Detection of Periodontal Pathogensin Oral Mucous Membranesof Edentulous IndividualsJose Roberto Cortelli,* Davi Romeiro Aquino,* Sheila Cavalca Cortelli,* Gilson Cesar NobreFranco,* Camila Borges Fernandes,* Caio Vinıcius Goncxalves Roman-Torres,*and Fernando Oliveira Costa†

Background: The purpose of this study was to investigatethe colonization of Campylobacter rectus, Porphyromonas gin-givalis, Aggregatibacter actinomycetemcomitans (previouslyActinobacillus actinomycetemcomitans), Prevotella interme-dia, and Tannerella forsythia (previously T. forsythensis) inthe tongue and cheek of newborns and elderly individualswith no teeth.

Methods: Seventy-four edentulous subjects were includedin this cross-sectional study. Microbiologic samples weretaken from the dorsum of the tongue and cheek mucosa ofall individuals and analyzed using a bacterial DNA-specificpolymerase chain reaction.

Results: C. rectus was the most prevalent species in bothgroups (20.9% in the cheek of newborns, and 77.4% in thetongue of elderly subjects). P. gingivalis and P. intermediawere not detected in any of the 43 newborns; however, P. gin-givalis was recovered from the tongue and cheek (3.2%) ofelderly individuals, whereas P. intermedia was detected in thetongue (9.6%) and cheek (3.2%) of elderly individuals. T. for-sythia was detected in newborns as well as elderly individuals,although the highest prevalence was observed in the tongue ofnewborns (6.9%) and elderly (9.6%) individuals. A. actinomy-cetemcomitans was not found in the tongue of newborns, butwe observed A. actinomycetemcomitans in the cheek (2.3%)of newborns and in the tongue (12.9%) and cheek (6.4%) of el-derly patients.

Conclusions: Although we did not detect P. gingivalis andP. intermedia in newborns, periodontal pathogens could bedetected from the oral mucous membranes of edentulous in-dividuals. Our results suggest that major attention should bepaid to edentulous individuals as an important measure inthe prevention of the initial colonization of natural teeth anddental implants by periodontal pathogens. J Periodontol 2008;79:1962-1965.

KEY WORDS

Bacteria; cross-sectional studies; elderly; epidemiology;newborn.

The mouth represents a variety ofdifferent ecologic situations, withage corresponding to the changes

in the composition of the normal micro-biota. During the first days of life, the col-onization of the host surfaces by variousbacteria starts, and gradually, a subset ofthese forms the indigenous microbiota,which constitute an integral componentof the function of each body site. Strep-tococcus salivarius is dominant and maymake up 98% of the total oral microbiotauntil the appearance of the teeth. Theeruption of the teeth during the first yearof life leads to colonization by Streptococ-cus mutans and Streptococcus sanguis.The remaining bacteria are primarilyGram-positive rods, whereas other strep-tococci adhere to the gums and cheek butnot to the teeth.1

During childhood, the formation of thegingival sulcus will provide a favorablehabitat for anaerobic species. Besidesother bacterial species, Aggregatibacteractinomycetemcomitans (previously Ac-tinobacillus actinomycetemcomitans) andCampylobacter rectus were found as com-mon members of the oral microbiota ofhealthy children, whereas Porphyromo-nas gingivalis and Prevotella intermediaappear to be transient organisms.2

The complexity of the oral microbiotacontinues to increase with time, althoughdependentonothervariables.3 Inaddition,the complete loss of teeth may eliminate

* Department of Dentistry, University of Taubate, Taubate, SP, Brazil.† Federal University of Minas Gerais, Belo Horizonte, MG, Brazil.

doi: 10.1902/jop.2008.080092

Volume 79 • Number 10

1962

some pathogenic bacteria due to an unsuitable micro-environment.4 Finally, in partially edentulous patients,it was suggested that proper periodontal infection con-trol before installment of dental implants may preventbacterial complications5 related to the early coloniza-tion previously reported.6

Although bacteria can colonize different surfaceswithin the oral cavity,7 only a few studies, as reviewed bySachdeo et al.,8 considered the presence of periodon-topathogens in edentulous individuals. Therefore, thepresent cross-sectional study evaluated the presenceof C. rectus, P. gingivalis, A. actinomycetemcomitans,P. intermedia, and Tannerella forsythia (previouslyT. forsythensis) in the cheek and dorsum of the tongueof newborns and elderly patients with no teeth.

