RSC Advances

PAPER

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.

View Article OnlineView Journal | View Issue

Detection of miR

aMedical Photonics Lab, Department of He

Medicine, Aalborg University, Fredrik BajersbSchool of Biological Sciences, University

Norwich, NR4 7TJ, UKcBiosynthesis, 612 East Main Street, LewisvidNanophotonics Technology Center, Univers

Vera S/N, 46022 Valencia, SpaineIDM, Instituto Interuniversitario de Inves

Desarrollo Tecnologico, Departamento d

Valencia, Camino de Vera S/N, 46022 ValenfBiologıa Molecular, Fundacion Instituto VagDepartment of Clinical Medicine, Aalborg U

Aalborg, Denmark. E-mail: nevespetersen@ghDepartment of Biomedical Sciences and M

(CBMR), University of Algarve, Campus de G

† Electronic supplementary informa10.1039/c9ra00081j

Cite this: RSC Adv., 2019, 9, 12766

Received 4th January 2019Accepted 7th April 2019

DOI: 10.1039/c9ra00081j

rsc.li/rsc-advances

12766 | RSC Adv., 2019, 9, 12766–1278

NA cancer biomarkers using lightactivated Molecular Beacons†

Odete Sofia Lopes Gonçalves, a Guy Wheeler,b Tamas Dalmay,b Houquan Dai,c

Miguel Castro,c Patrick Castro,c Jaime Garcıa-Ruperez,d Angela Ruiz-Tortola,d

Amadeu Griol,d Juan Hurtado,d Laurent Bellieres,d Marıa Jose Banuls, e

Daniel Gonzalez, e Jose Antonio Lopez-Guerrerof and Maria Teresa Neves-Petersen *gh

Early detection of cancer biomarkers can reduce cancermortality rate.miRNAs are small non-coding RNAswhose

expression changes upon the onset of various types of cancer. Biosensors that specifically detect such biomarkers

can be engineered and integrated into point-of-care devices (POC) using label-free detection, high sensibility and

compactness. In this paper, a new engineered Molecular Beacon (MB) construct used to detect miRNAs is

presented. Such a construct is immobilized onto biosensor surfaces in a covalent and spatially oriented way

using the photonic technology Light Assisted Molecular Immobilization (LAMI). The construct consists of a Cy3

labelled MB covalently attached to a light-switchable peptide. One MB construct contains a poly-A sequence in

its loop region while the other contains a sequence complementary to the cancer biomarker miRNA-21. The

constructs have been characterized by UV-Vis spectroscopy, mass spectrometry and HPLC. LAMI led to the

successful immobilization of the engineered constructs onto thiol functionalized optically flat quartz slides and

Silicon on Insulator (SOI) sensor surfaces. The immobilized Cy3 labelled MB construct has been imaged using

confocal fluorescence microscopy (CFM). The bioavailability of the immobilized engineered MB biosensors was

confirmed through specific hybridization with the Cy5 labelled complementary sequence and imaged by CFM

and FRET. Hybridization kinetics have been monitored using steady state fluorescence spectroscopy. The label-

free detection of miRNA-21 was also achieved by using integrated photonic sensing structures. The engineered

light sensitive constructs can be immobilized onto thiol reactive surfaces and are currently being integrated in

a POC device for the detection of cancer biomarkers.

1 Introduction

The Globocan report pinpoints that in 2018 there were 18.1million new cancer cases and 9.6 million cancer related deathsworldwide were registered despite advances in current

alth Science and Technology, Faculty of

Vej 7, DK-9220, Aalborg, Denmark

of East Anglia, Norwich Research Park,

lle, TX 75057-4052, USA

itat Politecnica de Valencia, Camino de

tigacion de Reconocimiento Molecular y

e Quımica, Universitat Politecnica de

cia, Spain

lenciano de Oncologıa, Valencia, Spain

niversity Hospital, Hobrovej 18-22, 9000

mail.com; Tel: +45 2252 2475

edicine, Centre for Biomedical Research

ambelas, 8005-139 Faro, Portugal

tion (ESI) available. See DOI:

3

therapies.1,2 The number of new cases is expected to rise by 70%over the next two decades.3 However, the WHO states that mostcancer types have high cure rates when detected early andtreated according to the best practices. Therefore, early andtrustful detection tools for the implementation of preventivescreening programs are crucial for reducing mortality rates.

Nanotechnology allows the engineering of biosensors withimproved performances and functionalities. In particular,nanophotonic technology enables the creation of the coretransduction elements of future high-performance biosensorsproviding high sensitivity, compactness and high integrationlevel, shorter time to result, label-free detection, and reducedsample volumes. In today's point-of-care (POC) market, there isan ever-increasing demand for novel and more efficient devicesfor the early diagnosis of diseases, such as cancer.

New analysis devices for the detection of novel microRNA(miRNA) biomarkers are most useful and needed. miRNAs area class of small non-coding RNAs (z22 nucleotides) whosedysregulation has been correlated with a growing number ofz400 human diseases,4 including cancer, Alzheimer's, Parkin-son's, diabetes, osteoporosis and cardiovascular diseases.

This journal is © The Royal Society of Chemistry 2019

Paper RSC Advances

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

Therefore, the use of miRNA biomarkers will allow the mini-mally invasive early diagnosis of almost 400 diseases. Thetechnologies might be adapted to the diagnosis of any otherdisease associated with miRNA dysregulation by changing theprobe immobilized on the sensor's surface.

Since the discovery of the loss of miRNA-15a andmiRNA-16-1in B-cell chronic lymphocytic leukaemia,5 several studies re-ported changes of miRNA expression in several cancers.6,7

Volinia et al. performed a large-scale miRNome analysis andidentied a large portion of overexpressed miRNAs in solidtumours,8 being miRNA-21, miRNA-191 and miRNA-17-5psignicantly overexpressed in all the considered tumour types.However, they also validated particular miRNA signatures foreach tumour. In recent years, miRNA expression proling hasbeen able to classify between healthy and tumour tissues andeven between different tumour grades.7,9–11 miRNAs have beenfound to be extraordinarily stable in plasma and serumsamples.12 Consequently, circulating miRNAs became potentialcandidates for blood-based biomarkers. Mitchell et al. showedthat serum levels of miRNA-141 signicantly discriminatedpatients with prostate cancer and healthy controls.13 Moreover,other studies demonstrated the up-regulation of miRNA-21,miRNA-141, miRNA-200, miRNA-200c, miRNA-200b, miRNA-203, miRNA-205 and miRNA-214 in circulating cancer exo-somes.4 Some other miRNAs have also been found in extracel-lular uids such as plasma serum, saliva and urine.14

The four varieties of cancer with higher incidence and mortality(z2.7 million deaths worldwide) are: breast, prostate, lung andcolorectal cancers.15 miRNA-21 is overexpressed in most humantumours, including the abovementioned cancers. Our main goal isthe detection of miRNA-21 using an engineered Molecular Beacon(MB) probe immobilized on a sensor surface using Light AssistedMolecular Immobilization (LAMI) technology.16 Two MBs havebeen engineered: a model MB comprising a poly-A sequence in itsloop region and aMBwith a sequence complementary tomiRNA-21in its loop region. Crucial to the success of this work has been theconjugation of a light activated peptide (KAMHAWGCGGGC-NH2)to the MB, with tryptophan in close spatial proximity to a disul-phide bridge (Fig. 1). The peptide enables the immobilization of

Fig. 1 Schematic representation of LAMI technology. The MB constructbridge. The disulfide bridge on the peptide is broken upon excitation of thonto the free thiol groups present on the biosensor support (e.g. SOI).

This journal is © The Royal Society of Chemistry 2019

MB-peptide constructs with LAMI technology onto surfaces. LAMIis a photonic technology that allows for covalent and orientedimmobilization of biomolecules onto thiol reactive surfaces, withmm and sub-mm spatial resolution.17–23 This photonic technologypresents some advantages over other immobilization tech-niques24–28 as it does not require chemical or thermal steps toachieve covalent immobilization and it allows for spatially orientedimmobilization. LAMI makes use of a conserved motif in proteins,i.e., the close spatial proximity between aromatic residues (trypto-phan, tyrosine and phenylalanine) and disulphide bridges.16,29,30UVexcitation (275–295 nm) of aromatic residue's side chain induceselectron ejection, which may react with the nearby disulphidebridge forming of a disulphide electron adduct.31 Such short livedadduct will dissociate, leading to the formation of free thiol groupsthat will covalently bind peptides/proteins to thiol reactive surfaces.Any molecule can be immobilized with LAMI, even if they do notdisplay aromatic residues or disulphide bridges, by tagging themolecule with a small peptide containing such motif.

