader (Berthold USA) at 475 nm emission.

25

2.8 Western blot

HEK cells were seeded at 60-70% confluence in 6 well plates and transfected with

X-tremeGene reagent. Cells were lysed with SDS lysis buffer 24 hours after transfection,

and sonicated at 40 kHz with the Sonic Dismembrator Model 150 (Fisher Canada).

Samples were ran on 8% polyacrylamide gels at 90 V for half an hour, then 120V for 2

hours in running buffer (3.03 g/L Tris-HCL (Bioshop Canada, Catalog #TRS002.500), 14.4

g/L Glycine (Bioshop Canada, Catalog #GLN001.1), 10 mL/L 10% SDS (Bioshop Canada,

Catalog #SDS001.100). Proteins were transferred to 0.45 µM nitrocellulose membranes

(GE Healthcare Canada, Catalog #10600002) for 1 hour at 80V in transfer buffer (3.03 g/L

Tris-HCL, 14.4 g/L glycine, 200 mL/L methanol (Caledon, Catalog #6701-7-40)).

Membrane was then blocked with 5% BSA (Bioshop Canada, Catalog #ALB001.250) in

TBS-T containing 0.1% Tween (Bioshop Canada, Catalog #TWN510.500). All antibodies

used were also diluted in 5% BSA in TBS-T. Primary antibodies used were mouse anti-

HA 12CA5 (1:3000 dilution, Sigma Aldrich Canada, Catalog #11666606001), and anti-

Myc 9E10 (1:3000 dilution, Millipore Canada, Catalog #05-419), and secondary anti-

mouse antibody (GE-Healthcare Canada, Catalog #NA931) was used for 12CA5.

Membranes were washed 3 times with TBS-T for 15, 10 and 5 minutes after each antibody

probe After transfer, membranes were blocked for 4 hours in cold room on a shaker,

followed by overnight primary antibody probe. Membranes probed with 12CA5 anti-HA

were washed with TBS-T and probed with secondary anti-mouse for 1 hour. Membranes

were then washed with TBS-T, and, 1.5 mL ECL was applied to each membrane, and the

membranes were visualized under a Gel Doc™ XR+ System (Bio Rad Canada).

26

2.9 Data analysis

Confocal images were exported as TIFF files using Fluoview FV100 image viewer

software, and analysed using ImageJ and Excel. In ImageJ, TIFF files were imported and

the cytoplasm and PM fluorescent intensity of cells were quantified by using the Straight

Line function and Plot Profile function. The values were transferred to Excel, where the

average signal of both PM and cytoplasm were quantified, and the ratio was calculated

from the two averages.

Data from βLac and ELISA assays were analysed using Excel. The substrate time point

readings from each well were plotted and the slope of the linear regression was calculated.

The average slope from each condition triplicate was calculated, and represents the surface

expression of D2L. Rate of internalization was calculated by normalizing slope from drug

conditions to the corresponding vehicle condition. The resulting value was converted into

a percentage, and represents the change in D2L surface expression following drug

treatment.

Statistical analysis of every data was calculated with GraphPad Prism 6.0. For confocal

data, one-way ANOVA was performed followed by Tukey post-hoc test. For βLac and

ELISA data, two-way ANOVA was performed followed by Tukey post-hoc test. Data are

represented as mean +/- standard error of the mean. Significance of all data was taken at

p<0.05.

27

3. Results

3.1 Overview

To test our hypothesis, we began development of an assay to quantify D2L expression and

D2L trafficking following drug treatment. We tested both a qualitative and quantitative

approach, both of which have their pros and cons. After establishing a reproducible

quantitative assay for quantifying D2L internalization, we co-expressed the RGS9-2

complex and DHHC5 to quantify the possible effect of DHHC5 on RGS9-2 inhibition of

D2L internalization.

3.2 Confocal imaging of D2L localization and internalization in HEK cells.

3.2.1 PFA fixation protocol:

Our lab has previously used confocal imaging to quantify protein localization at the PM

and cytosol for various proteins, and thus we developed this method first to quantify D2L

localization in HEK cells after drug treatment. To visualize D2L expression and trafficking,

we transiently expressed D2L-YFP in HEK cells, and then treated with vehicle or 10 µM

DA treatment, fixed with 4% PFA for 5 minutes, and visualized YPF fluorescence under

confocal microscopy. At basal state D2L-YFP expressing cells displayed either PM only

D2L-YFP localization, or an even distribution between PM and in the cytosol under basal

conditions (Figure 4A). Very few D2L-YFP expressing cells displayed no PM expression.

30 min DA treatment did not induce a contrasting change in D2L-YFP distribution. We

observed more HEK cells with increased D2L-YFP expression in the cytosol, but this

increase was minimal. We did not observe an increase in HEK cells expressing only

cytosolic D2L-YFP. Quantification of fluorescence ratio between PM to cytosol showed

28

no detectable change in the PM/cytosol distribution of D2L-YFP following DA treatment

(Figure 4B).

As a control for this methodology, the fixation protocol was next tested on GFP-tagged M2

muscarinic receptor, another well characterized Class A internalizing receptor (97; 98). In

basal conditions GFP-M2 is highly expressed at the PM and cytosol (Figure 5A). 30 min

stimulation with 100 µM carbachol induced a visible change in receptor localization. We

observed decreased PM expression and increased cytosolic expression. Quantification of

PM to cytosol fluorescence ratio confirmed carbachol treatment induced a decrease in PM

expression and/or increase in cytosolic expression (Figure 5B).

3.2.2 Live cell protocol:

Imaging of another internalizing GPCR, GFP-M2 muscarinic receptor, display a robust

internalization in response to agonist treatment. This suggest D2L-YFP internalization rate

is perhaps much lower than GFP-M2, and is much more difficult to quantify objectively

due to the small range of internalization. Thus, we next developed a protocol that will

visualize D2L-YFP distribution in selected live HEK cells following drug treatment. We

selected a field of HEK cells transiently expressing D2L-YFP where the majority displayed

PM only distribution of D2L-YFP, so that any increase in cytosolic in D2L-YFP might be

easily detected. Following 10 µM DA treatment for 30 minutes, we did not observe any

contrasting change in D2L-YFP distribution (Figure 6A). In the HEK cells expressing

D2L-YFP only at the PM, we did not observe any expression of cytosolic D2L-YFP

following drug treatment. Overall in the field of 9-10 cells, only one or two cells displayed

an increase in cytosolic punctae and fluorescent intensity. Quantification of PM to cytosol

29

fluorescence ratio indicated there was indeed no change in D2L-YFP distribution following

10 µM DA treatment (Figure 6B).

3.3 βLac-tagged quantification of D2L surface expression and internalization

From the confocal experiments we concluded only a small percentage of transfected HEK

cells appear to display marked D2L-YFP internalization, and thus it may be challenging to

visualize and quantify these phenomena from capturing a limited field of cells. Therefore

we next turned to a whole plate quantitative assay in an attempt to quantify the surface

expression and internalization dynamics of a much larger pool of D2L expressing cell

populations. The basis of these assays is to quantify only the surface expressing D2L, and

by comparing surface expression between vehicle and drug treated conditions we can

calculate the change in surface expression as the rate of internalization. The βLac-β2R

assay described in Lam. et al 2013 utilizes the β-Lactamase enzyme tagged to the N-

terminal GPCR domain that is protruding from the PM as a reporter for receptor surface

expression (96). Cells seeded in microplates can be probed with nitrocefin, which is

hydrolyzed in the presence of βLac, and the absorbance of hydrolysed nitrocefin for each

well can be quantified and used as an indicator of surface receptor. The βLac assay reported

similar internalization rates for βLac-β2R drug induced internalization compared to

traditional assays including ELISA and flow cytometry. Also, in comparison βLac assay is

much more time and cost efficient than ELISA and flow cytometry, allowing us to test

more plates per day. Thus, we chose to develop D2L internalization with this protocol, as

it would be faster to troubleshoot and optimize.

30

3.3.1 Increasing doses of βLac-D2L plasmid did not generate a reproducible

internalization phenotype

When setting parameters for the assay, an important parameter we first optimized was the

amount of receptor plasmid transfected. Overloading βLac-D2L may cause improper

sorting to the PM and sequestration in the golgi, while low amounts of plasmids may result

in low overall expression compared to background. HEK cells were transfected with

increasing doses of βLac-D2L (0.25 µg/well, 0.5 µg/well, 1 µg/well) in 6 well plates at 60-

70% confluence. 6 hours after transfection each well was trypsinized and resuspended in 3

mL media, and the resuspension was divided evenly into 12 wells in a Poly-lysine treated

48 well plate. We observed an increase in baseline βLac-D2L surface expression with

increasing plasmid doses (Figure 7), and the increase in surface expression was greatest

between 0.5 and 1.0 µg/well doses (49% increase in expression). 0.25 µg/well did not

display any decrease in surface expression following a time dose treatment with 10 µM

QNP (Figure 8). 0.5 µg/well displayed inconsistent decrease in surface expression,

although the overall trend seems to show a decrease in surface expression with QNP. 1

µg/well was the most consistent condition and exhibited an average internalization rate of

~15%, although the decrease in surface expression following QNP treatment was not

significant for any time dose. This indicates that βLac-D2L internalization at 1 µg/well is

still too inconsistent, and thus when the rate of internalization is only ~15%, which is a

small decrease, this effect is not significant.

31

3.3.2 Increasing the loading of cells/well expressing βLac-D2L did not generate a

reproducible internalization phenotype

We next investigated whether the effect of HEK cell loading on βLac-D2L response to

QNP. We tested this because overloading plates may result in rapid depletion of the

nitrocefin substrate before the 30 minute readout, and also may alter HEK cell function.

On the other hand, at lower confluence we increase the risk of cell wash-off during drug

treatment and PBS washing. We transfected cells with 1 µg/well plasmid, which produced

the most consistent phenotype in previous experiments. After trypsinization and

resuspension, each condition was loaded at a different confluence in 48 well plates. We

tested conditions where cell confluence ranged from less than 50% (25,000 cells/well), to

over 100% (200,000 cells/well). We observed an incremental increase in βLac-D2L surface

expression as we increased cell loading in 48 well plates (Figure 9). High confluence

conditions (100 to 200 thousand/well) displayed more consistent internalization than low

confluence conditions (25 and 50 thousand/well), and the trend indicates that increasing

the confluence also increases the magnitude of βLac-D2L internalization (Figure 10). 10

µM QNP after 15 minutes induced the largest decrease in surface expression (20%) in 200

thousand/well conditions.

Lam et al 2013 previously used HEK cells stably expressing βLac-β2R in their proof-of-

concept paper demonstrating the utility of this assay (96). As a positive control for our

studies, we obtained these βLac-β2R stable HEK cells, and indeed we were able to replicate

the results described in Lam et al 2013 (Figure 11). From this we deduced a βLac-D2L

stable cell line may generate a more reproducible internalization phenotype. Thus we

generated a βLac-D2L stable HEK cell line, which we seeded at 100,000 cells/well in Poly-

32

L-Lysine coated 48 well plates. Disappointingly the stable cell line also did not show robust

or reproducible D2L internalization in response to 10 µM QNP treatment (Figure 12).

3.4 Development of ELISA assay to quantify D2L surface expression

Due to the inconsistencies of the previous assays, we next pursued another more traditional

quantitative method for receptor expression, cell-based ELISA. Previously Celver et al

2010 used a cell culture-based ELISA (Enzyme linked immunosorbent assay) protocol to

quantify D2L internalization, and displayed co-expression of RGS9-2 and Gβ5 greatly

decreased D2L internalization (56). In this protocol, GPCRs in microplates coated with

cells are tagged with an epitope at the N-terminal, which can be probed with specific

antibodies and quantified as a representation of receptor surface expression. We decided to

replicate this protocol in our lab by using the FLAG-D2L clone used in the protocol, and

after optimizing the assay we planned to verify the R7BP and DHHC5 effect on RGS9-2

mediated attenuation of FLAG-D2L internalization.

