Embed Size (px)
Citation preview
Developing Gene Therapy Methods to Inhibit a BAG Family Co-Chaperone Protein in Rat Substantia Nigra
by
Stanley Li
A thesis submitted in conformity with the requirements for the degree of Master of Science
Department of Laboratory Medicine & Pathobiology University of Toronto
© Copyright by Stanley Li 2016
ii
Developing Gene Therapy Methods to Inhibit a BAG Family Co-Chaperone Protein in Rat Substantia Nigra
Stanley Li
Master of Science
Department of Laboratory Medicine & Pathobiology University of Toronto
2016
Abstract
Parkinson’s disease (PD) is a progressive neurodegenerative disorder affecting
dopaminergic neurons in the substantia nigra (SN). Bcl2-associated athanogene 5 (BAG5) is a
co-chaperone that promotes dopaminergic cell death in animal models of PD and dopaminergic
degeneration. BAG5 also inhibits Hsp70 and parkin, which are protective in animal models of
PD, and interacts with several other proteins implicated in PD pathogenesis. Thus, BAG5
represents a promising therapeutic target for PD. This thesis describes the development of a viral
vector that can deliver shRNA against BAG5 to rat SN. We identified shRNAs that efficiently
knocked down BAG5 in two cell lines and packaged them into lentivirus (LV) and adeno-
associated virus (AAV) 1/2 vectors. AAV-shBAG5 demonstrated superior expression in SN
compared to LV. In rat SN, AAV-shBAG5 produced significant BAG5 knockdown and
protected neurons from axotomy injury. This work provides the foundation for future studies of
BAG5 knockdown in rat models of PD.
iii
Acknowledgments
I am pleased that my graduate studies have proven to be a challenging and worthwhile
endeavour. I reflect on the past two years with great appreciation for the many skills and insights
I have gained, about science and about myself. As my graduate school journey comes to a close,
I would like to especially acknowledge the following individuals who have made my experience
such a positive one:
• Dr. Suneil Kalia - For his endless patience and guidance in my pursuits both inside and
outside the lab. I have been extremely privileged to work with such an empathetic and
supportive supervisor.
• Hien Chau - For her technical expertise and advice, and for teaching me very nearly
everything I know about how to function in a lab.
• Drs. James Eubanks and Joel Watts, my committee members - For their constant
encouragement and valuable input on the direction of this project.
• Dr. Lorraine Kalia - For her help with developing the ImageJ method described in
Chapter 2, and for providing feedback on experiments.
• My parents and family - For their unwavering support and encouragement of my studies
in science.
iv
Contributions
Hien Chau - helped perform AAV injection and MFBx surgeries; contributed to Figs. 2, 3, 5, and
11
Drs. Darius Ebrahimi-Fakhari & Mustafa Sahin - contributed to Fig. 5
Christopher Lozano - contributed to Fig. 7
Erik Friesen - contributed to Fig. 11
Mitch de Snoo - helped perform AAV injection surgeries
Drs. Ornella Pellerito & Sherri Thiele - helped perform lentivirus injection surgeries
v
Table of Contents ACKNOWLEDGMENTS ......................................................................................................................... III
CONTRIBUTIONS ................................................................................................................................. IV
TABLE OF CONTENTS ............................................................................................................................ V
LIST OF ABBREVIATIONS ................................................................................................................... VIII
LIST OF FIGURES .................................................................................................................................. IX
LIST OF TABLES .................................................................................................................................... X
INTRODUCTION ................................................................................................................................... 1
0.1 PARKINSON’S DISEASE OVERVIEW ............................................................................................................ 1
0.2 GENE THERAPY FOR PARKINSON’S DISEASE ............................................................................................... 2
0.3 MEDIAL FOREBRAIN BUNDLE AXOTOMY .................................................................................................... 3
0.4 BAG PROTEINS .................................................................................................................................... 4
0.5 RATIONALE FOR TARGETING BAG5 ......................................................................................................... 6
0.6 RNA-‐TARGETING STRATEGIES FOR GENE INHIBITION THERAPY ...................................................................... 9
0.6.1 RNA interference ..................................................................................................................... 9
0.6.2 Antisense oligonucleotides .................................................................................................... 10
0.7 DNA-‐TARGETING STRATEGIES FOR GENE INHIBITION THERAPY .................................................................... 11
0.7.1 Cre/loxP recombination ......................................................................................................... 11
0.7.2 TALEN .................................................................................................................................... 12
0.7.3 Zinc finger nucleases .............................................................................................................. 13
0.7.4 CRISPR/Cas ............................................................................................................................ 13
0.8 VIRAL VECTORS FOR GENE DELIVERY ...................................................................................................... 14
0.8.1 Lentivirus ............................................................................................................................... 14
0.8.2 Adeno-‐associated virus .......................................................................................................... 15
0.9 RESEARCH OBJECTIVES ........................................................................................................................ 16
CHAPTER 1: GENERATION OF VIRAL VECTORS EXPRESSING BAG5-‐TARGETING SHRNA ...................... 17
1.1 INTRODUCTION .................................................................................................................................. 17
1.2 MATERIALS AND METHODS ................................................................................................................. 17
1.2.1 BAG5 shRNA plasmid construction ........................................................................................ 17
1.2.2 Cell culture and transfection .................................................................................................. 18
vi
1.2.3 Immunoblotting and analysis ................................................................................................ 18
1.2.4 Adeno-‐associated virus generation ....................................................................................... 19
1.2.5 Lentivirus generation ............................................................................................................. 19
1.2.6 Rat primary hippocampal neuron culture and infection ........................................................ 20
1.3 RESULTS ........................................................................................................................................... 20
1.3.1 Screen of candidate BAG5 shRNA plasmids ........................................................................... 20
1.3.2 Confirmation of top three candidate shRNA plasmids .......................................................... 27
1.3.3 Generation of AAV1/2 and lentivirus vectors expressing BAG5 shRNA ................................. 29
1.3.4 AAV-‐shBAG5 knocks down BAG5 in rat primary hippocampal neurons ................................ 29
1.4 DISCUSSION ...................................................................................................................................... 32
1.4.1 Choice of shRNA as gene inhibition strategy ......................................................................... 32
1.4.2 BAG5 antibody validation ...................................................................................................... 33
1.4.3 Transfection efficiency and interpretation of apparent knockdown ..................................... 33
1.4.4 Limitations of western blot and densitometry analysis ......................................................... 36
1.4.5 Alternative techniques to quantify knockdown ..................................................................... 36
CHAPTER 2: CHARACTERIZATION OF BAG5 SHRNA VIRAL VECTORS IN VIVO ...................................... 37
2.1 INTRODUCTION .................................................................................................................................. 37
2.2 MATERIALS AND METHODS ................................................................................................................. 38
2.2.1 Animals .................................................................................................................................. 38
2.2.2 Stereotactic injection of AAV or LV into rat SN ...................................................................... 38
2.2.3 Medial forebrain bundle axotomy ......................................................................................... 39
2.2.4 Processing of rat brains ......................................................................................................... 39
2.2.5 Immunofluorescence staining of rat brain sections for TH and BAG5 ................................... 39
2.2.6 Immunostaining of rat brain sections for TH and NeuN ........................................................ 40
2.2.7 Semi-‐quantification of BAG5 expression in SN using ImageJ ................................................. 41
2.2.8 Statistical analyses ................................................................................................................ 41
2.3 RESULTS ........................................................................................................................................... 43
2.3.1 AAV1/2 achieves greater expression in rat SN than LV ......................................................... 43
2.3.2 AAV-‐shBAG5 vectors express throughout SN at level of MTN ............................................... 45
2.3.3 AAV-‐shBAG5 vectors at 1/2 dilution knock down BAG5 in vivo ............................................. 47
2.3.4 AAV-‐shBAG5 vectors at 1/3 dilution knock down BAG5 in vivo ............................................. 51
2.3.5 AAV-‐shBAG5 vectors protect against MFBx injury ................................................................ 55
2.4 DISCUSSION ...................................................................................................................................... 57
vii
2.4.1 Rationale for selecting AAV1/2 serotype and injection titers ................................................ 57
2.4.2 Comparison of AAV to LV ....................................................................................................... 57
2.4.3 Spatial expression of AAV and analysis at level of MTN ........................................................ 58
2.4.4 ImageJ fluorescence semi-‐quantification method ................................................................. 60
2.4.5 Analysis of BAG5 knockdown in rat SN .................................................................................. 61
2.4.6 Alternative methods to measure BAG5 knockdown in vivo ................................................... 62
2.4.7 Potential toxicity from GFP overexpression ........................................................................... 63
2.4.8 Effects of AAV-‐shBAG5 on TH expression .............................................................................. 65
2.4.9 Effects of pre-‐injected AAV-‐shBAG5 following MFBx ............................................................. 66
CHAPTER 3: GENERAL DISCUSSION AND CONCLUSION ...................................................................... 67
3.1 SUMMARY ........................................................................................................................................ 67
3.2 LIMITATIONS ..................................................................................................................................... 68
3.3 FUTURE DIRECTIONS ........................................................................................................................... 69
3.3.1 Human A53T-‐SNCA overexpression model of PD ................................................................... 69
3.3.2 VenusYFP-‐SNCA bimolecular protein complementation system ............................................ 69
3.4 CONCLUSION ..................................................................................................................................... 70
REFERENCES ....................................................................................................................................... 71
viii
List of Abbreviations
AAV = adeno-associated virus ANOVA = analysis of variance AP = anteroposterior ASO = antisense oligonucleotide BAG5 = Bcl2-associated athanogene 5 BGH = bovine growth hormone bp = base pairs CBA = chicken beta actin CHIP = Carboxyl-terminus of Hsp70 interacting protein CMV = cytomegalovirus CRISPR = clustered regularly interspaced short palindromic repeats DAB = 3,3′-Diaminobenzidine DIV = days in vitro DSB = double stranded break dsRNA = double-stranded RNA DV = dorsoventral FACS = fluorescence activated cell sorting GAPDH = glyceraldehyde 3-phosphate dehydrogenase GDNF = glial cell line-derived neurotrophic factor GFP = green fluorescent protein gp/mL = genomic particles per milliliter HDR = homology-directed repair IRES = internal ribosomal entry site LRRK2 = Leucine-rich repeat kinase 2 LV = lentivirus MFB = medial forebrain bundle MFBx = medial forebrain bundle axotomy miRNA = micro RNA ML = mediolateral
MOI = multiplicity of infection MTN = medial terminal nucleus NHEJ = non-homologous end joining PBS = phosphate buffered saline PD = Parkinson’s disease PEI = polyethyleneimine PGK = phosphoglycerate kinase PINK1 = PTEN-induced putative kinase 1 pre-mRNA = precursor mRNA qPCR = quantitative polymerase chain reaction RISC = RNA-induced silencing complex RNAi = RNA interference ROI = region of interest SEM = standard error of the mean shRNA = short hairpin RNA siRNA = small interfering RNA SN = substantia nigra SNc = substantia nigra pars compacta SNr = substantia nigra pars reticulata SSB = single stranded break ssDNA = single-stranded DNA ssRNA = single-stranded RNA TALE = transcription activator-like effector TALEN = transcription activator-like effector nuclease TH = tyrosine hydroxylase VTA = ventral tegmental area WPRE = woodchuck post-transcriptional regulatory element ZFN = zinc finger nuclease αSyn = alpha synuclein
ix
List of Figures
Introduction
Figure 1: BAG5 interactors in Parkinson’s disease pathogenesis
Chapter 1: Generation of viral vectors expressing BAG5-targeting shRNA
Figure 2: Targeting location of candidate shRNAs along rat BAG5 mRNA transcript
Figure 3: Initial in vitro screen of knockdown efficiency of candidate BAG5 shRNAs
Figure 4: Confirmation of efficient BAG5 knockdown by top three shRNAs
Figure 5: Expression and BAG5 knockdown by AAV-shBAG5 in rat primary hippocampal
neurons
Chapter 2: Characterization of BAG5 shRNA viral vectors in vivo
Figure 6: Demonstration of ImageJ semi-quantification method
Figure 7: GFP expression from AAV vs. LV vectors in rat SN
Figure 8: AAV-shBAG5 coverage of SN at level of MTN
Figure 9: BAG5 knockdown in SN by AAV-shBAG5 at 1/2 dilution (5.5×1011 gp/mL)
Figure 10: BAG5 knockdown in SN by AAV-shBAG5 at 1/3 dilution (3.7×1011 gp/mL)
Figure 11: Effect of AAV-shBAG5 on TH and NeuN expression at 7 days post-MFBx
x
List of Tables
Chapter 1: Generation of viral vectors expressing BAG5-targeting shRNA
Table 1: BAG5 shRNA targeting sequences and positions
1
Introduction
0.1 Parkinson’s disease overview
Parkinson’s disease (PD) is a common and progressive neurodegenerative disorder that
affects 1% of people over age 601. With the aging population and increasing life expectancy, PD
is expected to become an even greater public health issue in the near future2.
PD is associated with the misfolding and aggregation of α-synuclein (αSyn) and the
accompanying loss of dopaminergic neurons in the substantia nigra pars compacta (SNc). After a
majority of these neurons are lost, motor symptoms including tremor, rigidity, bradykinesia, and
postural instability begin to manifest. PD patients often also experience a variety of other non-
motor symptoms, which include sleep disturbances, impulse control issues, and hallucinations2,3.
Most cases of PD are of unclear etiology (sporadic), but about 10% of cases are the result
of mutations in specific genes. Autosomal dominant PD can be caused by mutations in SNCA
(which encodes αSyn), LRRK2, VPS35, EIF4G1, DNAJC13, CHCHD2, and the recently
discovered TMEM2302,4. Parkin, PINK1, and DJ-1 are responsible for autosomal recessive PD.
The identification of these genes has shed light on the molecular events and systems involved in
PD pathogenesis, which include protein aggregation, the ubiquitin-proteasome system, the
lysosome-autophagy pathway, mitophagy, and synaptic function2.
Although dopamine replacement drugs and deep-brain stimulation can effectively treat
many of the motor symptoms, they do not change the progression of the disease2,5. Thus, the
development of disease-modifying and neuroprotective therapeutics remains an important goal of
PD research2,5.
2
0.2 Gene therapy for Parkinson’s disease
Gene therapy is a therapeutic technique in which nucleic acids are introduced into cells in
vivo to treat or prevent disease. It can be used to replace a mutated gene in monogenic disorders,
add gene(s) to help treat complex disorders, or modify endogenous gene expression by targeting
RNA6.
Gene therapy is a promising therapeutic strategy for PD. One gene therapy strategy that
has been explored in animal models of PD is to drive increased expression of neuroprotective
proteins. Many of these studies have reported favourable effects. Gene transfer of Hsp70 into SN
was found to protect dopaminergic neurons in mice treated with MPTP, a toxin that selectively
kills dopaminergic neurons7. Rocha et al found that glucocerebrosidase overexpression in SN
promoted clearance of αSyn aggregates and preserved dopaminergic neurons in both mice and
rats overexpressing human αSyn8. Promotion of the expression of growth factors such as
vascular endothelial growth factor9, glial cell-line derived neurotrophic growth factor (GDNF)10,
and neurturin (a GDNF family member)11, has also demonstrated protection of dopaminergic
neurons in SN in toxin-based animal models.
A different gene therapy strategy of reducing expression of harmful proteins using
shRNA has been investigated as well. In rat models of PD, targets for silencing have included
αSyn12,13, ROCK214, and interleukin-1 receptor15. One study using a human αSyn overexpression
model reported that knockdown of human αSyn rescued forelimb deficit, but also led to
enhanced dopaminergic cell death, possibly due to chronic shRNA (or GFP) expression12.
Another study found that knockdown of endogenous rat αSyn in the rotenone model of PD
preserved dopaminergic neurons and rescued forelimb deficit, without causing toxicity13. Saal et
al experimented with toxin-based models of PD and reported that shRNA against ROCK2
3
protected midbrain neurons, upregulated pro-survival markers, and improved motor behaviour14.
However, interleukin-1 receptor knockdown failed to demonstrate any therapeutic effect in the 6-
hydroxydopamine model of PD15.
Results from human clinical trials of gene therapy for PD are just beginning to emerge.
These trials have focused on expressing neurotrophic factors or neurotransmitter synthesis
enzymes, as the complex etiology of PD makes it difficult to pinpoint one defective gene to
target16. One study used AAV2 vector to bilaterally deliver glutamate decarboxylase I to the
subthalamic nucleus. It was found to be a safe procedure and resulted in a significant
improvement in clinical motor evaluations at 6 months after treatment17. A second clinical trial
used AAV2 to deliver neurturin to the putamen bilaterally. An initial group of 12 patients at one-
year follow-up demonstrated safety and some motor improvement18. A second group of patients
showed no significant improvement at 12 months post-treatment, but mild improvement at 18
months19. When the brains of four patients were analyzed post-mortem, very little neurturin
expression was detected in SN, thus highlighting a challenge of delivering gene therapy to a
structure that may be severely degenerated by the time treatment is initiated20. In an attempt to
improve expression in SN, additional patients were injected in both putamen and SN, but failed
to demonstrate motor improvement after 2 years19. A third study is currently recruiting patients
with advanced PD. It will aim to deliver GDNF bilaterally to the putamen using AAV2 and
follow up the patients for 5 years21.
