Deletion in the promoter region and altered expression of Pitx3

© 2000 Oxford University Press Human Molecular Genetics, 2000, Vol. 9, No. 11 1575–1585

Deletion in the promoter region and altered expressionof Pitx3 homeobox gene in aphakia miceElena V. Semina1,+, Jeffrey C. Murray1,2, Rebecca Reiter2, Ronald F. Hrstka3 andJochen Graw4

1Department of Pediatrics, 2Biological Sciences and 3Department of Obstetrics and Gynecology, University of Iowa,Iowa City, IA 52242, USA, 4GSF-National Research Center for Environment and Health, Institute of MammalianGenetics, D-85764 Neuherberg, Germany

Received 4 February 2000; Revised and Accepted 14 April 2000 DDBJ/EMBL/GenBank accession no. AF224268

Mouse aphakia (ak) is a recessive phenotype that spon-taneously occurs in the 129/Sv-SlJ strain and is charac-terized by small eyes that lack a lens. We have recentlyidentified a homeobox-containing gene, Pitx3, and haveshown that it is expressed in the developing lens andmaps to chromosome 19 close to ak in mouse. HumanPITX3 gene was found to underlie anterior segmentdysgenesis and cataracts. We have now obtained theentire sequence of the mouse Pitx3 gene including 10 kbof the 5′ region and 5 kb of the 3′ region. Of severalmicrosatellite repeat regions identified within the Pitx3sequence, one was informative for linkage analysis. Norecombination was observed between ak and the Pitx3marker, indicating that these two loci are closely linked(0.2 ± 0.2 cM). Additionally, Pitx3 transcripts were notdetected in the ak/ak mice either in the lens placode or atlater developmental stages of the lens by in situ hybridi-zation. Since no differences were previously foundbetween ak/ak and wild-type sequences in the Pitx3coding region, we hypothesized that an etiologic muta-tion is located in the promoter or other regulatoryregions. To test this hypothesis we studied the 5′flanking region of the Pitx3 gene. This analysis revealeda deletion of 652 bp located 2.5 kb upstream from thestart point of the Pitx3 5′ UTR sequence in ak/ak mice.The deletion co-segregated with the ak mutation andwas not detected in 16 samples from 10 different mousestrains including the founder strains. Analysis of the 652bp region identified sequences similar to consensusbinding sites for transcription factors AP-2 and Maf thatwere shown to play a critical role in lens determination.These lines of evidence suggest that the abnormalocular development in the aphakia mouse is due to thedeletion upstream of the Pitx3 gene.

INTRODUCTION

Human cataracts represent one of the major causes of treatableblindness, accounting for nearly half of all vision impairment

worldwide (1). Congenital cataracts are less common (the esti-mated prevalence is 1 to 6 cases per 10 000 live births) but aremore difficult to treat and are therefore responsible for a signif-icant number of blind individuals in the pediatric age group(2). Moreover, healthy lens embryology is essential for thenormal development of other ocular structures, particularly inthe anterior chamber of the eye, that play an important role innormal vision. Analysis of factors underlying normal lensdevelopment is difficult in humans; therefore mouse modelsare often used in these studies.

In addition, the embryonic lens of vertebrates provides auseful model for studying gene regulation of tissue develop-ment from tissue induction to maturation. During develop-ment, the vertebrate lens is induced upon contact betweenpresumptive retina (optic vesicle) and surface ectoderm. As aresult, the ectoderm thickens into a placode that will first forma vesicle and later differentiate into a lens. To date, more than46 mouse mutations have been described that result in lensabnormalities with some that affect early lens development(reviewed in ref. 3). Genetic factors responsible for themajority of these phenotypes are still to be determined.

Mouse aphakia (ak) is a recessive phenotype that spontane-ously occurred in the 129/Sv-SlJ strain and was first describedby Varnum and Stevens in 1968 (4). The phenotype of ak/aknewborn mice is characterized by small eyes that lack a lens aswell as anterior segment structures. These anomalies arecaused by an arrest of lens development at the stage of lensvesicle formation around embryonic days 10.5–11 (4,5). In theak/ak mutants, there is a persistence of the lens stalk at embry-onic day 12.5 interrupting the corneal mesenchyme andleading to a permanent close contact between the developingcornea and other ocular tissues without the formation of ananterior chamber (5,6). There are no other systemic abnormal-ities reported in these mice.

Transcription factors in general and homeodomain-containing proteins in particular are fundamental for thegenetic control of different basic developmental processes. Wehave recently identified a homeobox-containing gene, Pitx3,and showed that it is expressed in the developing lens andmaps to chromosome 19 close to ak (7). The human homologof this gene, PITX3, which maps to the 10q24–25 region, wasfound, when mutated, to cause anterior segment dysgenesis

+To whom correspondence should be addressed. Tel: +1 319 335 6566; Fax: +1 319 335 6970; Email: [email protected]

1576 Human Molecular Genetics, 2000, Vol. 9, No. 11

with cataract and congenital total cataract in two unrelatedfamilies (8). All these facts—location, expression pattern andconserved function of the PITX3/Pitx3 gene during mamma-lian lens development—implicated it as being a strong candi-date for the ak phenotype. Surprisingly, a search for mutationsfailed to identify any significant differences in the coding andexon–intron junction regions of Pitx3 between ak and wild-type genomic DNA (7) as well as mRNA (J. Graw, unpub-lished results) sequences.

In this paper we report close linkage between ak and Pitx3gene, altered expression of Pitx3 in ak/ak mice and identifica-tion of a deletion in a 5′ flanking region of the Pitx3 gene,which is specific for ak mice and is not seen in two strainsconstituting the background of this mutation as well as eightother mouse strains. Therefore we suggest that altered expres-sion of the Pitx3 gene in ak mice is most likely a result of thedeletion and leads to an abnormal phenotype in these mice.

RESULTS

Genomic sequence of the mouse Pitx3 gene: analysis of thepromoter region and identification of neighboring genesGbf1 and Cig30

The genomic sequence of the Pitx3 gene was obtained bysequencing of BAC genomic clones: complete sequence ofintrons and ~10 kb of a 5′ flanking region and ~5 kb of a 3′flanking region was identified. The gene was found to span12.6 kb in genomic sequence and to consist of four exons of125, 129, 210 and 927 bp for exons 1–4, respectively, and threeintrons of 10729, 196 and 379 bp for introns 1–3, respectively(Fig. 1A). The genomic structure of the Pitx3 gene resemblesthe other Pitx genes, Pitx1 and Pitx2, with the homeoboxregion being interrupted by an intron at position 46 of thehomeodomain and the large first intron separating the first andsecond exons (9). Analysis of the Pitx3 genomic sequence wasperformed by comparison with other sequences in GenBankusing the BLAST program (http://www.ncbi.nlm.nih.gov/blast/blast.cgi ). Identification of potential transcription unitswas performed by GRAIL analysis and identification ofconsensus binding sites for different transcription factors wasperformed using MatInspector Version 2.2 software(http://transfac.gbf-braunschweig.de/cgi-bin/matSearch/matsearch.pl ) as well as manually.