MATERIALS AND METHODS

Subjects and Exclusion CriteriaThe eligible population was recruited from 239children who were born at the Taubate University Hos-pital, Vale do Paraıba, SP, Brazil, and 193 elderly sub-jects who were seeking dental implant treatment atthe Dental School of the University of Taubate from2004 to 2006. After screening for the exclusion crite-ria described below, 74 subjects representing variousethnic groups were divided into two groups: newborns(0 to 4 months) with no teeth and elderly subjects (58to 79 years of age) with no teeth (edentulous ‡12months and £36 months).

Medical and dental histories were obtained by indi-vidual self-declarations or by parents on a medicalquestionnaire. Either the subjects themselves or theirlegal guardians signed an informed consent that wasapproved by the University of Taubate’s committeeon research involving humans (protocol 362/03).

One trained and calibrated examiner conducted allclinical visual examinations and collected the micro-bial samples. Subjects presenting any of the followingconditions were excluded from the study: 1) antibi-otics for medical or dental treatment; 2) uncontrolledsystemic diseases; 3) immunologic compromise; 4)antibiotic treatment within 6 months prior to the clin-ical and microbial examination (elderly group); 5)past or current smokers (elderly group); and 6) indi-viduals with no teeth >36 months prior to the study (el-derly group).

Sampling of MicroorganismsMicrobial samples were taken from areas ;1 cm2 us-ing a cotton swab with reduced Ringer’s solution‡ ro-tated six times on the left side of the cheek mucosaand tongue dorsum. Each swab was transferred intoa microtube containing reduced Ringer’s solution(1 ml).

Bacteria-Specific Polymerase ChainReaction (PCR)The bacterial cells in the microtube were dispersed us-inganelectricmixeratmaximalsettingfor1minuteandthen maintained at -80�C until processing. The pres-enceofC.rectus,P.gingivalis,A.actinomycetemcomi-tans, P. intermedia, and T. forsythia was determinedby PCR using specific primer (59-39) sequences de-signed based on 16s ribosomal RNA (Table 1). PCR-mediated DNA amplification and amplicate analysiswere performed as previously published.9

Statistical AnalysisThe frequencies of bacterial species in the tonguedorsum and cheek mucosa were analyzed using thex2 test. The presence of all bacteria in each groupwas evaluated by the Kruskal-Wallis test. All tests wereperformed using statistical software.§i Results weredetermined to be statistically significant at P <0.05.

RESULTS

A totalof43 newborns (25 males and 18 females; meanage: 2.84 – 1.60 months) and 31 elderly subjects (14male and 17 female; mean age: 60.06 – 8.67 years)were examined. Elderly patients were toothless ‡12months but £36 months (23.74 – 7.06 months). Ad-vanced chronic periodontitis (n = 17) was the majorreason for extractions, followed by caries (n = 8), es-thetics/implants (n = 4), and others (n = 2).

The prevalence of bacteria in the tongue dorsumand cheek between newborns and elderly groups didnot show any significant difference (P <0.05). Amongthe bacteria tested, C. rectus showed the highest prev-alence in both groups; and a higher bacteria presenceof C. rectus, P. gingivalis, A. actinomycetemcomitans,P. intermedia, and T. forsythia was observed in the el-derly group than in the newborn group (Fig. 1).

Intragroup analysis revealed that C. rectus was moreprevalent in the cheek mucosa of newborns (20.9%)and in the dorsum of the tongue in the elderly popula-tion (77.4%). However, P. gingivalis and P. intermediawere not detected in the cheek mucosa and dorsum ofthe tongue of newborns. T. forsythia was detected innewborns and elderly subjects, although the highestprevalence was observed in the dorsum of the tonguein newborns and elderly individuals (6.9% and 9.6%,respectively). A. actinomycetemcomitans was foundonly in the cheek (2.3%) of newborns and at both thetongue dorsum (12.9%) and the cheek (6.4%) in el-derly patients.

‡ Oxoid, Basingstoke, Hampshire, U.K.§ SPSS for Windows Release 13.0, SPSS, Chicago, IL.i BioEstat 4.0, Belem, Para, Brazil.

J Periodontol • October 2008 Cortelli, Aquino, Cortelli, et al.