The present paper shows that LAMI has successfully immo-bilized MB-peptide constructs onto sensor surfaces which havesuccessfully hybridized with their respective complementaryoligonucleotide. Non-complementary oligonucleotides have beenused as controls. Hybridization kinetics have been monitoredusing steady state uorescence spectroscopy. Detection of theimmobilized MB construct's hybridization with the respectivetargets was visualised with confocal uorescence microscopy(CFM) and using photonic bandgap (PBG) sensing structures. Theuse of these PBG structures allows for specic recognition of thetarget oligonucleotides through hybridization with the immobi-lized MB constructs on the surface of the PBG structures ina label-free and highly sensitive manner. The engineered lightsensitiveMB construct can be immobilized onto any thiol reactivesurface and is being integrated in a photonic sensor device usingthe PBG structures for detection. The newly engineeredMBs, theirimmobilization and bioavailability are hereby presented. Wehereby demonstrate a proof-of-concept of the feasibility of the newintegrated technology used to detect cancer biomarkers. Furtherstudies are in progress in order to optimise the sensitivity of thenewly engineered biosensor.

is coupled to a peptide which contains a tryptophan nearby a disulfidee nearby tryptophan allowing for covalent bonding of the MB construct

RSC Adv., 2019, 9, 12766–12783 | 12767

Fig. 2 Molecular Beacon sequence (A) and specificity (B) and chemical synthesis of the Molecular Beacon constructs (C). (A) MolecularBeacon design (UEA) with the wild type complementary sequence to miRNA-21 showed four base pairs predicted form within the loop (A).Changing the A at position 21 to a G (red box) removed the internal loop structure to form the desired stem-loop structure (B). (B)Fluorescence ratio of the MBs containing the wild type complementary sequence for miRNA-21 and with the single base change whendetecting miRNA-21, compared with no miRNA target present (left). MiRNA-21 MB with the single base change could detect the miRNA-21oligo but not a control oligo of miRNA-140 (right). (C) Engineered MB structures containing different oligonucleotide sequences. The MB islabeled with a fluorescent probe (Cy3) and contains a quencher (DABCYL) in close spatial proximity to the fluorophore when the MB loop isin its closed form. A peptide is coupled through a linker to the MB structure. This peptide has a disulphide bridge in close proximity toa tryptophan. This will allow for the LAMI immobilization of the MB constructs to the sensor surfaces. (A) MB structure containing G-G-G-G-(A)20-C-C-C-C in the loop region. (B) MB structure containing G-G-G-G-TCAA CATC AGTC TGGT AAGC TA-C-C-C-C in the loopregion (oligonucleotide sequence complementary to miRNA21).

12768 | RSC Adv., 2019, 9, 12766–12783 This journal is © The Royal Society of Chemistry 2019

RSC Advances Paper

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

Paper RSC Advances

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

2 Materials and methods2.1 Materials

The MBs and miRNA-21 oligonucleotide were purchased fromSigma-Aldrich, UK. KCl, MgCl2 and Tris–HCl were alsopurchased from Sigma-Aldrich, UK. The MBs have a 50 6-FAMuorophore and 30 Black Hole Quencher-1 (BHQ-1),32 whichquenches 6-FAM uorescence. The structure of the designedMBs is depicted in Fig. 2A.

The two engineered MB constructs (Cy3 labelled), theircomplementary and control sequences and the peptideKAMHAWGCGGGC-NH2 have been purchased from Biosyn-thesis (Texas, USA). The salts used to make PBS (sodium chlo-ride, potassium chloride, sodium phosphate dibasicheptahydrate and potassium phosphate monobasic) werepurchased from Sigma-Aldrich (Missouri, USA).

2.2 MB design and validation

MBs were designed with the mFold folding prediction so-ware.33 Fluorescence based assays using the MBs displayed inFig. 2A were performed in white 96-well plates (Fisher, UK) inbuffer consisting of 10 mM KCl, 5 mM MgCl2 and 10 mM Tris–HCl pH 7.5.34 Exposure to light was minimised to reduce uo-rophore photobleaching and the samples were incubated at

Fig. 3 Schematic representation of the detection strategies adopted fonucleotide sequence, the MB loop will open, allowing for the fluorophoreto an increase of fluorescence intensity emission of Cy3 (top scheme). Aftwith the Cy3 labeled MB construct, the Cy3/Cy5 pair will be in close s(acceptor) (bottom scheme).

This journal is © The Royal Society of Chemistry 2019

room temperature for 10 min before uorescence readings weretaken. Three wells for each condition were used and averagereadings were performed to calculate the uorescence ratio(see, e.g., Fig. 2B), which was calculated using the readingsbetween wells containing the MB and the target miRNA oligoUACCACAGGGUAGAACCACGG and the MB alone.

2.3 Engineered MB construct structure

2.3.1 Selection of light activated peptide. The selectedpeptide was KAMHAWGCGGGC-NH2, being C cysteine (joinedby a disulphide bridge), K lysine, A alanine, M methionine, Hhistidine, W tryptophan and G glycine. Its molecular mass isz1175 g mol�1. UV excitation of the tryptophan leads to thedisruption of the disulphide bridge, enabling the immobiliza-tion of the MB linked to this peptide onto the thiolized surfaces.

2.3.2 MB construct synthesis and characterization. Thesynthesis of the engineered MBs is depicted in Fig. 2C, schemes1 and 2. The nal construct is shown in Fig. 3 (le). In scheme 1(Fig. 2C) is depicted the synthesis procedure for the poly-A MBand in scheme 2 (Fig. 2C) is depicted the procedure for themiRNA-21 specic MB. The peptide (step [2] and [20] in schemes1 and 2, respectively) was synthesized following standard solidphase peptide synthesis procedure to get the cyclized peptideand puried by RP-HPLC. Amino-C6-modied oligo (compound[1] in scheme 1 and compound [10] in scheme 2) were

r hybridization detection. Upon bonding with a complementary oligo-to be distanced from the quencher present on the loop stem, leading

er the hybridization of the Cy5 labeled complementary oligonucleotidepatial proximity allowing for energy transfer from Cy3 (donor) to Cy5

RSC Adv., 2019, 9, 12766–12783 | 12769

RSC Advances Paper

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

synthesized followed standard solid phase oligo synthesisprocedure and puried by HPLC. The compounds [1] or [2] weredissolved into a mixture solution of DMSO–H2O (1 : 2, v/v) andextra Disuccinimidyl Suberate (DSS) in DMSO was added. Themixture was incubated for several minutes at room tempera-ture, precipitated by 30% of NaClO4 in acetone, cooled down at�20 �C, and separated by centrifugation. Aer washing withacetone and drying, the precipitated products [3] or [30] weredissolved into a mixture solution of DMSO–H2O and extrapeptide [2] in DMSO was added. The reaction mixture wasincubated for 1–2 hours at 37 �C and precipitated by 30% ofNaClO4. Aer separation, the crude products [4], [5], or [40] and[50] were puried by RP-HPLC. The nal product was charac-terized by Maldi-Tof Mass Spectrometry (MS) on Applied Bio-system (Model: Voyager DE-Pro; matrix solution: 10 mg mL�1 3-hydroxypicolinic acid and 1 mg mL�1 diammonium hydrogencitrate in water) and the purity was assayed by RP-HPLC onBeckman (System Gold) and column (Phenomenex, Jupiter,C18, 300 A, 10 m, 150 � 3.0 mm). The assayed condition waswavelength: 260; ow rate: 0.8 mL min�1; solvent A: 50 mM oftriethylammonium acetate in water and solvent B : acetonitrile;with a gradient from 20% to 70% of solvent B in 20minutes. Thetheoretical molecular weight (MW) was also calculated accord-ing to:

Theoretical Mw ¼ Mw(oligonucleotide sequence)

+ Mw(DSS linker residue) + Mw(peptide) (1)

The calculated MW was correlated to the MW obtainedthrough MS.

2.3.3 MB-peptide construct structures. The engineeredMBs structure is depicted in Fig. 2C (steps [4], [5] in scheme 1and [40] [50] in scheme 2, respectively) and illustrated in Fig. 3(le). The poly-A MB loop region consists of 20 adenosine basesand 4 G–C base pairs form the stem of the MB (Fig. 2C, scheme1, step [1]). The loop region of the miRNA-21 specic MBconsists of TCAA CATC AGTC TGGT AAGC TA (Fig. 2C, scheme2, step [10]). This sequence is complementary to miRNA-21. BothMBs are coupled to a small peptide linked to one of the strandsof the MBs' stem (Fig. 2C, scheme 1, steps [4] and [5] andscheme 2, steps [40] and [50]). Cy3 is attached to the 30 end of thestem, being quenched by DABCYL, located on 50 end of thestem. When the MB loop is closed (no hybridization), thepresence of DABCYL in close spatial proximity to Cy3 will

Table 1 Oligonucleotide sequences used in this study

50 Sequence (50–30) Comments

Cy5 orunlabelled

GUAGCUUAUCAGACUGAUGUUGAC RNA base, miRNA-21 seq

Cy5 orunlabelled

GAAAAAAAAAAAAAAAAAAAAAC DNA base, sequence notMB, this sequence is use

Cy5 orunlabelled

GTTTTTTTTTTTTTTTTTTTTC DNA base, sequence com

Cy5 orunlabelled

UACCACAGGGUAGAACCACGG RNA base, miRNA-140 se(oligonucleotide used as

12770 | RSC Adv., 2019, 9, 12766–12783

quench Cy3 emission. When hybridization occurs, the MB loopopens and Cy3 is separated from DABCYL, becomingunquenched, increasing the uorescence intensity of Cy3(Fig. 3, top scheme). The MB loop will only open when there isbinding between the base pairs in the loop and the base pairs inthe target sequence.

2.4 Preparation of MB constructs stock solutions

The poly-A MB and the miRNA-21 specic MB constructs werereceived in lyophilized form and resuspended in PBS 1� toa concentration of 10 mM. MB solutions were aliquoted andstored at �20 �C until use.

2.5 Preparation of oligonucleotide stock solutions for theengineered MB constructs

Three different oligonucleotide sequences were used in thisstudy: two sequences are the complementary sequences to poly-A MB and to miRNA-21 specic MB. The third sequence isa non-complementary sequence to neither MBs (Table 1). Theoligonucleotides were received in lyophilized form, and withand without a uorescent label (Cy5), and resuspended in PBS1� to a concentration of 10 mM. Oligonucleotide solutions werealiquoted and stored at �20 �C until use.