3.4.1 FLAG-DOR, but not FLAG-D2L, exhibits time dependent decrease in surface

expression after drug treatment in HEK201 cells under the ELISA protocol described

in Celver et al 2010.

We transfected HEK cells with FLAG-D2L in 6 well plates, and 6 hours after transfection

we seeded the cells in Poly-lysine treated white 48 well plates. More than 70% of HEK

cells washed off by the end of the ELISA washing. The loss of cells created two problems:

it decreased the signal of surface FLAG-D2L, and it created inconsistencies within

triplicates. At first, we determined that it may be because the HEK cells were not as

adherent as other cell lines used by other groups. To examine this possibility we switched

33

to CHO cells, which indeed remained adherent throughout the ELISA procedure, but

transfection/surface expression of D2L in CHO cells was very low, and we were unable

detect any surface signal higher than background (data not shown). Because we had already

shown good transfection/expression of D2L-YFP in HEK cells we looked for ways to

increase the adherence of these cells to the culture dish. . We switched to 24-well plates,

and plated HEK at >100% confluence when seeding. Specifically, during transfection we

resuspended cells at 600,000 cells/ml concentration in 15 ml conical tubes, and seeded at

300,000 cells/well in 24 well plates. This change decreased the loss of cells to <20%, and

decreased variability within triplicates. This also increased the signal ratio of surface D2L

to background, which was usually between 2 to 4, which is still far below the ratio reported

in Celver et al 2010, who reported at least 20 fold D2R to background ratio. However, we

did not observe consistent internalization of FLAG-D2L following drug treatment (Figure

13A).

As a control for the ELISA methodology, we also seeded HEK cells expressing FLAG-

tagged delta opioid (DOR) receptors, which had been shown previously by Celver et al.,

2010 to internalize but not be inhibited by RGS9-2 complex. FLAG-DOR expression was

roughly 6 fold of background signal, and produced a drug time dose dependent decrease in

surface expression (Figure 13B). 15-minute treatment with 10 µM DOR agonist DPDPE

([D-Pen2,5]Enkephalin, Sigma Aldrich Canada, Catalog #E3888) treatment decreased

DOR surface expression by 25%, and 60 minute stimulation extended the decrease to 50%.

Thus, we were able to reproduce the ELISA protocol for FLAG-DOR but not FLAG-D2L

in our HEK cell system. This suggests there is an inherent inconsistency in FLAG-D2L

internalization in HEK cells.

34

3.5 ELISA protocol troubleshooting with HA-D2L-Rluc

βarr1/2 recruitment is an important step in receptor internalization, as it is required to

trigger the sequestration of the receptor in a clathrin-coated pit which internalizes into the

cytoplasm (31). We thus used a HA-D2L-Rluc tagged clone designed by the Salahpour

Lab that replaced the STOP codon with three arginines, which has been shown through

bioluminescence resonance energy transfer (BRET) assay to display increased receptor

palmitoylation and βarr2 recruitment (99). When expressed in HEK cells and probed with

anti-HA 12CA5 antibody, HA-D2L-Rluc displayed consistent decrease in surface

expression following treatment with 10 µM QNP, but the magnitude of decrease ranged

from 20% to 50%. We then observed the internalization in the same plate changes based

on OPD incubation time, by reading OPD absorbance at different time intervals without

stopping the reaction. To remove subjectivity and variability in the OPD readings, we

changed the OPD protocol to standardize the signal reading. Instead of an endpoint reading,

the OPD reaction was not stopped with HCl, and it’s 450 nm absorbance was read every

2.5 minutes for 6 time points. A known issue with OPD hydrolysis is that it may generate

absorbance hot spots in the well. Thus the plate was kept on a plate shaker at 400 rpm in

between readings to homogenize the OPD solution. Six readings were taken per plate, and

the slope of the plotted line for each well was calculated in Excel. This method produced

internalization rates ranging from 15 to 25%, and removed any subjectivity in the process.

35

Table 1. Changes made in HA-D2L-Rluc ELISA compared to FLAG-DOR ELISA

Old protocol New protocol Cells were transfected in 6 well plates and seeded in Poly-Lysine coated white 48 well plates 6 hours post-transfection

Cells were transfected in 6 well plates and seeded in Poly-Lysine coated clear 24 well plates 6 hours post-transfection

PBS, BSA washes, primary and secondary antibodies consisted of 500 µL/well volumes in 24 well plates.

The volume of PBS, BSA washes, primary and secondary antibody addition was decreased to 250 µL/well volumes in 24 well plates.

Final wash after secondary antibody consists of 5 times 500 µL/well PBS washes

Final wash after secondary antibody consists of two 5 min with 500 µL/well BSA, and one 5 min wash with 500 µL/well PBS

500 µL/well OPD was added to 24 well plates and incubated at room temperature between 10 to 30 minutes, and was stopped with 3N HCl after first sign of color saturation, and OPD absorbance was read once at 492 nm

500 µL/well OPD was added to 24 well plates and kept on a microplate shaker at 400 rpm. OPD absorbance was read at 450 nm every 2.5 minutes for 15 minutes, and the plate was kept on the shaker between reads

3.5.1 60 min 10 µM QNP treatment is the optimal drug condition for HA-D2L-Rluc

internalization

When developing the ELISA protocol HA-D2L-Rluc, we used only one drug dose and time

course (10 µM QNP for 60 min), and thus after establishing the ELISA protocol we

conducted a QNP time course and dose response with HA-D2L-Rluc to select the optimal

drug dose and time point. Results show that HA-D2L-Rluc displayed at least 20% decrease

in surface expression in all drug conditions (Figure 14). 1 µM QNP for 60 minutes

displayed a 50% decrease, as well as a time dependent decrease in surface expression.

However we observed more wash-off in the 1 µM QNP drug conditions, and thus the data

may be less reproducible than the other conditions. 10 µM QNP displayed the best overall

consistency within triplicates, and although the rate of internalization was not the greatest,

we believe this dose is the most consistent and reproducible condition.

36

3.5.2 1 µg/well of HA-D2L-Rluc is the optimal plasmid dose for D2L internalization

After establishing the drug dose and time point, we next optimized the amount of HA-D2L-

Rluc transfected in each well of a 6 well plate. The goal of this is to find the minimal dose

of HA-D2L-Rluc needed that still produces a consistent internalization rate, so that when

we co-transfect the RGS9-2 complex and DHHC5 it does not overwhelm the

transfection/expression capacity of the cell. Again we detected a proportional increase

between HA-D2L surface expression and plasmid dose. Results show that 1 µg/well, the

highest dose used, produced the highest internalization rate (25% decrease) (Figure 15),

while 0.5 µg/well displayed also displayed significant internalization albeit at a lower rate

(20%). 0.25 µg/well displayed 15% internalization, but this was not statistically significant.

Since we will need the dynamic range of drug-induced internalization to be as large as

possible for us to detect a DHHC5 effect in a co-transfection assay, we will need to use the

1 µg/well condition in subsequent experiments.

3.5.3 Coexpression of both GRK2 and βarr2 with 1 µg/well HA-D2L-Rluc further

increases the internalization rate.

A 25% decrease in D2L surface expression following 60 minute treatment with 10 µM

QNP is less than what is reported in the literature, and thus we tested whether it was because

of possible deficiencies in the internalization machinery in our HEK cells. Co-transfection

of GRK2 and βarr2, two important internalization machinery proteins, increased HA-D2L

internalization by 10% when both proteins were transfected at 0.5 µg/well each (Figure

16). Doubling the doses of GKR2 and βarr2, however, caused an unexpected decrease in

both basal D2L surface expression and we no longer observed internalization following

drug treatment. Expression of either GRK2 or βarr2 with 1 µg/well D2L did not induce any

37

significant change in D2L internalization rate. We thus opted to discontinue co-transfection

of GRK2 and βarr2 with HA-D2L, because the 10% increase in internalization rate did not

enough to offset the problem of plasmid overload, especially given that there will need to

be multiple additional plasmids added to test the effects of RGS9-2 complex and DHHC5

on D2R internalization.

3.5.4 Optimization of 4% PFA fixation to minimize potential HEK membrane

permeabilization.

One potentially confounding consequence of the 4% PFA fixation step in our ELISA

protocol is partial HEK membrane permeabilization, which might expose intracellular HA-

D2L to the extracellular antibody. To test the extent of permeablization with our current

fixation conditions, we did a time course and temperature dependent test with HEK cells

expressing intracellular HA-RGS9-2 (Figure 17). If the membrane was permeablized by

4% PFA, we would get increased OPD signal due to detection of HA-RGS9-2 by the

antibody. We normalized all conditions to HEK cells expressing Hisstrep empty vector.

Results show that 5 min fixation on ice induces minimal membrane permeablization

compared to control, while all other conditions induced at least two fold increase in OPD

signal.

3.6 RGS9-2 complex and DHHC5 co-transfection with HA-D2L in HEK cells display

a trend of decreased HA-D2L-Rluc internalization following QNP treatment.

Lastly, we tested the biologic activities of co-transfected RGS9-2 and DHHC5 on HA-

D2L-Rluc internalization using our optimized D2R internalization assay. Validation

through western blot, confocal imaging, and luciferase assay shows that HA-D2L-Rluc,

38

HA-RGS9-2, myc-Gβ5, GFP-R7BP, and HA-DHHC5 are all expressed in HEK when

transiently co-transfected (Figure 18, 19A). In addition, GFP-R7BP WT displays mainly

PM localization when co-expressed HA-DHHC5, while HA-DHHS5 co-expression shifts

GFP-R7BP WT localization partially to the nucleus (Figure 18B). GFP-R7BP SS is

completely localized in the nucleus. Following 60 min of 10 µM QNP treatment, we

observed a relative decrease in internalization when we co-expressed any combination of

RGS9-2 complex and DHHC5 (Figure 19B). More importantly only the condition with

control vector co-transfection yielded significant internalization (20%). However, when

we compared internalization rate between the various transfectants we were unable to

identify significant differences between them. Examination of the data indicates that

conditions where DHHC5 was co-transfected appeared to trend toward lower

internalization rate than those with DHHS5 co-transfected, however, more studies will be

needed to determine the biological significance of these observations.

39

Figure 4. Confocal imaging of D2L-YFP in HEK after drug treatment and fixed with 4% PFA Images were captured with Olympus Fluoview 1000 confocal microscope, excitation wavelength 515 nm, 60x oil magnification. Cells were incubated in 1X PBS during image capture. White arrows indicate HEK cells with significant aggregation of cytosolic D2L-YFP A. Imaging of 4% PFA fixed HEK cells transiently expressing D2L-YFP following treatment with 10 µM DA or vehicle for 30 min prior to fixation. B. Quantification of PM to cytosol fluorescent intensity ratio. YFP fluorescence intensity at the PM and cytosol was quantified using ImageJ and Excel. The fluorescence ratio of drug treatment condition was normalized to the vehicle condition. In each experiment, 30 cells were analysed for each condition and the mean PM/Cytosol ratio was determined. (n = 3; represents 3 different experiments carried out on separate data)

40

Figure 5. Confocal imaging of GFP-M2 in HEK after drug treatment and fixed with 4% PFA Images were captured with Olympus Fluoview 1000 confocal microscope, excitation wavelength 543 nm, 60x oil magnification. Cells were incubated in 1X PBS during image capture. A. Imaging of 4% PFA fixed HEK cells transiently expressing GFP-M2 treated with 100 µM carbachol. B. Quantification of PM to cytosol fluorescent intensity ratio as described above. (n = 1; represents pilot study to determine whether internalization can be detected for other receptors)

41

Figure 6. Confocal imaging of D2L-YFP localization in the same field of HEK cells following drug treatment Images were captured with Olympus Fluoview 1000 confocal microscope, excitation wavelength 515 nm, 60x oil magnification. Cells were incubated in 1X PBS during image capture. White arrows indicate HEK cells with significant aggregation of cytosolic D2L-YFP A. Imaging of live HEK cells transiently expressing D2L-YFP at basal state and after 30 minute treatment with 10 µM DA. Cells were incubated in serum free DMEM/F12 with HEPES during image capture. White arrows indicate the cell displaying an increase in cytosolic D2L-YFP B. Quantification of PM to cytosol fluorescent intensity ratio with ImageJ as described in Figure 4. (n = 2).