Analysis of the genomic sequence identified two murinegenes in close proximity to the Pitx3 gene: the Gbf1 gene, amouse homologue of the human GBF1, a ubiquitouslyexpressed gene of the Sec7 domain family (10), and the Cig30gene, encoding a brown adipose tissue membrane glycoprotein(11). The Gbf1 gene sequence was identified in the 5′ flankingregion of the Pitx3 gene at a distance of 4.2 kb from the Pitx35′ UTR start point; the direction of the transcription of the Gbf1gene is opposite to that of the Pitx3 gene, hence the 5′ regionsof these two genes overlap (Fig. 1A). Four exons of the Cig30gene were identified in the 4.5 kb region immediately down-stream of the Pitx3 gene but oriented in the opposite direction.In fact, the 3′ UTR sequences of the Cig30 and Pitx3 genes arecomplementary over the last 10 nucleotides. This is in agree-ment with a previous report (12). No other existing or potentialtranscription units were identified within 22 kb of Pitx3genomic sequence.

The DNA located upstream and surrounding the transcrip-tion initiation sites typically confers promoter activity for agene. As a transcription start point (tsp), the exact 5′ end ofPitx3 mRNA from mouse embryonic carcinoma was used (7).Analysis of the 5′ flanking region upstream of this tsp identi-fied the closest potential CAAT and TATA box sequences atpositions –205 to –200 and –86 to –80, and at positions –1590to –1584 and –1560 to –1552 (Fig. 1B). Also, sequencessimilar to consensus binding sites for some tissue-specific tran-scription factors were identified: several motifs similar to theAP-2 consensus sequence 5′-CCCCAGG-3′ (13) or 5′-CCCAGCCC-3′ (14); several sequences similar to thealphaCE2 element, 5′-TGCTGACC-3′, that was originallyidentified in the alpha A-crystallin gene promoter and wasshown to bind Maf transcription factors (13,15); and twomotifs similar to binding sites for forkhead-7 (16) (Fig. 1B).The AP-2 and Maf proteins were found to be crucial for normalformation of the craniofacial region and play an important rolein lens development (17–22).

Figure 1. (A) Structure of the Pitx3 genomic region. The Pitx3 exons areshown as boxes numbered 1–4; the coding region is shown in gray and thehomeobox region in black. The Gbf1 and Cig30 exons are located in theregions that are 5′ and 3′ to the Pitx3 gene, respectively; the direction ofexpression of each gene is indicated by arrows. The ∆0.652 ak/ak deletion isshown as a striped box. (B) Nucleotide sequence of the 5′ flanking region ofthe Pitx3 gene. The sequence of the first exon is shown in uppercase letterswhile the sequence of the 5′ flanking region is in lowercase letters; the first ini-tiation codon (Met) is indicated. The boxed area corresponds to the 652 bpdeletion. The transcription initiation site is shown in bold and assumed to be+1. Sequences similar to consensus binding sites for several transcription fac-tors are shown as follows: AP2, highlighted in light gray; Maf, boxed bold text;forkhead-7/FOXL1, boxed italicized text.

Human Molecular Genetics, 2000, Vol. 9, No. 11 1577

Pitx3 gene and aphakia are closely linked

In previous reports, a distance of 1.8 cM between ak and Pitx3was deduced from two independent crosses (5). In order toperform a detailed linkage analysis of Pitx3 and ak/ak, weidentified seven microsatellite repeat regions within the Pitx3genomic sequence (Table 1) and tested five of them for poly-morphisms between ak/ak and the two mouse strains, AKR andJF1, which were previously used for fine mapping of the akmutation (5). Three markers did not reveal any differencesbetween ak/ak, AKR and JF1 mice; only the Pitx3-CT markerwas informative with the JF1 strain. Therefore this marker wasused to search for recombination events in the existing back-cross panel of 416 F2 animals from matings (ak/ak × JF1)F1 ×ak/ak (5). In particular, all animals were checked for recombi-nations within the interval between the markers D19Mit19 andD19Mit38 spanning the entire ak-critical region of ~8 cM. Norecombination was observed between ak and the Pitx3-CTmarker placing them at a distance of 0.2 ± 0.2 cM from eachother. In addition, the markers D19Mit7, D19Mit8 andD19Mit102 were used in the same set of animals to refine theprevious mapping data. The results led us to conclude that themarker D19Mit8 is also very close to ak; however, D19Mit102(one recombination) and D19Mit7 (six recombinationsincluding one double crossover) have to be placed more prox-imal to ak (Fig. 2A). The actual mapping positions of ak andpolymorphic markers are summarized in Figure 2B.

Moreover, the markers Pitx3-CTT and CTAC did not give asignal in the ak/ak mutants, but yielded strong signals in alltested wild-type mice suggesting that an ak-specific deletionmight be present in the corresponding region (see below).Therefore, another set of primers was designed spanning theentire region including both repetitive sequences. Using thesenovel primers, all the ak/ak mutants revealed a shorter frag-ment than the wild-types: heterozygotes showed the long wild-type band and the short ak band. This strain difference alsosegregated in the JF1 backcross together with the ak mutation;no recombination could be detected. In conclusion, all thesemapping experiments demonstrated a close linkage of ak toPitx3 and, moreover, suggested a deletion in the region of theCTAC and CTT repeats.

Expression of the Pitx3 gene is altered in aphakia mice

The aphakia mice are characterized by severe ocular abnor-malities (Fig. 3). Varnum and Stevens originally reported in1968 (3) that the first visible abnormalities in ak lens develop-ment are seen at the early lens vesicle stage in 10.5- to 11-dayembryonic ak mice, with further development of the lens andthe eye being grossly disturbed. Later, Zwaan and Kirkland(23) noted that distinct anomalies are already seen at the lensplacode stage in 10- to 10.5-day embryonic ak mice. There-fore, we studied expression of the Pitx3 gene in the eye indetail to see whether its expression coincides with the onset ofanomalies in ak mice and to better assess the role of Pitx3.

Sections at the level of the eye from embryonic day 10 topostnatal day 1 were studied by in situ hybridization in wild-type mice. Adult eye RNA was analyzed by RT–PCR. Expres-sion was first strongly detected in the late lens placode stageshortly before the start of its invagination towards the optic cup(Fig. 4). Later in development expression was seen in the lenspit and in the primary fiber cells that obliterate the lumen of thelens vesicle (Fig. 4). In the maturing lens of day 13–15embryos the most abundant transcript is present at the equatorregions as described previously (7). In the postnatal and in theadult mouse eye, Pitx3 expression is still present at low levels(data not shown).