2.6 Steady-state uorescence spectroscopy studies –hybridization kinetics

2.6.1 Presence of tryptophan in the peptide. The excitation(emission xed at 350 nm) and emission (excitation at 295 nm)uorescence spectra of a 0.1 mM poly-A MB-peptide sample inPBS 1� were monitored at room temperature, without stirring,in a 0.5 mL quartz cuvette. Measurements were performed ina Felix uorescent RTC 2000 spectrometer (Photon TechnologyInternational, Canada, Inc. 347 Consortium Court London,Ontario N6E 2S8) with a T-conguration, using a 75 W Xenonarc lamp coupled to a monochromator.

2.6.2 Hybridization of the MB constructs with thecomplementary and control oligonucleotide using unquench-ing and Forster resonance energy transfer (FRET). Fluorescencebased hybridization experiments performed with the poly-A MBconstructs were carried out using the non-uorescent oligonu-cleotide 50-GTTTTTTTTTTTTTTTTTTTTC-30. The detectionstrategy is depicted in Fig. 3 (top scheme) has been described inSection 2.3.3. 300 mL of the poly-A engineered MB samples were

uence complementary to the miRNA21 specic MB sequence.

complementary to the loop region of the model MB and of the miRNA-21d as a hybridization negative control.plementary to the model MB sequence.

quence non-complementary to the miRNA21 specic MB sequencea non-hybridization control on the section MB design and validation).

This journal is © The Royal Society of Chemistry 2019

Paper RSC Advances

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

placed in a 0.5 mL quartz cuvette (0.1 mm optical pathway) ata nal concentration of 0.1 mM and were illuminated at 548 nm,monitoring the uorescence emission intensity at 562 nm for2 min, at room temperature. The experiment was paused anda solution of the oligonucleotide (30 mL) was added to the poly-AMB solution (0.1 and 1 mM of complementary oligo were addedto 0.1 mM of poly-A MB). Re-suspension was done with a pipette.Immediately aer mixing, the solution was continuously illu-minated at 548 nm and the increase uorescence emissionintensity at 562 nm (unquenching kinetics) was monitored for1 h, at room temperature.

Hybridization between the miRNA-21 specic MB constructand the target sequence was monitored through FRET. Cy3 ispresent in the MB loop stem and the target oligonucleotideswere Cy5 labelled. The emission spectra of Cy3 (donor) partiallyoverlaps the excitation spectra of Cy5 (acceptor). When in closespatial proximity, this spectral overlap allows for energy transferfrom the donor to the acceptor to occur. The spatial proximityrequirement is fullled when hybridization takes place, allow-ing for the detection of the specic binding between theMB andthe target oligonucleotide (Fig. 3, bottom scheme). Hybridiza-tion experiments with the miRNA-21 specic MB were carriedout using the Cy5 labelled synthesized oligonucleotide, 50-CAGUUG UAG UCA GAC UAU UCG AUG-30, complementary the MB'sloop sequence. 300 mL of the miRNA-21 specic MB sampleswere prepared in a 0.5 mL quartz cuvette (0.1 mm opticalpathway) at a concentration of 0.1 mM in PBS 1� and illumi-nated at 488 nm, monitoring the uorescence emission inten-sity at 670 nm for 2 min, at room temperature. Cy5 absorption isnon-existent at 488 nm, whereas for Cy3 is in the order of 17% ofits maximum absorbance.35 Cy5 uoresces maximally at670 nm, the wavelength monitored during these experiments.Thus, the recorded uorescence emission intensity results fromenergy transfer between Cy3 (donor) and Cy5 (acceptor).

The experiment was paused and 30 mL of a solution of Cy5labelled oligonucleotide solution was added to the miRNA-21specic MB solution (0.1 and 1 mM, respectively). Re-suspension was done with a pipette. Immediately aer mixing,the solution was again continuously illuminated at 488 nm andthe uorescence emission intensity at 670 nm was monitored for1 h, at room temperature. As a non-hybridization control, a 30 mLof a solution of Cy5 labelled non-complementary oligonucleotidepoly-A was added and the uorescence change was monitored.

Fig. 4 Photonic bandgap (PBG) sensing structures. (Left) Schematic reprmiRNA sensing experiments. (Right) Scanning Electron Microscope (SEM

This journal is © The Royal Society of Chemistry 2019

2.7 Sensor surfaces

Two kinds of sensor surfaces were used to immobilize the lightsensitiveMB constructs: optically at quartz slides and Silicon onInsulator (SOI) chips (with and without photonic bandgap (PBG)sensing structures). Optically at quartz slides were purchasedfrom ArrayIt (SuperClean 2, SCM2) and SOI chips (with andwithout PBG sensing structures) were provided by the UniversitatPolitecnica de Valencia. The PBG structures present in some ofthe SOI chips used in this study are generated by introducinga periodic modulation in the refractive index of the photonicstructure. In this type of PBG sensing structure, its periodicitygives rise to the presence of a spectral range where the propa-gation of the light is forbidden, the so-called photonic bandgap(PBG). When the refractive index of the surroundings of the PBGsensing structure will change due to the presence of the targetanalytes (themiRNA target in our case), the PBG spectral positionwill shi depending on the target analyte concentration.

The photonic chips used in the experiments comprisedseveral PBG sensing structures of dimensions width w ¼460 nm, height h ¼ 220 nm, period a ¼ 380 nm and length ofthe transversal elements we ¼ 1500 nm. The PBG sensingstructures where organized in pairs, where two different widthsof the transversal elements were used for each structure (wi ¼120 nm and wi ¼ 140 nm). Each chip contained 4 PBG sensorpairs. The photonic chips were fabricated using e-beamlithography and inductively coupled plasma etching to trans-fer the designs to the top silicon layer. An image of one of thefabricated PBG sensing structures is shown in Fig. 4. Shallowetch 1D grating couplers where fabricated at the accesses of thephotonic structures in order to vertically couple the light to/from the chip inputs/outputs. Finally, a top 400 nm-thick SiO2

upper cladding is deposited over the photonic chip in order toincrease the robustness of the photonic structures and to avoidtheir damage when the microuidic cell required to ow thereagents over the chip is placed; a channel is opened in the SiO2

upper cladding in the positions where the PBG sensing struc-tures are placed in order be in contact with the samples to beanalysed.

2.7.1 Thiolation of sensor surfaces. The surfaces werechemically modied by silanization according to a methoddescribed elsewhere,16 except that the surfaces were not treatedwith chromosulfuric acid prior to silanization.

esentation of the PBG sensing structure used to carry out the photonic) image of one of the PBG sensing structures fabricated in this work.

RSC Adv., 2019, 9, 12766–12783 | 12771

RSC Advances Paper

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

2.8 Illumination setup

A scheme of the experimental system36 is shown in Fig. 5A. Thefemtosecond (fs) laser Tsunami XP (Spectra-Physics), is pumpedby the Millennia eV (Spectra-Physics). Typical operation isaround 840 nm with maximum average power of 4 W. TheTsunami output (�100 fs pulses at 80 MHz) is frequency tripledin a harmonic generation module (Spectra-Physics) to produce�280 nm UV fs pulses with an efficiency of �10%. The funda-mental at 840 nm and the third harmonic at 280 nm are routedvia separate paths into the experimental system. Each beampasses through a computer controlled variable attenuator con-sisting of a half-wave plate, mounted in a motorized rotationstage (PR50CC, Newport) and followed by a polarizing beamcube. Aer each attenuator, a fused silica beam sampler is usedto direct a portion of the beam onto a photodiode (PD-300R-3Wand PD-300R-UV, OPHIR) for power monitoring. The beam thenpasses through safety shutters (LS6S2ZM1, VINCENT

Fig. 5 Schematic representations of the illumination setup and methodoUHGmodule and into the UV objective where the 280 nm light is focusedthe LAMI procedure carried out using the illumination setup and appliedlization of the MB constructs which will be ready to detect the specific m

12772 | RSC Adv., 2019, 9, 12766–12783

ASSOCIATES) to control exposure to the sample. Only the280 nm beam has been used in the present study.

2.8.1 Photonic immobilization of MB constructs usingLAMI technology. A droplet of each engineered MB (1 mL) wasplaced on the surface of the optically at thiol derivatizedsurfaces. Aer drying at room temperature, the sample wasplaced in the sample holder of the illumination setup (Fig. 5B).Samples were illuminated at 280 nm according to an arraypattern (500 � 500 mm) on the thiol derivatized quartz slidesand according to a line pattern (50 lines with 50 mm separation)on the thiol derivatized SOI surfaces (without PBG sensingstructures). The patterns were uploaded to the controlling stagesoware in a bitmap image format. Illumination was performedat 100 mm s�1 with a focused laser beam (focused light) througha 40� UV objective. The illumination power used was 20 or 40mW. For biofunctionalization of the SOI chips with PBG sensingstructures, a droplet of mi-RNA-21 MB construct was place two

logy. (A) Schematic description of the laser beam pathway through theon the sample placed onto themoving sample holder. (B) Illustration ofto the engineered MB. LAMI leads to covalent and oriented immobi-iRNA targets.

This journal is © The Royal Society of Chemistry 2019

Paper RSC Advances

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

pairs of these structures and illuminated continuously for 1 h at280 nm (diffuse light). The remaining pairs of PBG structuresdid not contain miRNA-21 specic MB construct and were usedas controls. Aer illumination, the immobilized samples werewashed overnight with PBS 1� plus 0.1% Tween 20 detergent,rinsed with PBS 1� and dried with compressed air.

2.9 Confocal uorescence microscopy (CFM) studies –

uorescent label detection

2.9.1 Imaging the immobilized MB constructs onto opti-cally at quartz slides and SOI surfaces without PBG sensingstructures. An inverted confocal uorescence microscope(LEICA TCS SP5) was used to visualize the patterns. To visualizethe immobilized patterns, the immobilized poly-A MB wasexcited using the 543 nm laser line form the HeNe laser and Cy3emission was visualized fromz570 to 650 nm. Even though theuorophore is quenched by DABCYL when the MBs are immo-bilised and non-hybridized with the respective complementaryoligonucleotides, their residual uorescence is still detected.

