A GENETIC AND EPIDEMIOLOGICAL STUDY OF HEREDITARY NON-

POLYPOSIS COLORECTAL CANCER IN COLORECTAL CARCINOMA PATIENTS PRESENTING TO A TERTIARY CARE

HOSPITAL

Department of SGENIMS Hyderabad

23-03-2009

THIS STUDY IS BEING DONE IN COLLABORATION WITH

CENTER FOR DNA FINGERPRINTING AND DIAGNOSTICS(CDFD)

Abbreviations

CRC colorectal carcinoma HNPCC Hereditary Non-polyposis

Colorectal Cancer APC adenomatous polyposis coli MSI micro satellite instability MMR mismatch repair PCR polymerase chain reaction

Outline

Background Aim Materials Methods

DNA isolation Genomic Tumor

Microsatellite instability Immunohistochemistry for MMR genes PCR Sanger’s sequencing

What is HNPCC(Lynch Syndrome)

Definition is based on demonstration of mutation in MMR genes

No clinical definition Amsterdam’s criteria helps in

clinically defining HNPCC

Amsterdam II criteria:

What is Amsterdam's criteria

What are Bethesda guidelines

Tests for HNPCC

Screening tests Confirmatory tests

Background

Colorectal carcinoma in India is biologically a different disease compared to western population. Occurs in young age Rectal carcinoma constitutes half of the cases Incidence is less Majority of young CRC patients are sporadic Late presentation

No studies on CRC genetics from India No reported cases of HNPCC from India

Background

90% of CRC in west occur after 50years

India 50-60% <50years

WHY?

Background

In west 10% occur in young 30% of these are HNPCC

This stimulated us to study about HNPCC and colorectal carcinoma in our own population

Vogelstein’s pathway

Background

HNPCC is caused by MSI, the hallmark of HNPCC

MSI is caused by MMR genes mutation

MMR genes are also called caretaker genes

MMR gene mutation causes HNPCC

Background

Bethesda guidelines are for MSI screening

It is likely that Bethesda guidelines are not useful in Indian population.

This hypothesis will be either proved or disproved by our study.

Life time risk of cancer in HNPCC

Primary objective

To study the incidence of HNPCC in CRC patients presenting to NIMS.

To study the mutations causing HNPCC

To identify any new mutation Study the usefulness of MSI & IHC in

diagnosing HNPCC To screen first degree relatives of

HNPCC patients for MMR mutation

Secondary objective

To assess age distribution , sex distribution , site distribution of CRC

To assess pathologic characteristics of CRC

To assess stage of presentation

INCLUSION CRITERIA

1. CRC, diagnosed in patients < 50 years2. Synchronous or metachronous CRC or

other tumors associated with HNPCC, regardless of age

3. CRC with of MSI-H or specific histology diagnosed < 60 years.

4. HNPCC related cancer <50yrs in 1 first degree relative

5. HNPCC associated tumor at any age in two first- or second-degree relatives

Exclusion criteria

All patients with neoadjuvant CT/RT are excluded from study.

All patients who are HIV/HBsAg +ve. Patients with FAP

Methods

DNA isolation Genomic Tumor

Microsatellite instability Immunohistochemistry for MMR genes PCR Sanger’s sequencing

Case 1

24yr female with bleeding PR Sigmoid carcinomas at two

synchronous locations-T2N0M0 Left hemi-colectomy T2N0M0 x2 3 yrs later - multiple carcinomas Caecum –T3N0M0 Duodenum-T2N0M0 Jejunum –T2N0M0

DNA isolation

Genomic DNA Blood – easy to isolate Normal tissue

Tumor DNA H&E stained 5micron slide Identify tumor cells Scrape the cells Isolate DNA

DNA isolation from blood

3ml blood Potassium EDTA bottle Store at 40⁰ c Should not be frozen If frozen - should not be thawed Blood should not be stored for more

than 7 days because yield will come down

DNA isolation from blood

Centrifuge blood after adding erythrocyte lysis buffer –30min

Centrifuge @10000 rpm for 10min Discard supernatant fluid WBC pellet Add proteinkinase , DDS Incubate at 37⁰ C for 12hours Purification of DNA

DNA isolation from blood

Purification is a lengthy procedure WBC pellet is digested with

proteinkinase Intra cellular contents are released Repeated purification and

centrifugation Protein heaviest at bottom DNA next to protein Need careful extraction

Once DNA is isolated it can be stored at -20⁰ c for a long time for many reactions

Genomic DNA is highly concentrated Should be very careful otherwise it

will contaminate other reactions

PCR

First described in 1985, Nobel Prize for Kary Mullis in 1993

The technique was made possible by the discovery of Taq polymerase, the DNA polymerase that is used by the bacterium Thermus aquaticus, discovered in hot springs.