0.3 Medial forebrain bundle axotomy
The medial forebrain bundle (MFB) is an anatomical structure containing several
different axon tracts, and in rat includes dopaminergic axons projecting from the SNc to the
striatum22. Medial forebrain bundle axotomy (MFBx) is a surgical procedure in which the axons
4
of the medial forebrain bundle are mechanically severed, resulting in retrograde degeneration of
dopaminergic neurons in SNc23. Weiser et al reported that, at seven days following unilateral
MFBx, the ipsilateral (transected side) SNc displayed 68% tyrosine hydroxylase (TH)
immunoreactivity compared to the contralateral control24. A similar study by Brecknell et al
reported a similar figure of 72%, again at 7 days post-MFBx25.
In the past, MFBx has been used to model PD in rats because it results in cell death of the
same cell population affected in PD26-28. Recently however, αSyn-overexpression models have
gained popularity, as they are believed to better represent some of the molecular features of PD
(i.e. presence of human αSyn)29-33. Nonetheless, MFBx remains a useful model of dopaminergic
cell death.
0.4 BAG proteins
The Bcl2-associated athanogene (BAG) family is a group of co-chaperone proteins that
function in cell growth and programmed cell death pathways34,35. The name comes from the
discovery of the first BAG protein, BAG1, which binds to B-cell lymphoma/leukemia 2 gene
(Bcl2). Bcl2 itself promotes cell survival and has been found to increase neuronal survival,
though its over-activation due to chromosomal translocations gives rise to cancer.
Six BAG proteins exist in humans: BAG1 through BAG634,35. Each BAG protein
contains one evolutionarily conserved 78-amino acid BAG domain near the C-terminus36, except
BAG5, which has four34,35,36 or possibly five37-39 BAG domains spread along its length34,35. BAG
proteins are nucleotide exchange factors for the Hsp70/Hsc70 family of molecular chaperones,
and BAG domains mediate direct interaction with the ATPase domain of Hsp70/Hsc7034,36.
Several other domains are also found within the different BAG proteins, allowing them to
interact with specific proteins or to be targeted to specific intracellular locales34,35.
5
There are four isoforms of BAG1 in humans: BAG1L, BAG1M, BAG1, and BAG1S, in
order from longest to shortest36. Among the isoforms, BAG1L is the only one to have a nuclear
localization signal at the N-terminus, so it is most likely found in the nucleus. BAG1 binding to
Hsc/Hsp70 stimulates nucleotide exchange, thus promoting chaperone activity. Each isoform
contains one ubiquitin-like domain that allows it to bring Hsc/Hsp70 chaperones to the
proteasome, suggesting a role for BAG1 in protein degradation36. BAG1 double knockout mice
were found to have dramatic apoptosis of the fetal liver and nervous system40. Recently, BAG1
overexpression in the red nucleus was found to protect neurons from dorsal hemisection injury41.
Thus, there is strong evidence for an anti-apoptotic role of BAG1.
BAG2 is overexpressed in some cancers and may promote tumour formation by
promoting the accumulation of other oncogenic mutations42. However, BAG2 may play a
different role in other contexts such as PD. In HEK293 cells, BAG2 inhibits C-terminus of
Hsp70 interacting protein (CHIP), which normally ubiquitylates αSyn, PINK1, and other
proteins for degradation43,44. In this fashion, BAG2 stabilizes PINK1 and promotes mitophagy43.
Although it inhibits CHIP-mediated ubiquitylation, BAG2 was found to promote ubiquitin-
independent Tau degradation45.
BAG3 expression is induced by oxidative and proteasome stress. BAG3 knockout mice
exhibit post-natal development issues, especially in muscle tissue, and die prematurely46. In
various cancer cell lines, BAG3 expression has been found to promote proliferation and enhance
resistance to anti-cancer drugs47,48. Recently, BAG3 was found to be important in autophagy
pathways. As human fibroblast cells aged, they switched from predominantly BAG1 to BAG3
expression, corresponding to a switch from proteasome to selective macroautophagy based
protein degradation49.
6
BAG4 is also called “silencer of death domain” and is well studied in cancer. It binds and
inhibits “death domains” found in some tumour necrosis factor receptors, thus promoting cancer
cell survival against radiation and anti-cancer drugs50,51.
BAG6 may be unique amongst the BAG proteins in that its BAG domain may lack
nucleotide exchange factor activity for Hsc70. Instead its BAG domain may help BAG6 form a
complex that regulates membrane protein degradation52. BAG6 inhibits Hsp70 protein refolding
activity and appears to regulate Hsp70 induction after heat shock53. It has been implicated in lung
cancer and multiple sclerosis54,55.
Unlike most other BAG proteins, several studies have suggested a pro-apoptotic function
for BAG5. It has been shown to directly interact with several molecules associated with PD
pathogenesis and it promotes dopaminergic cell death in two animal models of PD/dopaminergic
injury56. However, one recent study showed that BAG5 stabilized PINK1 by inhibiting its
ubiquitylation in HEK293 cells, and also protected mitochondria from oxidative stress by
upregulating PINK157. Nonetheless, another study also showed that BAG5 and BAG2 stabilized
pathogenic ataxin proteins by inhibiting their ubiquitylation, providing further evidence of the
role of BAG proteins in neurodegeneration42. BAG5 may play a different role in cancer, where it
was identified as a risk factor for non-Hodgkin’s lymphoma58. In prostate cancer patients, BAG5
was found to be overexpressed and inhibit ER-stress induced apoptosis38.
0.5 Rationale for targeting BAG5
BAG5 was originally discovered as a protein whose expression was upregulated in SNc
at 24 hours following dopaminergic neuron injury, via medial forebrain bundle axotomy
(MFBx), in rat56. Adenovirus-mediated overexpression of BAG5 in rat SN significantly
enhanced loss of TH immunoreactivity at 7 days post-MFBx56, suggesting a positive feedback
7
mechanism. Similarly, BAG5 overexpression in the MPTP mouse model of PD resulted in
greater amounts of TH loss at 2 weeks post-MPTP treatment, compared to controls56. These
animal experiments suggested that BAG5 could be a mediator of dopaminergic cell death.
BAG5 associates with several proteins that are mutated in familial forms of PD, including
parkin56,59, PINK157, and LRRK260. BAG5 directly interacts with parkin, sequesters it into
protein aggregates, and inhibits its E3 ligase activity, which is necessary for the controlled
removal of damaged mitochondria (mitophagy)56,59. In addition, BAG5 forms a complex with the
co-chaperone CHIP and αSyn, resulting in the inhibition of CHIP-mediated ubiquitylation of
αSyn, thus leading to increased αSyn oligomerization61. Furthermore, BAG5 has been identified
as an interactor of LRRK2, though the functional consequences are unclear60,62 (also see Fig. 1).
By inhibiting Hsp70 chaperone function56 and inhibiting the E3 ligase activity of
parkin56,59 and CHIP61, BAG5 negatively affects the molecular chaperone and ubiquitin-
proteasome systems, as well as the control of mitophagy, which are considered to be protective
in the contexts of PD and neurodegeneration63-66. Taken together with its role in mediating
dopaminergic cell death in vivo, BAG5 seems to be a common element in several pathways
relevant to PD, and thus represents a promising therapeutic target.
8
FIGURE 1.
Figure 1. BAG5 interactors and their involvement in pathways relevant to the pathogenesis
of Parkinson’s disease. BAG5 directly interacts with Hsp70, parkin, PINK1, and LRRK2. It
inhibits the chaperone activity of Hsp70 and also inhibits the E3 ligase activity of parkin56.
Through its interaction with Hsp70, BAG5 inhibits the E3 ligase activity of CHIP61. BAG5 also
stabilizes PINK1 by inhibiting its ubiquitylation57. Finally, BAG5 is a director interactor of
LRRK2, though the functional consequences of this interaction are unclear60. Also depicted:
PINK1 interacts with parkin to control mitophagy. CHIP ubiquitylates αSyn and reduces its
oligomerization (though this effect is inhibited by BAG5, through Hsp70)61. Molecular
chaperones (such as Hsp70) refold misfolded proteins (such as αSyn) and prevent their
aggregation.
9
0.6 RNA-targeting strategies for gene inhibition therapy
One approach to inhibiting gene expression in a biological system is to target mRNA
transcripts before they can be translated into protein. With this approach, since the gene itself is
not targeted, the risk of chromosomal mutation/damage is avoided, and inhibition is reversible.
The main technologies for RNA-targeting gene inhibition are short hairpin and small interfering
RNAs (via the endogenous RNA interference pathway) and antisense oligonucleotides.
0.6.1 RNA interference
RNA interference (RNAi) is a naturally occurring pathway that modulates gene
expression through small RNA molecules, including the endogenous micro RNAs (miRNA)67.
The RNAi machinery can be exploited to reduce expression of a specific target gene by adding
exogenous small RNAs, either in the form of short hairpin RNA (shRNA) or small interfering
RNA (siRNA).
Short hairpin RNAs consist of a 19-29 base pair stem region that is linked by a single-
stranded RNA loop of 4 or more nucleotides, plus a 2-nucleotide 3’ overhang68. In the RNAi
pathway, shRNAs are processed by two ribonucleases, Drosha and Dicer. Then, from the
remaining 19-29 bp double-stranded RNA molecule (dsRNA) the sense (or passenger) strand is
degraded and the antisense (or guide) strand is loaded into the RNA-induced silencing complex
(RISC)68. The guide strand directs RISC to bind and cleave mRNA transcripts that are fully
complementary to the loaded guide strand. The cleaving is performed by the endonuclease
Argonaute, a component of RISC67,68. The similar siRNAs are artificial short dsRNA molecules
designed to enter the RNAi pathway at the post-Dicer processing point and subsequently reduce
expression of a target protein.
10
siRNAs are well suited for transient knockdown conditions in vitro because it is
relatively cheap to synthesize and transfect siRNAs into cultured cells. For in vivo applications,
siRNAs can struggle to avoid degradation and enter cells, and they must be constantly resupplied
as they are (inefficiently) consumed69. Viral vector-delivered shRNA can be a more sustainable
strategy in the long term, as it provides long-lasting silencing of a target gene, and the viral
vector allows for more efficient and controlled delivery.
0.6.2 Antisense oligonucleotides
Antisense oligonucleotides (ASO) are synthetic nucleic acids, 8-50 nucleotides in length,
which are designed to bind to complementary RNA in order to alter gene expression70. ASOs
may operate through a variety of mechanisms, which may or may not lead to degradation of the
target RNA. Unlike RNAi, ASOs can also target precursor mRNA (pre-mRNA) in the nucleus,
before it has been exported and matured into mRNA. For instance, ASOs can bind near a splice
site in pre-mRNA, causing exons to be skipped or included. They may also bind close to the 3’
end of the pre-mRNA and modulate polyadenylation70,71. ASO binding on mature mRNA can
lead to translation inhibition, and binding on either pre-mRNA or mature mRNA can recruit
various nucleases that lead to transcript degradation70,71.
One of the challenges facing in vivo use of ASOs is the natural instability of unmodified
nucleic acids, due to the ubiquitous expression of nucleases. The chemical structure of ASOs
may be modified in several different ways in order to improve nuclease stability71,72. Some
modifications target the phosphate group in the backbone (swapping it for a sulfur-containing
group) or the ribose/deoxyribose sugar (tagging it with additional functional groups or fusing it
to a second ring that restricts conformation)71,72. A more extreme possibility is to produce nucleic
acid mimics. These mimics can be either morpholinos (in which pentose sugars are replaced by
11
morpholine rings) or peptide nucleic acids (in which the sugar-phosphate backbone is replaced
by a polypeptide backbone)70-72. Another challenge is to deliver ASOs to the target cells in the
body. This is usually attempted by attaching the ASOs to a ligand of, or antibody against, a target
cell-surface receptor to allow the ASO to enter via receptor-mediated endocytosis70.
0.7 DNA-targeting strategies for gene inhibition therapy
Rather than targeting RNA transcripts, genes themselves can be targeted in order to
delete or silence the target gene, or to replace the target gene with an exogenously supplied DNA
sequence. These alterations to the genome are mostly irreversible. The main technologies for
gene editing are either recombinases (Cre/loxP system), or customizable nucleases (TALENs,
zinc finger nucleases, CRISPR/Cas system) followed by endogenous DNA repair mechanisms.
0.7.1 Cre/loxP recombination
The Cre/loxP system, derived from machinery in P1 bacteriophage, uses Cre recombinase
to create a targeted recombination event between two 34-bp loxP sites in the genome73.
Depending on the positions and directionality of the loxP sites, the recombination event may
result in deletion or inversion of the interspacing DNA, or translocation (if the loxP sites are on
different DNA molecules)74,75. Several variations on the Cre/loxP setup make it quite flexible.
Target genes can be silenced or overexpressed, either in the presence or absence of Cre
expression. Genes can also be knocked in when Cre is present, via translocation or inversions.
Additionally, Cre expression can be made inducible or tissue-specific by placing it under the
control of various promoters, or it can be supplied via viral vectors74. The major disadvantage of
the Cre/loxP system is that it requires loxP sites to be inserted at the desired locations, resulting
in relatively long turnaround times as cell lines or transgenic organisms (usually mice) are
prepared74. In addition, it is difficult to accurately achieve multiple Cre/loxP recombination
12
events in the same cell since there would be many possible combinations of pairings between
multiple loxP sites.
The FLP-FRT recombination system, derived from machinery in yeast, can also produce
targeted recombination events. It is conceptually similar to Cre/loxP76.
0.7.2 TALEN
Transcription Activator-Like Effector (TALE) proteins are DNA-binding proteins found
in several bacterial species. TALEs can be reprogrammed to bind any DNA sequence, as their
binding specificity is conferred by just two amino acids in each DNA binding domain (DBD)67.
Customized TALEs can be fused to effector domains such as transcriptional repressors or
endonucleases (creating TALE nucleases, or TALENs) to precisely direct the activity of the
fused proteins. A particularly useful TALEN is the fusion of TALEs to FokI endonuclease,
which functions only as a dimer and has separate binding and cleavage sites67,77. The
combination of two different TALEs that target adjacent sites on DNA can bring together two
FokI to create a double-stranded break (DSB) at a highly specific target sequence67,77.
DSBs are repaired with one of two endogenous and competing repair mechanisms: non-
homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ is an error-prone
repair mechanism, resulting in frameshift (functional deletion) 2/3 of the time, and potential
insertions/deletions the other 1/3 of the time. Thus it can result in genetic and phenotypic
heterogeneity, and the outcome may be difficult to predict67. On the other hand, HDR is a high
fidelity repair system, but requires a template that shares homology with the area around the
DSB. This template may be the other allele or an exogenously supplied homologous donor DNA
sequence. In the latter case, a precise sequence can be inserted to bridge the DSB. While
13
TALENs are very specific with low off-target effects, it is expensive and time-consuming to
design TALEs for each custom target78.
0.7.3 Zinc finger nucleases
Zinc finger nucleases (ZFNs) are artificial restriction enzymes, formed by fusing
eukaryotic transcription factors with a Cys2-His2 zinc-finger DNA binding domain and FokI67.
These DBDs bind DNA three nucleotides apart, and can be placed in tandem to confer better
specificity for a target DNA sequence79. Otherwise, ZFNs are conceptually similar to TALENs,
though generally more difficult to program and less specific78.
With either ZFNs or TALENs, one of the FokI domains can be mutated to inactivate its
endonuclease activity. This creates a TALEN or ZFN “nickase” that generates a single-stranded
break (SSB) at the target location67,77. SSBs are repaired by HDR and not NHEJ, thus avoiding
some of the challenges with NHEJ such as unintentional mutations and increased risk of
apoptosis77.
0.7.4 CRISPR/Cas
CRISPR (clustered regularly interspaced short palindromic repeats)/Cas (CRISPR
associated protein) is a system found in the genome of bacteria and archaea that provides
adaptive immunity against foreign nucleic acids80. Unlike the protein domain-based binding of
TALENs and ZFNs, the CRISPR/Cas system uses a guide RNA to target the nuclease to the
target DNA site. It therefore has the major advantage of being easier to program to target custom
DNA sequences78,81.
The Cas9 endonuclease is most commonly used for CRISPR gene editing81. It contains
two nuclease domains and functions as a monomer, causing a DSB at the target location. Though
14
ZFNs and TALENs are more specific than normal Cas967, Cas9 specificity can be improved in a
few ways. For instance, one of its nuclease domains can be inactivated, producing a Cas9 nickase
that may be paired with a second Cas9 nickase. Alternatively, both of Cas9’s nuclease domains
can be inactivated to produce dCas9, which can then be fused to FokI domains. dCas9 can also
be fused to transcriptional activators or repressors for additional control of gene expression81,82.
0.8 Viral vectors for gene delivery
In recent years, many viruses have been modified for in vivo gene therapy applications,
including lentivirus and adeno-associated virus (AAV)83. Compared to physical or chemical
delivery methods, viral vectors provide superior transduction efficiency, allow for better
targeting, and naturally protect the gene product from nuclease degradation83. However, viral
vectors have a genomic size limit, may induce an immune response, and can be costly.