RT–PCR analysis of Pitx3 expression was performed usingtotal RNA extracted from whole day 10 and day 15 embryos ofwild-type, ak/+ and ak/ak mice. Pitx3-specific primers wereused with forward and reverse primers located in exons 1 and2, respectively, in order to eliminate false positives fromgenomic DNA (see Materials and Methods). Pitx3 expressionwas detected in day 15 wild-type and ak/+ embryos while itwas altered in three ak/ak embryos studied: completely absentin one ak/ak embryo (data not shown) and largely diminishedin two (Fig. 5A). Both Cig30 and Gbf1 RNAs were detected inthe day 15 embryos at a level indistinguishable between ak/akand wild-type mice. Northern blot analysis of the Pitx3 expres-sion was performed on the day 15 total RNA by hybridizationwith a radioactive probe containing partial Pitx3 cDNAsequence. Distinct signal corresponding to the Pitx3 transcriptwas detected in wild-type RNA but not in the ak/ak RNA aftera 5-day exposure (Fig. 5B). Longer exposure allowed weakdetection of the Pitx3 transcript in ak/ak RNA but its level waslargely diminished in comparison with the wild-type (Fig. 5B).

Table 1. The identified regions in the Pitx3 genomic sequence containing repeat units

aHighly polymorphic markers.aTm, annealing temperature; MgCl2, final concentration; nt, not tested.

Name Position Repeat unit Forward primer Reverse primer Product size Tm (°C) MgCl2

Pitx3_1a 5′ region (CAA) gtgccctgatttgtcttcat ctcagaaattaggatcagca 157 50 1.5

Pitx3_2a 5′ region (CT) (AC) ttgaagccagcctgtgcttc tactgtaactccagctccag 177 55 1.5

Pitx3_3a 5′ region (CTT) tgtccgcattgcgaaggaaa agtctgagggcctaatctca 138 55 1.5

Pitx3_4a 5′ region (GTTT) caaaggtcagacccttgtcc ggtgcagaagggtctgaaaa 157 n.t.

Pitx3_5a 5′ region (CT) gaccctagggtcatatggta ctacagagcaaattctagac 120 45 2.0

Pitx3_6a 5′ region (GTTTT) ggatgtaaaacaaatgggtg gctacacagagagaccctgt 121 n.t.

Pitx3_7a Intron 3 (AAAC) ctggtcaaccaagaacacac ggaaaccctattaggagcct 123 45 2.0


In order to assess specific sites of Pitx3 expression in ak/akembryos, in situ hybridization on sections was performed onday 10–16 ak/ak and wild-type embryos. While expression wasmissing in ak/ak embryos (Fig. 4A–P: embryonic days 10 and14 are shown), in the wild-type embryos Pitx3 expression wasdetected in the lens placode and, at later stages of lens develop-ment, in the head muscles, tongue, midbrain region, mesen-chyme and around the vertebrae and sternum. Theseobservations were all in good agreement with the patterndescribed previously (7,8).

In order to see whether expression of other Pitx genes isaltered in ak/ak embryos, expression of Pitx1 and Pitx2 was

studied by RT–PCR (Pitx1, Pitx2) and in situ hybridization(Pitx1). The Pitx1 and Pitx2 genes demonstrate overlappingpatterns of expression with the Pitx3 gene as has been shownfor many homeobox genes belonging to the same family(7,24). Transcripts for both genes were found to be present atindistinguishable levels in the total RNA extracted fromembryonic day 15 ak/ak and wild-type mice (RT–PCR data notshown). There were also no significant differences in the Pitx1gene expression studied by in situ hybridization in embryosranging from embryonic days 10–16 between ak and wild-typemice (Figure 4Q–T: day 12.5 is shown). Pitx1 was present inall of the sites of its normal expression and without any visibledifference in the amount of transcript between the two mice:tongue, midbrain, developing pituitary and gut region. Theonly expression that appeared to be altered was expression inthe developing lens where the Pitx1 gene is normally co-expressed with Pitx3 gene starting from the late lens vesiclestage around embryonic days 11.5–12 (E.V. Semina and R.Reiter, unpublished results). The ak/ak embryos did not showany detectable Pitx1 expression in the lens, which is mostlikely attributable to the evidently disturbed lens developmentin ak/ak embryos by this stage and therefore the lack of cellsthat would normally express the Pitx1 gene. It is also possiblethat the Pitx3 and Pitx1 genes are involved in a cascade ofmutual activation in the lens as has been shown for some otherparalogous homeobox genes (25–27).

Identification of a deletion in the 5′ region of Pitx3 gene inaphakia mice

Detailed sequence analysis of the Pitx3 5′ sequence in the ak/ak mice identified a 652 bp deletion located ~2.5 kb from thestart point of Pitx3 cDNA (Fig. 5C and D). This deletion wasnot detected in the DNA from mouse strains 129/Sv-SlJ

(129S1/Sv-+p +Tyr-c MgfSl-J/+ according to the new nomen-clature) and C57BLKS representing the genetic background ofthis mutation (4; B.A. Richards-Smith and D. Schroeder,personal communication) as well as eight other strains tested todate (Fig. 5C). Analysis of the 652 bp region revealed severalmotifs similar to the AP-2, Maf and forkhead 7 [now referredto as FOXL1 (28)] binding site consensus sequences (13–16)(Fig. 1B) that play a crucial role during early ocular develop-ment. This suggests that the loss of binding capacity for at leastsome of these transcription factors might lead to a loss of Pitx3transcripts, at least at the time during development when theeyes are being formed.

Other possible upstream regulators of Pitx3 ocular expres-sion include Pax6, Six3, Eya1, Eya2 and Sox1–3 genes (29–34). No binding sites for Pax6 or Sox proteins were found inthe 652 bp deletion fragment by either MatInspector programor visual examination.

DISCUSSION

Over the past few years, significant advances have been madein understanding the biology of eye development and inunraveling its molecular basis (34–36). Studies of mouseocular mutants were particularly useful for the identification ofgenes that control these diverse morphogenetic processes(6,36).

Figure 2. (A) Haplotype analysis of the ak backcross. Homozygous ak/ak micewere outcrossed to JF1 mice and the heterozygous mice were backcrossed tohomozygous ak mice. The heterozygous offspring were analyzed for theirparental phenotypes and for the size of several microsatellite and gene-specificmarkers. The same offspring were screened previously for other markers (5).The total number of progeny scored for each locus is given to the right of theboxes, including the calculated distances between the loci (in cM). The numberof progeny that inherited each haplotype is given below the boxes. (B) High-resolution map surrounding the ak-critical region. A high-resolution mapshows the location of ak in relation to relevant markers. The distances of themarkers are given in cM.