42

Figure 7. Optimization of βlac-D2L plasmid dose for high βlac-D2L surface expression in HEK HEK cells were seeded in 6 well plates at 70% confluence, and transfected with 0.25, 0.5 or 1.0 µg/well. 6 hours after transfection, cells were seeded in clear 48-well plates. Each condition was seeded in triplicates. 24 hours after transfection, the wells were washed with PBS and probed with Nitrocefin. Plates were read at 1 min intervals for 30 minutes at 486 nm in an EPOCH spectrophotometer. Rate of nitrocefin hydrolysis was quantified in Excel by measuring the slope of each 30 minute nitrocefin curve in each well, and the average rate of each triplicate represents βLac-D2L surface expression. Nitrocefin signal from empty vector transfected HEK cells were subtracted from each βLac-D2L condition. Surface expression of receptor for all transfection conditions were normalized to the 0.25 µg/well condition for each day. Statistical analysis were performed in GraphPad 6.0 using one-way ANOVA and Tukey Post-hoc comparison test. * = p < 0.05. n=4, error bars = standard error.

43

Figure 8. Optimization of βLac-D2L plasmid dose for 10 µM QNP induced internalization of βLac-D2L in HEK HEK cells were transfected and seeded in 48 well plates as described in the figure above. 24 hours after transfection, cells were treated with either vehicle or 10 µM QNP for 15, 30 or 60 minutes. After drug treatment, drug was washed off with 3 times PBS wash on ice, and the plate was probed with Nitrocefin. βLac-D2L surface expression was quantified as described in the figure above. Surface expression of βLac-D2L in HEK cell are normalized to vehicle (dashed line), following drug treatment. Each transfection condition following drug treatment was normalized to a corresponding vehicle condition with the same transfection condition (n = 4). Statistical analysis were performed in GraphPad 6.0 using one-way ANOVA and Tukey Post-hoc comparison test. * = p < 0.05. n=4, error bars = standard error.

44

Figure 9. Optimization of cell loading dose for high surface expression of βLac-D2L in HEK HEK cells were seeded in 6 well plates at 70% confluence, and transfected with 1 µg/well βLac-D2L. 6 hours after transfection, cells were trypsinized, resuspended and seeded in clear 48-well plates at varying doses (25, 50, 100, 200 thousand cells/well). Each condition was seeded in triplicates. 18 hours after seeding, the wells were washed with PBS and probed with Nitrocefin. Plates were read at 1 min intervals for 30 minutes at 486 nm in an EPOCH spectrophotometer. βLac-D2L surface expression was quantified as described in the Figure 7. Statistical analysis were performed in GraphPad 6.0 using one-way ANOVA and Tukey Post-hoc comparison test. * = p < 0.05. n=5, error bars = standard error.

45

Figure 10. Optimization of cell loading dose for 10 µM QNP induced internalization of βLac-D2L in HEK HEK cells were transfected and seeded in 48 well plates as described in the figure above. 24 hours after transfection, cells were treated with either vehicle or 10 µM QNP for 15, 30 or 60 minutes. After drug treatment, drug was washed off with 3 times PBS wash on ice, and the plate was probed with Nitrocefin. βLac-D2L surface expression was quantified as described in the figure above. Surface expression of βLac-D2L in HEK cell are normalized to vehicle (dashed line), following drug treatment. Each transfection condition following drug treatment was normalized to a corresponding vehicle condition with the same transfection condition (n = 4). Statistical analysis were performed in GraphPad 6.0 using one-way ANOVA and Tukey Post-hoc comparison test. * = p < 0.05. n=5, error bars = standard error.

46

Figure 11. 10 µM Isoprotenerol induced internalization of βLac-β2R in HEK HEK cells were seeded in 6 well plates at 70% confluence, and transfected with 1 µg/well βLac-β2R. 6 hours after transfection, cells were trypsinized, resuspended and seeded in clear 48-well plates at 50 thousand cells/well. 24 hours after transfection, cells were treated with either vehicle or 10 µM Isoprotenerol for 30 minutes. After drug treatment, drug was washed off with 3 times PBS wash on ice, and the plate was probed with Nitrocefin. Plates were read at 1 min intervals for 30 minutes at 486 nm in an EPOCH spectrophotometer. βLac-β2R surface expression was quantified as described in the Figure 7. (n=1)

47

Figure 12. Comparison of 10 µM QNP induced βLac-D2L internalization in HEK cells stably and transiently expressing βlac-D2L HEK cells stably expressing βlac-D2L or transiently expressing 1 µg/well βlac-D2L were seeded in 48 well plates at 200 thousand cells as described in Figure 7. 18 hours after transfection, cells were treated with either vehicle or 10 µM QNP for 15, 30 or 60 minutes. After drug treatment, drug was washed off with 3 times PBS wash on ice, and the plate was probed with Nitrocefin. βLac-D2L surface expression was quantified as described in the Figure 7. Surface expression of βLac-D2L in HEK cell are normalized to vehicle (dashed line), following drug treatment. Each transfection condition following drug treatment was normalized to a corresponding vehicle condition with the same transfection condition. (n=1)

48

Figure 13. ELISA quantification of FLAG-D2L and FLAG-DOR surface expression in HEK following drug treatment. HEK cells were cultured in 6 well plates until 70% confluent. Cells were then transfected with 1 µg/well FLAG-D2L or FLAG-DOR using X-tremeGene. 6 hours after transfection, the cells in each transfection condition were trypsinized and seeded in clear 24 well plates at 300,000 cells/well, 24 hours after transfection the cells were given drug. FLAG-D2L and FLAG-DOR cell surface signal were probed with HRP-conjugated anti-FLAG antibody, followed by probing with HRP substrate OPD. Once OPD reached color saturation in a triplicate, the reaction was stopped with 3N HCl, and OPD absorbance at 492 nm was quantified using the EPOCH spectrophotometer. Background OPD signal from empty vector transfected HEK cells was subtracted from each condition. . Surface expression of (A) FLAG-D2L and (B) FLAG-DOR in HEK cell were normalized to vehicle (dashed line), following treatment with receptor agonist in 24 well plates. A. FLAG-D2L surface expression in HEK cells following 10 µM QNP treatment (n = 3) B. FLAG-DOR surface expression in HEK201 cells following 10 µM DPDPE encephalin treatment (n = 1)

49

50

Figure 14. Optimization of QNP concentration and time point in agonist induced HA-D2L-Rluc internalization in HEK 24 well plate containing HEK cells transiently expressing HA-D2L-Rluc were prepared as described in Figure 13. HA-D2L was probed with anti-HA 12CA5 primary antibody, then with anti-mouse secondary antibody. Immediately after OPD addition, the plate was read at 450 nm in 2.5 min intervals for 15 minutes in the EPOCH microplate spectrophotometer. The plate was kept on a shaker at 450 rpm in between each reading. Background OPD signal from empty vector transfected HEK201 cells was subtracted from each condition. Surface expression of HA-D2L-Rluc in HEK cell normalized to vehicle (dashed line), following treatment with QNP in 24 well plates. (n=1)

51

Figure 15. Optimization of HA-D2L-Rluc plasmid dose in 10 µM QNP induced HA-D2L-Rluc internalization in HEK cells. 24 well plate containing HEK cells transiently expressing varying doses of HA-D2L-Rluc (0.25, 0.5 and 1 µg/well in a 6 well plate) were prepared as described in Figure 13. The plate was treated with 10 µM QNP for 60 minutes, and HA-D2L-Rluc surface signal was quantified as described in Figure 14. Each plasmid condition following drug treatment was normalized to a corresponding vehicle condition with the same plasmid condition. Results were analysed with two-way ANOVA followed by Tukey’s post-hoc test for multiple comparisons, p<0.05. * = significant difference from vehicle (n = 3).

52

Figure 16. Optimization of 10 µM QNP HA-D2L-Rluc internalization rate in HEK with transient co-expression of transient GRK2 and βarr2. 24 well plate containing HEK cells transiently expressing varying doses of HA-D2L-Rluc (0.25, 0.5 and 1 µg/well) were prepared as described in Figure 13. The plate was treated with 10 µM QNP for 60 minutes, and HA-D2L-Rluc surface signal was quantified as described in Figure 14. Each plasmid condition following drug treatment was normalized to a corresponding vehicle condition with the same plasmid condition. Results were analysed with two-way ANOVA followed by Tukey’s post-hoc test for multiple comparisons, p<0.05. * = significant difference from vehicle (n = 3).

53

Figure 17. Optimization of 4% PFA fixation in potential permeablization of HEK cells. 24 well plate containing HEK cells transiently expressing 1 µg/well HA-RGS9-2 were prepared as described in Figure 13. 24 hours after transfection, the plate was washed one ice with PBS, and treated with 4% PFA at room temperature or on ice (5, 10 or 15 minutes). Following fixation, the plate was washed three times with PBS and probed with 12CA5 anti-HA antibody. HA-RGS9-2 signal was quantified as described in Figure 14, and was normalized to 5 min on ice PFA fixation. (n=1)

54

Figure 18. Validation of transient transfection of HA-RGS9-2, myc-Gβ5, GFP-R7BP, and HA-DHHC5 in HEK cells. HEK cells were seeded in 6 well plates at 60-70% confluence, and each well was transfected with 225 mL Opti-MEM, 3.75 µL X-tremeGene, and 3 µg of plasmids. 24 hours after transfection, each well was imaged with a Yokogawa Spinning Disk confocal microscope. After imaging, each well was lysed with SDS lysis buffer, and proteins were analysed on a western blot. A. Western blot detection of HA-RGS9-2, HA-DHHC5, HA-DHS5, and myc-Gβ5. Samples were run on an 8% acrylamide gel for 30 minutes at 90 V, and then 2 hours at 120 V. The membrane was separated into half at the 48 ladder mark, and blotted for HA and myc tags. DHHC5 and DHHS5 appear at 90 kDA mark. RGS9-2 appears at the 75 kDA mark. Gβ5 appears at the 40 kDA mark. B. Confocal imaging of GFP-R7BP WT/SS from the same group of cells used for western blot in Figure 18A. Transfection conditions: WT/SS + D5/S5 (1 µg/well D2L + 0.5 µg/well RGS9-2 + 0.5 µg/well Gβ5 + 0.5 µg/well R7BP WT/SS + 0.5 µg/well DHHC5/DHHS5). Images were capture at 488 nm using 10X objective lens. (n=1)

55

56

57

Figure 19. ELISA assay quantification of DHHC5 activity in mediating RGS9-2 inhibition of HA-D2L-Rluc internalization 24 well plate containing HEK cells transiently expressing varying combinations of HA-D2L-Rluc, RGS9-2 complex and DHHC5 were prepared as described in Figure 13. The plate was treated with 10 µM QNP for 60 minutes, and HA-D2L-Rluc surface signal was quantified as described in Figure 14. Each transfection condition contains 3 µg/well plasmids. Conditions: D2L (1 µg/well D2L + 2 µg/well Hisstrep) RGS9-2/Gβ5 (1 µg/well D2L + 0.5 µg/well RGS9-2 + 0.5 µg/well Gβ5 + 1 µg/well Hisstrep) R7BP WT/SS (1 µg/well D2L + 0.5 µg/well RGS9-2 + 0.5 µg/well Gβ5 + 0.5 µg/well R7BP WT/SS + 0.5 µg/well Hisstrep) WT/SS + D5/S5 (1 µg/well D2L + 0.5 µg/well RGS9-2 + 0.5 µg/well Gβ5 + 0.5 µg/well R7BP WT/SS + 0.5 µg/well DHHC5/DHHS5). A. HEK cells with transient transfection of each condition were seeded in white 96 well plates and probed with RLuc substrate H-Coelenterazine. After quantification of RLuc signal results were normalized to RLuc signal in transfection condition “D2L”. B. HEK cells transiently transfected with each condition were seeded in 24 plates and treated with 10 µM QNP for 60 minutes. Surface HA-D2L signal was probed with anti-HA 12CA5 and secondary anti-mouse, and HRP substrate OPD was added to each well after washing and absorbance was read at 450 nm. Results were analysed with two-way ANOVA followed by Tukey’s post-hoc test for multiple comparisons, p<0.05. * = significant difference from vehicle (n = 7).