0.8.1 Lentivirus
Lentivirus (LV) is an enveloped ssRNA virus that has the unique ability among
retroviruses to integrate into non-dividing cells such as neurons. It has strong tropism (i.e.
tendency/ability to transduce) toward neural stem cells83. Lentivirus tropism can be modified by
pseudotyping, a process in which lentivirus particles are generated with glycoproteins from other
enveloped viruses. One of the most popular lentivirus pseudotypes uses vesicular stomatitis virus
glycoprotein (VSV-G), resulting in very broad tropism, including neurons84. Lentivirus has the
advantage of being able to deliver a relatively larger genomic payload of 8kb of RNA to infected
cells83. These features of lentivirus, combined with its low immunogenicity and lack of side
effects83, have made it a popular and effective gene therapy vector in CNS applications in animal
experiments85.
15
0.8.2 Adeno-associated virus
AAV vectors have been another popular choice for gene therapy. They are non-
enveloped ssDNA viruses that can transduce a wide range of dividing and non-dividing cells and
produce long-lasting transgene expression16. AAVs can deliver up to 4.8kb of DNA86. Upon
infection, AAV can either persist as a double-stranded episome or integrate into the host genome,
most often at the AAVS1 site on chromosome 1916,83,86. AAVs are not associated with any
disease, exhibit very low immunogenicity, and cannot replicate except in the presence of a helper
virus (usually adenovirus), making them safe for human therapeutic applications16,83.
AAV tropism is determined by its serotype, or type(s) of capsid protein expressed.
Different capsid proteins bind to specific mammalian cell surface receptors87. There are 11
natural AAV serotypes, but many hybrid serotypes (expressing capsid proteins from two
different serotypes) and other variants have been generated, allowing for custom tropism16,87.
Most AAV serotypes, but especially AAV1, 2, and 5, show strong neuronal tropism when
injected into the brain16. AAV4 preferentially transduces ependymal cells, while AAV9 exhibits
both neuronal and astrocytic tropism and has the unique ability to cross the blood-brain barrier16.
To date, AAV2 has been the vector of choice in both human and animal studies of gene therapy
in PD, mainly due to its historical safety record. For gene therapy applications, improved control
of spatiotemporal expression can be achieved through the appropriate selection of AAV
serotype, promoter, and injection strategy (i.e. systemic vs. targeted).
16
0.9 Research Objectives
The principal aim of this study is to develop and characterize an shRNA-expressing viral
vector that can achieve efficient knockdown of BAG5 expression in the rat substantia nigra.
Chapter 1: Generation of viral vectors expressing BAG5-targeting shRNA.
The first chapter of this thesis describes the identification of several shRNAs that
efficiently knock down rat BAG5 protein expression in two cell lines. Following this
identification AAV and lentivirus vectors that express these shRNAs were generated for in vivo
applications, as discussed in Chapter 2.
Chapter 2: Characterization of viral expression, target engagement, and biological
consequences of BAG5 knockdown in vivo.
The second chapter of this thesis focuses on interrogating the effects of the viral vectors
generated in Chapter 1 (especially the AAV) when injected into the rat substantia nigra. The
effects of AAV-shRNA driven BAG5 knockdown in the context of SN dopaminergic neuron
injury are also investigated.
17
Chapter 1: Generation of viral vectors expressing BAG5-1targeting shRNA
1.1 Introduction
This chapter describes the process of designing and generating two viral vectors, adeno-
associated virus and lentivirus, which express BAG5-targeting shRNA and GFP as an expression
marker. It begins by detailing the initial screen of several candidate BAG5 shRNA target
sequences in two cell lines and concludes with the generation and confirmation of AAV
infectivity in primary neurons. Subsequent in vivo experiments are covered in Chapter 2.
1.2 Materials and Methods
1.2.1 BAG5 shRNA plasmid construction
All plasmids from Origene were constructed to express shRNA under control of the U6
promoter and GFP under the CMV (cytomegalovirus) promoter. The plasmids also contained the
puromycin resistance gene under the SV40 promoter.
All Creative Biogene plasmids were constructed to express shRNA under control of the
U6 promoter and GFP under the CMV promoter. The plasmids also contained the puromycin
resistance gene under the PGK (phosphoglycerate kinase) promoter.
All Genecopoeia plasmids were constructed to express shRNA under control of the U6
promoter and both GFP and puromycin resistance under the SV40 promoter, using an
intervening IRES (internal ribosomal entry site) sequence.
Targeting sequences for each of the shRNAs are found in Table 1.
18
1.2.2 Cell culture and transfection
Rat pheochromocytoma PC12 cells were maintained in RPMI (Roswell Park Memorial
Institute) 1640 medium supplemented with 10% FCS (fetal calf serum), penicillin (100
units/mL), streptomycin (100 µg/mL), and amphotericin B (250 ng/mL). Human embryonic
kidney (HEK) 293T cells were maintained in DMEM (Dulbecco’s Modified Eagle Medium)
supplemented with 10% FCS (fetal calf serum), penicillin (100 units/mL), streptomycin (100
µg/mL), and amphotericin B (250 ng/mL). All cells were incubated at 37°C in a humidified air
atmosphere containing 5% carbon dioxide.
HEK and PC12 cells were plated on 6-well plates (1,000,000 cells/well for HEK;
2,000,000 cells/well for PC12) in antibiotic/antimycotic-free media. Cells were transfected with
1.5µg of plasmid DNA at 24 hours after plating (1.5µg each of shRNA and rat BAG5 plasmid for
HEK cells), using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol.
Media was replaced with fresh media at 24 hours post-transfection. Cells were harvested 48
hours post-transfection in RIPA (radioimmunoprecipitation assay) buffer containing protease
inhibitor cocktail (Roche).
1.2.3 Immunoblotting and analysis
Cells were (re-) suspended and lysed in RIPA buffer containing protease inhibitor
cocktail (Roche). Protein concentrations were determined using the DC Protein Assay (Bio-Rad).
Equal amounts of protein were loaded and run through sodium dodecyl sulfate (SDS)
polyacrylamide gels by electrophoresis, followed by wet transfer to polyvinylidene fluoride
(PVDF) membranes. Membranes were probed with anti-BAG5 antibody from mouse (Santa
Cruz, cat. #ab56738) diluted at 1:200 (for endogenous BAG5 in PC12 cells) or 1:1000 (for
exogenous rat FLAG-BAG5 in HEK cells), and with anti-GAPDH antibody from rabbit (Cell
19
Signaling, cat. #2118) diluted at 1:1000. Membranes were then probed with secondary anti-
mouse IgG or anti-rabbit IgG linked to horseradish peroxidase (Cell Signaling) diluted at 1:5000.
Detection was performed with the enhanced chemiluminescence (ECL) method (Pierce) for
GAPDH and with ECL+ (Pierce) for BAG5. Relative protein expression was determined by
western blot densitometry (with background subtraction), with GAPDH serving as the loading
control. Transfection efficiencies were assumed to be the same across all conditions, thus the
bands were not normalized for transfection efficiency.
1.2.4 Adeno-associated virus generation
Adeno-associated virus 1/2 vectors were custom ordered from GeneDetect Ltd.
(Auckland, New Zealand). Each vector expresses GFP under the control of the chicken beta actin
(CBA) promoter hybridized with the CMV immediate early enhancer sequence. These vectors
also include a woodchuck post-transcriptional regulatory element (WPRE) and a bovine growth
hormone (BGH) polyadenylation sequence to improve protein expression. Each vector also
expresses either Origene non-targeting Control, Origene C, or Genecopoeia G1 shRNA against
BAG5, under the U6 promoter. Stock viral titers were determined by quantitative PCR to be
1.1×1012 genomic particles/mL for all AAVs.
1.2.5 Lentivirus generation
Lentivirus vectors were custom ordered from the UHN Vector Core (Toronto, Canada).
Each vector expresses either Origene non-targeting Control or Origene B shRNA under the U6
promoter, and also GFP under the CMV promoter. Stock viral titers were determined to be
9.0×107 IU/mL.
20
1.2.6 Rat primary hippocampal neuron culture and infection
Dissociated E18.5 rat hippocampal neurons were obtained and cultured as previously
described by Nie & Sahin88. In brief, rats were euthanized with CO2 and embryos were
recovered. Hippocampi and cortices were dissected and placed in chilled dissociation medium
(Ca2+-free HBSS with 100mM MgCl2, 10mM kynurenic acid (Sigma-Aldrich), and 100mM
HEPES). Following enzymatic dissociation with papain (Worthington Biochemical Corporation)
and L-cysteine (Sigma-Aldrich), trypsin inhibitor (Sigma-Aldrich) was added, and cell clumps
were dissolved by trituration. Neurons were suspended in Neurobasal medium supplemented
with B-27, L-glutamine, and penicillin/streptomycin/primocin, and plated at a density of 1x106
per well in 6-well plates coated overnight with 20µg/ml poly-D-lysine (Sigma-Aldrich) and
3.5µg/mL laminin. At 2 days in vitro (DIV), neurons were infected with AAV vectors at an MOI
of 2×104 in a volume of 1 mL of conditioned medium. Half the medium was replaced with fresh
medium on DIV5. On DIV8, cells were washed with cold PBS, collected in 500uL PBS and
pelleted by centrifugation at 500g for 5 minutes at 4°C. Cell lysates were prepared for western
blot as described previously (Section 1.2.3). Unless stated otherwise, all reagents were purchased
from Thermo Fisher Scientific. This experiment (except western blot) was performed by Dr.
Darius Ebrahimi-Fakhari in Dr. Mustafa Sahin’s lab at Boston Children’s Hospital, Harvard
Medical School (Boston, MA, USA).
1.3 Results
1.3.1 Screen of candidate BAG5 shRNA plasmids
Thirteen potential rat BAG5-targeting shRNA sequences and plasmids were generated
from three vendors in order to increase our chances of identifying efficient shRNA clones. Based
on the vendors, these shRNAs were termed Origene A through D, Creative Biogene 1 through 4,
21
and Genecopoeia G1, G4, G12, G13, and G14. Each candidate shRNA targeted a different site
along the rat BAG5 mRNA transcript, within the open reading frame (ORF) (Fig. 2). None of the
candidate shRNAs were located near a splice site; rat BAG5 has a single splice site located in the
5’ UTR (Ensembl genome browser89).
Candidate shRNAs were screened for ability to knock down BAG5 in two cell lines, and
several promising shRNA sequences were identified. In rat pheochromocytoma PC12 cells
(adrenal gland tumour; expresses endogenous rat BAG5), all four shRNA plasmids from Origene
(clones A through D) generated substantial BAG5 knockdown 48h after transfection (Fig. 3A).
Compared to control shRNAs, transfection with these targeting clones resulted in a proportion of
BAG5 protein levels as follows (reported as mean ± standard deviation): Origene A (0.65 ±
0.18); Origene B (0.60 ± 0.23); Origene C (0.64 ± 0.27); Origene D (0.42 ± 0.07). All data are
presented after removal of outliers using Grubbs’ test. Transfection efficiency for PC12 cells was
observed to be roughly 30% (estimated proportion of GFP+ cells 48h post-transfection, based on
visual inspection).
In human embryonic kidney (HEK) cells co-transfected with rat BAG5 and the candidate
shRNA plasmids, substantial BAG5 knockdown was achieved 48 hours post-transfection by all
four Origene clones, as well as Creative Biogene clone 2 and Genecopoeia clone G1 (Fig. 3B).
Compared to controls, transfection with these targeting clones resulted in the following
proportions of BAG5 protein levels: Origene A (0.69 ± 0.23); Origene B (0.71 ± 0.28); Origene
C (0.51 ± 0.13); Origene D (0.35 ± 0.12); Creative Biogene 2 (0.59 ± 0.15); Genecopoeia G1
(0.46 ± 0.28). All data are presented after removal of outliers using Grubbs’ test. Transfection
efficiency for HEK cells was observed to be roughly 70% (estimated proportion of GFP+ cells
48h post-transfection, based on visual inspection).
22
When the results from PC12 and HEK transfections are combined (Fig. 3C), again BAG5
knockdown was observed by all four Origene clones, Creative Biogene clone 2, and
Genecopoeia clone G1. Compared to controls, transfection with these targeting clones resulted in
the following proportions of BAG5 protein levels: Origene A (0.67 ± 0.19); Origene B (0.66 ±
0.25); Origene C (0.57 ± 0.20); Origene D (0.37 ± 0.10); Creative Biogene 2 (0.79 ± 0.29);
Genecopoeia G1 (0.71 ± 0.48).
Origene D produces the most efficient knockdown in both PC12 and HEK cells. The
other three Origene clones were also efficient at knocking down BAG5 in either cell line. Clone
C in particular was quite effective at knocking down exogenous BAG5 in HEK cells, though not
quite as well as clone D. None of the four targeting shRNAs from Creative Biogene were able to
produce reliable endogenous BAG5 knockdown in PC12 cells. In HEK cells, Creative Biogene
clone 2 showed some knockdown of exogenous BAG5, though the magnitude of knockdown was
less than that produced by Origene C, Origene D, and Genecopoeia G1. The other Creative
Biogene clones displayed either lack of efficiency or lack of reliability in HEK cells. None of the
five Genecopoeia shRNAs were able to reliably knock down BAG5 in either PC12 or HEK cells,
with the exception of G1 in the HEK condition.
Origene C, Origene D, and Genecopoeia G1 were selected as the three most promising
candidate shRNAs. Although G1 showed similar overall efficiency (combined PC12 and HEK
results) as Origene A and B, we chose to not select three shRNAs from a single vendor in order
to avoid potential vendor-wide problems. Furthermore, despite the poor performance of G1 in
PC12 cells, it displayed the second greatest average knockdown efficiency in HEK cells, just
behind Origene D. This suggested that it may be quite effective at knocking down BAG5 under
some conditions, and may have potential for our subsequent in vivo applications.
23
TABLE 1.
BAG5 shRNA targeting sequences and positions
shRNA Targeting sequence (5’ to 3’) Target position on rat BAG5
mRNA
5’ 3’
Orig
ene
Control GCACTACCAGAGCTAACTCAGATAGTACT No match
A ACTGATAAGAACTACATTCGTCTGGAGGA 1308 1336
B ACACAGAACGCCTTCTCAAAGAGTTGGAG 358 386
C AGACTGGAGAGGATTCTGACGAAACAACT 258 286
D GTGCATCCTTCTGTCGCCAAGATCAATTC 672 700
Cre
ativ
e B
ioge
ne Control GCTTCGCGCCGTAGTCTTA No match
1 GCAAGGTACCACACACTAACC 579 599
2 GCGTACAGAGATCAGAAATTA 839 859
3 GGAAGCTGACAATACACATGC 917 937
4 GGGACAGAACCATTCCATTAT 947 967
Gen
ecop
oeia
Control GCTTCGCGCCGTAGTCTTA No match
G1 GTCGGATGACAAGAATTAC 236 254
G4 CACCGGATTGAAATCAAGA 405 423
G12 CGAAGTGAGTCTGGAGAAA 1091 1109
G13 GAACAAGGCCAGAGGTACT 716 734
G14 GGAGAAGAGCAGTGATTGA 1132 1150
24
FIGURE 2.
Figure also contributed by H. C.
Figure 2. Schematic showing target location of each of the 13 candidate BAG5-targeting
shRNAs along the rat BAG5 mRNA transcript.
25
FIGURE 3.
26
FIGURE 3 (CONT’D)
Figure 3. Initial in vitro screen of knockdown efficiency of candidate shRNAs against rat
BAG5, via western blot densitometry. (A) Knockdown of endogenous rat BAG5 in PC12 cells
transfected with candidate shRNAs, 48h post-transfection. (B) Knockdown of exogenous rat
BAG5 (co-transfected with the shRNAs) in HEK cells transfected with candidate shRNAs, 48h
post-transfection. (C) Combined data from (A) and (B). All data are reported as mean ± standard
deviation.
27
1.3.2 Confirmation of top three candidate shRNA plasmids
After identifying BAG5 shRNA clones C, D, and G1 as the three most promising
candidate shRNAs, the knockdown experiment in PC12 and HEK (Fig. 3) was repeated, focusing
on these top three shRNAs, in order to confirm their ability to knock down BAG5 in vitro.
In PC12 cells, densitometry analysis showed that, compared to the respective control
shRNA, transfection with targeting clones resulted in the following proportions of BAG5 protein
levels: Origene C (0.68); Origene D (0.64); Genecopoeia G1 (0.84) (Fig. 4A).
In HEK cells, transfection with targeting shRNA resulted in the following proportions of
BAG5 protein levels, relative to the respective control shRNA: Origene C (0.73); Origene D
(0.74); Genecopoeia G1 (0.22) (Fig. 4B).
The results here are similar to those observed in the initial shRNA screen, with clones C
and D being able to knock down BAG5 in both PC12 and HEK cells, while G1 resulted in strong
BAG5 knockdown in HEK cells, but not in PC12.
28
FIGURE 4.
Figure 4. Confirmation of efficient BAG5 knockdown by top three shRNAs identified in
the initial screen. (A) Knockdown of endogenous rat BAG5 in PC12 cells transfected with
candidate shRNAs at 48h post-transfection. Left: western blot. Right: western blot densitometry
(n=1). (B) Knockdown of exogenous rat BAG5 (co-transfected with the shRNAs) in HEK cells
transfected with candidate shRNAs at 48h post-transfection. Left: western blot. Right: Western
blot densitometry (n=1).
29
1.3.3 Generation of AAV1/2 and lentivirus vectors expressing BAG5 shRNA
Having confirmed the knockdown activity of clones C, D, and G1, these clones were
packaged into adeno-associated virus (AAV) 1/2 vectors co-expressing GFP. A non-targeting
control virus was also generated, using the shRNA sequence from Origene non-targeting
Control. From here on, these vectors will be referred to as AAV-shBAG5 C, D, G1, and Control.