Development of the vertebrate eye is dependent upon thecomplex interaction and coordinated development of tissuesderiving from surface ectoderm, neural ectoderm, neural crestand mesodermal mesenchyme (35,37,38). The eye field is oneof the first regions to be defined in the anterior neural plate.This region evaginates from the forebrain during the neuralfolding process to become the optic vesicle, which contactswith the overlying ectoderm and induces it to develop into thelens placode, which, in turn, invaginates and separates from theectoderm to form the lens vesicle. Structures of the anteriorsegment of the eye such as the corneal stroma bounded by anendothelium, iris, ciliary body, trabecular meshwork and scleraare developed upon separation of the lens vesicle from thecorneal ectoderm and include large contributions from neuralcrest mesenchyme cells (39).

In the aphakia mice, the first lens abnormalities are seen atthe late lens placode–early lens vesicle stage at days 10.5–11.0of embryonic life (4,23). The lumen of the mutant lens vesiclefills up with cells released from the lens epithelium (4).Abnormal lens morphogenesis in ak mice results in a club-shaped elongated lens structure that remains attached to thesurface epithelium by a persistent connecting stalk. Failure ofthe lens to separate from the cornea arrests the development ofthe anterior chamber, which is never formed in ak mice. In akmice the primary and secondary lens fiber cells are notproduced and thus the abnormal lens structure dissolves withtime so that the lumen of the eye globe becomes filled with thefolding retinal tissue.

By analysis of the ak/or and ak/fi compound mutants, it wassuggested that the ak gene exerts its function exclusively in the

Figure 3. Picture of ak/ak mouse (A) and histological sections of day 10.5 (B) and day 18.5 (C) ak/ak eye. Note the absence of the eye in adult mice (A) and themalformed lens vesicle with persisting lens stalk in the day 10.5 developing eye (B) as well as the absence of lens structures and anterior chamber in the day 18.5eye (C). C, cornea; LV, lens vesicle; LS, lens stalk; OV, optic vesicle; R, retina. Bar, 100 µm.


Figure 4. Results of the in situ hybridization with Pitx3 and Pitx1 radioactive probes on sections of wild-type (left) and ak/ak embryos (right); bright and dark field photo-graphs of every slide are presented. (A–C) Day 10 embryos, (E–H) day 10.25 embryos, (I–L) day 11 embryos and (M–T) day 14 embryos. Slides (A–P) were hybridizedwith Pitx3 and (Q–T) were hybridized with Pitx1 antisense riboprobes. ov, optic vesicle; lp, lens placode; lpt, lens pit; l, lens; nr, neural retina; m, head muscles; mb, mid-brain region; t, tongue; mes, gut mesenchyme; pt, pituitary; rpe, retina pigment epithelium. Bars in (A), (E) and (I), 115 µm; bars in (M) and (Q), 0.5 mm.


lens (40). Several candidate genes were studied for their poten-tial role in the ak phenotype including Pax2, Fgf8 and Chuk1and were excluded either by linkage or sequence analysis (5).Previously, we mapped the homeodomain-containing tran-scription factor gene Pitx3 to the vicinity of ak, but failed toidentify any mutations in the Pitx3 coding region bysequencing analysis of the ak genomic DNA (7) or RT–PCRanalysis of its mRNA (J. Graw, unpublished results). Subse-quently, the human PITX3 gene was found to be involved inanterior segment dysgenesis with cataracts in one family anddominant congenital cataracts in another (8).

In this study, we report an analysis of the entire sequence ofthe Pitx3 gene, which comprises 12.6 kb in genomic sequence.The Pitx3-containing region on mouse chromosome 19 wasfound to be extremely gene-rich as two other genes were iden-tified in a partially overlapping tail-to-tail (Cig30) and head-to-head (Gbf1) orientation to the Pitx3 gene at a distance of –10bp and +4.2 kb, respectively, from the known Pitx3 cDNAsequences. The GBF1 gene encodes a putative guanine nucleo-tide exchange factor that is likely to play a housekeeping roleand is ubiquitously expressed in humans (10), while the Cig30gene encodes the membrane glycoprotein, which appears tohave a role in the recruitment of brown adipose tissue andshows a restricted expression pattern (11,12). Both GBF1 andCig30 genes are expressed during embryonic development, asis the Pitx3 gene, therefore their transcripts may form RNAduplexes, if present in the same cell.

We identified several repetitive elements in the Pitx3genomic sequence that enabled us to map the Pitx3 genedirectly in the ak backcross. No recombination events werefound between ak and Pitx3 in 416 animals, placing them atdistance of 0.2 ± 0.2 cM. Additionally, Pitx3 expression wasfound to be largely diminished in ak/ak mice affecting all ofthe sites in which it is normally present. No expression wasdetected in the lens placode and lens pit or later in the lensremnants by in situ hybridization in the ak/ak animals. This ledus to suggest that the etiologic mutation might be located in the5′ region of the gene and that it affects a promoter or otherregulatory elements. Such mutations were described for avariety of human and mouse phenotypes (41–44). Thereforewe studied the Pitx3 promoter region in the ak/ak genomicDNA and identified a deletion of 652 nucleotides (∆652)residing at a distance of 2.5 kb from the start of the Pitx3cDNA. Multiple mouse strains were tested for the presence ofthis deletion including 129/Sv-SlJ and C57B6KS, which repre-sent the background of this mutation. The original ak mutationoccurred spontaneously in the 129/Sv-SlJ strain, which waslater crossed to C57B6KS several times to obtain more viablemice (4) and was maintained as such in the Jackson Labora-tory. None of the 10 mouse strains was found to have the dele-tion.