58

4. Discussion

4.1 Overview

DHHC5 has been shown to palmitoylate and promote PM association of various neural

proteins (87; 89; 90; 91). DHHC5 itself is also highly PM-associated, unlike other DHHC

proteins expressed mostly at the Golgi/ER and cytosol. One target for DHHC5

palmitoylation, R7BP, is an anchor protein that facilitates RGS9-2 GAP activity towards

Gi/o coupled receptors at the PM. This suggests DHHC5 can potentiate RGS9-2 GAP

activity by regulating a component of the RGS9-2 complex. RGS9-2 is a negative regulator

of D2L signalling, and studies have shown D2R internalization is inhibited with RGS9-2

complex co-expression (56; 100; 101). For this thesis, we have developed an ELISA

functional assay to quantify drug induced D2L internalization in HEK cells, and used this

assay to investigate the DHHC5 effect on RGS9-2 mediated inhibition of D2L

internalization. However, the relatively poor internalization of D2R together with an

intrinsically high variability of the internalization assay prevented conclusive investigation

of the roles of RGS9-2, R7BP and DHHC5 in the regulation of D2L signalling.

4.2 Confocal imaging of D2L-YFP was not optimal for quantifying D2L

internalization.

We first pursued a microscopic approach, and developed a confocal assay in attempt to

visualize D2R surface expression in HEK cells. Studies have shown through fluorescent

imaging of both live cells and fixed cells that D2Rs exhibit robust internalization (~50%

decrease in surface expression) following treatment with both DA and QNP (102; 103;

104). HEK cells transiently expressing D2L-YFP were 4% PFA fixed and imaged with

59

confocal microscope following QNP treatment. We expected to detect both an increase in

cytosolic punctae and decrease in PM fluorescence, as QNP has been show to induce D2L

internalization. However, we did not see a clear and reproducible change in D2L-YFP

expression pattern following drug treatment. These data were surprising and were in

contrast to what is reported in the literature (101; 105), as well as the results we observe in

the same culture/expression system for M2-GFP internalization, where the phenotype is

much more reproducible. We reasoned that one possible reason why D2L-YFP may not

show robust internalization dynamics is because of the position of the C-terminal YFP

attachment. Perhaps this fusion obstructs GRK phosphorylation of the D2R, subsequent

βarr2 binding, and receptor sequestration into clathrin pits. GFP-M2 is tagged at the N-

terminal, consistent with the notion that the placement of YFP may contribute to the lack

of internalization for D2R-YFP. Although future studies might benefit from an N-terminal

YFP-tagged D2L, for the reasons outlined below we instead pursued a more quantitative

approach and developed quantitative assays for receptor internalization that had been

previously tested and validated for D2R.

4.2.1 Limitations

We have identified potential issues with confocal imaging as a functional quantitative assay

for D2L internalization. D2L-YFP is expressed both at the PM and cytosol in both vehicle

and drug conditions, which created difficulty in setting parameters for cell selection and

analysis. Without a clear definitive parameter, this assay quantification method displayed

a high degree of variability owing to the diversity of the cell phenotypes observed. The

technique is also limited by the time and expense of collecting data with relatively small

numbers of transfected cells per field. Accordingly we next pursued and developed a D2L

60

internalization assay that would allow us to quantify D2L surface expression from large

numbers of transfected cells – the βLac reporter assay and ELISA assay methods.

4.3 βLac-D2L displayed inconsistent internalization, and thus the βLac assay is not

viable for quantifying D2L internalization.

The βLac mediated receptor internalization assay is a time and cost efficient method that

removes the need for intermediate probes. This technique has been shown to be as effective

as ELISA and flow cytometry for quantifying β2 adrenergic receptor surface expression in

HEK cells (96), and was able to reproduce the same results with βLac-β2R. With βLac-

D2L, we expected a similar rate of internalization following QNP treatment, as both

receptors require GRK and βarr1/2 recruitment for clathrin mediated internalization. An

important decision we made was to use transient expression of βlac-D2L, unlike the stable

expression of βLac-β2R. This is because when we test DHHC5 regulation of D2L

internalization, we will be transiently expressing four clones (RGS9-2, Gβ5, R7BP &

DHHC5), and it is important that the βLac-D2L expressing cells we quantify also express

all other four clones, so that any changes in internalization rate can be attributed to the

expression of all four clones. In transient transfection, one can infer that cells expressing

βLac-D2L is likely to also express the other four clones, and cells not expressing βLac-

D2L will not be expressing the other clones as well. Transfection efficiency in our HEK

cells with X-tremeGene is generally ~20%, and thus we expect all 20% of cells transfected

with βLac-D2L will likely also express the other clones. In βLac-D2L stable cells, the

phenotype of the ~20% transiently expressed RGS9-2 complex and DHHC may be

61

drowned out by the other 80% non-transfected cells. Thus, we opted for transient

transfection of all clones.

βLac-D2L did not display the same magnitude of internalization displayed by βLac-β2R,

and more importantly showed a high degree of inconsistency in response to QNP treatment

from one day to the next despite using an identical protocol. Neither changing the number

of cells/plate nor the dose of βLac-D2L plasmid produced a consistent internalization

phenotype, although transfecting 1 µg/well of βLac-D2L and loading at near 100%

confluence (100,000 cells/well) produced the most promising trend. Thus, to address the

consistency issue we generated βLac-D2L stably expressing HEK cells. Disappointingly,

the stable cell line did not display any further decrease in surface expression after QNP

treatment. In fact, they presented an almost identical phenotype to the transiently expressed

βLac-D2L in the same plate.

4.3.1 Limitations

The biggest potential limitation of the βLac assay is that the βLac enzyme may effect

receptor function for specific receptors. In our hands, β2AR exhibits robust internalization,

but βLac-D2L does not. There may be several explanations why the βLac assay does not

display consistent, large magnitude (50%) βLac-D2L internalization. First, the βLac

enzyme is a large protein greater than 30 kDa, and it may obstruct the ligand binding region

of D2L. Also, the large enzyme may interfere with βarr2 mediated internalization of D2L

by preventing D2L sequestration into clathrin pits.

Alternatively, it is possible the lack of βLac-D2L internalization stems from an

incompatibility between D2L and our HEK cells model, particularly since βLac does not

62

obstruct β2AR internalization in these same cells. Thus in the future it may be important

to test βLac-D2L in other cell types such as CHO cells and PC12 cells.

4.4 FLAG-D2L shows inconsistent internalization compared to FLAG-DOR

The next assay we pursued was the cell-based ELISA assay, which detects surface epitopes

attached to receptors at the PM. In this case the receptor tag examined by ELISA was the

much smaller FLAG epitope and thus was less likely to cause steric hindrance of ligand

binding or receptor internalization. ELISA has been a popular method for quantifying

surface receptors, and has been shown to be effective in quantifying D2R internalization

by many groups (56; 106; 107; 108). We attempted to reproduce the protocol described in

Celver et al 2010 using their FLAG-D2L, but several issues occurred. Firstly, using a 96

well plate loaded with 10,000 cells/well lead to significant cell wash-off by the end of the

secondary antibody probing. This caused problems including low signal, loss of

background signal, and inconsistent signals within triplicates. This was not an issue in βLac

assays, where only three washes in total were needed before plate reader quantification.

Thus, the wells had to be overloaded with cells, and the wells themselves had to become

larger, which decreased the level of wash-off. We modified our protocol afterwards mainly

after what is reported by Thibault et al 2011 (109). After switching to clear 24 well plates,

we tested the new protocol with FLAG-D2L, but still faced low basal surface expression

and an inconsistent internalization phenotype. Our FLAG-D2L surface expression was at

most 4 times higher than background signal, which is much lower than what is reported by

Celver et al 2010 (20 times background). We concluded that FLAG-D2L behaves

differently in our HEK cells compared to the Kovoor lab, and thus we compared it to

63

FLAG-DOR, another clone we obtained from the Kovoor lab which reported similar robust

internalization in their ELISA assay. DOR is also a clathrin-mediated internalizing GPCR

which requires βarr1/2 and GRK recruitment. Through FLAG-DOR we hoped to identify

whether our cell line, our assay, and/or the FLAG-D2L clone is the issue. FLAG-DOR

displayed a time dependent internalization following a drug time-course with DOR agonist

DPDPE in the same HEK cells under the same ELISA protocol. This result showed that

the ELISA protocol and the HEK cells are viable for quantifying GPCR internalization,

and the consistency and small magnitude issues we observed must originate from the

plasmid itself, or the drug preparation.

4.4.1 Limitations

The FLAG-D2L ELISA assay displayed inconsistencies in D2L internalization. This

prevents this assay from being a viable functional assay for quantifying DHHC5 function,

as we need a consistent internalization phenotype to assess RGS9-2 GAP activity. Perhaps

the HEK system we are using does not have the optimal expression of internalization

machinery to facilitate FLAG-D2L internalization consistently. A different HEK strain or

cell type may generate more consistent FLAG-D2L internalization. Also, alternatively

modifying the FLAG-D2L clone to facilitate FLAG-D2L phosphorylation and βarr1/2

recruitment may stabilize the internalization phenotype.

4.5 HA-D2L-RLuc displays consistent internalization in HEK cells.

We next switched to HA-D2L-Rluc, a D2 clone with the STOP codon replaced with triple

arginine to facilitate phosphorylation and βarr1/2 recruitment. Preliminary results showed

similar levels of basal surface expression as FLAG-D2L, and HA-D2L-Rluc displayed

64

consistent internalization, ranging from a 20 to 50% decrease in surface expression

following drug treatment. After modifying the OPD reading protocol we obtained an

internalization range between 15 and 30% for each experiment. Thibault et al 2011 also

reported roughly 20% internalization rate with transient D2L in HEK cells after 60 min

treatment with 10 µM QNP (109). We hypothesize the improved ability of this plasmid to

recruit βarr1/2 is the main reason that we now have a reproducible D2 internalization

protocol. This suggests perhaps the HEK cells used in Celver et al 2010 expressed a robust

amount of endogenous GRK and βarr1/2, which facilitated internalization of FLAG-D2L,

and our HEK cells either express low amounts of endogenous GRK and βarr1/2, or that

transient transfection disrupts proper transcription and translation of these proteins. Our

D2R internalization rate is comparable to what was reported by Thibault et al 2011, as well

as other studies which utilized cell surface labelling assays (100; 101; 109). We were

unable to reproduce the magnitude of D2L internalization reported by Celver et al 2010

(56). Kim et al 2004 reported βarr2 co-transfection increased D2R internalization rate by

15%. We thus co-transfected GRK2 and/or βarr2 and observed a 10% increase in HA-D2L-

Rluc internalization when both clones were co-transfected, suggesting we need to obtain a

HEK cell population that expresses high levels of endogenous GRK and βarr1/2. We

decided for future experiments to not co-express any combination of GRK2 or βarr2, as

this would increase the number of co-expressed plasmids from 5 to 7, a trade off that is too

much for only a slight increase in internalization.