2.9.1 Pattern imaging of immobilized and hybridized MBconstruct onto optically at quartz slides and SOI surfaceswithout PBG sensing structures. Hybridization of the immobi-lized patterns of both poly-A MB and of miRNA-21 specic MBconstructs with their respective complementary oligonucleotidewas detected by FRET. The immobilised MB constructs patterns(labelled with Cy3) were incubated with 10 mM of their respec-tive oligonucleotide (labelled with Cy5) for 1 h at 37 �C. Aerincubation, the arrays were rinsed with PBS 1� and gently driedwith compressed air. The same procedure was also appliedusing a non-complementary oligonucleotide (poly-A sequence).The arrays were then excited using the 543 nm laser line fromthe HeNe laser and emission was imaged by CFM by twoseparate PMT's registering emissions fromz570 nm to 650 nm(Cy3 emission) and from z700 nm to 780 nm (Cy5 emission),respectively. An overlap of these two emission channels wascarried out to detect co-localization of Cy3 labelled MB and ofCy5 labelled complementary oligo. Patterns were visualizedthrough an UV 20� objective.

2.9.3 Photonic-based detection on SOI surfaces with PBGsensing structures biofunctionalised with miRNA-21 specicMB construct – label-free detection. The biofunctionalized SOIchip with PBG sensing structures is assembled with a poly-dimethylsiloxane (PDMS) ow cell having a ow channel (400mm-wide and 50 mm-high). This assembled chip is then placedin an automated optical characterization setup where thespectral response of all the photonic sensing structures in thechip is continuously registered. A ber aspheric collimator(Thorlabs CFS2-1550-APC) is used to couple the light froma continuous sweep tunable laser (Keysight 81980A) to theaccess grating couplers. An infrared (IR) camera (Xenics Xeva-1.7-320) is used to measure the light from the output gratingcouplers, which is collected with an objective (20� OlympusPlan Achromat, 0.4 NA). The continuous sweep of the laser andthe image acquisition of the IR camera via a trigger signal aresynchronized by a soware programed in LabVIEW which isable to control the interrogation platform. This synchronization

This journal is © The Royal Society of Chemistry 2019

allows for the acquisition of the spectra of the photonic struc-tures with the desired spectral resolution.

The conguration for spectra acquisition was set to a rangebetween 1520 nm and 1620 nm with a sweeping speed of 10 nms�1 and a spectral resolution of 20 pm. Using a constant owrate of 20 ml min�1, the target oligonucleotide solutions areowed using a syringe pump working in withdraw mode.

2.10 Data analysis

All data analysis, plotting and tting procedures were doneusing Origin 8.1 (OriginLab Corporation, Northampton, MA,USA) and MATLAB (MathWorks, Inc. Natick, MA, USA). Fluo-rescence emission intensity proles and the 3D surface plot ofthe immobilized and hybridized MB patterns, imaged by CFM,were obtained using ImageJ 1.50i.

2.10.1 Emission spectra and excitation spectra. Emissionand excitation spectra were smoothed using a 10 points adja-cent averaging. All uorescence spectra obtained were Ramancorrected by subtracting the buffer spectra. Normalized emis-sion and excitation spectra were obtained by dividing each datapoint by the maximum intensity value in each spectrum.

2.10.2 Hybridization kinetic traces. The hybridization curvesobtained for both poly-A MB and miRNA-21 specic MB werenormalized to their maximum uorescence emission intensity.

2.11 Fitting procedures

2.11.1 Hybridization kinetic traces – emission recorded asa function of time at 562 nm and 670 nm upon 548 nmcontinuous excitation. Each hybridization curve was acquiredupon addition of the complementary oligonucleotide andmonitored upon continuous illumination at 548 nm and488 nm for 1 h (Fig. 6A and B, respectively). The uorescenceemission intensity data obtained upon addition (at 120 s) of thecomplementary oligonucleotide were tted using a doubleexponential growth model given by the function F(t) ¼ y0 + A1(1� exp(�x/t1)) + A2(1� exp(�x/t2)), where y0 is the offset value, A1and A2 are the amplitudes and t1 and t2 are the rate constants ofeach phase. The errors associated to each parameters and theroot mean square error determined the goodness of the t. Thefractional intensity (fi) of each time constant is given by fi ¼ Aiti/SiAiti, where Ai is the amplitude (pre-exponential factor) and ti isthe time constant. The mean time constant was calculatedaccording to hti ¼ Sifiti. These parameters are presented inTable 2. The hybridization curve obtained for 0.1 mM poly-A MB+ 1 mM complementary oligonucleotide (poly-T) did not t wellto either a single or double exponential growth model (due toa fast rise of the curve that led to few points before the plateauregion) thus, no tting is presented. The kinetics for hybrid-ization of the MB constructs with the respective complementaryoligonucleotide were assumed to follow a two-state mechanismwhere [MB] + [complementary oligonucleotide] 4 [MB $

complementary oligonucleotide].

2.12 Image treatment

An area of the CFM images was selected and analysed to obtainthe accumulated average uorescence emission intensity

RSC Adv., 2019, 9, 12766–12783 | 12773

Fig. 6 Monitoring the binding kinetics between each MB and its respective complementary oligonucleotide sequence through unquenching (A)and FRET (B). The following concentration ratios were used: 0.1 mM MB + 0.1 mM complementary oligo (ratio 1 : 1) and 0.1 mM MB + 1 mMcomplementary oligo (ratios 1 : 10). The hybridization curves were fitted according to a double exponential growth model F(t) ¼ y0 + A1(1 �exp(�x/t1)) + A2(1� exp(�x/t2)). The fitted curves are represented in red and the residuals are represented bellow each curve. (A) Binding kineticsbetween Cy3 labelled poly-A MB construct and its complementary oligonucleotide sequence (poly-T) monitored by C3 fluorescence emissionintensity signal. (B) Binding kinetics between Cy3 labeled miRNA-21 MB construct and the Cy5 labeled complementary oligonucleotide (miRNA-21) monitored by C5 fluorescence emission intensity signal. Binding kinetics between Cy3 labeled miRNA-21 MB and Cy5 labelled non-complementary poly-A was monitored as a non-hybridization control.

RSC Advances Paper

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

proles. These proles result in a 2D display of pixel intensityalong a selected area of the image. For the 3D surface plot, a plotderived from the pixel intensity displayed in the selected area ofthe image was created and adjusted for lighting, perspectiveand smoothing.

3 Results3.1 MB selection and validation

MB design showed unwanted base pairing within the loop(Fig. 2A, le). A single base change was required to open thestructure out into the desired loop to allow access by the targetmiRNA-21. As seen in Fig. 2A (right), a mutation of A at position21 to a G removed this unwanted base pairing, whilst stillretaining the hybridization potential with the T in the miRNA-21 sequence from G:T pairing. Specicity of the MB formiRNA-21 was tested by comparing the results using a MBcontaining the wild type loop sequence complementary to

12774 | RSC Adv., 2019, 9, 12766–12783

miRNA-21 against that with the A–G base change necessary toremove the unwanted base pairing, and a negative control usingan RNA oligo of the unrelated miRNA-140. The concentrationsused were 25 nM of miRNA-21 specic MB and 50 nM of targetmiRNA (see paragraph ahead, justifying this choice of concen-trations). As seen in Fig. 2B (le), opening of the loop with thesingle base change makes the MB more able to hybridize withthe target miRNA, with an increase in uorescence ratio ofz8.6%, compared with the MB containing the wild typesequence. No increase in uorescence ratio was observed whenhybridizing the miRNA-21 specic MB with miRNA-140 (Fig. 2B,right).

Optimization experiments were performed to nd theconcentration of the MB necessary for uorescence detection oftarget miRNA. The uorescence emission intensity of differentconcentrations of miRNA-21 specic MB (labelled with 6FAMbut without quencher) was monitored and the uorescenceratio calculated as the uorescence reading of the MB against

This journal is © The Royal Society of Chemistry 2019

Table 2 Parameters obtained according to the double exponential fitting model F(t) ¼ y0 + A1(1 � exp(�x/t1)) + A2(1 � exp(�x/t2))a

Y offset Rate constant (s�1) Fractional intensity (%) Amplitude

Poly-A MB (unquenching)Poly-A MB + poly-T oligo (1 : 1)y0 ¼ �19.323 � 1.116 t1 (slow phase) ¼ 465.272 � 6.453 f1 ¼ 6 A1 ¼ 0.081 � 0.001

t2 (fast phase) ¼ 27.757 � 0.326 f2 ¼ 94 A2 ¼ 20.240 � 1.115hti ¼ 55.262

miRNA-21 MB (FRET)miRNA-21 MB + miRNA-21 oligo (1 : 1)y0 ¼ �0.021 � 0.004 t1 (slow phase) ¼ 1120.800 � 9.225 f1 ¼ 83 A1 ¼ 0.499 � 0.003

t2 (fast phase) ¼ 210.142 � 2.496 f2 ¼ 17 A2 ¼ 0.543 � 0.003hti ¼ 966.487

miRNA-21 MB + miRNA-21 oligo (1 : 10)y0 ¼ �13.896 � 4.721 t1 (slow phase) ¼ 126.854 � 1.374 f1 ¼ 22 A1 ¼ 0.784 � 0.019

t2 (fast phase) ¼ 24.449 � 1.750 f2 ¼ 78 A2 ¼ 14.111 � 4.706hti ¼ 47.366

a Y offset (y0), amplitude (Ai), rate constants (ti), intensity fraction (fi) and average rate constant (hti) for hybridization of poly-A and miRNA-21specic MB constructs with the respective complementary oligonucleotides (ratios 1 : 1 and 1 : 10).