We also had access to an AAV1/2 expressing only GFP and no shRNA, but otherwise identical
to our AAV-shBAG5 vectors, and termed this AAV-GFP.
Preliminary in vivo testing of the different AAV-shBAG5s showed that C and G1
produced more reliable knockdown of BAG5 in injected rat substantia nigra compared to D (data
not shown). Thus, all subsequent experiments focused on investigating only AAV-shBAG5 C
and G1 compared to the non-targeting Control AAV.
Lentivirus (LV) vectors co-expressing shRNA and GFP were also generated, using
shRNA sequences from Origene B and Origene non-targeting Control. From here on, the LV
vectors will be called LV-shBAG5 and LV-Control. The LV vectors were generated well before
the AAVs. At the time of LV generation, fewer candidate shRNAs were available for testing. In
addition, fewer replicates of the in vitro knockdown experiments (as in Fig. 3) had been
performed. Based on the data available at the time, we chose to package Origene clone B shRNA
into the LV vector, rather than one of the shRNA sequences used in the AAVs.
1.3.4 AAV-shBAG5 knocks down BAG5 in rat primary hippocampal neurons
AAV-shBAG5 vectors were used to infect rat primary hippocampal neurons. GFP
expression and BAG5 knockdown activity were assessed by western blot (Fig. 5A). All three
AAV-shBAG5 vectors were all able to infect these neurons and drive expression of GFP. By 8
30
days in vitro, infection efficiency was observed to be approximately 75%, by visual inspection of
the proportion of GFP+ neurons. Infection with AAV-shBAG5 Control resulted in considerably
greater GFP expression compared to C (44% of Control) or G1 (68% of Control) (Fig. 5B). Both
AAV-shBAG5 C and G1 were able to produce substantial knockdown of BAG5. Infection with
AAV-shBAG5 C resulted in 28% BAG5 expression compared to Control AAV-infected neurons,
while AAV-shBAG5 G1 resulted in 50% BAG5 expression compared to Control (Fig. 5C).
31
FIGURE 5.
Figure also contributed by D. E-F, M. S., and H. C.
Figure 5. GFP expression and BAG5 knockdown by AAV-shBAG5 vectors in rat primary
hippocampal neurons at 8 days post-infection. (A) Western blot for BAG5, GFP, and GAPDH
from lysate of primary rat hippocampal neurons infected with AAV-shBAG5 C, AAV-shBAG5
G1, and AAV-shBAG5 Control at MOI of 2×104. (B) Densitometry analysis of GFP expression,
relative to GAPDH. (C) Densitometry analysis of BAG5 expression, relative to GAPDH. (n=1).
32
1.4 Discussion
1.4.1 Choice of shRNA as gene inhibition strategy
There are several advantages to using shRNA as a gene inhibition strategy in vivo. Once
it is delivered to cells via viral transduction, it results in sustained knockdown of its target
mRNA. Thus, shRNA treatment requires only a single intervention, which saves on costs and
reduces risk to the animal. Virus-delivered shRNA is also easier to target to a specific area of the
brain. This accuracy can be further refined to specific cell types by carefully selecting viral
serotype/tropism. By comparison, ASOs would require regular infusions and constant production
of the therapeutic agent. Since these agents are usually delivered by intrathecal or
intraventricular infusion, it is also more difficult to target them to specific locations, potentially
resulting in unwanted effects in other regions of the CNS (not to mention the inefficiency). The
similar siRNA can also be delivered in vivo, but has traditionally struggled to overcome issues of
low stability and cellular uptake69. Nonetheless, siRNAs and ASOs have shown promising
results in animal models, and currently ASOs are being investigated in clinical trials for
Huntington’s disease90.
Another strategy to inhibit BAG5 could be to target the protein rather than the mRNA. A
BAG5 mutant, BAG5-DARA, has already been characterized. The DARA mutant is unable to
interact with Hsp70, and prevents normal BAG5 from interacting with Hsp7056. The BAG5-
Hsp70 interaction is critical for some of BAG5’s functions, including its interaction with CHIP,
which prevents CHIP from ubiquitylating αSyn61. However, the DARA mutant does not affect
BAG5’s interaction with parkin or its inhibition of parkin’s E3 ligase activity56. In addition,
BAG5 may have other, potentially deleterious functions that are unaffected by DARA. Thus,
inhibiting the expression of BAG5 may result in a different phenotype that may have more
comprehensive effects than DARA-based inhibition.
33
At the time of this project’s initiation, reports of in vivo CRISPR strategies were just
beginning to emerge, so we chose a more traditional technology in shRNA. Going forward,
CRISPR will be an interesting alternative strategy to pursue, though gene knockdown and
knockout may be differ in phenotype, and CRISPR has its own off-target effects and
disadvantages to consider. For instance, it may be less efficient than RNAi given that it must
successfully cleave and functionally knock outboth alleles of the target gene. Additionally,
unrepaired double-stranded breaks can cause cell death, and off-target effects could result from
cleaving at untargeted loci91.
1.4.11.4.2 BAG5 antibody validation
For application in western blot, our lab had previously tested several BAG5 antibodies
from different vendors. Of these antibodies, the antibody used in Chapter 1 (Santa Cruz, cat.
#ab56738) provided the cleanest detection of endogenous BAG5 in PC12 cell lysate. It detected
a single band at the predicted molecular weight of 51 kDa in HEK cell lysate expressing FLAG-
BAG5, and in the S2 (cytosolic) fraction of rat brain lysate (data not shown).
1.4.21.4.3 Transfection efficiency and interpretation of apparent knockdown In PC12 cells, we achieved approximately 30% transfection efficiency using 1.5µg of
plasmid and Lipofectamine 2000, after trying several different cationic lipid-based transfection
reagents that were no more efficient. Reports of PC12 transfection efficiency in the literature are
quite variable. Lee et al reported 14% efficiency with 1 µg of DNA and Lipofectamine 2000, and
15% with polyethyleneimine (PEI)92. Cogli et al achieved a 30% transfection efficiency using a
different cationic lipid product (Metafectene Pro)93. Covello et al achieved a transfection
efficiency of 46% using 1 µg of plasmid Lipofectamine 200094. However, they were able to
increase transfection efficiency to 90% when they used an electroporation method instead94.
34
In HEK cells, we were able to achieve a relatively high transfection efficiency of
approximately 70% using 1.5µg of plasmid and Lipofectamine 2000. This value is similar to
literature reports, which range from 60% efficiency with Lipofectamine 2000 and 1-2 µg of
DNA95, to 75% with PEI (with suspension cells)96.
Since we analyzed cell lysate from the entire population of cells and not just the
transfected cells, the maximum expected knockdown in our population of cells should be equal
to the transfection efficiency. The level of knockdown observed in our shRNA screen (Fig. 3)
generally followed this rule, with the most efficient shRNA clones achieving roughly 30%
knockdown in PC12 cells (Fig. 3A), and 70% knockdown in HEK cells (Fig. 3B). Thus, the
actual knockdown produced by the most efficient shRNAs would be close to 100%. However,
Origene clone D produced a mean knockdown of 58% (i.e. 0.42 times the BAG5 band density
compared to Control), which is substantially greater than the expected maximum knockdown of
30%. The reason for this is unclear. It is possible that transfection efficiency was underestimated,
or that clone D produced an off-target effect increasing GAPDH expression, causing the amount
of BAG5 in lysate to be underestimated. On the other extreme, we also observed that several less
efficient shRNAs from Genecopoeia produced an apparent mean upregulation of BAG5
compared to non-targeting Control, in both HEK and PC12 cells (Fig. 3). This result may be
attributable to the low sample size with high variance, poorly designed Control sequence, or off-
target effects.
It is also important to consider protein half-life in knockdown experiments because
shRNA only reduces mRNA levels without affecting existing protein. Previous studies of the
proteome in various mammalian cell types have found that protein half-lives can be highly
variable and depends on cell type, but are mostly on the order of hours to tens of hours97-99. The
35
half-life of BAG5 has not been studied, but if actual BAG5 knockdown were indeed close to
100% at 48h post-transfection, our results would suggest that BAG5 half-life would be on the
order of several hours, such that the vast majority would be degraded within 48 hours. Protein
half-life can be more accurately determined by pulse-chase assay or by cycloheximide
blocking100.
It is unclear why some of the candidate shRNAs appeared to not produce appreciable
knockdown, especially the clones from Creative Biogene (in PC12) and the non-G1 clones from
Genecopoeia (in PC12 and HEK). These shRNAs may simply not have been effective at binding
the target sequence or associating with RISC. It is unlikely that there is an issue with transfection
or with the plasmids’ stability or interaction with the lipofection reagent, since cells transfected
with these plasmids demonstrated similar GFP expression levels and transfection efficiencies
compared to shRNA clones that produced efficient knockdown. One possible explanation of
poor knockdown efficiency is the dilution of plasmids as cells divide, since the plasmids are not
designed to replicate in mammalian cells. The plasmids from Creative Biogene and Genecopoeia
may produce efficient knockdown only at high plasmid copy numbers, perhaps because the
shRNA targeting sequences bind less effectively to BAG5 mRNA. Different doubling times
between PC12 and HEK cells (and thus plasmid dilution rates), and also different transfection
efficiencies, may also explain the efficient knockdown produced by Creative Biogene plasmids
in HEK cells, but not in PC12 cells. In addition, the Genecopoeia plasmids use a different GFP
promoter than the plasmids from the other vendors. Therefore, although the GFP expression and
transfection efficiency from Genecopoeia plasmids may seem comparable to that produced by
other plasmids, the actual amount of plasmid delivered to each cell and the expression of shRNA
may not be.
36
1.4.31.4.4 Limitations of western blot and densitometry analysis
Knockdown in vitro was quantified by western blot densitometry, which relies on the
assumption that all bands of interest fall within the linear range (i.e. band intensity is directly
proportional to amount of protein). We tried to adjust X-ray film exposure times to remain in the
linear range, but did not use a protein standard to confirm. BAG5 bands were normalized to
GAPDH (glyceraldehyde 3-phosphate dehydrogenase) bands as a loading control. While this is
standard practice, it assumes that all cells express equal amounts of GAPDH, and that this
expression is not altered by the experimental treatment of shRNA transfection. While our
shRNAs did not target GAPDH, there remains the risk of off-target effects. Recently, several
groups have suggested that analyzing total protein (using a stain such as Ponceau S or Coomassie
Brilliant Blue) instead of a specific high-abundance protein such as GAPDH or actin would be a
more accurate method of normalizing101-103.
1.4.41.4.5 Alternative techniques to quantify knockdown
There is some ambiguity in assessing knockdown in a heterogeneous population of
transfected and non-transfected cells. New variations on transfection methods can achieve higher
rates of transfection, but not 100% efficiency94,104. Instead, it is possible to isolate transfected
cells (GFP+) from a population using fluorescence activated cell sorting (FACS), followed by
analysis (or subculture) of this highly purified subpopulation105,106. Flow cytometry methods
could also to used to obtain a more accurate measurement of transfection efficiency107. Another
method of quantifying shRNA-mediated knockdown is RT-qPCR, though reported mRNA levels
are not always reflective of the amount of protein available108. Unlike western blot, RT-qPCR is
feasible even when good antibodies for the target protein are unavailable.
37
Chapter 2: Characterization of BAG5 shRNA viral 2vectors in vivo
2.1 Introduction
In the previous chapter, we identified shRNA sequences that can efficiently knock down
BAG5 in vitro, and subsequently generated AAV and LV vectors that co-express these shRNAs
along with a GFP expression marker. The next aim is to establish in vivo expression and BAG5
knockdown capabilities of these BAG5 shRNA viral vectors in rat SN. In this chapter, we aim to
identify a suitable viral titer for infection, characterize the spatiotemporal expression of these
vectors, and establish successful BAG5 knockdown in the rat SN. We also observe significant
differences in expression of AAV compared to LV. Finally we conduct a preliminary analysis of
some of the effects of BAG5 knockdown using the medial forebrain bundle axotomy (MFBx) rat
model of dopaminergic neuron injury.
Dopaminergic neurons, which express and positively stain for tyrosine hydroxylase (TH),
are present in the SNc and in the ventral tegmental area (VTA), a medial structure in the rat
ventral midbrain. It can be difficult to distinguish the boundary between the SNc and VTA in
certain coronal sections (“levels”) of the rat midbrain where these structures are continuous with
each other from left to right of the ventral region in coronal sections. However, another
anatomical structure called the medial terminal nucleus (MTN), which does not contain
dopaminergic neurons, exists between SNc and VTA at some levels of the midbrain. On TH-
stained coronal sections, the MTN appears as a small TH-negative area that extends
dorsolaterally from the ventral surface, separating SNc from VTA. Thus, at the level of the
MTN, the SNc is easily distinguishable from the VTA using TH staining, allowing subsequent
analysis to accurately examine SNc and not mistakenly include VTA in the analysis (or exclude
38
medial SNc). For this reason, all microscopy images and analysis included in this chapter have
been taken/conducted at the level of the medial terminal nucleus (MTN).
Anatomically, SNc extends from -4.56mm to -6.60mm relative to bregma (Paxinos &
Watson, 1997). The VTA is particularly challenging to distinguish from SNc in more anterior
sections, though VTA exists from -4.68mm to -6.24mm, nearly the entire anteroposterior extent
of the SNc. MTN is a useful divider of SNc and VTA from -4.92mm to -5.28mm. Since the
anteroposterior coordinate of injection is -5.2mm, the MTN-containing sections included in our
analysis tend to be located very close but slightly anterior to the ideal injection site.
2.2 Materials and Methods
2.2.1 Animals
All animal experiments were conducted using female adult Sprague-Dawley rats (Charles
River), weighing 275-300g at the time of virus injection. Rats were co-housed in pairs on a
regulated 12-hour light/dark cycle at standard temperature (21–22 °C) and allowed food and
water ad libitum.
2.2.2 Stereotactic injection of AAV or LV into rat SN
All procedures were performed in accordance with the rules and regulations of the
Animal Resources Centre in the University Health Network. Animals were deeply anaesthetized
with Anafen (Merial) at 5mg/kg delivered subcutaneously. Animals were mounted on a
stereotactic frame and a craniotomy was made relative to bregma according to the brain atlas of
Paxinos and Watson (1997). Rats received a single 2µL, unilateral injection of AAV or lentivirus
targeted to the SN by stereotactic injection. AAVs were injected at either 1/2 of stock titer
(resulting in a titer of 5.5×1011 gp/mL) or at 1/3 of stock (resulting in a titer of 3.7×1011 gp/mL).
AAV-GFP (used in Fig. 7) was injected at a titer of 5.1×1012 gp/mL. Lentivirus was injected at a
39
titer of 9.0×104 IU/µL (or 9.0×107 IU/mL). Viruses were delivered via microinjector (Harvard
Apparatus) at a rate of 0.5 µL/min, using the following coordinates relative to bregma: AP, -
5.2mm; ML, -2.0mm; DV, -7.5mm (Paxinos & Watson, 1997). After surgery, animals were
housed individually on a regulated 12-hour light/dark cycle and allowed food and water ad
libitum.
2.2.3 Medial forebrain bundle axotomy
Three weeks following AAV injection, rats received unilateral axotomy of the medial
forebrain bundle (MFBx), ipsilateral to the side of injection. A retractable wire knife was
inserted directly into the brain at the following coordinates relative to bregma: AP, -3.8mm; ML,
-2.4mm; DV, -8.0mm (Paxinos & Watson, 1997). The blade was extended, then raised 2.5mm,
then lowered 3.0mm. The blade was retracted and removed. After surgery, animals were housed
individually on a regulated 12-hour light/dark cycle and allowed food and water ad libitum. Rats
were sacrificed 7 days post-MFBx (see Section 2.2.4).
2.2.4 Processing of rat brains
Rats were anaesthetized, and then sacrificed by exsanguination and transcardial perfusion
with cold saline, followed by cold 4% paraformaldehyde (PFA). Brains were then removed and
stored at 4°C, first in 4% PFA for 24 hours, then put through a 15% to 30% sucrose-PBS
gradient. In order to generate sections, brains were frozen on a stage and then six series of 40µm
coronal sections were generated using a sliding microtome. Each series of sections was stored in
cryoprotectant (30% glycerol, 30% ethoxyethanol, 40% PBS) at -20°C.
2.2.5 Immunofluorescence staining of rat brain sections for TH and BAG5
Cryoprotectant was washed off with several rinses of 0.2% PBS-Tween 20 (PBS-T), then
sections were blocked in 10% NGS + 2% BSA in 0.2% PBS-T for one hour at room temperature.
40
Sections were then incubated at room temperature overnight in primary antibody: rabbit
polyclonal anti-BAG5, 1:1000 (Imgenex cat. #IMG-5678, identical to Novus Biologicals cat.
#NB100-56091); mouse anti-TH, 1:1000 (Millipore cat. #MAB318). After several washings in
PBS-T, sections were incubated in goat anti-mouse IgG biotin-SP at 1:1000 (Jackson
ImmunoResearch cat. #115-065-146) for 1 hour at room temperature, in order to amplify TH
staining using the biotin-streptavidin system. After another several washings in PBS-T, sections
were incubated for 1 hour at room temperature in either secondary fluorescent antibody (for
BAG5 staining) goat Alexa Fluor anti-rabbit 594, 1:500 (Invitrogen cat. #A-11037); and/or in
either Alexa Fluor streptavidin 350, 1:500 (Molecular Probes cat. #S11249) or Alexa Fluor
streptavidin 594, 1:500 (Molecular Probes cat. #S32356). Sections were again washed in PBS-T,
then mounted on glass slides, allowed to dry, then covered by a coverslip with fluorescent
mounting medium (Dako cat. #S302380-2).