1963

DISCUSSION

The human mouth provides many sites for oral biofilmcolonization,10 and the tongue and the cheek supporttheir own microbial populations that differ from thosefound on the teeth. Although soft tissue harbors peri-odontal pathogens in patients who are partially or to-tally dentate,7 little attention has been paid to totallyedentate individuals.8 This is most likely a result ofmany microorganisms, especially anaerobic patho-gens, disappearing from the oral cavity after teeth ex-traction.4,11,12

Becausenostudy, toour knowledge,has addressedthepossiblepresenceofperiodontalpathogens inbothedentate newborns and elderly subjects, consideringthese pathogens and their associated risk factors with

respect to initial colonization when the teethemerge or dental implants are placed, thepresent study examined the prevalence offive periodontal pathogens in the oral cavityof these two population groups.

An early colonization of C. rectus andT. forsythia was demonstrated in both sitesofnewborns,whereasA. actinomycetemco-mitans was detected at a low prevalenceonly in the cheek (2.3%). However, in el-derly individuals, all bacterial species werenoted in both the tongue and cheek. Ourresults are in agreement with the study ofSachdeo et al.,8 which described microbialecologic relationships in the oral cavity of61 edentulous subjects and evaluated themicrobiota on hard surfaces (palatal sur-faces of dentures and denture teeth), eightsoft tissue surfaces, and saliva samples andfound that the periodontopathogens A. acti-

nomycetemcomitans and P. gingivalis were present insignificant numbers in these subjects. Conversely,Danser et al.13 did not detect A. actinomycetemcomi-tans and P. gingivalis in edentulous subjects. More-over, our results confirmed that, in the mouth,periodontopathogens could adhere to soft tissues,many of them due to the presence of binding factorssuch as fimbriae14 and S-layer.15

In general, there was a higher numeric tendency forthe elderly subjects to have more bacteria comparedto the newborns. However, this difference was statis-tically confirmed only for C. rectus (P = 0.000). Wecan only suppose that the reasons for teeth extraction,lower epithelial desquamation, and lower salivary flowmay have favored a higher bacteria presence amongelderly subjects (Fig. 1).

The presence of pathogens in the tongue dorsumand cheek observed in the present study, except forP. gingivalis and P. intermedia in newborns, indicatesthat it is fundamentally important for dentists to plantherapeuticstrategies toreducethesemicroorganismsbefore either the eruption of the deciduous teeth or in-stallment of dental implants. The early colonization ofdental implants by periodontopathogens in partiallyedentulous patients and the transmission of periodon-tal disease–associated bacteria from teeth to osseoin-tegrated implants are possible.5,6,16 We speculatedthat the presence of periodontal pathogens among el-derly subjects could contribute to the microbial coloni-zation of future implants. This theory is also supportedby Oringer et al.17 After comparison of the presenceand levels of 40 bacterial species between implantsand teeth from partially or fully edentulous patients,theseauthorsdidnotfinddifferences for38species, re-inforcing the concept of teeth being an important res-ervoir for bacterial colonization around implants.

Figure 1.Total prevalence of all periodontal pathogens in newborns and elderlypatients. *Statistically significant difference (P <0.05; Kruskal-Wallistest).

Table 1.

Bacteria-Specific Primers and PCR-ProductSizes (bp)

Bacteria Primer

Base

Pairs

A. actinomycetemcomitans 59AAACCCATCTCTGAGTTCTTCTTC39

59ATGCCAACTTGACGTTAAAT39

550

P. intermedia 59TTTGTTGGGGAGTAAAGCGGG39

59TCAACATCTCTGTATCCTGCGT39

575

P. gingivalis 59AGGCAGCTTGCCATACTGCGG39

59ACTGTTAGCAACTACCGATGT39

404

T. forsythia 59GCGTATGTAACCTGCCCGCA39

59TGCTTCAGTGTCAGTTATACCT39

641

C. rectus 59TTTCGGAGCGTAAACTCCTTTTC39

59TTTCTGCAAGCAGACACTCTT39

598

Colonization of Periodontal Pathogens in Edentulous Individuals Volume 79 • Number 10

1964

CONCLUSIONS

Except for P. gingivalis and P. intermedia, we ob-served the presence of other pathogens in the tongueand cheek of edentulous newborns. The prevalence ofC. rectus, P. gingivalis, A. actinomycetemcomitans,P. intermedia, andT. forsythiademonstrateddifferencesin their colonization in both types of tissues and agegroups. C. rectus showed the higher prevalence in thetongue and cheek mucosa in both groups.