Paper RSC Advances

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

that of the assay buffer (Fig. S1A†). For further optimizations,25 nM of 6-FAM labelled miRNA-21 specic MB was used sincethe uorophore emission intensity was clearly detectable. Tooptimize the concentration of miRNA oligo in the assay, 25 nMof MB and a range of miRNA concentrations from 25–1000 nMwere used. As shown in Fig. S1B† miRNA oligo at 50 nM andabove produced uorescence ratios clearly detectable abovethose of the MB or assay buffer alone. For further experiments,25 nMMB and 50 nMmiRNA oligo were used (Fig. 1, scheme 3).

3.2 Engineered MB constructs: synthesis andcharacterization

The purity level of the MB coupled to the peptide obtained byHPLC was >96% for the poly-A MB construct and >97% for themiRNA-21MB construct (Fig. S2†). TheMW of theMB constructswas determined by MS (Fig. S3†). Data obtained for the poly-AMB construct (Fig. S3,† upper panel) shows a clearly denedpeak corresponding to a MW of 11 384.78 Da, matches thetheoretical MW (11 384.84 Da). The same was observed for theMS data obtained for the miRNA-21 construct (Fig. S3,† lowerpanel), where a sharp peak shows a MW of 12 001.09 Da, whichmatches the calculated MW (12 000.16 Da).

3.3 Steady state uorescence studies – hybridization kinetics

3.3.1 Presence of tryptophan in the peptide construct. InFig. S4† are depicted the uorescence excitation and emissionspectra of the poly-A MB upon excitation at 295 nm and xedemission at 350 nm. The uorescence emission spectrumpresents maximum intensity peak at 353 nm, whereas themaximum uorescence intensity peak of the excitation spectrais at 298 nm. These spectral features are characteristic of tryp-tophan, proving its presence in the tag construct.

3.3.2 Hybridization studies using poly-A and miRNA-21specic MB constructs. In Fig. 3 is depicted the strategy usedfor the detection of the target miRNA by the MB constructs (as

This journal is © The Royal Society of Chemistry 2019

explained in Section 2.6.2). The binding kinetics between thepoly-A MB and the respective complementary non-labelledoligonucleotide were studied at different concentrations: 0.1and 1 mM of complementary oligonucleotide poly-T were addedto 0.1 mM of poly-A MB (ratios 1 : 1 and 1 : 10, respectively). Thebinding kinetics were monitored following the increase ofuorescence emission intensity as a function of time aeradding the complementary oligonucleotide to the poly-A MBsolution. The MB loop opens upon binding with the comple-mentary oligonucleotide resulting in an increase of Cy3 emis-sion due to separation between the uorophore (Cy3) and thequencher (dtDABCYL), (Fig. 3A). In Fig. 6A are displayed thekinetic curves obtained upon monitoring the uorescenceemission intensity of Cy3 (lexcitation ¼ 548 nm, lemission ¼ 562nm) and the respective tted curve for the hybridization ata ratio of 1 : 1. The tting parameters are described in Table 2.The residual values for this tting are randomly distributedaround 0 (Fig. 6A, lower panel).

The hybridization curve obtained for ratio 1 : 1 demonstratesa fast phase with a rate constant of 27.757 � 0.326 s�1 and anamplitude of 20.240� 1.115 followed by a slow phase with a rateconstant of 465.272 � 6.453 s�1 and an amplitude of 0.081 �0.001. The calculated fractional intensity for the fast rateconstant was 94% and for the slow rate constant was 6%. Thus,the average rate constant obtained for this ratio was 55.3 s�1,indicating a reaction where the [MB $ complementary oligo-nucleotide] equilibrium is reached fast. Increasing the ratio to1 : 10, the reaction rate is much faster (Fig. 6A, blue dottedlines). A good tting was not achieved for the hybridizationcurve obtained at the ratio 1 : 10, however the curve shapeshows a fast increase of uorescence intensity reachinga plateau within z150 s.

The binding kinetics between the miRNA-21 specic MB andits respective complementary oligonucleotide were monitoredthrough FRET between Cy3 (stem of the MB loop) and Cy5(complementary oligonucleotide) (Fig. 3B). In Fig. 6B is

RSC Adv., 2019, 9, 12766–12783 | 12775

RSC Advances Paper

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

depicted the binding curve between the miRNA-21 specic MBand the oligonucleotide at different concentrations: 0.1 and 1mM of oligonucleotide miRNA-21 were added to 0.1 mM ofmiRNA-21 specic MB (ratios 1 : 1 and 1 : 10, respectively). Theincrease of uorescence emission intensity of Cy5 is monitoredas a function of time (lexcitation ¼ 488 nm, lemission ¼ 670 nm)before and aer adding the oligonucleotide. The respectivetted curves are also depicted in Fig. 6B and the derived ttingparameters can be found in Table 2. The residual values forthese tting are randomly distributed around 0 (Fig. 6B, lowerpanels).

The curve obtained for the hybridization of the miRNA-21specic MB with the complementary oligonucleotide at a ratioof 1 : 1 shows an initial fast phase with a rate constant of210.142� 2.496 s�1 and an amplitude of 0.543� 0.003 followedby a slower phase with a rate constant of 1120.800 � 9.225 s�1

and an amplitude of 0.499 � 0.003. However, at a ratio of 1 : 10,the obtained fast rate constant was 24.449 � 1.75 s�1 with anamplitude of 14.111 � 4.71 and the slower rate constant was126.854 � 1.37 s�1 with an amplitude of 0.784 � 0.02. At ratio(1 : 1), the calculated fractional intensity is higher for the slowrate constant (83%) whereas at a ratio of 1 : 10, the highercalculated fractional intensity was obtained for the fast rateconstant (78%). Thus, the obtained average rate constants forratios 1 : 1 and 1 : 10 were 966.5 s�1 and 47.4 s�1, respectively.This indicates that at the lower molar ratio of 1 : 1, the [MB $

complementary oligonucleotide] equilibrium (plateau region) isreached at a slower pace, as expected. However, the differenceregistered between ratios for the miRNA-21 specic MB (Fig. 6B)hybridization is much higher then what is observed for the poly-A MB (Fig. 6A). The uorescence emission intensity of miRNA-21 specic MB upon addition of a non-complementary poly-Aoligonucleotide was also monitored (Fig. 6B, black dashedline). No hybridization occurs, as expected.

3.4 Photonic immobilization using LAMI and visualdetection using CFM – uorescent label detection

3.4.1 Photonic immobilization of poly-A MB construct ontooptically at thiol derivatized quartz surfaces. The poly-A MBconstruct was illuminated with 280 nm light according to anarray pattern using the laser system setup described in Section2.8. Aer overnight washing, the array was visualized by CFMand is depicted in Fig. 7A. It is possible to observe that the poly-A MB construct was successfully immobilized according to anarray pattern (500 � 500 mM). A 3D projection of the immobi-lized array is shown in Fig. 7B. In this analysis, the area con-taining the immobilized array was selected (yellow lines). Thesoware creates an interactive surface plot, where the height ofthe plot is interpreted from the pixel intensity of the selectedarea. Spatially well-dened and homogeneous uorescenceemission intensity distribution among spots is observed. InFig. 7C is depicted the accumulated average uorescenceemission intensity distribution across the MB constructimmobilized array. The average intensity prole is plotted aspixel intensity (a.u.) as a function of distance (in pixels) in theselected area (yellow lines). The intensity prole is periodic,

12776 | RSC Adv., 2019, 9, 12766–12783

with sharp peaks with homogeneous distribution and approxi-mately the same intensity. A total of 18 peaks are observed inthis average uorescence emission intensity prole, correlatingto each vertical line of the immobilized poly-A MB constructarray.

3.4.2 Hybridization of the complementary oligonucleotidesequences to LAMI immobilized MB constructs (poly-A andmiRNA-21 specic MB constructs) onto optically at thiolderivatized quartz surfaces. Immobilization of the miRNA-21specic MB construct was also carried out and the bioavail-ability of both poly-A and miRNA-21 MB constructs was testedthrough visualization of co-localization of the immobilized MBconstructs and the respective complementary oligonucleotidesby FRET.

The hybridization of immobilized poly-A MB and mi-RNAspecic MB constructs with their respective complementaryoligonucleotides can be observed in Fig. 8A and 9A. The uo-rescence intensity emission of both Cy3 (lem from z570 nm to650 nm, present in the MBs) and Cy5 (lem from z700 nm to780 nm, present in the complementary oligonucleotides) wasmonitored upon excitation at 543 nm (Cy3 excitation wave-length). In Fig. 8A and 9A are depicted Cy3 emission (le) for theimmobilized poly-A MB and miRNA-21 MB constructs, respec-tively, and Cy5 emission (center) for the respective comple-mentary oligonucleotides. Fig. 8A and 9A (right panels) wereobtained through an overlap of the respective Cy3 and Cy5emissions images. Both emissions are spatially overlapped,revealing co-localization of both uorophores and thus,hybridization between the immobilized MB constructs andtheir respective complementary oligonucleotides. An averageuorescence emission intensity prole was obtained for each ofthe individual images as well as a 3D plot of the co-localizationimages (Fig. 8B and 9B). The confocal uorescence images ob-tained for the immobilized poly-A MB array (Cy3 emission,Fig. 8A, le panel) and for the hybridization with the respectivecomplementary poly-T oligonucleotide (Cy5 emission, Fig. 8A,center panel) show a clear prole with sharp and dened peaks(Fig. 8B, le and center panels). The 3D plot of the co-localizedCy3 and Cy5 emissions also shows a dened array pattern, witha homogeneous distribution of the spots inside the array(Fig. 8B, right panel). The array images obtained for theimmobilized miRNA-21 specic MB construct (Cy3 emission)and for the hybridized complementary oligonucleotide (Cy5emission) appear less dened (Fig. 9A, le and center panel,respectively) but the array pattern is still perceptible. Theaverage uorescence emission intensity prole analysis (Fig. 9B,le and center panel, respectively) reveals the presence of peaksperiodically distributed, which location is correlated with eachvertical line of the array pattern. These peaks are well denedbut less spatially resolved than the peaks observed for theaverage intensity prole of the images obtained from both theimmobilized poly-A MB constructs and the hybridized poly-AMB with its respective complementary oligonucleotide. The3D plot of the overlapped Cy3 and Cy5 images (immobilized MBconstruct and complementary oligonucleotide, respectively)shows the co-localization between the immobilized miRNA-21specic MB and the respective complementary oligonucleotide

This journal is © The Royal Society of Chemistry 2019

Fig. 7 Analysis of a LAMI immobilized poly-A MB array onto a SH derivatized quartz surface. (A) CFM image of poly-A MB construct immobilizedaccording to an array pattern (20� amplification). (B) 3D surface plot obtained from the analysis of pixel intensity under the selected area in A(yellow box). (C) Correspondent average Cy3 fluorescence emission intensity profile of array in A.