PCR

The primary materials, or reagents, used in PCR are: DNA nucleotides, the building blocks for the

new DNA Template DNA, the DNA sequence that you

want to amplify Primers, single-stranded DNAs between 20 and

50 nucleotides long (oligonucleotides) that are complementary to a short region on either side of the template DNA

DNA polymerase, a heat stable enzyme that drives, or catalyzes, the synthesis of new DNA

PCR

Sample tray and micropipettor. Each tray holds 96 samples

http://en.wikipedia.org/wiki/File:PCR.svg

PCR

The result is a dramatic amplification of a the DNA that exists between the primers.

The amount of amplification is 2 raised to the n power;

n represents the number of cycles that are performed.

After 20 cycles, this would give approximately 1 million fold amplification. After 40 cycles the amplification would be 1 x 1012

STEP-1

Denaturation at around 94°C : During the denaturation, the double

strand melts open to single stranded DNA, all enzymatic reactions stop (for example the extension from a previous cycle).

STEP-2

Annealing at around 54°C : Hydrogen bonds are constantly

formed and broken between the single stranded primer and the single stranded template. If the primers exactly fit the template, the hydrogen bonds are so strong that the primer stays attached

STEP-3

Extension at around 72°C : The bases (complementary to the

template) are coupled to the primer on the 3' side (the polymerase adds dNTP's from 5' to 3', reading the template from 3' to 5' side, bases are added complementary to the template)

THERMOCYCLER

Sitamahalakshmi

AGAROSE GEL ELECTROPHORESIS

A method used toseparate macromoleculeslike proteins and nucleicacids (ie DNA/RNA) basedon their size and electriccharge

Sequencing

“Sequencing” means finding the order of nucleotides on a piece of DNA .

Nucleotide order determines Amino acid order, and by extension, protein structure and function (proteomics)

An alteration in a DNA sequence can lead to an altered or non functional protein, and hence to a harmful effect

Sequencing

Historically there are two main methods of DNA sequencing:

Maxam & Gilbert, using chemical sequencing

Sanger, using dideoxynucleotides.

Modern sequencing equipment uses the principles of the Sanger technique.

The Sanger Technique

Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc)

These are molecules that resemble normal nucleotides but lack the normal -OH group.

Because they lack the -OH (which allows nucleotides to join a growing DNA strand), replication stops.

Normally, this wouldbe where another phosphateIs attached, but with no -OHgroup, a bond can not form and replication stops

The Sanger method requires

Multiple copies of single stranded template DNA A suitable primer (a small piece of DNA that can

pair with the template DNA to act as a starting point for replication)

DNA polymerase (an enzyme that copies DNA, adding new nucleotides to the 3’ end of the template

A ‘pool’ of normal nucleotides A small proportion of dideoxynucleotides

labeled in some way ( radioactively or with fluorescent dyes)

The template DNA pieces are replicated, incorporating normal nucleotides, but occasionally and at random dideoxy (DD) nucleotides are taken up.

This stops replication on that piece of DNA The result is a mix of DNA lengths, each

ending with a particular labeled DDnucleotide.

Because the different lengths ‘travel’ at different rates during electrophoresis, their order can be determined.

A Nanodrop readout :DNA purity & concentration is checked by spectrophotometer

Preparing the wells

The Sample wells are loaded with DNA to be sequenced. Great care needs to be taken to ensure that each sample goes into its assigned well.

Reagents are added (water, dye, primers) in required amounts

The sample wells are ‘spun’ to ensure that the DNA and reagents are mixed and at the bottom of the sample wells.

The samples are run through a cycle sequencing process to get the fluorescent dyes incorporated by the DNA.The DNA and reagents are alternately heated and cooled over a2 1/2 hour period.