65

4.6 RGS9-2 complex and DHHC5 co-transfection display a trend of decreased HA-

D2L-Rluc internalization

Celver et al 2010 reported a We co-transfected the RGS9-2/Gβ5/R7BP complex and

DHHC5 with HA-D2L-Rluc in HEK cells, and quantified surface expression following 60

min 10 µM QNP treatment. Confocal imaging of GFP-R7BP WT shows that DHH5 co-

expression increases R7BP PM localization, similar to the data reported by Dr. Bastin

(Figure 3), while dominant negative mutant DHHS5 resulted in nuclear localization,

although not to the same extent as previously reported by Dr. Bastin. This may be due to

the expression of other DHHC proteins in the HEK used in these experiments that were not

present in the HEK used by Dr. Bastin. These DHHC proteins can facilitate R7BP PM

localization in the absence of DHHC5. We expected co-transfection of RGS9-2/Gβ5 to

decrease HA-D2L-Rluc internalization, and this is what we observed. In fact, all conditions

involving co-transfections of the RGS9-2 complex displayed a decrease in HA-D2L-Rluc

internalization and only HA-D2L-Rluc co-transfected with Hisstrep displayed statistically

significant internalization (20%, p<0.05). When comparing trends, R7BP WT co-

transfection displayed a smaller internalization rate than R7BP SS, which is what we expect

when we mutate the shuttling component of the RGS9-2 complex. DHHC5 co-transfection

displayed a smaller internalization rate than DHHS5 mutant in both conditions co-

transfected with R7BP WT or SS. We expected DHHC5 to exhibit this phenotype in R7BP

WT, as the lack of R7BP palmitoylation by DHHS5 will lead to R7BP nuclear localization

and prevent proper facilitation of RGS9-2 GAP activity. We were surprised to see a

difference between DHHC5 and DHHS5 when co-transfected with R7BP SS, as we have

essentially already mutated the RGS9-2 complex and mutation of DHHC5 should not have

66

any further effect on RGS9-2 GAP activity. We think perhaps DHHC5 is exerting a direct

effect on D2L trafficking, as DHHC5 is at the PM and DHHC proteins have been shown

previously to palmitoylate GPCRs to mediate its interaction with GRK (82). We also

observed increased inconsistencies within conditions with more than 3 plasmids co-

transfected. A possible solution to this consistency issue begun constructing a polycistronic

vector that will contain RGS9-2, Gβ5, R7BP, and DHHC5. This will decrease the number

of plasmids down to two, and our results show that when three or less plasmids are co-

expressed the variability within triplicates decrease. Also, it will guarantee that all four

clones will be expressed in the same cell, as all four clones will share one promoter site.

4.6.1 Limitations:

The major limitations of our ELISA protocol is that we have no validation method to

visualize all 5 plasmids in the same cell while quantifying D2L internalization. Even

though we used western blot and confocal to validate all 5 plasmids can be co-expressed

in HEK, in the ELISA assay we can only infer that any change in D2L internalization was

caused by all 4 plasmids that were co-transfected. Our assay is based on the premise that if

one plasmid is transfected, the other four plasmids will also be transfected. In addition, we

currently have no method of directly validating RGS9-2 is trafficking to the PM. Our

transient D2L ELISA also suffers from a small dynamic range of internalization, and this

drawback makes it difficult to statistically differentiate between the effects of DHHC5 and

RGS9-2 overexpression on D2L internalization relative to D2L basal internalization. In the

future we will generate a polycistronic clone containing all plasmids aside from D2L, that

way we decrease the variability in co-expression. We will also pursue D2L stable protocols

with these polycistronic vectors, and troubleshoot to increase the transfection efficiency in

67

HEK cells so that the RGS9-2/DHHC5 effect is not drowned out by basal D2L

internalization.

4.7 Conclusions and main findings of this work:

We have endeavoured to develop a robust D2R functional assay using a variety of methods

including: confocal, βLac reporter and cell culture based ELISA assay. In the confocal

studies, a surprisingly small percentage of D2L-YFP expressing HEK cells exhibited

internalization, leading us to conclude that quantifying D2R trafficking would be difficult

with this method. Likewise, the βLac reporter assay did not show reproducible

internalization, suggesting that altering the N-terminal extracellular domain of the D2R

with the addition of a large enzymatic reporter may have deleterious consequences with

respect to agonist binding and internalization. The most successful efforts were in the

development of an ELISA assay to measure surface expression of an epitope-tagged D2R.

Notably, it was not until we used modified D2R receptor (HA-D2L-Rluc) containing a

string of three arginine residues in its carboxyl terminal domain between the receptor and

luciferase enzyme, that we could demonstrate reproducible internalization of D2R. The

arginine string was previously shown to increase receptor palmitoylation and β-arrestin

recruitment suggesting that the wild type receptor may not be interacting optimally with

the endogenous HEK internalization machinery in our system. Indeed, overexpression of

β-arrestin2 and GRK2 increased the level of internalization to the ~ 35% level, the best

dynamic range we were able to achieve for any protocol. Notably, however, this level is

still well below the ~50% reported in the literature. These findings indicate the possibility

that the rate of D2R internalization may vary depending on the strain of HEK cells used

68

for the study. One possible explanation for such results may be the level of endogenous

GRK6 expressed in the different HEK cell lines since GRK6 has been shown to be an

important modulator of D2R surface expression in other experimental models (110; 111).

From these studies, it seems likely that D2R internalization may behave very inconsistently

in different HEK cell models. Thus, in the future, studies that aim to use other surrogate

measures of D2R activity should also be explored. For example receptor activity assays

measuring GIRK activation, Gi-mediated inhibition of adenylyl cyclase activity, or direct

quantification of Gi activation (separation from activated heterotrimeric complexes) via

BRET may provide more viable approaches. Lastly, due to the inherent inconsistencies of

this assay, we were not able to conclusively verify the DHHC5 effect on RGS9-2 and R7BP

mediated inhibition of D2L, but the trends encouragingly confirm what was shown by

Celver et al 2010, that RGS9-2-Gβ5 decrease D2R internalization.

4.8 Future directions:

4.8.1 Improving the D2L internalization assay

Multi-plasmid co-transfection in HEK cells have been shown to become inconsistent once

the number of plasmids exceeds three. In future D2L experiments, aside from D2L that

could be either transiently or stably expressed, the RGS9-2 complex and DHHC5 enzyme

should be reconstructed into a single polycistronic vector that contains all these plasmids.

In transient D2L assays, this will decrease the transfection variability, and in stable cells

this will guarantee that all transfected cells will express all four plasmids.

To increase the rate of D2L internalization, generating a D2L stable cell line is a viable

option. Some studies where D2L was stably expressed report a 50% decrease in surface

69

expression after treatment with DA and QNP (102; 112). Attempts in this lab to generate a

polyclonal HA-D2L-Rluc stable HEK cells failed to produce a colony that expressed

appreciable levels of HA-D2L-Rluc, as detected in the RLuc assay. In the future, if we can

generate a HA-D2L-Rluc expressing stable cell line, it would worthwhile to test DHHC5

palmitoylation effect on RGS9-2 GAP activity using polycistronic vectors.

Another method would be to gather more samples of HEK cells from different labs,

especially papers that claim a 50% internalization rate for transient D2L expressing HEK

cells, with the goal to find a HEK population that produces a D2L internalization rate closer

to 50%.

We could also pursue alternate cell types for investigating D2L internalization. In this

thesis we have already pursued two cell types, both of which failed to produce D2L surface

expression and internalization. CHO cells have been shown to express D2R and D2R

internalization. When we worked with them, we found that CHO cells were much more

adherent than HEK cells, and we did not observe significant wash-off during the entire

ELISA protocol. However, our transfection protocol did not work on our CHO cells. Thus

we did not further pursue this pathway, as we eventually were able to obtain consistent

internalization with HEK cells. It is also unsure whether transient D2L in CHO cells will

generate a larger dynamic range of internalization compared to D2L in our HEK cells.

However, we could pursue this cell line because the adherence of CHO cells may mean we

can use 48 or even 96 well plates instead of 24 well plates, making the ELISA assay much

more high-throughput.

PC12 cells were also pursued as an alternate to HEK cells, in an effort to find a controlled

environment that best mimics the endogenous tissue of D2L. Undifferentiated PC12 cells

70

mimic neural cells, and studies on MOR expression and internalization has been conducted

in PC12 (64). Transfection of both D2L-YFP and GFP-M2 in PC12 cells yielded very poor

transfection efficiency, with less than ~5% cells transfected. ELISA with D2L transient

PC12 cells also yielded very poor expression. Thus, we did not further pursue this cell type.

In the future it would be of interest to pursue this cell type as it is a neural-like cell type

that may provide a more endogenous environment for RGS9-2 – DHHC5 – D2L

interactions.

4.8.2 Alternate assays for quantifying D2L activity and RGS9-2 activity

RGS9-2 can potentially inhibit other aspects of D2L activity, as studies have shown that

D2L stimulation activates Gi/o mediated pathways such as inhibition of cAMP production

by AC, and Gβγ mediated pathways such as GIRK channel activation (113). If we cannot

produce an internalization protocol with an increased dynamic range for testing DHHC5

mediated RGS9-2 GAP activity, we can pursue other functional assays that quantify these

signalling pathways, such as whole-cell patch clamping to quantify GIRK activation, and

cAMP assays to quantify cAMP production.

Indeed, studies investigating RGS9-2 GAP activity and R7BP function have utilized these

alternative functional assays. R7BP has been shown to accelerate the activation and

deactivation kinetics of GIRK channels by Gβγ, and inhibition of R7BP palmitate turnover

leads to decreased interaction between R7BP and RGS9-2/Gβ5 as well as delayed GIRK

channel closing (79; 114). It would be worthwhile to establish a protocol to test whether

DHHC5 can increase GIRK channel closing in the presence of RGS9-2/Gβ5 and R7BP.

71

The direct signalling pathway of D2R-Gi/o is inhibition of cAMP production by AC5. Thus

a cAMP assay to quantify cAMP production is another viable functional assay to analyse

RGS9-2 GAP activity, and in turn observe DHHC5 mediated RGS9-2 activity.

Specifically, we will quantify inhibition of forskolin mediated cAMP production following

D2L stimulation with QNP (99). RGS9-2 has already been characterized as a regulator of

AC5 activity in striatal neurons, and was the most prominent inhibitor of AC activity and

cAMP production among all R7 RGS proteins (115). It would be worthwhile to investigate

whether DHHC5 co-expression will increase RGS9-2 inhibition of AC5 activity.

Aside from D2R, RGS9-2 also displays GAP activity to MOR, and studies have shown that

morphine treatment has a greater stimulatory and analgesic effect on RGS9-2 KO mice.

One group has shown that RGS9-2 co-expression inhibits DAMGO mediated MOR

internalization in PC12 cells (64). Thus. MOR internalization could be another functional

assay for quantifying DHHC5 modulation of RGS9-2 GAP activity. We have attempted to

express rat myc-MOR in HEK cells using X-tremeGene, but we could not detect any MOR

surface expression using the old protocol. We can re-attempt to express myc-MOR in our

HEK cells and see if we can detect surface expression and internalization.

Lastly, the BRET assay, which is used to detect interaction between two proteins, can be

used to quantify MOR activation through detecting dissociation of Gβγ from Gα after MOR

activation. A recent study has used the PM bound GRK3-Cterminal-RLuc as a reporter for

the amount of free Gβγ-Venus released after MOR agonist stimulation (71). The BRET

assay was able to detect an increase in Gβγ-Venus release upon morphine treatment, and

then a decrease in Gβγ-Venus signal baseline after subsequent antagonist Naxalone

treatment. Co-expression of chemically PM bound RGS9-2–Gβ5 increased the deactivation

72

rate of MOR after Naxalone treatment compared to control. This makes BRET another

viable assay for quantifying DHHC5 mediated RGS9-2 GAP activity. In the same assay,

we can co-express R7BP and DHHC5 with RGS9-2–Gβ5, and quantify the change in MOR

deactivation. We can also apply this BRET technique to D2L activation and deactivation,

and measure RGS9-2 GAP activity with DHHC5 co-expression. Due to the high number

of plasmids that will be co-transfected, we would need to create two polycistronic vectors,

one containing the RGS9-2 complex and DHHC5, the other vector containing the BRET

assay proteins GRK3-Cterminal-RLuc, Gβy-Venus, and Gα.