Paper RSC Advances

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

(Fig. 9B, right panel). However, as observed for the individualCy3 and Cy5 emission images, the spots inside the array patternare homogenously distributed but poorly resolved, with somebackground noise between spots.

3.4.3 Control experiments. The same experiments werecarried out with the immobilized Cy3 labelled poly-A MB andmiRNA-21 specic MB constructs, being the hybridizationcarried out with the non-complementary Cy5 labelled oligo-nucleotide strand (poly-A). Cy3 emission is the only observedsignal upon excitation of Cy3 (Fig. S5 and S6,† le and rightpanels). A faint uorescence signal was detected when excitingCy3 and specically opening the detector to detect Cy5 emis-sion (Fig. S5 and S6,† middle panels). This proves thathybridization was not successful and no co-localizationbetween the two uorophores was visible (Fig. S5 and S6†).

3.4.4 Photonic immobilization of poly-A MB andmiRNA-21specic MB constructs on thiol derivatized SOI surfaces(without PBG sensing structures). The poly-A MB and themiRNA-21 specic MB constructs were placed on a thiolderivatized SOI surface and illuminated at 280 nm according

This journal is © The Royal Society of Chemistry 2019

to a line pattern (50 lines, 50 mM separation). In Fig. 10 A1 andB1 are depicted part of the immobilized lines pattern of bothMB constructs, observed by CFM. Due to the large size of thearrays, only a portion of each array is visible in the eld of viewof each image. In Fig. 10A2 and 10B2 are depicted the averageuorescence emission intensity proles obtained fromFig. 10A1 and 10B1, respectively. Both MB constructs weresuccessfully immobilized onto the thiol derivatized SOIsurface. The line pattern of the immobilized poly-A MBconstruct appears less intense and with thinner lines than thepattern of immobilized miRNA-21 specic MB constructbecause the light was more focused upon immobilization. Theoverall uorescence emission intensity distribution of theimmobilized patterns is more homogeneous for the immobi-lized miRNA-21 specic MB construct (see intensity proleimages, Fig. 10A1 and A2). However, for both immobilized MBconstructs the peaks appear to be sharp and well dened witha periodic distribution, correlating well with the dened linepattern visualized.

RSC Adv., 2019, 9, 12766–12783 | 12777

Fig. 8 Bioavailability analysis of a LAMI immobilized poly-AMB arrays onto SH derivatized quartz slides. (A) CFM images of Cy3 labeled poly-AMBconstructs fluorescence (left), Cy5 labeled hybridized complementary oligonucleotide fluorescence (centre) and co-localization of Cy3 and Cy5fluorescence emission (right). (B) Average fluorescence emission intensity profiles of the images in A displayed for Cy3 and Cy5 fluorescence (leftand centre) and 3D surface plot of co-localized Cy3 and Cy5 fluorescence emission (right).

RSC Advances Paper

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

3.4.5 Hybridization of the complementary oligonucleotidesequence to LAMI immobilized miRNA-21 specic MBconstruct onto thiol derivatized SOI surfaces (without PBGsensing structures). The miRNA-21 specic MB construct wasilluminated and immobilized onto the SOI surfaces according toa line pattern (see Section 3.4.4.) and hybridized with the targetoligonucleotide. The emissions of both the immobilized MB (Cy3emission) and of the target oligonucleotide (Cy5 emission) wereacquired upon excitation at 543 nm (Cy3 excitation) (see Fig. 11A).It is possible to observe the uorescence of the immobilized MBconstruct according to a line pattern in the rst image (Cy3emission, le panel) as well as the hybridized complementaryoligonucleotide in the second image (Cy5 emission, middle panel).In both images, a dened pattern is observed.

An overlap of both images (Cy3 and Cy5 emissions) was alsoperformed (Fig. 11A, right panel). The co-localization of theimmobilized MB construct and the uorescently labeled oligo-nucleotide is observed, proving successful hybridization. The3D plot also shows the overlap, maintaining the resolution ofthe immobilized pattern and showing that both the immobili-zation and the hybridization took place in a spatially orientedmanner (Fig. 11B).

3.5 Photonic immobilization with LAMI of miRNA-21specic MB construct photonic-based detection on SOIsurfaces with PBG sensing structures – label-free detection

Once the immobilization of the MB probes was tested on SOIsurfaces and the detection of their complementary miRNA

12778 | RSC Adv., 2019, 9, 12766–12783

targets was successfully validated by means of uorescence-based measurements, a photonic-based detection experi-ment was performed using nanophotonic sensing structuresfabricated on those SOI substrates. To this aim, a photonicchip having several photonic bandgap (PBG) sensing struc-tures (Fig. 4) was used. The photonic sensing chips were bio-functionalised using the LAMI immobilization protocol withdiffuse irradiation of the sample instead of focused light. ThemiRNA-21 specic MB construct was immobilized in two of thePBG sensors pairs while leaving another PBG sensors pair free(i.e., with the organosilane on the surface, but no irradiatedmiRNA-21 specic MB construct on it). Fig. 12 shows thesensing response for some representative PBG sensing struc-tures on the chip. It can be observed that the PBG sensingstructures having the MB construct immobilized are able todetect the presence of the specic target miRNA-21 (red andblue lines), while no sensing response was obtained for thatPBG sensor where the MB probe has not been immobilized(green line). The signal obtained for miRNA-21 detection washigher (z4�) for the structure with wider transversalelements (wi ¼ 140 nm, red line) than the signal obtained formiRNA-21 detection from the narrower transversal elements(wi ¼ 120 nm, blue line). Therefore, we can see that thephysical parameters of the PBG sensing structure havea dramatic inuence on the sensitivity, obtaining a sensingsignal �4 times higher for the structure having wider trans-versal elements on the PGB sensing structure (red line), whathighlights the importance of a proper design in order to obtainan optimized sensitivity.

This journal is © The Royal Society of Chemistry 2019

Fig. 9 Bioavailability analysis of a LAMI immobilized miRNA-21 specific MB arrays onto SH derivatized quartz slides. (A) CFM images of Cy3labeled miRNA-21 MB constructs fluorescence (left), Cy5 labeled hybridized complementary oligonucleotide fluorescence (centre) and co-localization of Cy3 and Cy5 fluorescence images (right). (B) Average fluorescence emission intensity profiles corresponding to the images in Cdisplayed for Cy3 and Cy5 fluorescence (left and centre) and 3D surface plot of co-localized Cy3 and Cy5 fluorescence images (right).

Paper RSC Advances

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

4 Discussion4.1 Steady state uorescence studies – hybridization kinetics

The presence of tryptophan in the peptide construct and itsproximity to the disulphide bridge is crucial for LAMI. Upon280 nm excitation, tryptophan undergoes photoionization. Theresulting ejected electron is most likely to react with nearbydisulphide bridges.31 A disulphide electron adduct is formedwhich dissociates, leading to the breakage of the disulphidebridge. As a result, free thiol group(s) will be formed, whichcovalently bind to thiol derivatized surfaces,17,30 enabling thespatially oriented immobilization of the MB constructs. Themonitored emission spectra upon excitation at 295 nm (wave-length for selective excitation of Trp) displayed a maximumintensity peak at 353 nm. Tryptophan has an emissionmaximum in water close to 350 nm, being its emission highlydependent on solvent polarity and the surrounding environ-ment.37 Thus, the presence of this amino acid residue in thepeptide was conrmed (see Fig. S4†).