2.2.6 Immunostaining of rat brain sections for TH and NeuN
Cryoprotectant was washed off with several rinses of 0.1% PBS-T. Endogenous
peroxidase was quenched by washing sections in 3% H2O2 (Sigma cat. #H-1009) for 3 minutes,
followed by another several rinses in PBS-T. Sections were blocked in 10% NGS + 2% BSA in
0.2% PBS-T for one hour at room temperature. Sections were then incubated at room
temperature overnight in primary mouse anti-NeuN antibody, 1:1000 (Chemicon cat.
#MAB377). After several washings in PBS-T, sections were incubated in secondary antibody for
2 hours at room temperature: biotinylated anti-mouse IgG from goat, 1:400 (Vector cat. #BA-
9200). After washing in PBS-T, sections were incubated for 1 hour at room temperature in ABC
Elite mix according to the manufacturer’s instructions (Vector cat. #PK-6100). Sections were
rinsed in 0.1M Dulbecco’s PBS (Sigma), and then stained with DAB (3,3′-Diaminobenzidine)
according to the manufacturer’s instructions (Vector cat. #SK-4105). This was followed by
41
another several rinses in PBS-T and overnight, room temperature incubation in the second
primary antibody, rabbit anti-TH, 1:2000 (Chemicon cat. #AB152). Sections were rinsed and
incubated in secondary antibody as previously described, using alkaline phosphatase-conjugated
anti-rabbit IgG from goat, 1:400 (Jackson ImmunoResearch cat. #111-055-144). This was
followed by another series of PBS-T rinses, then by incubation in Vector Blue substrate
according to the manufacturer’s instructions (Vector cat. #SK-5300). Sections were again
washed in PBS-T, then mounted on glass slides, allowed to dry overnight, then covered by a
coverslip with Vectamount (Vector cat. #H-5000).
2.2.7 Semi-quantification of BAG5 expression in SN using ImageJ
Paired images of rat SN stained for BAG5 were acquired at 100x magnification using a
deconvolution microscope (Zeiss Axioplan 2). Paired images were captured using identical
exposure times, set to the automatically determined optimal exposure time for the uninjected SN
using AxioVision 4.8 software (Zeiss). These images were opened in grayscale using ImageJ
software (Schneider et al., 2012)109. A freeform region of interest (ROI) was used to enclose the
area of the SNc on the image taken contralateral to virus injection, and this ROI was mirrored
onto the paired image. Using the “Find Maxima” tool with noise tolerance value arbitrarily set to
8, the number of points of local pixel intensity maxima within each ROI was identified, as a
proxy for overall intensity (see discussion and Fig. 6).
2.2.8 Statistical analyses
Statistical analysis was conducted using GraphPad Prism 6.0 software (GraphPad
Software, La Jolla, California, USA, www.graphpad.com). Data containing three or more groups
were analyzed by one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test.
Statistical significance was arbitrarily set to p < 0.05.
42
FIGURE 6.
Figure 6. Demonstration of semi-quantitative method of assessing BAG5
immunofluorescence in SN, using “find maxima” function in ImageJ.
43
2.3 Results
2.3.1 AAV1/2 achieves greater expression in rat SN than LV
As an initial step in our in vivo experiments, LV and AAV1/2 vectors were tested for
expression in rat brain. We used AAV-GFP rather than AAV-shBAG5 vectors here because the
latter were not yet available. Four weeks following unilateral injection of virus into the rat SN,
coronal midbrain sections were examined for GFP expression (Fig. 7). Substantial GFP signal
was observed in and around the SN in rats injected with AAV-GFP vector, but LV-Control and
LV-shBAG5 injected brains showed very poor GFP signal. These sections were also stained by
immunofluorescence as an attempt to amplify any GFP signal that may be too weak to see by
eye. However, even after signal amplification, GFP signal in the LV sections was poor. There
was occasionally some GFP signal near the injection track, but not in SN, and signal was
generally highly inconsistent. The reason for the LV vectors’ poor expression is unclear, as they
efficiently transduced cultured cells (data not shown). Based on these results, we decided to use
only the AAV vectors in subsequent experiments.
44
FIGURE 7.
Figure also contributed by C. L
Figure 7. GFP expression in SN-containing sections of LV- or AAV-injected rat brains, at
four weeks post-injection. Top row: GFP signal without amplification, in green channel. Second
row: immunofluorescence-amplified GFP signal, in red channel. Bottom row: merge of green
and red channels.
45
2.3.2 AAV-shBAG5 vectors express throughout SN at level of MTN
All three AAVs provided excellent mediolateral coverage of the SNc, as visualized by
GFP expression throughout the SNc, in MTN-containing sections (Fig. 8). All three AAVs also
provided fairly comprehensive SN coverage along the anteroposterior axis (images not shown),
though GFP expression tended to appear slightly weaker in the most posterior sections. With the
BAG5-targeting AAVs, GFP expression was well localized to SNc, though some green signal
was observed in the surrounding tissues, especially those immediately dorsal to the SN. By
contrast, AAV-shBAG5 Control resulted in a large spread of strong GFP expression dorsal to the
SN, often covering nearly half the injected hemisphere.
46
FIGURE 8.
Figure 8. SNc-containing sections from rat brains injected with AAV-shBAG5 Control, C,
or G1 at 1/2 stock dilution (resulting in 5.5×1011 gp/mL), at three weeks post-injection.
Immunofluorescence staining of tyrosine hydroxylase (TH) in red channel, merged with
endogenous GFP in green channel, reveal the coverage of AAV expression in and around SNc at
the level of the medial terminal nucleus (MTN), the area of non-TH immunoreactivity indicated
by the white arrow.
47
2.3.3 AAV-shBAG5 vectors at 1/2 dilution knock down BAG5 in vivo
Having confirmed excellent AAV coverage at the level of the MTN at three weeks
following a 1/2 of stock AAV dilution (resulting in 5.5×1011 gp/mL), we next sought to establish
knockdown of BAG5 in these same animals by immunostaining for BAG5. Most MTN-
containing sections from rats injected with either of the targeting AAV-shBAG5 vectors
displayed clear BAG5 knockdown in the injected SN, by visual inspection and comparison
against the uninjected SN as an internal control (Fig. 9A-F). Furthermore, the overall degree of
BAG5 knockdown was judged to be roughly 50% with both AAV-shBAG5 C and G1, again by
inspection.
In order to confirm BAG5 knockdown and to eliminate potential observer bias, we
developed a semi-quantitative image analysis method that could be used to compare BAG5
staining in the injected SN to the uninjected SN (see section 2.2.7). Based on this method, which
uses an algorithm to identify the number of local pixel intensity maxima within a user-defined
region of interest, it was confirmed that both AAV-shBAG5 C and G1 resulted in a significantly
greater BAG5 knockdown in the injected SN than that produced by AAV-shBAG5 Control (Fig.
9G). Specifically, the ratio of total maxima in injected SN to total maxima in uninjected SN was
found to be the following (reported as mean ± standard deviation): Control (0.62 ± 0.25); C (0.34
± 0.19); G1 (0.33 ± 0.21). Paired sections judged to have exceptionally poor BAG5 staining were
excluded from the analysis. All data are presented after removal of outliers using Grubbs’ test.
48
FIGURE 9.
49
FIGURE 9 (CONT’D)
50
Figure 9. AAV-shBAG5 mediated BAG5 knockdown at three weeks post-injection of
AAVs at 1/2 dilution (5.5×1011 gp/mL). Representative immunofluorescence staining of BAG5
and TH in SNc of rats injected with AAV-shBAG5 Control, at low magnification (A) and high
magnification (B); AAV-shBAG5 C, at low magnification (C) and high magnification (D); or
AAV-shBAG5 G1, at low magnification (E) and high magnification (F). Maxima-based semi-
quantification of BAG5 staining in SNc of MTN-containing sections, expressed as the ratio
between right side (RS; injected) and left side (LS; uninjected) total maxima (n=6 rats injected
with each AAV; three MTN-containing sections analyzed for each rat). Statistical analysis
performed by ANOVA with Tukey’s post-hoc test, * indicates p < 0.05.
51
2.3.4 AAV-shBAG5 vectors at 1/3 dilution knock down BAG5 in vivo
Since our AAV-shBAG5 vectors also express GFP, which has previously been shown to
be toxic to neurons when overexpressed in rat SN33, we next assessed the expression and
knockdown capabilities of our AAV-shBAG5 vectors when injected at a lower dilution (1/3 of
stock, resulting in 3.7×1011 gp/mL) but otherwise using the same experimental parameters as
before. At three weeks following AAV injection at this lower dilution, immunostaining for
BAG5 demonstrated substantial BAG5 knockdown in the injected SN, by visual inspection and
comparison against the uninjected SN (Fig. 10A-F). Similar to observations with the 1/2 dilution,
the degree of knockdown achieved by C and G1 was judged to be roughly 50% for both AAVs,
by inspection. As before, the maxima-based semi-quantitative method was applied to confirm
knockdown, and again showed that significantly greater BAG5 knockdown was achieved by the
two targeting AAVs compared to AAV-shBAG5 Control (Fig. 10G). Specifically, the ratio of
total maxima in injected SN to total maxima in uninjected SN was found to be the following
(reported as mean ± standard deviation): Control (1.03 ± 0.36); C (0.59 ± 0.19); G1 (0.57 ±
0.27). Paired sections judged to have exceptionally poor BAG5 staining were excluded from the
analysis. All data are presented after removal of outliers using Grubbs’ test.
By inspection, the overall magnitude of BAG5 knockdown produced by the 1/3 dilution
appeared to be slightly less than that produced by the 1/2 dilution. However, the difference
between the magnitudes of knockdown achieved by the two dilutions is difficult to quantify, and
the maxima-based method does not provide a suitable measure of this.
52
FIGURE 10.
53
FIGURE 10 (CONT’D)
54
Figure 10. AAV-shBAG5 mediated BAG5 knockdown at three weeks post-injection of
AAVs at 1/3 dilution (3.7×1011 gp/mL). Representative immunofluorescence staining of BAG5
and TH in SNc of rats injected with AAV-shBAG5 Control, at low magnification (A) and high
magnification (B); AAV-shBAG5 C, at low magnification (C) and high magnification (D); or
AAV-shBAG5 G1, at low magnification (E) and high magnification (F). Maxima-based semi-
quantification of BAG5 staining in SNc of MTN-containing sections, expressed as the ratio
between right side (RS; injected) and left side (LS; uninjected) total maxima (n=6 rats injected
with each AAV; three MTN-containing sections analyzed for each rat). Statistical analysis
performed by ANOVA with Tukey’s post-hoc test, * indicates p < 0.05.
55
2.3.5 AAV-shBAG5 vectors protect against MFBx injury
Following confirmation that our AAV-shBAG5 vectors are able to knock down BAG5 in
rat SN at the tested dilutions, we next conducted a preliminary investigation into the
neuroprotective potential of BAG5 knockdown in the MFBx model of dopaminergic injury23.
Injection of either targeting AAV three weeks prior to MFBx resulted in significant
protection from loss of TH in the ipsilateral SN at 7 days post-MFBx (Fig. 11A). The
percentages of TH+ profiles in the injected SN compared to the uninjected SN (reported as mean
± SEM) are as follows: Control (41.9 ± 11.7); C (70.9 ± 11.0); G1 (70.2 ± 10.1).
In addition, AAV-shBAG5 C significantly rescued the loss of mature neurons (NeuN+
cells) in the SN, while AAV-shBAG5 G1 trended towards rescue but did not reach statistical
significance (Fig. 11B). The percentages of NeuN+ profiles in the injected SN compared to the
uninjected SN (reported as mean ± SEM) are as follows: Control (30.8 ± 5.0); C (46.1 ± 3.6); G1
(42.5 ± 8.0). All data are presented after removal of outliers using Grubbs’ test.
56
FIGURE 11.
Figure 11. Effect of AAV-shBAG5 injected at 1/2 dilution (5.5×1011 gp/mL) on TH and
NeuN expression in SN of rats receiving medial forebrain bundle axotomy at 7 days post-
axotomy (four weeks post-injection). Ratio of TH+ (A) and NeuN+ (B) profiles on injected vs.
contralateral (i.e. uninjected) side at the level of the MTN (n=6 for Control, n=8 each for C and
G1; three MTN-containing sections analyzed per animal). All data are reported as mean ± SEM.
Statistical analysis performed by ANOVA with Tukey’s post-hoc test, * indicates p < 0.05.
57
2.4 Discussion
2.4.1 Rationale for selecting AAV1/2 serotype and injection titers
Although AAV2 has typically been the vector of choice for clinical gene therapy trials for
CNS disorders16, we chose to use AAV1/2 vector in our work for several reasons. Firstly, it
combines the strong neuronal tropism of AAV2 with the widespread penetrance in brain tissue of
AAV133,110 to ensure full coverage of the SN. In addition, expertise about this specific vector
was readily available from our collaborators, who developed a rat model of PD using AAV1/2
expressing the A53T mutant of human αSyn33,111. Based on their previous reports, we were able
to choose an appropriate injection titer to minimize GFP-mediated toxicity by comparing titers to
the previously characterized AAV1/2-GFP in rat SN111. Our first choice of titer (Fig. 9) of 1/2
stock (5.5×1011 gp/mL) was chosen to closely match the 5.1×1011 gp/mL titer of AAV1/2-GFP
used by Koprich et al111, which showed no trend toward toxicity at either 3 or 6 weeks post-
injection, as determined by TH expression and forepaw asymmetry111. Finally, using an AAV1/2
vector for shRNA delivery would enable us, as a future experiment, to test our vectors in the
AAV1/2-hA53T-SNCA model while ensuring consistency in spatiotemporal expression (see
Section 3.3.1).
2.4.2 Comparison of AAV to LV
It is unclear why the LV vectors failed to express any detectable amounts of GFP in the
rat SN or around the injection site in the midbrain, even after signal amplification. Our injection
titer of 9.0×104 IU/µL (or 9.0×107 IU/mL) falls within the range of titers used by other groups to
achieve lentivirus-delivered GFP expression in rat SN. For instance, Harms et al. successfully
expressed GFP with a 2µL injection of LV at a titer of 3.3×107 IU/mL, at both 2 and 5 weeks
post-injection112. Similarly, Yin et al. found success with a 1µL injection of 1.0×108 IU/mL of
LV, and detected GFP expression in SN as early as 72 hours post-injection113. A third group was
58
successful using a higher titer of 9.0×108 IU/mL of LV, at 8 weeks post-injection114. Besides the
injection titer, we also chose a well-established mammalian constitutive promoter (CMV) for
protein expression, used standard stereotactic coordinates for SN injection, and allowed a
reasonable time frame (4 weeks post-injection) for expression. Indeed, the LVs were injected
using the same techniques and parameters as AAV-GFP (Fig. 7), which did show robust GFP
expression at 4 weeks post-injection.
Given the lack of GFP expression following LV injection, it seemed likely that the
shRNAs from the LV would also be poorly expressed. We therefore did not investigate BAG5
knockdown in the LV-injected brains. Based on the these results, we conclude that at least in our
hands, AAV1/2 is superior to LV as a viral gene delivery vector in the rat SN, and we thus
proceeded with AAV for the remainder of the experiments.
2.4.3 Spatial expression of AAV and analysis at level of MTN
The excellent coverage of the SN in sections containing MTN (Fig. 8) reinforces our
decision to analyze SN at that level. We can be confident that our analysis of the SN includes
AAV-infected neurons along the full extent of the SN while it also excludes TH+ neurons of the
VTA based on the anatomy defined by the MTN. By narrowing the focus of analysis toward an
area relatively dense in nigral dopaminergic neurons infected with AAV, differences between the
injected and uninjected sides become easier to detect, since the suppressing effect of irrelevant
background is minimized.
The widespread mediolateral SN coverage pattern in MTN-containing sections was
observed at a relatively early time point of three and four weeks post-injection (as in Figs. 8-10,
and Figs. 7 & 11, respectively). Although this is the only time window of AAV expression
reported here, others have reported sustained protein expression with AAV1/2 at six33 and
59
twenty-four110,115 weeks after injection in rat brain. AAV expression in humans has been shown
to last even longer: in one patient enrolled in a hemophilia gene therapy trial, AAV2 continued
expressing after 10 years in non-dividing cells (skeletal muscle)116.
Based on the spatiotemporal expression of GFP, we expect that AAV-shBAG5 vectors
will also be able to deliver widespread and sustained expression of shRNA well beyond the
demonstrated three-week window. The ability to produce sustained BAG5 knockdown over
several months would allow these vectors to be delivered in combination with one of several rat
models of PD in which pathology and behavioural deficits may take several weeks to fully
develop33,111,117 (also see section 3.3). It also better supports experimental designs where AAV-
shBAG5 is injected prior to the induction of the PD model, rather than a simultaneous or delayed
injection.