ACKNOWLEDGMENTS

The authors are grateful to the Sao Paulo Foundationfor Research, Sao Paulo, SP, Brazil (grant 04/00256-6), the National Council for Scientific and Technolog-ical Development, Brasılia, DF, Brazil, and JonasCarvalho Filho, technician, Department of MolecularBiology, University of Taubate. The authors report noconflicts of interest related to this study.

REFERENCES1. Kononen E. Anaerobes in the upper respiratory tract in

infancy. Anaerobe 2005;11:131-136.2. Ooshima T, Nishiyama N, Hou B, et al. Occurrence of

periodontal bacteria in healthy children: A 2-yearlongitudinal study. Community Dent Oral Epidemiol2003;31:417-425.

3. Kononen E, Paju S, Pussinen PJ, et al. Population-based study of salivary carriage of periodontal path-ogens in adults. J Clin Microbiol 2007;45:2446-2451.

4. Kononen E, Asikainen S, Alaluusua S, et al. Are cer-tain oral pathogens part of normal oral flora in denture-wearing edentulous subjects? Oral Microbiol Immunol1991;6:119-122.

5. van Winkelhoff AJ, Goene RJ, Benschop C, Folmer T.Early colonization of dental implants by putative peri-odontal pathogens in partially edentulous patients.Clin Oral Implants Res 2000;11:511-520.

6. Furst MM, Salvi GE, Lang NP, Persson GR. Bacterialcolonization immediately after installation of oral im-plants. Clin Oral Implants Res 2007;18:501-508.

7. Mager DL, Ximenez-Fyvie LA, Haffajee AD, SocranskySS. Distribution of selected bacterial species on intra-oral surfaces. J Clin Periodontol 2003;30:644-654.

8. Sachdeo A, Haffajee AD, Socransky SS. Biofilms in theedentulous oral cavity. J Prosthodont 2008;17:348-356.

9. Cortelli JR, Cortelli SC, Jordan S, Haraszthy VI, ZambonJJ. Prevalence of periodontal pathogens in Brazilianswith aggressive or chronic periodontitis. J Clin Peri-odontol 2005;32:860-866.

10. Palmer RJ Jr., Diaz PI, Kolenbrander PE. Biocomplexityin the oral cavity—the basics of structure in supra-gingival bacterial communities. Biofilms 2004;1:329-335.

11. Danser MM, van Winkelhoff AJ, de Graaff J, Loos BG,van der Velden U. Short-term effect of full-mouth ex-traction on periodontal pathogens colonizing the oral mu-cous membranes. J Clin Periodontol 1994;21:484-489.

12. Devides SL, Franco AT. Evaluation of peri-implantmicrobiota using the polymerase chain reaction incompletely edentulous patients before and after place-ment of implant-supported prostheses submitted toimmediate load. Int J Oral Maxillofac Implants 2006;21:262-269.

13. Danser MM, van Winkelhoff AJ, van der Velden U.Periodontal bacteria colonizing oral mucous mem-branes in edentulous patients wearing dental implants.J Periodontol 1997;68:209-216.

14. Watanabe K, Yamaji Y, Umemoto T. Correlation be-tween cell-adherent activity and surface structure inPorphyromonas gingivalis. Oral Microbiol Immunol1992;7:357-363.

15. Wang B, Kraig E, Kolodrubetz D. Use of definedmutants to assess the role of the Campylobacter rectusS-layer in bacterium-epithelial cell interactions. InfectImmun 2000;68:1465-1473.

16. Renvert S, Roos-Jansaker AM, Lindahl C, Renvert H,Rutger Persson G. Infection at titanium implants withor without a clinical diagnosis of inflammation. ClinOral Implants Res 2007;18:509-516.

17. Oringer RJ, Palys MD, Iranmanesh A, et al. C-telopep-tide pyridinoline cross-links (ICTP) and periodontalpathogens associated with endosseous oral implants.Clin Oral Implants Res 1998;9:365-373.

Correspondence: Dr. Jose Roberto Cortelli, Rua Nelson FreireCampelo, 343, Jardim Eulalia, Taubate, CEP 12010-700, SP,Brazil. Fax: 55-12-31526566; e-mail: jrcortelli@uol.com.br.

Submitted February 14, 2008; accepted for publicationApril 8, 2008.

J Periodontol • October 2008 Cortelli, Aquino, Cortelli, et al.

1965