The hybridization rate of poly-A MB (Fig. 6A) and miRNA-21specic MB (Fig. 6B) constructs with their respective targets isconcentration dependent. In general, an initial fast bindingphase is observed at all ratios followed by a slower phase untilequilibrium is reached. For higher concentrations of oligonu-cleotide (ratio 1 : 10), this initial phase is almost immediate andequilibrium is reached within minutes (z2.5 min for poly-A MBand z 6 min for miRNA-21 specic MB). For lower MB/

This journal is © The Royal Society of Chemistry 2019

oligonucleotide ratio (1 : 1), this equilibrium is reached atz25 min for poly-A MB but for the miRNA MB it can take up to60 min. Hybridization consists of three steps which, in mostcases, happens simultaneously: (a) the target binds to the MBprobe domain which remains in a closed loop; (b) the loopopens as the number of bound base pairs increases; (c) bindingof target base pairs to the remaining base pairs in the MB.34 It isreasonable to assume that the hybridization rate is faster in thepresence of an excess of oligonucleotide as there is a higherprobability for the target sequence to nd the MB loop. Asconcentrations are lowered, steps (a) and (b) are dependent ontarget sequence/MB loop proximity which might reduce thespeed at which these two events occur. Steps (a) and (b) are thenthe limiting steps for the hybridization reaction and the pres-ence of Cy3 at the stem of the MB does not affect the hybrid-ization rate.34

The length of theMB stem also inuences the speed at whichstep (a) occurs. In this study, both poly-A MB and miRNA-21specic MB have a stem composed of 4 GC base pairs.However, the miRNA-21 specic MB possesses an extra A–Tpairing at the stem from the miRNA-21 specic loop. Theobserved binding kinetics is 17.5� faster for the poly-A MB andits target sequence at a ratio of 1 : 1 (Table 2) when comparedwith the miRNA-21 MB and its target at a ratio of 1 : 1. Thismight be due to the simplicity of the sequence as it is composedof a single nucleotide repetition, making it easier for binding tooccur. Also, it might be due to the extra A–T pairing in the stem

RSC Adv., 2019, 9, 12766–12783 | 12779

Fig. 10 Analysis of LAMI immobilized poly-A and miRNA-21 MB specific patterns onto SH derivatized SOI surfaces. (A1) CFM image of Cy3fluorescence emitted by the immobilized poly-A MB construct, according to a line pattern. (A2) Average fluorescence emission intensity cor-responding to the immobilized pattern in A1 under the selected area (yellow square). (B1) CFM image of Cy3 fluorescence emitted by theimmobilized miRNA-21 specific MB construct, according to a line pattern. (B2) Average fluorescence emission intensity corresponding to theimmobilized pattern in B1 under the selected area (yellow square).

RSC Advances Paper

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

of the miRNA-21 specic MB. Nonetheless, the hybridization ofthe two MBs with their respective complementary oligonucleo-tide was monitored by two different uorescence emissionprocesses (unquenching and FRET), which might also inuencethe observed result.

4.2 Photonic immobilization with LAMI and visual detectionof hybridization by CFM

The poly-A MB construct immobilization was successful (Fig. 7)and a spatially oriented immobilization was achieved due to thespatially controlled illumination.

The immobilized poly-A MB construct presents a closed loopconformation, as it has not been exposed to its target sequence.This means that the uorescence emission of the MB in thisstate is less intense than when in the open form due to the closespatial proximity of DABCYL (quencher) to Cy3, both present inthe stem of the loop (see Fig. 3). However, even in the quenchedform, Cy3 uoresces, allowing the visualization of the immo-bilized array (see Fig. 7). Such residual Cy3 uorescence emis-sion was also observed in the initial baseline monitored duringthe hybridization studies (Fig. 6).

Even though the presence of background uorescence hasbeen a drawback in the past,38 data showed that there wasa good signal-to-background ratio upon hybridization with thetarget sequence (S/N ratio below 14.5 for hybridization with

12780 | RSC Adv., 2019, 9, 12766–12783

miRNA-21 specic and below 3.8 for hybridization with poly-AMB). Furthermore, previous data of immobilized poly-A MBconstruct showed the increase in the array's uorescenceemission signal upon hybridization with the target sequencedue to unquenching.36 Successful hybridization of the immo-bilized MB constructs with the target oligonucleotide sequenceswas also done using FRET (Fig. 8, 9, 10 and 11), both on opti-cally at thiol derivatized quartz and thiol derivatized SOIsurfaces.

The SOI derivatized surfaces are to be integrated in a POCdiagnostic device. LAMI presents some advantages over othertraditional immobilization techniques. Conventional tech-niques cannot achieve spatially oriented immobilization ofbiosensors nor can they assure an immobilized homogeneousmonolayer.39 LAMI is able to achieve covalent immobilizationof biosensors in a spatially oriented manner, avoiding thecrowding effect that hinders hybridization due to high densityof the immobilized probes.39 Also, LAMI presents high repro-ducibility and allows for immobilization of proteins, anti-bodies and MB constructs without compromising thebioavailability of the immobilized biosensors. Furthermore, itdoes not require high temperatures for hybridization tooccur39 as the hybridization results presented in this paperwere obtained at room temperature. Although LAMI uses280 nm light to achieve immobilization, it does not hinder thebiosensors ability to recognize their analytes. UVB light (280–

This journal is © The Royal Society of Chemistry 2019

Fig. 11 Bioavailability analysis of LAMI immobilized miRNA-21 specific MB patterns onto SH derivatized SOI surfaces. (A) CFM image of a Cy3labeled miRNA-21 specific MB construct line array (left), fluorescence emission from the Cy5 labeled and hybridized complementary oligo-nucleotide fluorescence (centre) and co-localization of Cy3 and Cy5 fluorescence images (right). (B) 3D surface plots of Cy3 labeled miRNA-21specificMB construct line array (left), Cy5 emission from the hybridized complementary oligonucleotide (centre) and of the co-localized Cy3 andCy5 emitted fluorescence (right).

Paper RSC Advances

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

315 nm) has been reported to cause damage to DNA. Deami-nation of bases, depyrimidination and depurination as well asformation of free radicals or reactive oxygen species are someof the UV induced possible changes.40 However, both immo-bilized MBs were capable of recognizing the target sequences.Illumination time applied for the immobilization of MBpatterns was very short (ms), as the velocity of the movingstage upon illumination was of 100 mm s�1. Thus, thehybridization between the target sequences and the immobi-lized MB constructs hereby reported was not hindered by theimmobilization process.

The excitation wavelength chosen (laser line at 543 nm) forCFM imaging was close to the maximum excitation wavelengthdescribed for Cy3 (z548 nm) and the monitored emissionwavelengths correspond to intervals where both Cy3 and Cy5emit, respectively. At 700 nm (approximate lower limit of theinterval in which Cy5 uorescence emission was monitored),there is almost no uorescent emission for Cy3 (z2% relative toits maximum absorption intensity) whereas for Cy5 the uo-rescence emission intensity at this wavelength is z28%.Furthermore, at the excitation wavelength selected, Cy5 hasonly a residual absorption of 6% (compared to its maximumabsorption intensity).35 As a consequence, the monitored uo-rescence emission intensity is mainly due to FRET, even thoughsome background uorescence might be visible in the wave-length interval monitored for Cy5 emission. Control experi-ments where the immobilized Cy3 labelled poly-A MB constructwas hybridized with a Cy5 labelled non-complementary oligo-nucleotides (poly-A oligonucleotide) show that there is no Cy5

This journal is © The Royal Society of Chemistry 2019

emission (upon Cy3 excitation) (Fig. S5†). When using themiRNA-21 MB construct, a faint residual Cy5 signal can beobserved (Fig. S6†).

The focal distance also inuences the pattern spatial distribu-tion. Fig. 10A1 and B1 show a difference in the thickness of thelines in the immobilized patterns. Although both arrays weredesigned under the same conditions, a small difference in thefocal distance inuences the immobilized pattern. The patternimmobilized with more focused light displays lines with z5 mmwidth whereas the pattern immobilized with less focused lightdisplays lines with a width ofz17 mm, even though both patternspresent a distance between lines of 50 mm, as specied in thedesign. All MB constructs were immobilized with mm resolution.

4.3 Photonic immobilization with LAMI and photonic-baseddetection on SOI chips with PBG sensing structures – label-free detection

The detection of LAMI immobilized miRNA-21 specic MBusing PBG structures was successful. However, it was observedthat the sensitivity of detection is dependent on physicalparameters such as the width of the transversal elements of thesensing structures and also the presence of SiO2 in thesestructures. As the PBG sensing structures need to be in contactwith the medium to be analysed, windows are opened in theSiO2 upper cladding just in the positions where they are placedby UV lithography and etching of the SiO2. Aer opening thesewindows, a more robust photonic chip is obtained, but thepresence of some SiO2 residues in the walls of the PBG sensingstructures produces a decrease of its sensitivity. This trade-off

RSC Adv., 2019, 9, 12766–12783 | 12781

Fig. 12 Spectral evolution of the PBG edge position for the sensing structures within the photonic chip when the target miR-21 is flowed overtheir surface. The sensing response for PBG sensor is depicted in a different color.

RSC Advances Paper

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

between chip robustness and sensitivity needs to be overcomein future sensing chips developments. The physical parametersof the PBG sensing structure also have a dramatic inuence onthe sensitivity. The acquired sensing signal for the structurehaving wider transversal elements of the PGB sensing structurewas �4 times higher (Fig. 12, red line) than the signal obtainedfor the narrower transversal elements of the PBG sensingstructure (Fig. 12, blue line). This sensitivity difference is higherthan what it might be expect (around 1.5� from previousexperiments), possibly due to the non-uniform presence of theSiO2 residues from the upper cladding layer. Nanophotonicsensing technology is characterized by a very high sensitivity,which comes from the high interaction occurring between thelight conned in the photonic structures and the target analytesin a reduced size structure. Additionally, the type of PBGsensing structures used in this work have demonstrated an evenhigher sensitivity,41 which is determined by the appearance ofthe so-called slow-wave behavior that induces a more effectiveinteraction with the target analyte during a longer time.

5 Conclusions

The new MB constructs presented in this paper were able torecognize target sequences in vitro. One of such sequences isa biomarker for colon and breast cancer. The recognition ach-ieved by the two MB constructs was assessed by two differentuorescence recognition methods. These constructs weresuccessfully immobilized onto thiol reactive surfaces usingLAMI. LAMI presents some advantages over more conventionalimmobilization techniques as it allows for immobilization inspatially oriented and covalent manner and with mm resolution(sub-mm resolution can also be achieved).22,23 Biosensorsbioavailability is not compromised by the UV light used forimmobilization, making these biosensors and LAMI suitable toproduce arrays for integration in POC diagnostic devices andused in this specic project for the detection of cancerbiomarkers.

