57
Darwin & Natural Selection Adapted from Mr. Gray & Bristol University

Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

  • Upload
    others

  • View
    1

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Darwin & Natural Selection

Adapted from Mr. Gray & Bristol University

Page 2: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Hypothesis: is an educated guess, based on observations . It's a prediction of cause and effect.

Theory:

Summarizes a hypothesis/hypotheses

Supported with repeated testing

Valid as long as there is no evidence to dispute it

Explains how and why something happens

Example: Theory of Plate Tectonics

Law:

Generalizes a LOT of observations

Tells you what IS going to happen

Example: Law of Gravitation

Basic Scientific Terms Review

Page 3: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Directions Manager: read ?’s

1. Can a theory become a law?

Explain.

2. What’s wrong with this statement

– I have a theory that students

get more write ups after the

holidays.

Page 4: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Evolution

Evolution: The process of change over

time; one species gives rise to another &

“tree” grows!

All living things share a common ancestor.

We can draw a “family” tree of life to show

how every species is related.

Page 5: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Learning Manager – read ?

Besides cell phones, what other

non-biological items have

evolved?

Page 6: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Charles Darwin

Father of Evolution

Proposed the theory of evolution, change over time

Made observations on a 5-year trip around the world on the ship the HMS Beagle

Wrote a book “Origin of the Species” that documented his observations

Survival of the Fittest idea came from this book

Page 7: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 8: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Darwin’s Finches

Page 9: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Check out their feet!!!

Page 10: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 11: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

On Task Manager – read ?

Charles Darwin noticed all the

different looks of the same species.

How might different looks affect

whether a species goes extinct?

Page 12: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Natural Selection

Natural Selection: Organisms that are best

adapted to an environment survive and

reproduce more than others

Page 13: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

How Natural Selection Occurs – 4 Ways

Overproduction

Variation

Competition

Selection

Page 14: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Overproduction

Each species produces more offspring that can

survive

Page 15: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Each individual has a unique combination of inherited traits (DNA)

Adaptation: an inherited trait that increases an organism’s chances of survival

Environments can changewhich can change the success of an adaptation Same Parents

Variation

Page 16: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Adaptation Categories

Camouflage (Blend in and hide)

Mimicry (Act and look like)

Physiological (Poison)

Behavioral (Group behavior)

Remember the organism doesn’t CHOOSE the

adaptation! They are born with it or the

environment is more supporting of it!

Page 17: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 18: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Coral Snake

(Poisonous)Milk Snake

(Not

poisonous)

Page 19: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 20: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 21: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 22: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 23: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 24: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 25: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Stick Mantid

Page 26: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Flower Mantid

Page 27: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

What adaptations do

you see?

Page 28: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

What adaptations do

you see?

Page 29: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Variation

The more variation within a species, the more likely they are to survive

The more variation of types of species in a habitat, the more likely at least some will survive

Page 30: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 31: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Which community has a better chance of

surviving a natural disaster?

Community A Community B

Page 32: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Competition

Individuals COMPETE for food, water, space, etc.

Survival of the Fittest – the fittest is most able to

survive and reproduce

Not all individuals survive to adulthood

Page 33: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Best adaptations will survive and be able to pass on

their traits to their kids

Genotype: your genes/DNA

Ex: Cat’s ear shape

Phenotype: your physical appearance that is

influenced by your genes and the environment

The color of the flamingo is based on what they eat

(environment)

Selection

Page 34: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Materials Manager – read ? ‘s

What are the 4 “methods” of natural

selection?

Which “method” in your opinion

affects humans most?

Page 35: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

How It Works

Individuals with traits that are not well suited to their environment either die or leave few offspring.

Evolution occurs when good traits build up in a population over many generations and bad traits are eliminated by the death of the individuals.

Page 36: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

50 Million Years Ago

Page 37: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 38: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 39: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Today

Page 40: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 41: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Directions Manager – read ?

Summarize how giraffes evolved.

Page 42: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Peppered Moth

Which moth will the bird catch?

A

B

Page 43: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Evidence for Evolution:

Fossil Record

Homologous Body Structures

Vestigial Organs

Embryology

Biochemical Evidence

Page 44: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Fossils provide a record of the history of life on

Earth

Fossil Record

Page 45: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Progression of Organisms

dinosaurs humansbacteriaorigins

http://en.wikipedia.org/wiki/Geologic_time_scale

en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png© World Health Org.

© NASA

complex cells

The fossil record shows a sequence from simple bacteria to

more complex organisms through time and provides the most

compelling evidence for evolution.

Page 46: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Transitional Fossils – Ex.

Archaeopteryx

Missing link between

reptiles and birds

Page 47: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Geologic Separation

Page 48: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Homologous Body Structures

Body parts that are

similar in different

species

Related organisms have

similar body structures

Page 49: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor
Page 50: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Humans and Gorillas Bone Structure

Page 51: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

“Leftover” organs (traces of

evolution) that serve no

purpose currently (did in the

past)

Examples appendix,

tonsils, tailbone, wisdom

teeth

Vestigial Organs

Page 52: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Embryos of all vertebrates are very similar early

on – yes you had gills!

Embryology

Page 53: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

The Pharyngeal Pouches will shape parts of the

pharynx and upper bronchial segments

Page 54: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

DNA with more similar

sequences suggest species

are more closely related

Humans and chimpanzees

share > 98% of identical

DNA sequences

Biochemistry

HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA

GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

Genetic code of chimps and gorillas is almost identical to humans

Page 55: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Directions Manager – read ?

What are the 5 types of evidence

used for evolution?

What is your opinion about evolution?

Page 56: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Thinking outside

biology/species – how might

the quote above affect you in

everyday/real life?

Page 57: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor

Supporting Resources

https://www.youtube.com/watch?v=0SCjhI86grU

Must Watch—Fantastic Review

https://www.youtube.com/watch?v=FW-uW71-DHU

Simpson Evolution