If DHHC5 does display a positive effect on RGS9-2 GAP activity, it would be interesting

to study its effect in cultured primary striatal neurons. Using patch clamp or calcium

imaging, we can quantify neural activity when we treat it with QNP or DA to activate D2R

signalling. We can then overexpress and knock-down DHHC5 expression by transfection

and siRNA, respectively, and observing any changes in neural signalling in response to

D2R stimulation. Ideally we would expect DHHC5 overexpression to inhibit D2R

signalling.

73

5. References

1.Yager,L.M.,Garcia,A.F.,Wunsch,A.M.,&Ferguson,S.M.(2015).Theinsandoutsof the striatum: role in drug addiction. Neuroscience, 301, 529-541.doi:10.1016/j.neuroscience.2015.06.033

2.Gainetdinov,R.R.,Premont,R.T.,Bohn,L.M.,Lefkowitz,R.J.,&Caron,M.G.(2004).DesensitizationofGprotein-coupledreceptorsandneuronalfunctions.AnnuRevNeurosci,27,107-144.doi:10.1146/annurev.neuro.27.070203.144206

3.Lorenz,M.,Hottenrott,C.,Seufert,R.M.,Kirkowa-Reimann,M.,&Encke,A.(1986).[Continuousintravenousorintra-arterialadministrationviaasubcutaneousimplantable infusion chamber. Preliminary clinical experiences withparticularreferencetointra-arterialchemotherapy].DtschMedWochenschr,111(20),772-779.doi:10.1055/s-2008-1068530

4. Cabrera-Vera, T. M., Vanhauwe, J., Thomas, T. O., Medkova, M., Preininger, A.,Mazzoni, M. R., & Hamm, H. E. (2003). Insights into G protein structure,function, and regulation.Endocr Rev, 24(6), 765-781. doi:10.1210/er.2000-0026

5. Neves, S. R., Ram, P. T., & Iyengar, R. (2002). G protein pathways. Science,296(5573),1636-1639.doi:10.1126/science.1071550

6.Ho,M. K., &Wong, Y.H. (2001). G(z) signaling: emerging divergence fromG(i)signaling.Oncogene,20(13),1615-1625.doi:10.1038/sj.onc.1204190

7.Jastrzebska,B.,Debinski,A.,Filipek,S.,&Palczewski,K.(2011).Roleofmembraneintegrity onG protein-coupled receptors: Rhodopsin stability and function.ProgLipidRes,50(3),267-277.doi:10.1016/j.plipres.2011.03.002

8. Kinnamon, S. C. (2012). Taste receptor signalling - from tongues to lungs.ActaPhysiol(Oxf),204(2),158-168.doi:10.1111/j.1748-1716.2011.02308.x

9. Riobo, N. A., & Manning, D. R. (2005). Receptors coupled to heterotrimeric Gproteins of the G12 family. Trends Pharmacol Sci, 26(3), 146-154.doi:10.1016/j.tips.2005.01.007

10.Offermanns,S. (2003).G-proteinsas transducers in transmembranesignalling.Prog Biophys Mol Biol, 83(2), 101-130. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/12865075

11.Narumiya,S.,Ishizaki,T.,&Watanabe,N.(1997).Rhoeffectorsandreorganizationof actin cytoskeleton. FEBS Lett, 410(1), 68-72. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/9247125

12.Riento,K.,&Ridley,A.J.(2003).Rocks:multifunctionalkinasesincellbehaviour.NatRevMolCellBiol,4(6),446-456.doi:10.1038/nrm1128

13.Simonds,W.F.,&Zhang,J.H.(2000).NewdimensionsinGproteinsignalling:Gbeta5andtheRGSproteins.PharmActaHelv,74(2-3),333-336. Retrievedfromhttp://www.ncbi.nlm.nih.gov/pubmed/10812978

14.Watson,A.J.,Katz,A.,&Simon,M.I.(1994).AfifthmemberofthemammalianG-proteinbeta-subunitfamily.Expressioninbrainandactivationofthebeta2isotype of phospholipase C. J Biol Chem, 269(35), 22150-22156. Retrievedfromhttp://www.ncbi.nlm.nih.gov/pubmed/8071339

74

15.Snow,B.E.,Krumins,A.M.,Brothers,G.M.,Lee,S.F.,Wall,M.A.,Chung,S., . . .Siderovski, D. P. (1998). A G protein gamma subunit-like domain sharedbetweenRGS11andotherRGSproteinsspecifiesbindingtoGbeta5subunits.Proc Natl Acad Sci U S A, 95(22), 13307-13312. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/9789084

16.Cabrera,J.L.,deFreitas,F.,Satpaev,D.K.,&Slepak,V.Z.(1998).IdentificationoftheGbeta5-RGS7proteincomplexintheretina.BiochemBiophysResCommun,249(3),898-902.doi:10.1006/bbrc.1998.9218

17.Zhang,J.H.,Pandey,M.,Seigneur,E.M.,Panicker,L.M.,Koo,L.,Schwartz,O.M.,...Simonds, W. F. (2011). Knockout of G protein beta5 impairs braindevelopment and causes multiple neurologic abnormalities in mice. JNeurochem,119(3),544-554.doi:10.1111/j.1471-4159.2011.07457.x

18.Chen,C.K.,Eversole-Cire,P.,Zhang,H.,Mancino,V.,Chen,Y.J.,He,W.,...Simon,M.I.(2003).InstabilityofGGLdomain-containingRGSproteinsinmicelackingtheGproteinbeta-subunitGbeta5.ProcNatlAcadSciUSA,100(11),6604-6609.doi:10.1073/pnas.0631825100

19.Simon,M. I.,Strathmann,M.P.,&Gautam,N.(1991).DiversityofGproteins insignal transduction. Science, 252(5007), 802-808. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/1902986

20.Ross,E.M.,&Wilkie,T.M.(2000).GTPase-activatingproteinsforheterotrimericGproteins:regulatorsofGproteinsignaling(RGS)andRGS-likeproteins.AnnuRevBiochem,69,795-827.doi:10.1146/annurev.biochem.69.1.795

21.Watson,N.,Linder,M.E.,Druey,K.M.,Kehrl,J.H.,&Blumer,K.J.(1996).RGSfamilymembers: GTPase-activating proteins for heterotrimeric G-protein alpha-subunits.Nature,383(6596),172-175.doi:10.1038/383172a0

22.Zheng,B.,DeVries,L.,&GistFarquhar,M.(1999).DivergenceofRGSproteins:evidencefortheexistenceofsixmammalianRGSsubfamilies.TrendsBiochemSci, 24(11), 411-414. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/10542401

23.Hamm,H.E.(1998).ThemanyfacesofGproteinsignaling.JBiolChem,273(2),669-672.Retrievedfromhttp://www.ncbi.nlm.nih.gov/pubmed/9422713

24. Strader, C. D., Fong, T. M., Tota, M. R., Underwood, D., & Dixon, R. A. (1994).StructureandfunctionofGprotein-coupledreceptors.AnnuRevBiochem,63,101-132.doi:10.1146/annurev.bi.63.070194.000533

25.Tobin,A.B. (2008).G-protein-coupledreceptorphosphorylation:where,whenand by whom. Br J Pharmacol, 153 Suppl 1, S167-176.doi:10.1038/sj.bjp.0707662

26.Benovic,J.L.,Kuhn,H.,Weyand,I.,Codina,J.,Caron,M.G.,&Lefkowitz,R.J.(1987).Functional desensitization of the isolated beta-adrenergic receptor by thebeta-adrenergic receptor kinase: potential role of an analog of the retinalproteinarrestin(48-kDaprotein).ProcNatlAcadSciUSA,84(24),8879-8882.Retrievedfromhttp://www.ncbi.nlm.nih.gov/pubmed/2827157

27.Premont,R.T.,Macrae,A.D.,Aparicio,S.A.,Kendall,H.E.,Welch,J.E.,&Lefkowitz,R. J. (1999). The GRK4 subfamily of G protein-coupled receptor kinases.Alternative splicing, gene organization, and sequence conservation. J Biol

75

Chem, 274(41), 29381-29389. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/10506199

28.Gurevich,E.V.,Tesmer, J. J.,Mushegian,A.,&Gurevich,V.V.(2012).Gprotein-coupled receptor kinases: more than just kinases and not only for GPCRs.PharmacolTher,133(1),40-69.doi:10.1016/j.pharmthera.2011.08.001

29.Lohse,M.J.,&Hoffmann,C.(2014).ArrestininteractionswithGprotein-coupledreceptors.HandbExpPharmacol,219,15-56.doi:10.1007/978-3-642-41199-1_2

30.Lohse,M.J.,Benovic,J.L.,Codina,J.,Caron,M.G.,&Lefkowitz,R.J.(1990).beta-Arrestin:aproteinthatregulatesbeta-adrenergicreceptorfunction.Science,248(4962), 1547-1550. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/2163110

31.Goodman,O.B.,Jr.,Krupnick,J.G.,Santini,F.,Gurevich,V.V.,Penn,R.B.,Gagnon,A.W., . . . Benovic, J. L. (1996). Beta-arrestin acts as a clathrin adaptor inendocytosis of the beta2-adrenergic receptor.Nature, 383(6599), 447-450.doi:10.1038/383447a0

32.Lefkowitz,R.J.,&Shenoy,S.K.(2005).Transductionofreceptorsignalsbybeta-arrestins.Science,308(5721),512-517.doi:10.1126/science.1109237

33. Shenoy, S. K., & Lefkowitz, R. J. (2011). beta-Arrestin-mediated receptortrafficking and signal transduction. Trends Pharmacol Sci, 32(9), 521-533.doi:10.1016/j.tips.2011.05.002

34.Perroy, J.,Pontier,S.,Charest,P.G.,Aubry,M.,&Bouvier,M. (2004).Real-timemonitoringofubiquitinationinlivingcellsbyBRET.NatMethods,1(3),203-208.doi:10.1038/nmeth722

35.Shenoy,S.K.,&Lefkowitz,R.J.(2003).Traffickingpatternsofbeta-arrestinandGprotein-coupled receptors determined by the kinetics of beta-arrestindeubiquitination. J Biol Chem, 278(16), 14498-14506.doi:10.1074/jbc.M209626200

36.Oakley,R.H.,Laporte,S.A.,Holt,J.A.,Barak,L.S.,&Caron,M.G.(1999).Associationof beta-arrestinwithGprotein-coupled receptors during clathrin-mediatedendocytosis dictates the profile of receptor resensitization. J Biol Chem,274(45), 32248-32257. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/10542263

37.Oakley,R.H.,Laporte,S.A.,Holt,J.A.,Caron,M.G.,&Barak,L.S.(2000).Differentialaffinitiesofvisualarrestin,betaarrestin1,andbetaarrestin2forGprotein-coupled receptors delineate two major classes of receptors. J Biol Chem,275(22),17201-17210.doi:10.1074/jbc.M910348199

38.DeWire,S.M.,Ahn,S.,Lefkowitz,R.J.,&Shenoy,S.K.(2007).Beta-arrestinsandcell signaling. Annu Rev Physiol, 69, 483-510.doi:10.1146/annurev.ph.69.013107.100021

39.Lindgren,N.,Usiello,A.,Goiny,M.,Haycock,J.,Erbs,E.,Greengard,P.,...Fisone,G.(2003). Distinct roles of dopamine D2L and D2S receptor isoforms in theregulationofproteinphosphorylationatpresynapticandpostsynapticsites.ProcNatlAcadSciUSA,100(7),4305-4309.doi:10.1073/pnas.0730708100

76

40.Gould,T.D.,&Manji,H.K.(2005).DARPP-32:Amolecularswitchatthenexusofreward pathway plasticity. Proc Natl Acad Sci U S A, 102(2), 253-254.doi:10.1073/pnas.0408700102

41. Kravitz, A. V., Tye, L. D., & Kreitzer, A. C. (2012). Distinct roles for direct andindirectpathwaystriatalneuronsinreinforcement.NatNeurosci,15(6),816-818.doi:10.1038/nn.3100