Mlh1 amplicons

Exon 1; amplicon 1 5’ UTR:

Tggggctggatggcgtaagctacagctgaaggaagaacgtgagcacgaggcactgaggtg

Exon 1: ATTGGCTGAAGGCACTTCCGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCAAAATGTCGTTCGTGGCAGGGGTTATTCGGCGGCTGGACGAGACAGTGGTGAACCGCATCGCGGCGGGGGAAGTTATCCAGCGGCCAGCTAATGCTATCAAAGAGATGATTGAGAACTG

Intron1: gtacggagggagtcgagccgggctcacttaagggctacgacttaacgggccgcgtcactcaatggcgcggacacgcctctttgcccgggcagaggcatgtacagcgcatgcccacaacggcggaggccgccgggttccctgacgtgccagtcaggccttctccttttccgcagaccgtgtgt

Microsatellites

Microsatellites also known as variable nucleotide tandem repeats (VNTRs), are loci throughout the genome in which a short motif, such as a dinucleotide or mononucleotide sequence, is repeated at least several times.

AAAAAAAAAAAAAAAAAAAAAAAAAAAAA

CACACACACACACACACACACACACACACA

Microsatellites

Microsatellites refer to long segments of nontranscribed DNA that are composed of a repeating mononucleotide (eg, AAAAAAAAAAAAAAAA) or dinucleotide sequences (eg, GTGTGTGTGTGTGT).

These long DNA sequences provide a simple indicator of genetic mutation rate and risk because mutations are readily apparent in these long repeating sequences.

MSI

MSI is the hallmark of lynch syndrome occuring in >90% of lynch syndrome.

Aaltonen L.A et.al science 1993;260:812-816Altonen et.al cancer res-1994;54;1645

MSI

Only 20% to 25% of patients who have MSI-H colon cancer have an MMR gene mutation and Lynch syndrome .Barnetson RA, Tenesa A, et al. . N Engl J Med 2006;356(26):2751–63.

MSI

The finding of microsatellite instability should lead to genetic testing because it is found in more than 90% of patients who have Lynch syndrome,but in only 15% to 20% of patients who have sporadic colon cancer.

ICG-HNPCC

Mismatch Repair Genes

MMR are called caretaker genes because of their important role in policing the integrity of the genome and correcting DNA replication errors.

MMR genes that undergo a loss of function contribute to carcinogenesis by accelerating tumor progression.

Mismatch Repair Genes

Mutations in MMR genes produce microsatellite instability.

Microsatellites are repetitive sequences of DNA that appear to be randomly distributed throughout the genome.

Mismatch Repair Genes

Stability of microsatellite sequences is a good measure of the general integrity of the genome.

MMR gene mutations result in errors in S phase when DNA is newly synthesized and copied.

Microsatellite instability exists in 10% to 15% of sporadic tumors and in 95% of tumors in patients with HNPCC. Even so, only 50% of patients diagnosed with HNPCC have readily identifiable MMR mutations.

Mismatch Repair Genes

Stability of these sequences is a good measure of the general integrity of the genome.

MMR gene mutations result in errors in S phase when DNA is newly synthesized and copied.

Microsatellite instability exists in 10% to 15% of sporadic tumors and in 95% of tumors in patients with HNPCC. Even so, only 50% of patients diagnosed with HNPCC have readily identifiable MMR mutations.

Age Number

</=20 221-30 431-40 941-50 1051-60 861-70 471-80 3total 41

Observations

Total number of cases till now 41 Male 21 Female 20

<50 yrs 25 >50 yrs 16

Rectal ca 20 Colonic 21

Site Number Caecum 4Ascending colon 4Hepatic flx. 2Transverse colon +1Splenic flex. 1Descending colon 4+1Sigmoid colon 3Rectum 20Total 41

Sex distribution

number

male female

FAMILY HYSTORY

SIGNIFICANT IN 10 PATIENTS 1st degree relatives with cancer 8

patients Second primary in 2 patients

Patient no 14

Patient no 14

Patient no 6,8

Patient no 2,3,4,5 for 5 exons

Patient no 2,3,4,5 for 5 exons

Our plan of work for next 3 months

12 patients suspected HNPCC – priority Complete investigation DNA isolation

Tumor Genomic

MSI IHC DNA amplification of specific gene all exons Sequencing Final result

Next

All patients who are included in study – MSI IHC

MSI+ IHC + DNA-SEQUENCING FINAL RESULT

THANK YOU