The deleted 652 bp fragment contains several sequences thatare similar to binding sites for ocular transcription factors.Combining the sequence analysis of the deleted region with thePitx3 expression data in the ak/ak mice, there is strikingevidence for enhancer/promoter activity in this particularregion. Several motifs similar to binding consensus sequencesfor AP-2 and Maf transcription factors were identified in thisregion. The AP-2 transcription factors belong to a family ofretinoic acid-responsive proteins and were shown to berequired for early morphogenesis of the lens vesicle (21). A

Figure 5. Altered expression of the Pitx3 gene and localization of the ∆652deletion in the 5′ region of the Pitx3 gene in ak/ak mice. (A) The RT–PCRresults: lanes 1–5 represent results of PCR amplification with the Pitx3- (lanes1–5), Cig-30- (lanes 6 and 7), Gbf1- (lanes 8 and 9) and GADPH-specificprimers and cDNAs extracted from day 15 embryos. Lane 1, H2O; lane 2, wildtype; lane 3, ak/+; lanes 4 and 5, ak/ak; lane 6, wild-type; lane 7, ak/ak; lane 8,wild-type; lane 9, ak/ak. (B) Northern blot results: 1 (5 days exposure) and 2(14 days exposure), hybridization with the Pitx3 probe (nucleotides 1–1392 ofPitx3 sequence, GenBank accession no. AF005772); 3, hybridization withGADPH gene probe. (C) Picture of an agarose gel showing results of PCR


pan-specific antibody that recognizes all three AP-2 proteinsdetected a strong signal in the developing lens starting from thelens placode stage and in neural-crest-derived mesenchymalcells around the developing eye (21). This expression patternresembles that of the Pitx family homeodomain transcriptionfactor genes—developing lens for Pitx3 and Pitx1 genes, andneural-crest-derived mesenchyme for Pitx2 and Pitx1—indi-cating that AP-2 transcription factors might be involved inregulation of the Pitx genes during ocular development. More-over, the AP-2α-deficient mice exhibit ocular phenotypesranging from anophthalmia to defects in the developing lensinvolving persistent adhesion of the lens to the overlyingsurface ectoderm, which is similar to the aphakia phenotype.

The Maf family genes encode transcription factorscontaining a basic region/leucine zipper domain; these proteinsplay an important role in lens development as supported byexpression and mutant studies in mice (45–48). The L-mafproducts are first seen in the lens placode and are restricted tolens cells, which is similar to Pitx3 expression (47). Ectopicexpression of L-maf converts chick embryonic ectodermalcells and cultured cells into lens fibers suggesting that thisfactor regulates the expression of multiple genes expressed inthe lens. It was also recently shown that in the C-maf-deficientmice, lens fiber cells fail to elongate resulting in a small andhollow lens cavity and a microphthalmia phenotype (45). BothAP-2 and Maf proteins represent good candidates for upstreamregulators of Pitx3 expression in the developing lens. Hence,removal of their binding sites from the Pitx3 promoter regionin ak/ak mice, as a result of the ∆652 deletion, may be respon-sible for altered expression of Pitx3 in these animals. It wouldbe interesting to investigate whether Pitx3 expression is alteredin the AP-2- and Maf-deficient mice.

Also, putative binding sites were identified for proteins ofthe forkhead/winged-helix family of transcription factors in thedeleted region (16). The forkhead genes serve as regulatorykeys in embryogenesis (49); their role in ocular developmenthas just started to be elucidated (50,51).

There are several mouse mutations that result in the forma-tion of an abnormal lens vesicle that often remains attached tothe corneal ectoderm leading to an overall disorganized eyedevelopment (3,6). In addition to the Ap-2-deficient and ak/akmice mentioned above, this phenotype is also present in at leastfive other independent mutations in the mouse: dominantmouse mutations Small eye = Pax6 (52), Coloboma (53), Cat4a

(54), recessive mutations dysgenetic lens (55) and lens aplasia(56,57). In humans, anterior segment dysgenesis and particu-larly Peters’ anomaly disorders resemble these mouse pheno-types. These disorders are characterized by corneal defectssometimes associated with keratolenticular adhesion, cataractor even aphakia (58–60). Both PITX3/Pitx3 and PAX6/Pax6genes in mouse, which are involved in aphakia and small eye,respectively (this paper and ref. 61), were found to be involvedin related disorders in humans (8,62), suggesting conservationof the gene function in ocular development. Identification ofcellular partners of the Pitx3 gene may reveal genes respon-sible for similar murine phenotypes and may also lead to theisolation of human genes responsible for defects in the anteriorsegment of the eye and lens development.

Conclusion

In this paper we present several lines of evidence suggestingthat abnormal ocular development in mouse aphakia is causedby a mutation in the promoter region of the Pitx3 gene. First,we show that the ak and Pitx3 genes are closely linked; second,we demonstrate that the expression of Pitx3 gene is altered inak/ak mice; third, analysis of the promoter region of the Pitx3gene identified a deletion in ak/ak DNA, which is not presentin the parental strains of ak/ak as well as eight other mousestrains tested; and fourth, several sequences similar toconsensus binding sites for AP-2 and Maf transcription factorsthat were shown to regulate a cascade of genes involved in lensdevelopment, were identified in the deleted region. It furtherimplicates the Pitx family of homeodomain-containing tran-scription factors as important determinants of lens and anteriorsegment development in mammals (8,9,63–66).

This investigation also demonstrates that extended muta-tional analysis of an appropriate candidate gene may discloseetiologic mutations in regulatory regions well outside tradi-tional gene boundaries. The mutation now provides a substratefor the investigation of the role of other factors in lens andanterior segment development.

MATERIALS AND METHODS

Animal care

The ak/ak mice used in this study were obtained from theJackson Laboratory and then housed by the Transgenic CoreFacility at the University of Iowa, which employs an animalmanagement program that is recommended by the AmericanAssociation for Accreditation of Laboratory Animal Care andmeets NIH guidelines regarding the care and use of laboratoryanimals. The original breeding pair, consisting of a hetero-zygous ak/+ female and homozygous ak/ak male, were bredwith each other several times to obtain homozygous animals.They were outcrossed to C57BL/6 mice several times in orderto obtain more viable animals and then crossed with each otherto obtain ak/ak mice. The ak/ak embryos were collected atembryonic days 9–16 from ak/ak females impregnated by ak/ak males.

Histology

For histological analysis, embryos from a homozygous ak linewere fixed in Carnoy solution and embedded in JB4 (Poly-sciences Europe, Eppelheim, Germany). Sections (2 µm) werecut and stained with 0.013% methylene blue and 0.035% basicfuchsin in 20% ethanol. Sections were analyzed under a ZeissAxioplan microscope and documented with a high-resolutionCCD camera (ProGres 3008; Carl Zeiss Jena, Jena, Germany).Pictures were adjusted for brightness, contrast and colorbalance in Adobe Photoshop 5.0.

Identification and analysis of genomic sequence

The BAC genomic clone carrying an insert that contained theentire Pitx3 gene was identified by screening the Mouse BACLibrary (Research Genetics) clones for the presence of thePitx3-specific product. The product was obtained by PCR-amplification of the library’s DNA using standard conditions


(7) and specific primers that corresponded to the 5′ and 3′regions of the gene: Pitx3-5′F, ctgcctgcgctccagaa; Pitx3-5′R,agtgcgtcccgcagcag; Pitx3-3′F, gcaggtctgtggatccatc; Pitx3-3′R,tgcgagggaaaaggccctct. The BAC DNA was isolated using aQiagen plasmid DNA isolation kit following the manufac-turer’s protocols (Qiagen). Sequencing of the introns and the 5′and 3′ regions was performed automatically using an ABMSequencer and Pitx3-specific primers were designed from thecDNA sequence. Contigs were assembled using Sequencer 3.0software.