42. Paspalas, C. D., Rakic, P., & Goldman-Rakic, P. S. (2006). Internalization of D2dopamine receptors is clathrin-dependent and select to dendro-axonicappositions in primate prefrontal cortex.Eur J Neurosci, 24(5), 1395-1403.doi:10.1111/j.1460-9568.2006.05023.x

43.Caine,S.B.,Negus,S.S.,Mello,N.K.,Patel,S.,Bristow,L.,Kulagowski,J.,...Borrelli,E.(2002).RoleofdopamineD2-likereceptorsincocaineself-administration:studieswithD2receptormutantmiceandnovelD2receptorantagonists. JNeurosci,22(7),2977-2988.doi:20026264

44.Sim,H.R.,Choi,T.Y.,Lee,H.J.,Kang,E.Y.,Yoon,S.,Han,P.L.,...Baik,J.H.(2013).Role of dopamine D2 receptors in plasticity of stress-induced addictivebehaviours.NatCommun,4,1579.doi:10.1038/ncomms2598

45.Chausmer,A.L.,Elmer,G.I.,Rubinstein,M.,Low,M.J.,Grandy,D.K.,&Katz,J.L.(2002). Cocaine-induced locomotor activity and cocaine discrimination indopamineD2receptormutantmice.Psychopharmacology(Berl),163(1),54-61.doi:10.1007/s00213-002-1142-y

46.Welter,M.,Vallone,D.,Samad,T.A.,Meziane,H.,Usiello,A.,&Borrelli,E.(2007).AbsenceofdopamineD2 receptorsunmasks an inhibitory control over thebraincircuitriesactivatedbycocaine.ProcNatlAcadSciUSA,104(16),6840-6845.doi:10.1073/pnas.0610790104

47.Kramer,P.F.,Christensen,C.H.,Hazelwood,L.A.,Dobi,A.,Bock,R.,Sibley,D.R.,...Alvarez,V.A.(2011).DopamineD2receptoroverexpressionaltersbehaviorand physiology in Drd2-EGFP mice. J Neurosci, 31(1), 126-132.doi:10.1523/JNEUROSCI.4287-10.2011

48. Park, K., Volkow, N. D., Pan, Y., & Du, C. (2013). Chronic cocaine dampensdopaminesignalingduringcocaine intoxicationandunbalancesD1overD2receptor signaling. J Neurosci, 33(40), 15827-15836.doi:10.1523/JNEUROSCI.1935-13.2013

49. Thompson,D.,Martini, L., &Whistler, J. L. (2010). Altered ratio ofD1 andD2dopamine receptors in mouse striatum is associated with behavioralsensitization to cocaine. PLoS One, 5(6), e11038.doi:10.1371/journal.pone.0011038

50.Chen,H.,&Lambert,N.A.(2000).EndogenousregulatorsofGproteinsignalingproteins regulate presynaptic inhibition at rat hippocampal synapses.ProcNatlAcadSciUSA,97(23),12810-12815.doi:10.1073/pnas.230260397

51.Goldenstein,B.L.,Nelson,B.W.,Xu,K.,Luger,E.J.,Pribula,J.A.,Wald,J.M.,...Doze,V.A.(2009).RegulatorofGproteinsignalingproteinsuppressionofGalphaoprotein-mediated alpha2A adrenergic receptor inhibition of mousehippocampal CA3 epileptiform activity.Mol Pharmacol, 75(5), 1222-1230.doi:10.1124/mol.108.054296

77

52.Talbot,J.N.,Jutkiewicz,E.M.,Graves,S.M.,Clemans,C.F.,Nicol,M.R.,Mortensen,R. M., . . . Traynor, J. R. (2010). RGS inhibition at G(alpha)i2 selectivelypotentiates5-HT1A-mediatedantidepressanteffects.ProcNatlAcadSciUSA,107(24),11086-11091.doi:10.1073/pnas.1000003107

53.Gerber,K.J.,Squires,K.E.,&Hepler,J.R.(2016).RolesforRegulatorofGProteinSignalingProteinsinSynapticSignalingandPlasticity.MolPharmacol,89(2),273-286.doi:10.1124/mol.115.102210

54.Xie,K.,Ge,S.,Collins,V.E.,Haynes,C.L.,Renner,K.J.,Meisel,R.L.,...Martemyanov,K.A.(2012).Gbeta5-RGScomplexesaregatekeepersofhyperactivityinvolvedincontrolofmultipleneurotransmittersystems.Psychopharmacology(Berl),219(3),823-834.doi:10.1007/s00213-011-2409-y

55.Traynor,J.(2010).RegulatorofGprotein-signalingproteinsandaddictivedrugs.AnnNYAcadSci,1187,341-352.doi:10.1111/j.1749-6632.2009.05150.x

56.Celver,J.,Sharma,M.,&Kovoor,A.(2010).RGS9-2mediatesspecificinhibitionofagonist-induced internalization of D2-dopamine receptors. J Neurochem,114(3),739-749.doi:10.1111/j.1471-4159.2010.06805.x

57.Sondek,J.,&Siderovski,D.P.(2001).Ggamma-like(GGL)domains:newfrontiersin G-protein signaling and beta-propeller scaffolding. Biochem Pharmacol,61(11), 1329-1337. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/11331068

58.Martemyanov,K.A.,Lishko,P.V.,Calero,N.,Keresztes,G.,Sokolov,M.,Strissel,K.J., . . . Arshavsky, V. Y. (2003). The DEP domain determines subcellulartargeting of theGTPase activating proteinRGS9 in vivo. JNeurosci, 23(32),10175-10181. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/14614075

59. Slepak, V. Z. (2009). Structure, function, and localization of Gbeta5-RGScomplexes. Prog Mol Biol Transl Sci, 86, 157-203. doi:10.1016/S1877-1173(09)86006-7

60.Anderson,G.R.,Posokhova,E.,&Martemyanov,K.A.(2009).TheR7RGSproteinfamily:multi-subunitregulatorsofneuronalGproteinsignaling.CellBiochemBiophys,54(1-3),33-46.doi:10.1007/s12013-009-9052-9

61.Rahman,Z.,Gold,S.J.,Potenza,M.N.,Cowan,C.W.,Ni,Y.G.,He,W.,...Nestler,E.J. (1999). Cloning and characterization of RGS9-2: a striatal-enrichedalternativelysplicedproductoftheRGS9gene.JNeurosci,19(6),2016-2026.Retrievedfromhttp://www.ncbi.nlm.nih.gov/pubmed/10066255

62.Granneman,J.G.,Zhai,Y.,Zhu,Z.,Bannon,M.J.,Burchett,S.A.,Schmidt,C.J., . . .Cooper,J.(1998).MolecularcharacterizationofhumanandratRGS9L,anovelsplice variant enriched in dopamine target regions, and chromosomallocalizationoftheRGS9gene.MolPharmacol,54(4),687-694.Retrievedfromhttp://www.ncbi.nlm.nih.gov/pubmed/9765512

63.Thomas,E.A.,Danielson,P.E.,&Sutcliffe, J.G. (1998).RGS9:a regulatorofG-protein signalling with specific expression in rat and mouse striatum. JNeurosci Res, 52(1), 118-124. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/9556034

64.Psifogeorgou,K.,Papakosta,P.,Russo,S.J.,Neve,R.L.,Kardassis,D.,Gold,S.J.,&Zachariou,V.(2007).RGS9-2isanegativemodulatorofmu-opioidreceptor

78

function. J Neurochem, 103(2), 617-625. doi:10.1111/j.1471-4159.2007.04812.x

65.Rahman,Z.,Schwarz,J.,Gold,S.J.,Zachariou,V.,Wein,M.N.,Choi,K.H.,...Nestler,E.J.(2003).RGS9modulatesdopaminesignalinginthebasalganglia.Neuron,38(6), 941-952. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/12818179

66.Zachariou,V.,Georgescu,D.,Sanchez,N.,Rahman,Z.,DiLeone,R.,Berton,O., . . .Nestler,E.J.(2003).EssentialroleforRGS9inopiateaction.ProcNatlAcadSciUSA,100(23),13656-13661.doi:10.1073/pnas.2232594100

67.Gaspari,S.,Papachatzaki,M.M.,Koo,J.W.,Carr,F.B.,Tsimpanouli,M.E.,Stergiou,E.,...Zachariou,V.(2014).Nucleusaccumbens-specificinterventionsinRGS9-2activitymodulateresponsestomorphine.Neuropsychopharmacology,39(8),1968-1977.doi:10.1038/npp.2014.45

68.Garzon,J.,Lopez-Fando,A.,&Sanchez-Blazquez,P.(2003).TheR7subfamilyofRGS proteins assists tachyphylaxis and acute tolerance at mu-opioidreceptors. Neuropsychopharmacology, 28(11), 1983-1990.doi:10.1038/sj.npp.1300263

69.Martemyanov,K.A.,Yoo,P.J.,Skiba,N.P.,&Arshavsky,V.Y.(2005).R7BP,anovelneuronalproteininteractingwithRGSproteinsoftheR7family.JBiolChem,280(7),5133-5136.doi:10.1074/jbc.C400596200

70.Drenan,R.M.,Doupnik,C.A.,Boyle,M.P.,Muglia,L.J.,Huettner,J.E.,Linder,M.E.,& Blumer, K. J. (2005). Palmitoylation regulates plasmamembrane-nuclearshuttlingofR7BP,anovelmembraneanchorfortheRGS7family.JCellBiol,169(4),623-633.doi:10.1083/jcb.200502007

71. Muntean, B. S., & Martemyanov, K. A. (2016). Association with the PlasmaMembrane isSufficient forPotentiatingCatalyticActivityofRegulatorsofGprotein Signaling (RGS) Proteins of the R7 subfamily. J Biol Chem.doi:10.1074/jbc.M115.713446

72. Anderson, G. R., Semenov, A., Song, J. H., & Martemyanov, K. A. (2007). Themembrane anchor R7BP controls the proteolytic stability of the striatalspecific RGS protein, RGS9-2. J Biol Chem, 282(7), 4772-4781.doi:10.1074/jbc.M610518200

73.Anderson,G.R.,Lujan,R.,Semenov,A.,Pravetoni,M.,Posokhova,E.N.,Song,J.H.,. . . Martemyanov, K. A. (2007). Expression and localization of RGS9-2/G5/R7BP complex in vivo is set by dynamic control of its constitutivedegradationbycellularcysteineproteases.JNeurosci,27(51),14117-14127.doi:10.1523/JNEUROSCI.3884-07.2007

74. Anderson, G. R., Lujan, R., & Martemyanov, K. A. (2009). Changes in striatalsignalinginduceremodelingofRGScomplexescontainingGbeta5andR7BPsubunits.MolCellBiol,29(11),3033-3044.doi:10.1128/MCB.01449-08

75.Anderson,G.R.,Cao,Y.,Davidson,S.,Truong,H.V.,Pravetoni,M.,Thomas,M.J.,...Martemyanov,K.A.(2010).R7BPcomplexeswithRGS9-2andRGS7inthestriatum differentially control motor learning and locomotor responses tococaine. Neuropsychopharmacology, 35(4), 1040-1050.doi:10.1038/npp.2009.212

79

76.Terzi,D.,Cao,Y.,Agrimaki,I.,Martemyanov,K.A.,&Zachariou,V.(2012).R7BPmodulates opiate analgesia and tolerance but not withdrawal.Neuropsychopharmacology,37(4),1005-1012.doi:10.1038/npp.2011.284

77.Song, J.H.,Waataja, J. J.,&Martemyanov,K.A. (2006).Subcellular targetingofRGS9-2 is controlled bymultiplemolecular determinants on itsmembraneanchor, R7BP. J Biol Chem, 281(22), 15361-15369.doi:10.1074/jbc.M600749200