There are several limitations to narrowing the analysis of the SN to MTN-containing
sections. Firstly, this approach ignores SN in non-MTN containing sections, which together
represent a large part of the SN structure. We did not formally evaluate or confirm BAG5
knockdown on sections without MTN. If BAG5 is only knocked down in MTN-containing
sections and not elsewhere, the functional consequences of BAG5 knockdown may be difficult to
detect. Furthermore, it is possible that BAG5 knockdown in different regions of the SN can have
different effects on the animal, and certain regions may be more critical for normal physiological
functioning than others. Going forward, it may be important to analyze the other regions of the
SN to see how a single injection at our target coordinates affects BAG5 knockdown and
pathology. If knockdown is insufficient in some areas of the SN, multiple injections and/or
increased injection titer may be needed. Based on our observations however, most brains injected
60
with AAV-shBAG5 have displayed fairly comprehensive anteroposterior SN coverage, which
should alleviate some of the concerns outlined above.
2.4.4 ImageJ fluorescence semi-quantification method
We have been unable to find methods in the literature to rapidly quantify or semi-
quantify protein knockdown in the SN. In fact, many studies do not quantify in vivo knockdown
at all, possibly due to the technical challenges involved.
We sought to develop a relatively rapid and unbiased approach to compare levels of
BAG5 protein in the injected SN versus the contralateral SN, free from observer bias and more
quantitative than a simple visual assessment of staining intensity. The “find maxima” function in
ImageJ109 identifies local intensity maxima within a user-specified region of interest. This simple
and efficient method fairly consistently produces results that match relative staining intensity as
judged by eye (albeit subjectively). It is more reliable and less subject to human bias compared
to sampling-based strategies, and is better able to capture small differences compared to mean
intensity based methods, in which non-specific/background staining tends to wash out intensity
differences between the two SN. This issue is especially problematic in the case of BAG5, which
does not stain very strongly by immunofluorescence. In addition, unlike mean intensity based
methods, the maxima method is mostly unaffected by technical imperfections such as tissue
cracking or overlapping.
One caveat of the maxima method is that it becomes unreliable when the staining is
extremely weak (i.e. almost indistinguishable from background), as this results in a low number
of total maxima, which could more easily skew the ratio of maxima between the injected and
uninjected SN. For this reason we have excluded such sections from the analysis. In addition,
due to the relatively weak detection of BAG5 by immunostaining, SN images must be captured
61
at 100x magnification to ensure clarity. However, it is not possible to capture the entire SN in a
single image at this magnification with the equipment available to us (only around 80% of the
SN can be captured at this magnification), thus excluding analysis of the most medial and most
lateral portions of the structure. The maxima method somewhat relies on the assumption that the
areas of high light intensity in a given area are spread out. For instance, if all the areas of
intensity are very tightly clustered together, this method will report a low number of total
maxima, even if the mean intensity in the area is very high.
2.4.5 Analysis of BAG5 knockdown in rat SN
At both the 1/2 and 1/3 titer, the BAG5 targeting AAVs had very similar
injected/uninjected ratios, suggesting they have a similar knockdown efficiency. At both tested
titers, the targeting AAVs resulted in significantly greater knockdown than the non-targeting
Control, according to the maxima analysis method. Though we did not quantify magnitude of
knockdown, our roughly estimated knockdown of 50% for both targeting AAVs is similar to
previous reports of in vivo intranigral delivery of shRNA against αSyn (35% knockdown with
AAV2)13 and interleukin-1 receptor (40% knockdown with lentivirus)15. Unlike our non-
targeting Control AAV, control vectors in these two studies resulted in no appreciable
knockdown of the target protein, as determined by single-cell densitometry analysis.
The maxima count does not necessarily scale linearly with the total brightness in a given
image or region of interest, because it depends on the pattern of intensity distribution throughout
the ROI. Thus, the maxima ratio between injected and uninjected SN derived from this method
should not be interpreted as the magnitude of knockdown. Instead, it provides an unbiased
method to support protein knockdown already observed by eye.
62
In theory the maxima counts in uninjected SN and SN injected with AAV-shBAG5
Control should be the same, since the Control shRNA should not produce BAG5 knockdown. As
a result, the maxima ratio between injected and uninjected SN for Control AAV brains should
theoretically be 1. This ratio was indeed very close to 1 when Control AAV was injected at 1/3
dilution (Fig. 10). At 1/2 dilution however, the mean injected to uninjected ratio across SN pairs
of 0.62 suggests that BAG5 signal tended to be weaker in the injected SN vs. the uninjected SN
(Fig. 9). One potential explanation is that the Control shRNA had some off-target effect leading
to down-regulation of BAG. Partial complementation between an shRNA targeting sequence and
a stretch of mRNA can result in translation repression or mRNA degradation67,118. This type of
“specific off-target effect” can depend on the dose of shRNA119, which fits our observations of
apparent knockdown in the higher dilution only. As well, cells that are overloaded with
siRNA/shRNA may exhibit “non-specific off-target effects” as a result of endogenous miRNAs,
which normally help control gene expression, being displaced from RISC120. Again, this would
fit our observation that only the higher titer of Control AAV results in apparent BAG5
knockdown.
2.4.6 Alternative methods to measure BAG5 knockdown in vivo
It is also possible to quantitatively assess BAG5 knockdown in vivo, though these
methods tend to be more complicated and time-consuming. One such method is single-cell
densitometry analysis13,15, a technique in which many individual cells in each SN would be
imaged followed by densitometry analysis of each cell. Single-cell densitometry has been used to
quantify levels of αSyn13 and interleukin-1 receptor 115 in rat SN following delivery of shRNA
against those molecules. However, it relies on having a strong antibody signal and may still be
subject to selection bias when the individual cells are selected. Since BAG5 displays a fairly
weak signal by immunostaining, single-cell densitometry may not be the most appropriate
63
method for our purposes. Another option for quantifying BAG5 knockdown in the SN is to
dissect out the SN and western blot the tissue lysate121,122. This option surveys the entire SN
without having to select a sample of cells, and may function without a strong antibody. It may be
a viable way to further validate BAG5 knockdown in rat SN. As a third option is to use laser
capture micro-dissection to excise individual cells from the SN, followed by protein (or RNA)
analysis123,124. One benefit of this technique is the ability to analyze only infected neurons,
avoiding other cell types and uninfected cells, which could dilute the measured knockdown
effect.
As previously suggested, an alternate approach is to examine BAG5 mRNA rather than
protein. Analyzing the levels of BAG5 mRNA more directly measures the effects of shRNA, and
would be a valuable complement to protein analysis. One of the most popular techniques to
quantify a specific mRNA molecule from a tissue sample is qPCR. Another option is in situ
hybridization (followed by quantification), which can show the localization of the mRNA of
interest, unlike traditional PCR methods that require RNA isolation. However, this technique is
also limited by the nature of overlapping cells of mixed populations in tissue sections.
2.4.7 Potential toxicity from GFP overexpression
As shown by both western blot of infected primary hippocampal cells (Fig. 5) and by
visual inspection of sections from AAV-shBAG5 injected SN (Figs. 8-10), the Control AAV
tends to produce greater GFP expression than either of the two targeting AAVs, which appear to
produce comparable levels of GFP expression compared to each other. The reason for the
difference in GFP expression is unclear, given that all three AAVs are completely identical in
sequence, aside from the shRNA targeting sequence. One possibility is that the Control AAV had
a greater functional titer (i.e. more AAV able to infect cells) than the other AAVs, despite all
64
three AAVs having the same physical titer (in terms of genomic particles per mL). Another
explanation could be that both shRNA targeting mRNAs exhibit off-target effects that reduce
GFP expression.
High levels of GFP expression have been reported to be toxic to dopaminergic neurons in
the rat SN, in a dose-dependent fashion33,111,125. Koprich et al reported that delivery of AAV1/2-
GFP vector to the rat SN produced a 24% loss of TH+ neurons at three weeks post-injection
using a titer of 5.1×1012 gp/mL, but no loss was observed when AAV titer was diluted down to
1.7×1012 gp/mL33,111. We chose to use relatively low injection titers in an attempt to avoid GFP-
associated toxicity. Our higher titer (5.5×1011 gp/mL) was more than three times less
concentrated than the “safe” titer of 1.7×1012 gp/mL reported by Koprich et al111. Despite this
precautionary measure, it is possible that the reduction of BAG5 in SN injected with our higher
titer of Control AAV is (at least partially) a result of GFP-mediated toxicity (Fig. 9). If this is
indeed the case, the efficiency of BAG5 knockdown may be even greater than originally
observed. The Control AAV (presumably causing increased cell death) would reduce the amount
of BAG5 available for detection, but the targeting AAVs (presumably resulting in less cell death)
still resulted in apparent knockdown compared to Control.
The intended purpose of the AAV-shBAG5 Control vector was to control for both
shRNA and GFP expression. However, assuming the functional titers of all three AAVs are
identical, the GFP expression difference makes it such that the Control vector is only
(presumably) appropriately controlling for shRNA load, but not GFP load. It is important for the
AAVs to co-express a marker in order to easily confirm and visualize infection and expression,
as shRNA expression itself is difficult to detect. Ideally a less toxic expression marker could be
used, but GFP already seems to be the marker of choice, with relatively low toxicity.
65
Unfortunately, dopaminergic neurons tend to be particularly susceptible to insult125, so other
protein markers may present the same problem. AAV titer can always be reduced further, but
this risks insufficient shRNA expression to achieve a detectable effect.
2.4.8 Effects of AAV-shBAG5 on TH expression
The effect of AAV-shBAG5 vectors on TH immunoreactivity was found to be highly
variable across brain sections and animals, with either injection titer. We did not formally
quantify TH expression in the immunofluorescence-stained sections (Figs. 9 & 10) partly for this
reason. While many sections showed robust and equal levels of TH immunoreactivity in both SN
(with any of the three AAVs), several sections also showed very poor TH staining. The TH
signal in these sections appeared ghostlike, with the fluorescence signal in apparently TH+ cells
being significantly weaker than truly TH+ cells in the same section or same animal.
This issue may be related to tissue damage resulting from the injection of several
microliters of liquid into the brain parenchyma. Indeed, the “ghosting” phenomenon was
observed mainly in sections near the injection site and in the middle of the mediolateral extent of
the SN structure, where the injections were targeted. The mediolateral and anteroposterior
extremes of the SN structure tended to be relatively spared.
We stained TH with two fluorophores, Alexa 594 (red) and Alexa 350 (blue) to try and
rule out problems with a specific fluorophore or fluorescence channel, but the results were
identical in both channels. The pattern of TH immunoreactivity following AAV-shBAG5
injection will require further investigation with a larger sample size.
66
2.4.9 Effects of pre-injected AAV-shBAG5 following MFBx
Seven days following MFBx, AAV-shBAG5 Control-injected rats demonstrated a 42%
preservation of TH immunoreactivity (Fig. 11). This figure is very similar to the report by
Crocker et al of 44% TH preservation using adeno-virus overexpressing β-galactosidase (as a
control in their study)23. However, others have reported that in non-injected SNc at 7 days post-
MFBx, TH immunoreactivity only falls to around 70% of contralateral24,25, implying that virus
injection and/or protein overexpression does result in some toxicity in rat SN.
Despite this apparent toxicity, both targeting AAVs significantly mitigated TH loss
following MFBx, suggesting a protective effect of BAG5 knockdown (Fig. 11). In support of
this, clone C significantly preserved loss of mature neurons (NeuN+) in the injected SN, while
clone G1 trended toward reducing NeuN loss. This difference between the two targeting AAVs
could be due to a lack of statistical power, in which case future studies may consider expanding
the sample size. It is also possible that the two targeting AAVs have slightly different off-target
effects that impact neuronal survival/NeuN expression, since the shRNA targeting sequences are
different.
These results again confirm successful BAG5 knockdown and demonstrate that the levels
of BAG5 knockdown produced by our AAVs, though not formally quantified, were sufficient to
achieve measurable and relevant biological effects. Additionally, they show that the protective
effects of the targeting AAVs in the MFBx model outweigh potential GFP-mediated toxicity at
the 1/2 titer.
67
Chapter 3: General Discussion and Conclusion 3
3.1 Summary
The aim of this thesis was to develop and characterize a viral vector that could produce
shRNA-mediated BAG5 knockdown in rat substantia nigra. We set out to accomplish this in two
chapters. In chapter 1, we identified efficient shRNAs against BAG5 from a pool of candidates
and packaged them, along with a non-targeting Control, in lentivirus and AAV vectors. We
confirmed that the AAVs were able to infect primary neurons and knock down BAG5.
In chapter 2, we tested the LV and AAV vectors in rats, but discovered that the LVs did
not express in the rat brain, despite LV being an established vector for gene delivery in the rat
brain. By contrast, the AAV vectors achieved strong expression throughout the extent of the
substantia nigra. Upon analysis of sections close to the injection site, both clones of targeting
AAV-shBAG5 were able to knock down BAG5 at two different dilutions. Finally, pre-injection
of either targeting AAV-shBAG5 vectors resulted in significant protection from axotomy-
induced dopaminergic degeneration.
To our knowledge, this is work is among the first to study shRNA delivery to the rat
substantia nigra using the AAV1/2 serotype. The only published study to date using specifically
AAV1/2 to deliver shRNA in vivo targeted the red nucleus in rats41. Our work contributes to a
rapidly emerging body of research demonstrating the effectiveness of AAV1/2 as an shRNA
delivery vector in animal experiments. As gene therapy delivery research moves forward, it will
be important to understand the performance of different AAV serotypes in vivo as one of several
dimensions of spatiotemporal control.
68
3.2 Limitations
Firstly, it is worth noting that we studied knockdown but not knockout, and these two
conditions may have different phenotypes67. We did not formally quantify BAG5 knockdown,
and did not formally demonstrate knockdown throughout the entire SN, since we only analyzed
MTN-containing sections. Thus, it is possible that our current injection target and titer does
produce sufficiently great or widespread knockdown to exert the full phenotypic effects of
BAG5 inhibition. Performing multiple injections or increasing titer may resolve some of these
potential issues, but these modifications come with their own risks, such as increased toxicity
from GFP load, or physical damage to the tissue from injecting larger volumes of liquid.
Despite having demonstrated some protective effects of BAG5 knockdown with
histological analyses, we did not show that this effect translates to functional improvement with
behavioural tests. Again, it is thus unclear how impactful our attained levels of BAG5
knockdown will be in terms of improving behavioural deficits when applied in animal models of
PD.
As with any animal model, the MFBx model is limited in how well it can represent
human disease states. Other rat models that better recapitulate some of the molecular features of
PD, such as the presence of human αSyn, have recently gained favour over MFBx as models of
PD in rats. However, MFBx is still a useful model of dopaminergic degeneration, and we have
shown that BAG5 knockdown does have biologically relevant consequences in the context of
this particular injury. Accordingly, it has potential to protect dopaminergic neurons in other
contexts of insult, including toxin and protein overexpression-based models of Parkinson’s
disease, though this remains an open question for future investigation.
69
3.3 Future Directions
3.3.1 Human A53T-SNCA overexpression model of PD
Having established successful BAG5 knockdown using our AAV-shBAG5 vectors, and
demonstrated protective effects in the MFBx model of dopaminergic injury, the next step would
be to test this therapeutic strategy in a rat model of PD. The human A53T mutant αSyn
overexpression model of PD (delivered by AAV1/2) is well characterized in terms of motor
phenotype and timeframe of dopaminergic neuron loss, both of which are viral titer-
dependent33,111. We attempted to test the effects of BAG5 knockdown in this model by co-
injecting our AAV-shBAG5 vectors with AAV-A53T-SNCA. However, at 6 weeks post-
injection, the hA53T-SNCA overexpression model did not behave as previously characterized in
terms of behaviour and pathology33,111, so we were unable to interpret the influence of BAG5
knockdown in this system (data not shown). Thus some technical challenges remain to be
addressed before testing our AAV-shBAG5 vectors in this model.
3.3.2 VenusYFP-SNCA bimolecular protein complementation system
The αSyn bimolecular protein complementation system can be used as another rat model
of PD117. In this model, an AAV encoding the N-terminus half of VenusYFP fused to full-length
wild-type human αSyn is co-injected with an AAV encoding αSyn fused to the C-terminus half
of VenusYFP. When the protein products of both AAVs are expressed in the same cell, the
oligomerization of αSyn joins the halves of Venus and produces a fluorescent signal, allowing
for the visualization of αSyn oligomers in vivo. This complementation system has previously
been implemented in rats using an AAV8 vector for delivery117. We are currently working on
characterizing the behavioural and histopathological outcomes of this model of PD when
delivered using AAV1/2 vector. After this, as a future experiment, we could pair this Venus-
αSyn model with our AAV-shBAG5 vectors (expressing RFP rather than GFP to avoid
70
confusion with Venus signal) to evaluate the effects of BAG5 knockdown on motor behaviour
(by rescue of forepaw asymmetry), dopaminergic cell death, and synuclein pathology.
3.4 Conclusion
We have created and characterized an AAV1/2 vector capable of selectively and quite
comprehensively transducing neurons in the rat substantia nigra, producing substantial
knockdown of BAG5 in neurons as early as three weeks post-injection. This work establishes the
foundation for future investigations into the role of BAG5 in the SN, especially in relation to
neurodegeneration and Parkinson’s disease.
71
References
1 Abdullah, R., Basak, I., Patil, K. S., Alves, G., Larsen, J. P. & Moller, S. G. Parkinson's disease and age: The obvious but largely unexplored link. Exp Gerontol 68, 33-38, doi:10.1016/j.exger.2014.09.014 (2015).