Linkage analysis

Female homozygous ak mice were mated to male JF1 mice andthe heterozygous outcross animals were backcrossed tohomozygous ak mice (5). The resulting backcross mice wereclassified for the absence or presence of the ak phenotype andgenotyped for the Pitx3 polymorphic markers (see Table 1).Genomic DNA was isolated from tail clips of the backcrossoffspring. For comparison, genomic DNA was also isolatedfrom wild-type AKR and JF1 mice. Hot-start PCR wasperformed as described previously (5). Additionally, in allcases 2 µl DMSO were added to the reaction mixture; finalMgCl2 concentration and annealing temperature were as indi-cated in Table 1. Pitx3-CT products were analyzed using 15%polyacrylamide gel. Primers for PCR amplification of themarkers D19Mit7, D19Mit8 and D19Mit102 were obtainedfrom the NCBI homepage (http://www.ncbi.nlm.nih.gov/dbSTS/index.html ) and applied in the existing (ak/ak × JF1)F1× ak/ak backcross (5). Annealing temperature of the markersD19Mit7 and D19Mit102 was 50°C, and 55°C for D19Mit8.

Expression studies: RT–PCR, northern blot and in situhybridization analyses

Total RNA was prepared from embryos using the RNA extrac-tion kit from Qiagen in accordance with the protocols suppliedby the manufacturer. Total RNA (5 µg) was transcribed to thefirst strand of cDNA using Advantage RT-for-PCR kit fromClontech. PCR cycling after the RT step was performed withprimers specific for the gene of interest and designed to flankthe intron region in order to assure specific amplification of thecDNA. Products were analyzed by electrophoresis on a 1.5%agarose gel and, if needed, extracted from the gel using the gel-extraction kit from Qiagen and sequenced. Total RNA (15 µg)extracted from the day 15 wild-type and ak/ak embryos wasdenatured, separated on 1.2% formaldehyde gel and blottedonto Hybond N membrane (Amersham). To prepare a probefor hybridization, DNA insert containing nucleotides 30–716of Pitx3 cDNA (7) was released from the plasmid vector bydigestion with NotI and EcoRI, isolated by electrophoresis inagarose gels and subsequently purified using a column gelpurification kit from Qiagen. DNA fragments were radioac-tively labeled with [32P]dCTP using random-primed DNAlabeling kit (Boehringer Mannheim) and hybridized with theblot using conditions recommended by the manufacturer(Amersham). The in situ hybridization on embryos andsections was performed as described previously (7).

Screening of the genomic sequence for mutations

Approximately 4 kb of the 5′ region of the Pitx3 gene was PCRamplified from the genomic DNA of wild-type, ak/+ and ak/akmice using extended PCR conditions as described previously(9) and the following specific primers: Pitx3-5′-set1 (PCRproduct = 1140 bp), forward, aattcggcccgtgcaatctt, and reverse,taatcccagcacttgagagg; Pitx3-5′-set2 (PCR product = 1183 bp),forward, ctcgaactcaggtctgtctg, and reverse, gtgccctgatttgtct-tcat; Pitx3-set3 (PCR product = 971 bp), forward, attagaggtcgt-tcaggatg, and reverse, taattgaggccttgggctct; Pitx3-set4 (PCRproduct = 701 bp), forward, aagacagacagcgacaagtg, andreverse, aaactccatggagggaggtc. The DNA fragments wereprepared for automated sequencing by separation of the PCRproducts on 1% agarose gel, followed by extraction using a GelExtraction kit (Qiagen) as described previously (9).

The following mouse strains were tested: AKR, JF1 (GSF,National Research Center for Environment and Health, Insti-tute of Mammalian Genetics, Neuherberg, Germany), C57B6J,Mus spretus, CAST, B33alpha, 129/Sv-SlJ, C57B6KS, DBA,B1 (University of Iowa).

GenBank submission

The 5′ region sequence of Pitx3 gene was submitted toGenBank under accession no. AF224268.

ACKNOWLEDGEMENTS

We would like to thank Bonnie Ludwig for help withsequencing, Karmen Munson and Dawn Cady for animal careand Erika Bürkle for expert technical assistance during PCR-based linkage analysis. We are also grateful to B.A. Richards-Smith and D. Schroeder from the Jackson Laboratory forproviding us with DNA samples and information about mousestrains used in this study. This work was supported by NIH-NEI grant EY12384 to J.C.M.

REFERENCES

1. Livingston, P.M., Carson, C.A. and Taylor, H.R. (1995) Theepidemiology of cataract: a review of the literature. Ophthalmol.Epidemiol., 2, 151–164.

2. Taylor, D. (1998) The Doyne Lecture. Congenital cataract: the history, thenature and the practice. Eye, 12, 9–36.

3. Smith, R.S., Sundberg, J.P. and Linder, C.C. (1997) Mouse mutations asmodels for studying cataracts. Pathobiology, 65, 146–154.

4. Varnum, D.S. and Stevens, L.C. (1968) Aphakia, a new mutation in themouse. J. Hered., 59, 147–150.

5. Grimm, C., Chatterjee, B., Favor, J., Immervoll, T., Loster, J., Klopp, N.,Sandulache, R. and Graw, J. (1998) Aphakia (ak), a mouse mutationaffecting early eye development: fine mapping, consideration of candidategenes and altered Pax6 and Six3 gene expression pattern. Dev. Genet., 23,299–316.

6. Graw, J. (1999) Cataract mutations and lens development. Prog. Retin.Eye Res., 18, 235–267.

7. Semina, E.V., Reiter, R.S. and Murray, J.C. (1997) Isolation of a newhomeobox gene belonging to the Pitx/Rieg family: expression during lensdevelopment and mapping to the aphakia region on mouse chromosome19. Hum. Mol. Genet., 6, 2109–2116.

8. Semina, E.V., Ferrell, R.E., Mintz-Hittner, H.A., Bitoun, P., Alward,W.L., Reiter, R.S., Funkhauser, C., Daack-Hirsch, S. and Murray, J.C.(1998) A novel homeobox gene PITX3 is mutated in families withautosomal-dominant cataracts and ASMD. Nature Genet., 19, 167–170.

9. Semina, E.V., Reiter, R., Leysens, N.J., Alward, W.L., Small, K.W.,Datson, N.A., Siegel-Bartelt, J., Bierke-Nelson, D., Bitoun, P., Zabel,B.U. et al. (1996) Cloning and characterization of a novel bicoid-related


homeobox transcription factor gene, RIEG, involved in Rieger syndrome.Nature Genet., 14, 392–399.