78. Jia, L., Linder, M. E., & Blumer, K. J. (2011). Gi/o signaling and thepalmitoyltransferaseDHHC2regulatepalmitatecyclingandshuttlingofRGS7family-binding protein. J Biol Chem, 286(15), 13695-13703.doi:10.1074/jbc.M110.193763

79.Jia,L.,Chisari,M.,Maktabi,M.H.,Sobieski,C.,Zhou,H.,Konopko,A.M.,...Blumer,K.J.(2014).AmechanismregulatingGprotein-coupledreceptorsignalingthatrequirescyclesofproteinpalmitoylationanddepalmitoylation. JBiolChem,289(9),6249-6257.doi:10.1074/jbc.M113.531475

80.Nadolski,M.J.,&Linder,M.E.(2007).Proteinlipidation.FEBSJ,274(20),5202-5210.doi:10.1111/j.1742-4658.2007.06056.x

81. Smotrys, J. E., & Linder,M. E. (2004). Palmitoylation of intracellular signalingproteins: regulation and function. Annu Rev Biochem, 73, 559-587.doi:10.1146/annurev.biochem.73.011303.073954

82.Resh,M.D.(2006).Palmitoylationofligands,receptors,andintracellularsignalingmolecules.SciSTKE,2006(359),re14.doi:10.1126/stke.3592006re14

83.Mitchell, D. A., Vasudevan, A., Linder,M. E., &Deschenes, R. J. (2006). Proteinpalmitoylation by a family of DHHC protein S-acyltransferases. J Lipid Res,47(6),1118-1127.doi:10.1194/jlr.R600007-JLR200

84.Putilina,T.,Wong,P.,&Gentleman,S.(1999).TheDHHCdomain:anewhighlyconservedcysteine-richmotif.MolCellBiochem,195(1-2),219-226.Retrievedfromhttp://www.ncbi.nlm.nih.gov/pubmed/10395086

85.Jennings,B.C.,&Linder,M.E.(2012).DHHCproteinS-acyltransferasesusesimilarping-pong kineticmechanisms but display different acyl-CoA specificities. JBiolChem,287(10),7236-7245.doi:10.1074/jbc.M111.337246

86.Ohno,Y.,Kihara,A.,Sano,T.,&Igarashi,Y.(2006).Intracellularlocalizationandtissue-specificdistributionofhumanandyeastDHHCcysteine-richdomain-containing proteins. Biochim Biophys Acta, 1761(4), 474-483.doi:10.1016/j.bbalip.2006.03.010

87. Thomas, G. M., Hayashi, T., Chiu, S. L., Chen, C. M., & Huganir, R. L. (2012).PalmitoylationbyDHHC5/8targetsGRIP1todendriticendosomestoregulateAMPA-R trafficking. Neuron, 73(3), 482-496.doi:10.1016/j.neuron.2011.11.021

88.Yang,W.,DiVizio,D.,Kirchner,M.,Steen,H.,&Freeman,M.R.(2010).ProteomescalecharacterizationofhumanS-acylatedproteinsinlipidraft-enrichedandnon-raft membranes. Mol Cell Proteomics, 9(1), 54-70.doi:10.1074/mcp.M800448-MCP200

89. Li, Y., Martin, B. R., Cravatt, B. F., & Hofmann, S. L. (2012). DHHC5 proteinpalmitoylates flotillin-2 and is rapidly degraded on induction of neuronal

80

differentiation in cultured cells. J Biol Chem, 287(1), 523-530.doi:10.1074/jbc.M111.306183

90.He,M.,Abdi,K.M.,&Bennett,V. (2014).Ankyrin-GpalmitoylationandbetaII-spectrinbindingtophosphoinositidelipidsdrivelateralmembraneassembly.JCellBiol,206(2),273-288.doi:10.1083/jcb.201401016

91.Brigidi,G.S.,Sun,Y.,Beccano-Kelly,D.,Pitman,K.,Mobasser,M.,Borgland,S.L.,... Bamji, S. X. (2014). Palmitoylation of delta-catenin by DHHC5 mediatesactivity-induced synapse plasticity. Nat Neurosci, 17(4), 522-532.doi:10.1038/nn.3657

92.Li,Y.,Hu,J.,Hofer,K.,Wong,A.M.,Cooper,J.D.,Birnbaum,S.G.,...Hofmann,S.L.(2010).DHHC5interactswithPDZdomain3ofpost-synapticdensity-95(PSD-95)proteinandplaysa role in learningandmemory. JBiolChem,285(17),13022-13031.doi:10.1074/jbc.M109.079426

93.Hilgemann,D.W.,Fine,M.,Linder,M.E.,Jennings,B.C.,&Lin,M.J.(2013).Massiveendocytosis triggered by surface membrane palmitoylation undermitochondrial control in BHK fibroblasts. Elife, 2, e01293.doi:10.7554/eLife.01293

94.Lin,M.J.,Fine,M.,Lu,J.Y.,Hofmann,S.L.,Frazier,G.,&Hilgemann,D.W.(2013).Massive palmitoylation-dependent endocytosis during reoxygenation ofanoxiccardiacmuscle.Elife,2,e01295.doi:10.7554/eLife.01295

95.Sutor,B.,&tenBruggencate,G.(1990).Ascorbicacid:ausefulreductanttoavoidoxidation of catecholamines in electrophysiological experiments in vitro?Neurosci Lett, 116(3), 287-292. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/2243607

96.Lam,V.M.,Beerepoot,P.,Angers, S.,&Salahpour,A. (2013).Anovelassay formeasurement of membrane-protein surface expression using a beta-lactamase.Traffic,14(7),778-784.doi:10.1111/tra.12073

97.Yamanushi,T.T.,Shui,Z.,Leach,R.N.,Dobrzynski,H.,Claydon,T.W.,&Boyett,M.R. (2007). Role of internalization of M2 muscarinic receptor via clathrin-coatedvesiclesindesensitizationofthemuscarinicK+currentinheart.AmJPhysiol Heart Circ Physiol, 292(4), H1737-1746.doi:10.1152/ajpheart.01287.2005

98.Pals-Rylaarsdam,R.,Xu,Y.,Witt-Enderby,P.,Benovic,J.L.,&Hosey,M.M.(1995).Desensitization and internalization of the m2 muscarinic acetylcholinereceptor are directed by independent mechanisms. J Biol Chem, 270(48),29004-29011. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/7499433

99.Masri,B.,Salahpour,A.,Didriksen,M.,Ghisi,V.,Beaulieu,J.M.,Gainetdinov,R.R.,&Caron,M.G.(2008).AntagonismofdopamineD2receptor/beta-arrestin2interaction isa commonpropertyof clinicallyeffectiveantipsychotics.ProcNatlAcadSciUSA,105(36),13656-13661.doi:10.1073/pnas.0803522105

100. Xiao,M. F., Xu, J. C., Tereshchenko, Y., Novak, D., Schachner,M., & Kleene, R.(2009).Neuralcelladhesionmoleculemodulatesdopaminergicsignalingandbehavior by regulating dopamine D2 receptor internalization. J Neurosci,29(47),14752-14763.doi:10.1523/JNEUROSCI.4860-09.2009

81

101.Kim,S.J.,Kim,M.Y.,Lee,E.J.,Ahn,Y.S.,&Baik,J.H.(2004).Distinctregulationofinternalization and mitogen-activated protein kinase activation by twoisoforms of the dopamine D2 receptor. Mol Endocrinol, 18(3), 640-652.doi:10.1210/me.2003-0066

102.Goggi,J.L.,Sardini,A.,Egerton,A.,Strange,P.G.,&Grasby,P.M.(2007).Agonist-dependentinternalizationofD2receptors:Imagingquantificationbyconfocalmicroscopy.Synapse,61(4),231-241.doi:10.1002/syn.20360

103.Basu,D.,Tian,Y.,Bhandari,J.,Jiang,J.R.,Hui,P.,Johnson,R.L.,&Mishra,R.K.(2013). Effects of the dopamine D2 allosteric modulator, PAOPA, on theexpressionofGRK2,arrestin-3,ERK1/2,andonreceptorinternalization.PLoSOne,8(8),e70736.doi:10.1371/journal.pone.0070736

104.Guo,N.,Guo,W.,Kralikova,M.,Jiang,M.,Schieren,I.,Narendran,R.,...Rayport,S. (2010). Impact of D2 receptor internalization on binding affinity ofneuroimaging radiotracers. Neuropsychopharmacology, 35(3), 806-817.doi:10.1038/npp.2009.189

105.Sedaghat,K.,Nantel,M.F.,Ginsberg,S.,Lalonde,V.,&Tiberi,M.(2006).Molecularcharacterization of dopamine D2 receptor isoforms tagged with greenfluorescentprotein.MolBiotechnol,34(1),1-14.doi:10.1385/MB:34:1:1

106.Spelsberg,T.C.,Ruh,T.,Ruh,M.,Goldberger,A.,Horton,M.,Hora,J.,&Singh,R.(1988).Nuclearacceptorsitesforsteroidhormonereceptors:comparisonsofsteroidsandantisteroids.JSteroidBiochem,31(4B),579-592.Retrievedfromhttp://www.ncbi.nlm.nih.gov/pubmed/3059057

107.Espinoza,S.,Salahpour,A.,Masri,B.,Sotnikova,T.D.,Messa,M.,Barak,L.S.,...Gainetdinov, R. R. (2011). Functional interaction between trace amine-associatedreceptor1anddopamineD2receptor.MolPharmacol,80(3),416-425.doi:10.1124/mol.111.073304

108.Peterson,S.M.,Pack,T.F.,Wilkins,A.D.,Urs,N.M.,Urban,D.J.,Bass,C.E., . . .Caron, M. G. (2015). Elucidation of G-protein and beta-arrestin functionalselectivity at thedopamineD2 receptor.ProcNatlAcad SciU SA, 112(22),7097-7102.doi:10.1073/pnas.1502742112

109. Thibault, D., Albert, P. R., Pineyro, G., & Trudeau, L. E. (2011). NeurotensintriggersdopamineD2receptordesensitizationthroughaproteinkinaseCandbeta-arrestin1-dependent mechanism. J Biol Chem, 286(11), 9174-9184.doi:10.1074/jbc.M110.166454

110.Gainetdinov,R.R.,Bohn,L.M.,Sotnikova,T.D.,Cyr,M.,Laakso,A.,Macrae,A.D.,...Premont,R.T.(2003).DopaminergicsupersensitivityinGprotein-coupledreceptor kinase 6-deficient mice.Neuron, 38(2), 291-303. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/12718862

111.Oda,Y.,Tadokoro,S.,Takase,M.,Kanahara,N.,Watanabe,H.,Shirayama,Y.,...Iyo,M.(2015).Gprotein-coupledreceptorkinase6/beta-arrestin2systemina rat model of dopamine supersensitivity psychosis. J Psychopharmacol,29(12),1308-1313.doi:10.1177/0269881115593903

112.Kabbani,N.,Jeromin,A.,&Levenson,R.(2004).Dynamin-2associateswiththedopamine receptor signalplex and regulates internalization of activatedD2receptors. Cell Signal, 16(4), 497-503. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/14709338

82

113. Beaulieu, J. M., & Gainetdinov, R. R. (2011). The physiology, signaling, andpharmacology of dopamine receptors. Pharmacol Rev, 63(1), 182-217.doi:10.1124/pr.110.002642

114.Zhou,H.,Chisari,M.,Raehal,K.M.,Kaltenbronn,K.M.,Bohn,L.M.,Mennerick,S.J., & Blumer, K. J. (2012). GIRK channel modulation by assembly withallostericallyregulatedRGSproteins.ProcNatlAcadSciUSA,109(49),19977-19982.doi:10.1073/pnas.1214337109

115.Xie,K.,Masuho,I.,Brand,C.,Dessauer,C.W.,&Martemyanov,K.A.(2012).ThecomplexofGproteinregulatorRGS9-2andGbeta(5)controlssensitizationandsignalingkineticsoftype5adenylylcyclaseinthestriatum.SciSignal,5(239),ra63.doi:10.1126/scisignal.2002922