12782 | RSC Adv., 2019, 9, 12766–12783

Conflicts of interest

The authors declare no conicts of interest.

Acknowledgements

This work was supported by the European Commission throughthe project H2020-644242 – SAPHELY and the project H2020-634013-2-PHOCNOSIS.

References

1 New Global Cancer Data: GLOBOCAN 2018|UICC, https://www.uicc.org/new-global-cancer-data-globocan-2018,accessed 14 December 2018.

2 WHO|Cancer, http://www.who.int/cancer/en/, accessed 14December 2018.

3 WHO|Cancer, http://www.who.int/mediacentre/factsheets/fs297/en/, accessed 16 August 2017.

4 Y. Li, C. Qiu, J. Tu, B. Geng, J. Yang, T. Jiang and Q. Cui,HMDD v2.0: a database for experimentally supported humanmicroRNA and disease associations, https://academic.oup.com/nar/article-lookup/doi/10.1093/nar/gkt1023, accessed 16 August 2017.

5 G. A. Calin, C. D. Dumitru, M. Shimizu, R. Bichi, S. Zupo,E. Noch, H. Aldler, S. Rattan, M. Keating, K. Rai,L. Rassenti, T. Kipps, M. Negrini, F. Bullrich andC. M. Croce, Proc. Natl. Acad. Sci. U. S. A., 2002, 99, 15524–15529.

6 M. D. Jansson and A. H. Lund, Mol. Oncol., 2012, 6, 590–610.7 Y. S. Lee and A. Dutta, Annu. Rev. Pathol., 2009, 4, 199–227.8 S. Volinia, G. A. Calin, C.-G. Liu, S. Ambs, A. Cimmino,F. Petrocca, R. Visone, M. Iorio, C. Roldo, M. Ferracin,R. L. Prueitt, N. Yanaihara, G. Lanza, A. Scarpa,A. Vecchione, M. Negrini, C. C. Harris and C. M. Croce,Proc. Natl. Acad. Sci. U. S. A., 2006, 103, 2257–2261.

9 J. Iqbal, Y. Shen, X. Huang, Y. Liu, L. Wake, C. Liu,K. Deffenbacher, C. M. Lachel, C. Wang, J. Rohr, S. Guo,

This journal is © The Royal Society of Chemistry 2019

Paper RSC Advances

Ope

n A

cces

s A

rtic

le. P

ublis

hed

on 2

5 A

pril

2019

. Dow

nloa

ded

on 5

/9/2

019

3:07

:08

PM.

Thi

s ar

ticle

is li

cens

ed u

nder

a C

reat

ive

Com

mon

s A

ttrib

utio

n-N

onC

omm

erci

al 3

.0 U

npor

ted

Lic

ence

.View Article Online

L. M. Smith, G. Wright, S. Bhagavathi, K. Dybkaer, K. Fu,T. C. Greiner, J. M. Vose, E. Jaffe, L. Rimsza, A. Rosenwald,G. Ott, J. Delabie, E. Campo, R. M. Braziel, J. R. Cook,R. R. Tubbs, J. O. Armitage, D. D. Weisenburger,L. M. Staudt, R. D. Gascoyne, T. W. McKeithan andW. C. Chan, Blood, 2015, 125, 1137–1145.

10 S. Thakur, R. K. Grover, S. Gupta, A. K. Yadav and B. C. Das,PLoS One, 2016, 11, e0158946.

11 A. Bunschoten, T. Buckle, J. Kuil, G. D. Luker, K. E. Luker,O. E. Nieweg and F. W. B. van Leeuwen, Biomaterials, 2012,33, 867–875.

12 C. Glinge, S. Clauss, K. Boddum, R. Jabbari, J. Jabbari,B. Risgaard, P. Tomsits, B. Hildebrand, S. Kaa, R. Wakili,T. Jespersen and J. Tfelt-Hansen, PLoS One, 2017, 12(2),e0167969.

13 P. S. Mitchell, R. K. Parkin, E. M. Kroh, B. R. Fritz,S. K. Wyman, E. L. Pogosova-Agadjanyan, A. Peterson,J. Noteboom, K. C. O'Briant, A. Allen, D. W. Lin, N. Urban,C. W. Drescher, B. S. Knudsen, D. L. Stirewalt,R. Gentleman, R. L. Vessella, P. S. Nelson, D. B. Martinand M. Tewari, Proc. Natl. Acad. Sci. U. S. A., 2008, 105,10513–10518.

14 J. A. Weber, D. H. Baxter, S. Zhang, D. Y. Huang,K. H. Huang, M. J. Lee, D. J. Galas and K. Wang, Clin.Chem., 2010, 56(11), 1733–1741.

15 Globocan 2012 – Home, http://globocan.iarc.fr/Default.aspx,accessed 16 August 2017.

16 M. T. Neves-Petersen, T. Snabe, S. Klitgaard, M. Duroux andS. B. Petersen, Protein Sci., 2006, 15, 343–351.

17 M. T. Neves-Petersen, M. Duroux, E. Skovsen, L. Duroux andS. B. Petersen, J. Nanosci. Nanotechnol., 2009, 9, 3372–3381.

18 E. Skovsen, T. Neves-Petersen, L. Duroux and S. Petersen,Advanced Biomedical and Clinical Diagnostic Systems VI,Proc. of SPIE, 2008, vol. 6848, p. 68480O-1.

19 E. Skovsen, M. Duroux, M. T. Neves-Petersen, L. Duroux andS. B. Petersen, Int. J. Optomechatronics, 2007, 1, 383–391.

20 M. Duroux, E. Skovsen, M. T. Neves-Petersen, L. Duroux,L. Gurevich and S. B. Petersen, Proteomics, 2007, 7, 3491–3499.

21 E. Skovsen, M. T. Neves-Petersen, A. Kold, L. Duroux andS. B. Petersen, J. Nanosci. Nanotechnol., 2009, 9, 4333–4337.

22 E. Skovsen, A. B. Kold, M. T. Neves-Petersen andS. B. Petersen, Proteomics, 2009, 9, 3945–3948.

23 S. B. Petersen, A. Kold di Gennaro, M. T. Neves-Petersen,E. Skovsen and A. Parracino, Appl. Opt., 2010, 49, 5344–5350.

This journal is © The Royal Society of Chemistry 2019

24 P. Jonkheijm, D. Weinrich, H. Schroder, C. M. Niemeyer andH. Waldmann, Angew. Chem., Int. Ed., 2008, 47, 9618–9647.

25 D. S. Wilson and S. Nock, Curr. Opin. Chem. Biol., 2002, 6, 81–85.

26 B. Johnsson, Anal. Biochem., 1991, 277, 268–277.27 A. Collioud, J. F. Clemence, M. Sanger and H. Sigrist,

Bioconjugate Chem., 1993, 4, 528–536.28 R. Y. Sweeney, B. R. Kelemen, K. J. Woycechowsky and

R. T. Raines, Anal. Biochem., 2000, 286, 312–314.29 M. T. Petersen, P. H. Jonson and S. B. Petersen, Protein Eng.,

1999, 12, 535–548.30 M. T. Neves-Petersen, Z. Gryczynski, J. Lakowicz, P. Fojan,

S. Pedersen, E. Petersen and S. B. Petersen, Protein Sci.,2002, 11, 588–600.

31 M. T. Neves-Petersen, S. Klitgaard, T. Pascher, E. Skovsen,T. Polivka, A. Yartsev, V. Sundstrom and S. B. Petersen,Biophys. J., 2009, 97, 211–226.

32 Black Hole Quencher® Dyes|LGC Bioresearch Technologies,https://www.biosearchtech.com/support/education/uorophores-and-quenchers/black-hole-quencher-dyes,accessed 12 December 2017.

33 M. Zuker, Nucleic Acids Res., 2003, 31, 3406–3415.34 A. Tsourkas, M. A. Behlke, S. D. Rose and G. Bao, Nucleic

Acids Res., 2003, 31, 1319–1330.35 Thermo Fisher Scientic Inc., Fluorescence SpectraViewer,

https://www.thermosher.com/dk/en/home/life-science/cell-analysis/labeling-chemistry/uorescence-spectraviewer.html, accessed 7 November 2017.

36 O. Gonçalves, S. Snider, R. Zadoyan, Q.-T. Nguyen,H. Vorum, S. B. Petersen and M. T. Neves-Petersen,Reporters, Markers, Dyes, Nanoparticles, and MolecularProbes for Biomedical Applications IX, Proc. of SPIE, 2017,vol. 10079, p. 100790F-1.

37 J. R. Lakowicz, Principles of uorescence spectroscopy,Academic/Plenum Publishers, New York, 2nd edn, 1999.

38 C. S. Wu, L. Peng, M. You, D. Han, T. Chen, K. R. Williams,C. J. Yang and W. Tan, Int. J. Mol. Imaging, 2012, 2012,501579.

39 S. B. Nimse, K. Song, M. D. Sonawane, D. R. Sayyed andT. Kim, Sensors, 2014, 14, 22208–22229.

40 R. P. Rastogi, A. K. Richa, M. B. Tyagi and R. P. Sinha, J.Nucleic Acids, 2010, 2010, 592980.

41 A. Ruiz-Tortola, F. Prats-Quılez, D. Gonzalez-Lucas,M.-J. Banuls, A. Maquieira, G. Wheeler, T. Dalmay,A. Griol, J. Hurtado and J. Garcıa-Ruperez, Biomed. Opt.Express, 2018, 9, 1717–1727.

RSC Adv., 2019, 9, 12766–12783 | 12783