10. Mansour, S.J., Herbrick, J.A., Scherer, S.W. and Melancon, P. (1998)Human GBF1 is a ubiquitously expressed gene of the sec7 domain familymapping to 10q24. Genomics, 54, 323–327.

11. Tvrdik, P., Asadi, A., Kozak, L.P., Nedergaard, J., Cannon, B. andJacobsson, A. (1997) Cig30, a mouse member of a novel membraneprotein gene family, is involved in the recruitment of brown adiposetissue. J. Biol. Chem., 272, 31738–31746.

12. Tvrdik, P., Asadi, A., Kozak, L.P., Nuglozeh, E., Parente, F., Nedergaard,J. and Jacobsson, A. (1999) Cig30 and Pitx3 genes are arranged in apartially overlapping tail-to-tail array resulting in complementarytranscripts. J. Biol. Chem., 274, 26387–26392.

13. Matsuo, I. and Yasuda, K. (1992) The cooperative interaction betweentwo motifs of an enhancer element of the chicken alpha A-crystallin gene,alpha CE1 and alpha CE2, confers lens-specific expression. Nucleic AcidsRes., 20, 3701–3712.

14. Mitsuda, N., Roses, A.D. and Vitek, M.P. (1997) Transcriptionalregulation of the mouse presenilin-1 gene. J. Biol. Chem., 272, 23489–23497.

15. Matsuo, I., Takeuchi, M. and Yasuda, K. (1992) Identification of thecontact sites of a factor that interacts with motif I (alphaCE1) of thechicken alpha A-crystallin lens-specific enhancer. Biochem. Biophys. Res.Commun., 184, 24–30.

16. Pierrou, S., Hellqvist, M., Samuelsson, L., Enerback, S. and Carlsson, P.(1994) Cloning and characterization of seven human forkhead proteins:binding site specificity and DNA bending. EMBO J., 13, 5002–5012.

17. Mitchell, P.J., Timmons, P.M., Hebert, J.M., Rigby, P.W. and Tjian, R.(1991) Transcription factor AP-2 is expressed in neural crest cell lineagesduring mouse embryogenesis. Genes Dev., 5, 105–119.

18. Funahashi, J., Sekido, R., Murai, K., Kamachi, Y. and Kondoh, H. (1993)Delta-crystallin enhancer binding protein delta EF1 is a zinc finger-homeodomain protein implicated in postgastrulation embryogenesis.Development, 119, 433–446.

19. Tomarev, S.I., Duncan, M.K., Roth, H.J., Cvekl, A. and Piatigorsky, J.(1994) Convergent evolution of crystallin gene regulation in squid andchicken: the AP-1/ARE connection. J. Mol. Evol., 39, 134–143.

20. Morriss-Kay, G.M. (1996) Craniofacial defects in AP-2 null mutant mice.Bioessays, 18, 785–788.

21. West-Mays, J.A., Zhang, J., Nottoli, T., Hagopian-Donaldson, S., Libby,D., Strissel, K.J. and Williams, T. (1999) AP-2alpha transcription factor isrequired for early morphogenesis of the lens vesicle. Dev. Biol., 206, 46–62.

22. Ring, B.Z., Cordes, S.P., Overbeek, P.A. and Barsh, G.S. (2000)Regulation of mouse lens fiber cell development and differentiation by theMaf gene. Development, 127, 307–317.

23. Zwaan, J. and Kirkland, B.M. (1975) Malorientation of mitotic figures inthe early lens rudiment of aphakia mouse embryos. Anat. Rec., 182, 345–354.

24. Lanctot, C., Lamolet, B. and Drouin, J. (1997) The bicoid-relatedhomeoprotein Ptx1 defines the most anterior domain of the embryo anddifferentiates posterior from anterior lateral mesoderm. Development,124, 2807–2817.

25. Zerucha, T., Muller, J.P., Chartrand, N. and Ekker, M. (1997) Cross-interactions between two members of the Dlx family of homeobox-containing genes during zebrafish development. Biochem. Cell Biol., 75,613–622.

26. Wang, W., Van De Water, T. and Lufkin, T. (1998) Inner ear and maternalreproductive defects in mice lacking the Hmx3 homeobox gene.Development, 125, 621–634.

27. Qu, S., Tucker, S.C., Zhao, Q., deCrombrugghe, B. and Wisdom, R.(1999) Physical and genetic interactions between Alx4 and Cart1.Development, 126, 359–369.

28. Kaestner, K.H., Knöchel, W. and Martinez, D.E. (2000) Unifiednomenclature for the winged helix/forkhead transcription factors. GenesDev., 14, 142–146.

29. Oliver, G., Loosli, F., Koster, R., Wittbrodt, J. and Gruss, P. (1996)Ectopic lens induction in fish in response to the murine homeobox geneSix3. Mech. Dev., 60, 233–239.

30. Zygar, C.A., Cook, T.L. and Grainger Jr, R.M. (1998) Gene activationduring early stages of lens induction in Xenopus. Development, 125,3509–3519.

31. Epstein, J., Cai, J., Glaser, T., Jepeal, L. and Maas, R. (1994)Identification of a Pax paired domain recognition sequence and evidence

for DNA-dependent conformational changes. J. Biol. Chem., 269, 8355–8361.

32. Xu, P.X., Woo, I., Her, H., Beier, D.R. and Maas, R.L. (1997) Mouse Eyahomologues of the Drosophila eyes absent gene require Pax6 forexpression in lens and nasal placode. Development, 124, 219–231.

33. Kamachi, Y., Uchikawa, M., Collignon, J., Lovell-Badge, R. and Kondoh,H. (1998) Involvement of Sox1, 2 and 3 in the early and subsequentmolecular events of lens induction. Development, 125, 2521–2532.

34. Gehring, W.J. and Ikeo, K. (1999) Pax 6: mastering eye morphogenesisand eye evolution. Trends Genet., 15, 371–377.

35. Jean, D., Ewan, K. and Gruss, P. (1998) Molecular regulators involved invertebrate eye development. Mech. Dev., 76, 3–18.

36. Fini, M.E., Strissel, K.J. and West-Mays, J.A. (1997) Perspectives on eyedevelopment. Dev. Genet., 20, 175–185.

37. Saha, M.S., Servetnick, M. and Grainger, R.M. (1992) Vertebrate eyedevelopment. Curr. Opin. Genet. Dev., 2, 582–588.

38. Graw, J. (1996) Genetic aspects of embryonic eye development invertebrates. Dev. Genet., 18, 181–197.

39. Haustein, J. (1983) On the ultrastructure of the developing and adultmouse corneal stroma. Anat. Embryol., 168, 291–305.

40. Koniukhov, B.V. and Nonchev, S.G. (1982) Interaction of the mutantaphakia, fidget and ocular retardation genes in mice. Genetika, 18, 1107–1114.