2 Kalia, L. V. & Lang, A. E. Parkinson's disease. Lancet, doi:10.1016/S0140-6736(14)61393-3 (2015).
3 Szewczyk-Krolikowski, K., Tomlinson, P., Nithi, K., Wade-Martins, R., Talbot, K., Ben-Shlomo, Y. et al. The influence of age and gender on motor and non-motor features of early Parkinson's disease: initial findings from the Oxford Parkinson Disease Center (OPDC) discovery cohort. Parkinsonism Relat Disord 20, 99-105, doi:10.1016/j.parkreldis.2013.09.025 (2014).
4 Deng, H. X., Shi, Y., Yang, Y., Ahmeti, K. B., Miller, N., Huang, C. et al. Identification of TMEM230 mutations in familial Parkinson's disease. Nat Genet, doi:10.1038/ng.3589 (2016).
5 Connolly, B. S. & Lang, A. E. Pharmacological treatment of Parkinson disease: a review. JAMA 311, 1670-1683, doi:10.1001/jama.2014.3654 (2014).
6 Wang, D. & Gao, G. State-of-the-art human gene therapy: part II. Gene therapy strategies and clinical applications. Discov Med 18, 151-161 (2014).
7 Dong, Z., Wolfer, D. P., Lipp, H. P. & Bueler, H. Hsp70 gene transfer by adeno-associated virus inhibits MPTP-induced nigrostriatal degeneration in the mouse model of Parkinson disease. Mol Ther 11, 80-88, doi:10.1016/j.ymthe.2004.09.007 (2005).
8 Rocha, E. M., Smith, G. A., Park, E., Cao, H., Brown, E., Hayes, M. A. et al. Glucocerebrosidase gene therapy prevents alpha-synucleinopathy of midbrain dopamine neurons. Neurobiol Dis 82, 495-503, doi:10.1016/j.nbd.2015.09.009 (2015).
9 Tian, Y. Y., Tang, C. J., Wang, J. N., Feng, Y., Chen, X. W., Wang, L. et al. Favorable effects of VEGF gene transfer on a rat model of Parkinson disease using adeno-associated viral vectors. Neurosci Lett 421, 239-244, doi:10.1016/j.neulet.2007.05.033 (2007).
10 Du, Y., Zhang, X., Tao, Q., Chen, S. & Le, W. Adeno-associated virus type 2 vector-mediated glial cell line-derived neurotrophic factor gene transfer induces neuroprotection and neuroregeneration in a ubiquitin-proteasome system impairment animal model of Parkinson's disease. Neurodegener Dis 11, 113-128, doi:10.1159/000334527 (2013).
11 Herzog, C. D., Brown, L., Kruegel, B. R., Wilson, A., Tansey, M. G., Gage, F. H. et al. Enhanced neurotrophic distribution, cell signaling and neuroprotection following substantia nigral versus striatal delivery of AAV2-NRTN (CERE-120). Neurobiol Dis 58, 38-48, doi:10.1016/j.nbd.2013.04.011 (2013).
72
12 Khodr, C. E., Sapru, M. K., Pedapati, J., Han, Y., West, N. C., Kells, A. P. et al. An alpha-synuclein AAV gene silencing vector ameliorates a behavioral deficit in a rat model of Parkinson's disease, but displays toxicity in dopamine neurons. Brain Res 1395, 94-107, doi:10.1016/j.brainres.2011.04.036 (2011).
13 Zharikov, A. D., Cannon, J. R., Tapias, V., Bai, Q., Horowitz, M. P., Shah, V. et al. shRNA targeting alpha-synuclein prevents neurodegeneration in a Parkinson's disease model. J Clin Invest 125, 2721-2735, doi:10.1172/JCI64502 (2015).
14 Saal, K. A., Koch, J. C., Tatenhorst, L., Szego, E. M., Ribas, V. T., Michel, U. et al. AAV.shRNA-mediated downregulation of ROCK2 attenuates degeneration of dopaminergic neurons in toxin-induced models of Parkinson's disease in vitro and in vivo. Neurobiol Dis 73, 150-162, doi:10.1016/j.nbd.2014.09.013 (2015).
15 Walsh, S., Gavin, A., Wyatt, S., O'Connor, C., Keeshan, K., Nolan, Y. M. et al. Knockdown of interleukin-1 receptor 1 is not neuroprotective in the 6-hydroxydopamine striatal lesion rat model of Parkinson's disease. Int J Neurosci 125, 70-77, doi:10.3109/00207454.2014.904304 (2015).
16 Ojala, D. S., Amara, D. P. & Schaffer, D. V. Adeno-associated virus vectors and neurological gene therapy. Neuroscientist 21, 84-98, doi:10.1177/1073858414521870 (2015).
17 LeWitt, P. A., Rezai, A. R., Leehey, M. A., Ojemann, S. G., Flaherty, A. W., Eskandar, E. N. et al. AAV2-GAD gene therapy for advanced Parkinson's disease: a double-blind, sham-surgery controlled, randomised trial. Lancet Neurol 10, 309-319, doi:10.1016/S1474-4422(11)70039-4 (2011).
18 Marks, W. J., Jr., Ostrem, J. L., Verhagen, L., Starr, P. A., Larson, P. S., Bakay, R. A. et al. Safety and tolerability of intraputaminal delivery of CERE-120 (adeno-associated virus serotype 2-neurturin) to patients with idiopathic Parkinson's disease: an open-label, phase I trial. Lancet Neurol 7, 400-408, doi:10.1016/S1474-4422(08)70065-6 (2008).
19 Warren Olanow, C., Bartus, R. T., Baumann, T. L., Factor, S., Boulis, N., Stacy, M. et al. Gene delivery of neurturin to putamen and substantia nigra in Parkinson disease: A double-blind, randomized, controlled trial. Ann Neurol 78, 248-257, doi:10.1002/ana.24436 (2015).
20 Bartus, R. T., Kordower, J. H., Johnson, E. M., Jr., Brown, L., Kruegel, B. R., Chu, Y. et al. Post-mortem assessment of the short and long-term effects of the trophic factor neurturin in patients with alpha-synucleinopathies. Neurobiol Dis 78, 162-171, doi:10.1016/j.nbd.2015.03.023 (2015).
21 Kalia, L. V., Kalia, S. K. & Lang, A. E. Disease-modifying strategies for Parkinson's disease. Mov Disord 30, 1442-1450, doi:10.1002/mds.26354 (2015).
22 Nieuwenhuys, R., Geeraedts, L. M. & Veening, J. G. The medial forebrain bundle of the rat. I. General introduction. J Comp Neurol 206, 49-81, doi:10.1002/cne.902060106 (1982).
73
23 Crocker, S. J., Lamba, W. R., Smith, P. D., Callaghan, S. M., Slack, R. S., Anisman, H. et al. c-Jun mediates axotomy-induced dopamine neuron death in vivo. Proc Natl Acad Sci U S A 98, 13385-13390, doi:10.1073/pnas.231177098 (2001).
24 Weiser, M., Baker, H., Wessel, T. C. & Joh, T. H. Differential spatial and temporal gene expression in response to axotomy and deafferentation following transection of the medial forebrain bundle. J Neurosci 13, 3472-3484 (1993).
25 Brecknell, J. E., Dunnett, S. B. & Fawcett, J. W. A quantitative study of cell death in the substantia nigra following a mechanical lesion of the medial forebrain bundle. Neuroscience 64, 219-227 (1995).
26 Beck, K. D., Valverde, J., Alexi, T., Poulsen, K., Moffat, B., Vandlen, R. A. et al. Mesencephalic dopaminergic neurons protected by GDNF from axotomy-induced degeneration in the adult brain. Nature 373, 339-341, doi:10.1038/373339a0 (1995).
27 Chang, J. W., Wachtel, S. R., Young, D. & Kang, U. J. Biochemical and anatomical characterization of forepaw adjusting steps in rat models of Parkinson's disease: studies on medial forebrain bundle and striatal lesions. Neuroscience 88, 617-628 (1999).
28 Tseng, J. L., Bruhn, S. L., Zurn, A. D. & Aebischer, P. Neurturin protects dopaminergic neurons following medial forebrain bundle axotomy. Neuroreport 9, 1817-1822 (1998).
29 Lu, J., Sun, F., Ma, H., Qing, H. & Deng, Y. Comparison between alpha-synuclein wild-type and A53T mutation in a progressive Parkinson's disease model. Biochem Biophys Res Commun 464, 988-993, doi:10.1016/j.bbrc.2015.07.007 (2015).
30 Moloney, T. C., Hyland, R., O'Toole, D., Paucard, A., Kirik, D., O'Doherty, A. et al. Heat shock protein 70 reduces alpha-synuclein-induced predegenerative neuronal dystrophy in the alpha-synuclein viral gene transfer rat model of Parkinson's disease. CNS Neurosci Ther 20, 50-58, doi:10.1111/cns.12200 (2014).
31 Sanchez-Guajardo, V., Annibali, A., Jensen, P. H. & Romero-Ramos, M. alpha-Synuclein vaccination prevents the accumulation of parkinson disease-like pathologic inclusions in striatum in association with regulatory T cell recruitment in a rat model. J Neuropathol Exp Neurol 72, 624-645, doi:10.1097/NEN.0b013e31829768d2 (2013).
32 Van der Perren, A., Toelen, J., Casteels, C., Macchi, F., Van Rompuy, A. S., Sarre, S. et al. Longitudinal follow-up and characterization of a robust rat model for Parkinson's disease based on overexpression of alpha-synuclein with adeno-associated viral vectors. Neurobiol Aging 36, 1543-1558, doi:10.1016/j.neurobiolaging.2014.11.015 (2015).
33 Koprich, J. B., Johnston, T. H., Reyes, M. G., Sun, X. & Brotchie, J. M. Expression of human A53T alpha-synuclein in the rat substantia nigra using a novel AAV1/2 vector produces a rapidly evolving pathology with protein aggregation, dystrophic neurite architecture and nigrostriatal degeneration with potential to model the pathology of Parkinson's disease. Mol Neurodegener 5, 43, doi:10.1186/1750-1326-5-43 (2010).
74
34 Kabbage, M. & Dickman, M. B. The BAG proteins: a ubiquitous family of chaperone regulators. Cell Mol Life Sci 65, 1390-1402, doi:10.1007/s00018-008-7535-2 (2008).
35 Takayama, S. & Reed, J. C. Molecular chaperone targeting and regulation by BAG family proteins. Nat Cell Biol 3, E237-241, doi:10.1038/ncb1001-e237 (2001).
36 Behl, C. Breaking BAG: The Co-Chaperone BAG3 in Health and Disease. Trends Pharmacol Sci, doi:10.1016/j.tips.2016.04.007 (2016).
37 Arakawa, A., Handa, N., Ohsawa, N., Shida, M., Kigawa, T., Hayashi, F. et al. The C-terminal BAG domain of BAG5 induces conformational changes of the Hsp70 nucleotide-binding domain for ADP-ATP exchange. Structure 18, 309-319, doi:10.1016/j.str.2010.01.004 (2010).
38 Bruchmann, A., Roller, C., Walther, T. V., Schafer, G., Lehmusvaara, S., Visakorpi, T. et al. Bcl-2 associated athanogene 5 (Bag5) is overexpressed in prostate cancer and inhibits ER-stress induced apoptosis. BMC Cancer 13, 96, doi:10.1186/1471-2407-13-96 (2013).
39 Gupta, M. K., Tahrir, F. G., Knezevic, T., White, M. K., Gordon, J., Cheung, J. Y. et al. GRP78 Interacting Partner Bag5 Responds to ER Stress and Protects Cardiomyocytes From ER Stress-Induced Apoptosis. J Cell Biochem 117, 1813-1821, doi:10.1002/jcb.25481 (2016).
40 Gotz, R., Wiese, S., Takayama, S., Camarero, G. C., Rossoll, W., Schweizer, U. et al. Bag1 is essential for differentiation and survival of hematopoietic and neuronal cells. Nat Neurosci 8, 1169-1178, doi:10.1038/nn1524 (2005).
41 Challagundla, M., Koch, J. C., Ribas, V. T., Michel, U., Kugler, S., Ostendorf, T. et al. AAV-mediated expression of BAG1 and ROCK2-shRNA promote neuronal survival and axonal sprouting in a rat model of rubrospinal tract injury. J Neurochem 134, 261-275, doi:10.1111/jnc.13102 (2015).
42 Yue, X., Zhao, Y., Liu, J., Zhang, C., Yu, H., Wang, J. et al. BAG2 promotes tumorigenesis through enhancing mutant p53 protein levels and function. Elife 4, doi:10.7554/eLife.08401 (2015).
43 Che, X., Tang, B., Wang, X., Chen, D., Yan, X., Jiang, H. et al. The BAG2 Protein Stabilises PINK1 By Decreasing its Ubiquitination. Biochem Biophys Res Commun, doi:10.1016/j.bbrc.2013.10.086 (2013).
44 Arndt, V., Daniel, C., Nastainczyk, W., Alberti, S. & Hohfeld, J. BAG-2 acts as an inhibitor of the chaperone-associated ubiquitin ligase CHIP. Mol Biol Cell 16, 5891-5900, doi:10.1091/mbc.E05-07-0660 (2005).
45 Carrettiero, D. C., Hernandez, I., Neveu, P., Papagiannakopoulos, T. & Kosik, K. S. The cochaperone BAG2 sweeps paired helical filament- insoluble tau from the microtubule. J Neurosci 29, 2151-2161, doi:10.1523/JNEUROSCI.4660-08.2009 (2009).
75
46 Konersman, C. G., Bordini, B. J., Scharer, G., Lawlor, M. W., Zangwill, S., Southern, J. F. et al. BAG3 myofibrillar myopathy presenting with cardiomyopathy. Neuromuscul Disord 25, 418-422, doi:10.1016/j.nmd.2015.01.009 (2015).
47 Shi, H., Xu, H., Li, Z., Zhen, Y., Wang, B., Huo, S. et al. BAG3 regulates cell proliferation, migration, and invasion in human colorectal cancer. Tumour Biol 37, 5591-5597, doi:10.1007/s13277-015-4403-1 (2016).
48 Mani, J., Antonietti, P., Rakel, S., Blaheta, R., Bartsch, G., Haferkamp, A. et al. Knockdown of BAG3 sensitizes bladder cancer cells to treatment with the BH3 mimetic ABT-737. World J Urol 34, 197-205, doi:10.1007/s00345-015-1616-2 (2016).
49 Minoia, M., Boncoraglio, A., Vinet, J., Morelli, F. F., Brunsting, J. F., Poletti, A. et al. BAG3 induces the sequestration of proteasomal clients into cytoplasmic puncta: implications for a proteasome-to-autophagy switch. Autophagy 10, 1603-1621, doi:10.4161/auto.29409 (2014).
50 Eichholtz-Wirth, H. & Sagan, D. Altered signaling of TNFalpha-TNFR1 and SODD/BAG4 is responsible for radioresistance in human HT-R15 cells. Anticancer Res 22, 235-240 (2002).
51 Eichholtz-Wirth, H., Fritz, E. & Wolz, L. Overexpression of the 'silencer of death domain', SODD/BAG-4, modulates both TNFR1- and CD95-dependent cell death pathways. Cancer Lett 194, 81-89 (2003).
52 Mock, J. Y., Chartron, J. W., Zaslaver, M., Xu, Y., Ye, Y. & Clemons, W. M., Jr. Bag6 complex contains a minimal tail-anchor-targeting module and a mock BAG domain. Proc Natl Acad Sci U S A 112, 106-111, doi:10.1073/pnas.1402745112 (2015).
53 Corduan, A., Lecomte, S., Martin, C., Michel, D. & Desmots, F. Sequential interplay between BAG6 and HSP70 upon heat shock. Cell Mol Life Sci 66, 1998-2004, doi:10.1007/s00018-009-9198-z (2009).
54 Chen, J., Zang, Y. S. & Xiu, Q. BAT3 rs1052486 and rs3117582 polymorphisms are associated with lung cancer risk: a meta-analysis. Tumour Biol 35, 9855-9858, doi:10.1007/s13277-014-1912-2 (2014).
55 Saresella, M., Piancone, F., Marventano, I., La Rosa, F., Tortorella, P., Caputo, D. et al. A role for the TIM-3/GAL-9/BAT3 pathway in determining the clinical phenotype of multiple sclerosis. FASEB J 28, 5000-5009, doi:10.1096/fj.14-258194 (2014).
56 Kalia, S. K., Lee, S., Smith, P. D., Liu, L., Crocker, S. J., Thorarinsdottir, T. E. et al. BAG5 inhibits parkin and enhances dopaminergic neuron degeneration. Neuron 44, 931-945, doi:10.1016/j.neuron.2004.11.026 (2004).
57 Wang, X., Guo, J., Fei, E., Mu, Y., He, S., Che, X. et al. BAG5 protects against mitochondrial oxidative damage through regulating PINK1 degradation. PLoS One 9, e86276, doi:10.1371/journal.pone.0086276 (2014).
76
58 Kelly, J. L., Novak, A. J., Fredericksen, Z. S., Liebow, M., Ansell, S. M., Dogan, A. et al. Germline variation in apoptosis pathway genes and risk of non-Hodgkin's lymphoma. Cancer Epidemiol Biomarkers Prev 19, 2847-2858, doi:10.1158/1055-9965.EPI-10-0581 (2010).