41. Bushby, K.M., Cleghorn, N.J., Curtis, A., Haggerty, I.D., Nicholson,L.V., Johnson, M.A., Harris, J.B. and Bhattacharya, S.S. (1991)Identification of a mutation in the promoter region of the dystrophin genein a patient with atypical Becker muscular dystrophy. Hum. Genet., 88,195–199.

42. Héon, E., Priston, M., Schorderet, D.F., Billingsley, G.D., Girard, P.O.,Lubsen, N. and Munier, F.L. (1999) The γ-crystallins and humancataracts: a puzzle made clearer. Am. J. Hum. Genet., 65, 1261–1267.

43. Levinson, B., Conant, R., Schnur, R., Das, S., Packman, S. and Gitschier,J. (1996) A repeated element in the regulatory region of the MNK geneand its deletion in a patient with occipital horn syndrome. Hum. Mol.Genet., 5, 1737–1742.

44. Timms, K.M., Huckett, L.E., Belmont, J.W., Shapira, S.K. and Gibbs,R.A. (1998) DNA deletion confined to the iduronate-2-sulfatase promoterabolishes IDS gene expression. Hum. Mutat., 11, 121–126.

45. Kim, J.I., Li, T., Ho, I.C., Grusby, M.J. and Glimcher, L.H. (1999)Requirement for the c-Maf transcription factor in crystallin generegulation and lens development. Proc. Natl Acad. Sci. USA, 96, 3781–3785.

46. Kawauchi, S., Takahashi, S., Nakajima, O., Ogino, H., Morita, M.,Nishizawa, M., Yasuda, K. and Yamamoto, M. (1999) Regulation of lensfiber cell differentiation by transcription factor c-Maf. J. Biol. Chem., 274,19254–19260.

47. Ogino, H. and Yasuda, K. (1998) Induction of lens differentiation byactivation of a bZIP transcription factor, L-Maf. Science, 280, 115–118.

48. Yoshida, K., Imaki, J., Koyama, Y., Harada, T., Shinmei, Y., Oishi, C.,Matsushima-Hibiya, Y., Matsuda, A., Nishi, S., Matsuda, H. et al. (1997)Differential expression of maf-1 and maf-2 genes in the developing ratlens. Invest. Ophthalmol. Vis. Sci., 38, 2679–2683.

49. Kaufmann, E. and Knochel, W. (1996) Five years on the wings of forkhead. Mech. Dev., 57, 3–20.

50. Kenyon, K.L., Moody, S.A. and Jamrich, M. (1999) A novel fork headgene mediates early steps during Xenopus lens formation. Development,126, 5107–5116.

51. Kidson, S.H., Kume, T., Deng, K., Winfrey, V. and Hogan, B.L. (1999)The forkhead/winged-helix gene, Mf1, is necessary for the normaldevelopment of the cornea and formation of the anterior chamber in themouse eye. Dev. Biol., 211, 306–322.

52. Hogan, B.L., Hirst, E.M., Horsburgh, G. and Hetherington, C.M. (1988)Small eye (Sey): a mouse model for the genetic analysis of craniofacialabnormalities. Development, 103 (suppl.), 115–119.

53. Theiler, K. and Varnum, D.S. (1981) Development of coloboma (Cm/+), amutation with anterior lens adhesion. Anat. Embryol., 162, 121–126.

54. Grimes, P.A., Koeberlein, B., Favor, J., Neuhauser-Klaus, A. andStambolian, D. (1998) Abnormal eye development associated with Cat4a,a dominant mouse cataract mutation on chromosome 8. Invest.Ophthalmol. Vis. Sci., 39, 1863–1869.

55. Sanyal, S. and Hawkins, R.K. (1979) Dysgenetic lens (dyl)—a new genein the mouse. Invest. Ophthalmol. Vis. Sci., 18, 642–645.

56. Aso, S., Horiwaki, S. and Noda, S. (1995) Lens aplasia: a new mutationproducing lens abnormality in the mouse. Lab. Anim. Sci., 45, 41–46.


57. Aso, S., Tashiro, M., Baba, R., Sawaki, M., Noda, S. and Fujita, M. (1998)Apoptosis in the lens anlage of the heritable lens aplastic mouse (lapmouse). Teratology, 58, 44–53.

58. Trabucchi, G., Piantanida, A., Bandello, F., Freschi, M., Nucci, P. andBrancato, R. (1997) Congenital aphakia in Peters’ anomaly syndrome. Acase report. Acta Ophthalmol. Scand., 75, 595–597.

59. Myles, W.M., Flanders, M.E., Chitayat, D. and Brownstein, S. (1992)Peters’ anomaly: a clinicopathologic study. J. Pediatr. Ophthalmol.Strabismus, 29, 374–381.

60. Beauchamp, G.R. (1980) Anterior segment dysgenesis keratolenticularadhesion and aniridia. J. Pediatr. Ophthalmol. Strabismus, 17, 55–58.

61. Hill, R.E., Favor, J., Hogan, B.L., Ton, C.C., Saunders, G.F., Hanson,I.M., Prosser, J., Jordan, T., Hastie, N.D. and van Heyningen, V. (1991)Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature, 354, 522–525.

62. Hanson, I.M., Fletcher, J.M., Jordan, T., Brown, A., Taylor, D., Adams,R.J., Punnett, H.H. and van Heyningen, V. (1994) Mutations at the PAX6

locus are found in heterogeneous anterior segment malformationsincluding Peters’ anomaly. Nature Genet., 6, 168–173.

63. Gage, P.J., Suh, H. and Camper, S.A. (1999) Dosage requirement of Pitx2for development of multiple organs. Development, 126, 4643–4651.

64. Kitamura, K., Miura, H., Miyagawa-Tomita, S., Yanazawa, M., Katoh-Fukui, Y., Suzuki, R., Ohuchi, H., Suehiro, A., Motegi, Y., Nakahara, Y.et al. (1999) Mouse pitx2 deficiency leads to anomalies of the ventralbody wall, heart, extra- and periocular mesoderm and right pulmonaryisomerism. Development, 126, 5749–5758.

65. Lin, C.R., Kioussi, C., O’Connell, S., Briata, P., Szeto, D., Liu, F.,Izpisua-Belmonte, J.C. and Rosenfeld, M.G. (1999) Pitx2 regulates lungasymmetry, cardiac positioning and pituitary and tooth morphogenesis.Nature, 401, 279–282.

66. Lu, M.F., Pressman, C., Dyer, R., Johnson, R.L. and Martin, J.F. (1999)Function of Rieger syndrome gene in left-right asymmetry andcraniofacial development. Nature, 401, 276–278.


Documents

Deletion in the promoter region and altered expression of Pitx3