59 Hasson, S. A., Kane, L. A., Yamano, K., Huang, C. H., Sliter, D. A., Buehler, E. et al. High-content genome-wide RNAi screens identify regulators of parkin upstream of mitophagy. Nature 504, 291-295, doi:10.1038/nature12748 (2013).
60 Beilina, A., Rudenko, I. N., Kaganovich, A., Civiero, L., Chau, H., Kalia, S. K. et al. Unbiased screen for interactors of leucine-rich repeat kinase 2 supports a common pathway for sporadic and familial Parkinson disease. Proc Natl Acad Sci U S A 111, 2626-2631, doi:10.1073/pnas.1318306111 (2014).
61 Kalia, L. V., Kalia, S. K., Chau, H., Lozano, A. M., Hyman, B. T. & McLean, P. J. Ubiquitinylation of alpha-synuclein by carboxyl terminus Hsp70-interacting protein (CHIP) is regulated by Bcl-2-associated athanogene 5 (BAG5). PLoS One 6, e14695, doi:10.1371/journal.pone.0014695 (2011).
62 Zheng, X. Y., Yang, M., Tan, J. Q., Pan, Q., Long, Z. G., Dai, H. P. et al. Screening of LRRK2 interactants by yeast 2-hybrid analysis. Zhong Nan Da Xue Xue Bao Yi Xue Ban 33, 883-891 (2008).
63 Auluck, P. K., Chan, H. Y., Trojanowski, J. Q., Lee, V. M. & Bonini, N. M. Chaperone suppression of alpha-synuclein toxicity in a Drosophila model for Parkinson's disease. Science 295, 865-868, doi:10.1126/science.1067389 (2002).
64 Flower, T. R., Chesnokova, L. S., Froelich, C. A., Dixon, C. & Witt, S. N. Heat shock prevents alpha-synuclein-induced apoptosis in a yeast model of Parkinson's disease. J Mol Biol 351, 1081-1100, doi:10.1016/j.jmb.2005.06.060 (2005).
65 Klucken, J., Shin, Y., Masliah, E., Hyman, B. T. & McLean, P. J. Hsp70 Reduces alpha-Synuclein Aggregation and Toxicity. J Biol Chem 279, 25497-25502, doi:10.1074/jbc.M400255200 (2004).
66 Lorenc-Koci, E., Lenda, T., Antkiewicz-Michaluk, L., Wardas, J., Domin, H., Smialowska, M. et al. Different effects of intranigral and intrastriatal administration of the proteasome inhibitor lactacystin on typical neurochemical and histological markers of Parkinson's disease in rats. Neurochem Int 58, 839-849, doi:10.1016/j.neuint.2011.03.013 (2011).
67 Boettcher, M. & McManus, M. T. Choosing the Right Tool for the Job: RNAi, TALEN, or CRISPR. Mol Cell 58, 575-585, doi:10.1016/j.molcel.2015.04.028 (2015).
68 Ge, Q., Ilves, H., Dallas, A., Kumar, P., Shorenstein, J., Kazakov, S. A. et al. Minimal-length short hairpin RNAs: the relationship of structure and RNAi activity. RNA 16, 106-117, doi:10.1261/rna.1894510 (2010).
77
69 Shim, M. S. & Kwon, Y. J. Efficient and targeted delivery of siRNA in vivo. FEBS J 277, 4814-4827, doi:10.1111/j.1742-4658.2010.07904.x (2010).
70 Evers, M. M., Toonen, L. J. & van Roon-Mom, W. M. Antisense oligonucleotides in therapy for neurodegenerative disorders. Adv Drug Deliv Rev 87, 90-103, doi:10.1016/j.addr.2015.03.008 (2015).
71 Bennett, C. F. & Swayze, E. E. RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Annu Rev Pharmacol Toxicol 50, 259-293, doi:10.1146/annurev.pharmtox.010909.105654 (2010).
72 Goodchild, J. Therapeutic oligonucleotides. Methods Mol Biol 764, 1-15, doi:10.1007/978-1-61779-188-8_1 (2011).
73 Sternberg, N. & Hamilton, D. Bacteriophage P1 site-specific recombination. I. Recombination between loxP sites. J Mol Biol 150, 467-486 (1981).
74 Kratochwil, C. F. & Rijli, F. M. The Cre/Lox system to assess the development of the mouse brain. Methods Mol Biol 1082, 295-313, doi:10.1007/978-1-62703-655-9_20 (2014).
75 Sauer, B. Inducible gene targeting in mice using the Cre/lox system. Methods 14, 381-392, doi:10.1006/meth.1998.0593 (1998).
76 Theodosiou, N. A. & Xu, T. Use of FLP/FRT system to study Drosophila development. Methods 14, 355-365, doi:10.1006/meth.1998.0591 (1998).
77 Luo, Y., Wang, Y., Liu, J., Cui, C., Wu, Y., Lan, H. et al. Generation of TALE nickase-mediated gene-targeted cows expressing human serum albumin in mammary glands. Sci Rep 6, 20657, doi:10.1038/srep20657 (2016).
78 Heidenreich, M. & Zhang, F. Applications of CRISPR-Cas systems in neuroscience. Nat Rev Neurosci 17, 36-44, doi:10.1038/nrn.2015.2 (2016).
79 Ul Ain, Q., Chung, J. Y. & Kim, Y. H. Current and future delivery systems for engineered nucleases: ZFN, TALEN and RGEN. J Control Release 205, 120-127, doi:10.1016/j.jconrel.2014.12.036 (2015).
80 Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A. & Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821, doi:10.1126/science.1225829 (2012).
81 Barakate, A. & Stephens, J. An Overview of CRISPR-Based Tools and Their Improvements: New Opportunities in Understanding Plant-Pathogen Interactions for Better Crop Protection. Front Plant Sci 7, 765, doi:10.3389/fpls.2016.00765 (2016).
82 Tsai, S. Q., Wyvekens, N., Khayter, C., Foden, J. A., Thapar, V., Reyon, D. et al. Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol 32, 569-576, doi:10.1038/nbt.2908 (2014).
78
83 Nayerossadat, N., Maedeh, T. & Ali, P. A. Viral and nonviral delivery systems for gene delivery. Adv Biomed Res 1, 27, doi:10.4103/2277-9175.98152 (2012).
84 Cronin, J., Zhang, X. Y. & Reiser, J. Altering the tropism of lentiviral vectors through pseudotyping. Curr Gene Ther 5, 387-398 (2005).
85 Kantor, B., Bailey, R. M., Wimberly, K., Kalburgi, S. N. & Gray, S. J. Methods for gene transfer to the central nervous system. Adv Genet 87, 125-197, doi:10.1016/B978-0-12-800149-3.00003-2 (2014).
86 Deyle, D. R. & Russell, D. W. Adeno-associated virus vector integration. Curr Opin Mol Ther 11, 442-447 (2009).
87 Salganik, M., Hirsch, M. L. & Samulski, R. J. Adeno-associated Virus as a Mammalian DNA Vector. Microbiol Spectr 3, doi:10.1128/microbiolspec.MDNA3-0052-2014 (2015).
88 Nie, D. & Sahin, M. A genetic model to dissect the role of Tsc-mTORC1 in neuronal cultures. Methods Mol Biol 821, 393-405, doi:10.1007/978-1-61779-430-8_25 (2012).
89 Herrero, J., Muffato, M., Beal, K., Fitzgerald, S., Gordon, L., Pignatelli, M. et al. Ensembl comparative genomics resources. Database (Oxford) 2016, doi:10.1093/database/bav096 (2016).
90 Wild, E. J. & Tabrizi, S. J. Targets for future clinical trials in Huntington's disease: what's in the pipeline? Mov Disord 29, 1434-1445, doi:10.1002/mds.26007 (2014).
91 Barrangou, R., Birmingham, A., Wiemann, S., Beijersbergen, R. L., Hornung, V. & Smith, A. Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference. Nucleic Acids Res 43, 3407-3419, doi:10.1093/nar/gkv226 (2015).
92 Lee, J. H., Ahn, H. H., Kim, K. S., Lee, J. Y., Kim, M. S., Lee, B. et al. Polyethyleneimine-mediated gene delivery into rat pheochromocytoma PC-12 cells. J Tissue Eng Regen Med 2, 288-295, doi:10.1002/term.94 (2008).
93 Cogli, L., Progida, C., Lecci, R., Bramato, R., Kruttgen, A. & Bucci, C. CMT2B-associated Rab7 mutants inhibit neurite outgrowth. Acta Neuropathol 120, 491-501, doi:10.1007/s00401-010-0696-8 (2010).
94 Covello, G., Siva, K., Adami, V. & Denti, M. A. An electroporation protocol for efficient DNA transfection in PC12 cells. Cytotechnology 66, 543-553, doi:10.1007/s10616-013-9608-9 (2014).
95 Lin, C. Y., Huang, Z., Wen, W., Wu, A., Wang, C. & Niu, L. Enhancing Protein Expression in HEK-293 Cells by Lowering Culture Temperature. PLoS One 10, e0123562, doi:10.1371/journal.pone.0123562 (2015).
96 de Los Milagros Bassani Molinas, M., Beer, C., Hesse, F., Wirth, M. & Wagner, R. Optimizing the transient transfection process of HEK-293 suspension cells for protein
79
production by nucleotide ratio monitoring. Cytotechnology 66, 493-514, doi:10.1007/s10616-013-9601-3 (2014).
97 Cambridge, S. B., Gnad, F., Nguyen, C., Bermejo, J. L., Kruger, M. & Mann, M. Systems-wide proteomic analysis in mammalian cells reveals conserved, functional protein turnover. J Proteome Res 10, 5275-5284, doi:10.1021/pr101183k (2011).
98 Eden, E., Geva-Zatorsky, N., Issaeva, I., Cohen, A., Dekel, E., Danon, T. et al. Proteome half-life dynamics in living human cells. Science 331, 764-768, doi:10.1126/science.1199784 (2011).
99 Schwanhausser, B., Busse, D., Li, N., Dittmar, G., Schuchhardt, J., Wolf, J. et al. Global quantification of mammalian gene expression control. Nature 473, 337-342, doi:10.1038/nature10098 (2011).
100 Zhou, P. Determining protein half-lives. Methods Mol Biol 284, 67-77, doi:10.1385/1-59259-816-1:067 (2004).
101 Gilda, J. E. & Gomes, A. V. Western blotting using in-gel protein labeling as a normalization control: stain-free technology. Methods Mol Biol 1295, 381-391, doi:10.1007/978-1-4939-2550-6_27 (2015).
102 Thacker, J. S., Yeung, D. H., Staines, W. R. & Mielke, J. G. Total protein or high-abundance protein: Which offers the best loading control for Western blotting? Anal Biochem 496, 76-78, doi:10.1016/j.ab.2015.11.022 (2016).
103 Welinder, C. & Ekblad, L. Coomassie staining as loading control in Western blot analysis. J Proteome Res 10, 1416-1419, doi:10.1021/pr1011476 (2011).
104 Zu, Y., Huang, S., Liao, W. C., Lu, Y. & Wang, S. Gold nanoparticles enhanced electroporation for mammalian cell transfection. J Biomed Nanotechnol 10, 982-992 (2014).
105 Basu, S., Campbell, H. M., Dittel, B. N. & Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp, doi:10.3791/1546 (2010).
106 Sorensen, T. U., Gram, G. J., Nielsen, S. D. & Hansen, J. E. Safe sorting of GFP-transduced live cells for subsequent culture using a modified FACS vantage. Cytometry 37, 284-290 (1999).
107 Marjanovic, I., Kanduser, M., Miklavcic, D., Keber, M. M. & Pavlin, M. Comparison of flow cytometry, fluorescence microscopy and spectrofluorometry for analysis of gene electrotransfer efficiency. J Membr Biol 247, 1259-1267, doi:10.1007/s00232-014-9714-4 (2014).
108 Holmes, K., Williams, C. M., Chapman, E. A. & Cross, M. J. Detection of siRNA induced mRNA silencing by RT-qPCR: considerations for experimental design. BMC Res Notes 3, 53, doi:10.1186/1756-0500-3-53 (2010).
80
109 Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9, 671-675 (2012).
110 Kiyota, T., Yamamoto, M., Schroder, B., Jacobsen, M. T., Swan, R. J., Lambert, M. P. et al. AAV1/2-mediated CNS gene delivery of dominant-negative CCL2 mutant suppresses gliosis, beta-amyloidosis, and learning impairment of APP/PS1 mice. Mol Ther 17, 803-809, doi:10.1038/mt.2009.44 (2009).
111 Koprich, J. B., Johnston, T. H., Huot, P., Reyes, M. G., Espinosa, M. & Brotchie, J. M. Progressive neurodegeneration or endogenous compensation in an animal model of Parkinson's disease produced by decreasing doses of alpha-synuclein. PLoS One 6, e17698, doi:10.1371/journal.pone.0017698 (2011).
112 Harms, A. S., Barnum, C. J., Ruhn, K. A., Varghese, S., Trevino, I., Blesch, A. et al. Delayed dominant-negative TNF gene therapy halts progressive loss of nigral dopaminergic neurons in a rat model of Parkinson's disease. Mol Ther 19, 46-52, doi:10.1038/mt.2010.217 (2011).
113 Yin, X. F., Xu, H. M., Jiang, Y. X., Zhi, Y. L., Liu, Y. X., Xiang, H. W. et al. Lentivirus-mediated Persephin over-expression in Parkinson's disease rats. Neural Regen Res 10, 1814-1818, doi:10.4103/1673-5374.170309 (2015).
114 Cordero-Llana, O., Houghton, B. C., Rinaldi, F., Taylor, H., Yanez-Munoz, R. J., Uney, J. B. et al. Enhanced efficacy of the CDNF/MANF family by combined intranigral overexpression in the 6-OHDA rat model of Parkinson's disease. Mol Ther 23, 244-254, doi:10.1038/mt.2014.206 (2015).
115 Kiyota, T., Ingraham, K. L., Swan, R. J., Jacobsen, M. T., Andrews, S. J. & Ikezu, T. AAV serotype 2/1-mediated gene delivery of anti-inflammatory interleukin-10 enhances neurogenesis and cognitive function in APP+PS1 mice. Gene Ther 19, 724-733, doi:10.1038/gt.2011.126 (2012).
116 Buchlis, G., Podsakoff, G. M., Radu, A., Hawk, S. M., Flake, A. W., Mingozzi, F. et al. Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer. Blood 119, 3038-3041, doi:10.1182/blood-2011-09-382317 (2012).
117 Dimant, H., Kalia, S. K., Kalia, L. V., Zhu, L. N., Kibuuka, L., Ebrahimi-Fakhari, D. et al. Direct detection of alpha synuclein oligomers in vivo. Acta Neuropathol Commun 1, 6, doi:10.1186/2051-5960-1-6 (2013).
118 Jackson, A. L. & Linsley, P. S. Recognizing and avoiding siRNA off-target effects for target identification and therapeutic application. Nat Rev Drug Discov 9, 57-67, doi:10.1038/nrd3010 (2010).
119 Wang, X., Wang, X., Varma, R. K., Beauchamp, L., Magdaleno, S. & Sendera, T. J. Selection of hyperfunctional siRNAs with improved potency and specificity. Nucleic Acids Res 37, e152, doi:10.1093/nar/gkp864 (2009).
81
120 Khan, A. A., Betel, D., Miller, M. L., Sander, C., Leslie, C. S. & Marks, D. S. Transfection of small RNAs globally perturbs gene regulation by endogenous microRNAs. Nat Biotechnol 27, 549-555, doi:10.1038/nbt.1543 (2009).
121 Maraschi, A., Ciammola, A., Folci, A., Sassone, F., Ronzitti, G., Cappelletti, G. et al. Parkin regulates kainate receptors by interacting with the GluK2 subunit. Nat Commun 5, 5182, doi:10.1038/ncomms6182 (2014).
122 Salvatore, M. F., Pruett, B. S., Dempsey, C. & Fields, V. Comprehensive profiling of dopamine regulation in substantia nigra and ventral tegmental area. J Vis Exp, doi:10.3791/4171 (2012).
123 Parkinson, G. M., Dayas, C. V. & Smith, D. W. Age-related gene expression changes in substantia nigra dopamine neurons of the rat. Mech Ageing Dev 149, 41-49, doi:10.1016/j.mad.2015.06.002 (2015).
124 Parkinson, G. M., Dayas, C. V. & Smith, D. W. Increased mitochondrial DNA deletions in substantia nigra dopamine neurons of the aged rat. Curr Aging Sci 7, 155-160 (2014).
125 Klein, R. L., Dayton, R. D., Leidenheimer, N. J., Jansen, K., Golde, T. E. & Zweig, R. M. Efficient neuronal gene transfer with AAV8 leads to neurotoxic levels of tau or green fluorescent proteins. Mol Ther 13, 517-527, doi:10.1016/j.ymthe.2005.10.008 (2006).
![MolecularandCellularAlterationsinDownSyndrome ...Cortex, brain Ts65Dn 8d Vip, Vipr1 Q[40] Total brain Ts65Dn 1m 62% of 3-copy genes Q[18] Hippocampus, frontal cortex, substantia nigra](https://img.pdfslide.us/doc/110x75/60e20dfd79a719230774a01c/molecularandcellularalterationsindownsyndrome-cortex-brain-ts65dn-8d-vip-vipr1.jpg)
