Supplementary Information

Spliceostatin A targets SF3b and inhibits both splicing and nuclear retention of

pre-mRNA

Daisuke Kaida, Hajime Motoyoshi, Etsu Tashiro, Takayuki Nojima, Masatoshi

Hagiwara, Ken Ishigami, Hidenori Watanabe, Takeshi Kitahara, Tatsuhiko Yoshida,

Hidenori Nakajima, Tokio Tani, Sueharu Horinouchi, Minoru Yoshida

Cyclin A

CDK2

CDK4

CDK6

FR901464

Supplementary Fig. 1

Supplementary Fig. 1 Detection of proteins in the extract from HeLa cellstreated with drugs. (a) Detection of cell cycle regulaters in the extract fromHeLa cells treated with FR901464 (100 ng ml–1, 14 h) using anti-cyclin A, anti-CDK2, anti-CDK4 and anti-CDK6 antibodies. (b) Detection of β-actin and β-tubulin in the extract from HeLa cells treated with SSA (100 ng ml–1, 14 h)using β-actin and β-tubulin antibodies.

β-actin β-tubulin

SSAa b

Supplementary Fig. 2

FRMG132

p27p27*

Supplementary Fig. 2 p27* is not the product of proteolytic processing.(a) Effect of a proteasome inhibitor MG132 (10 mM, 14 h) on the p27*production in the cells treated with FR901464 (100 ng ml–1, 14 h). (b)Detection of FLAG-p27. HEK293T cells were transfected with FLAG-p27cDNA and treated with FR901464 (100 ng ml–1, 14 h). FLAG-p27 wasdetected using an anti-FLAG antibody.

Anti-FLAG

FLAG-p27

Vec. FLAG-p27

FR

a

b

Supplementary Fig. 3

Supplementary Fig. 3 Stability of FR901464 and spliceostatin A, and biologicalactivity of biotinylated spliceostatin A. (a) Stability of FR901464 and spliceostatinA. FR901464 (FR, blue) and spliceostatin A (SSA, red) were incubated in culturemedium for 0, 1, 3 and 6 h and the amount of the remaining compounds wasmeasured by HPLC. t1/2 values were 45 min for FR and over 6 h for SSA,respectively. (b) Detection of p27* in HeLa cells treated with biotin-SSA at theconcentration of 0, 1, 3, 10, 30, 100, 300 and 1000 nM.

Time (h)

Resid

ual a

mou

nt (%

)

b-SSA

p27p27*

a

b

Supplementary Fig. 4

0 12 (h)

mature

Supplementary Fig. 4 Splicing inhibition by spliceostatin A is partial in vivo.(a) RT-PCR analysis of β-globin mRNA in the cells transfected with the FLAG-β-globin plasmid in the presence or absence of SSA treatment (100 ng ml–1, 12h). Primer sets were designed to amplify the sequence between exon 1 and exon2. (b, c) Effects of a high concentration of SSA on in vivo splicing. mRNAspecies in the cells treated with a high concentration of SSA (1 mg ml–1) for 12 hwere analyzed by RT-PCR using primer sets designed for the sequences betweenp27 exon 1 and exon 2 (b, upper), p27 exon 1 and intron 2 (b, lower), and IκBαexon 1 and exon 4 (c).

a

b

MeOH SSA

pre-mRNA

mature

β-globin mRNA

pre-mRNApartially spliced

p27 mRNA

c0 12 (h)

IκBα mRNA

mature

SAP155 DAPI

control

SAP155KD

SAP145 DAPI

control

SAP145KD

Supplementary Fig. 5

a b

Supplementary Fig. 5 Subcellular localization of SAP155 (a) and SAP145(b). HeLa cells were transfected with siRNA for SAP155 and SAP145, andthen SAP155 and SAP145 were observed using the antibodies 3 days afterthe transfection.

a

b

Flag-p27*+ LMB

10 ng ml–1, 6 h

Flag-p27*Flag-p27

p27

p27*198

KRPATDDSSTQNKRANRTEENVSDGSPNAGSVEQTPKKPGLRRRQT153 166

KRPATDGNDPFPTIECVWGPALPAGGC179153

NLS motif

Supplementary Fig. 6 Amino acid sequence and localization of p27*. (a) C-tarminal amino acid sequence of p27 and p27*. Red letters indicate residuescommon to p27 and p27*. A green letter indicates the site of phosphorylation byCDKs. (b) Subcellular localization of p27 and p27*. Cos7 cells were transfectedwith pcDNA3.1-FLAG-p27 (0.3 µg) or pcDNA3.1-FLAG-p27* (0.3 µg). The cellsexpressing FLAG-p27 were treated with leptomycin B (10 ng ml–1, 6 h). Theprotein localization was detected by immunofluorescence.

Supplementary Fig. 6

total b-SSA

SF1

SAP155

Supplementary Fig. 7

a

b

SF1

HA

Myc

SF1Con

trol

*

Supplementary Fig. 7 Effect of SF1 knockdown on pre-mRNA retention. (a)Translation of unspliced mRNA in SF3b knockdown cells. HeLa cells that hadbeen transfected with the reporter plasmid p27-int-HA were knocked down withSF1 siRNA and production of p27*-HA was detected. (b) Biotinylated SSAdoes not bind to SF1. Proteins bound to biotinylated SSA were analyzed bywestern blotting using an anti-SF1 antibody. Asterisks indicate a non-specificband.

*

control

β-globin

Supplementary Fig. 8

MeOH 6 h FR 6 h WT NS WT NS WT NS

CHX 3 h

Supplementary Fig. 8 FR901464 does not inhibit NMD. (a) HeLa cells weretransfected with either β-globin WT or β-globin NS39, together with an internalcontrol plasmid β-globin wt+300+e3. The transfected cells were treated withMeOH (6 h), FR901464 (6 h, 10 ng ml–1) or cycloheximide (6 h, 100 ng ml–1).Cyclohexamide that inhibits translation is known to block NMD. mRNAsprepared from transfected cells were analyzed by Northern blotting. (b) Relativesignal intensities in (a).

MeOH FR CHX

Ratio

of N

S/W

T sig

nal

a

b

Antibodies

Rabbit polyclonal anti-p16 (C-20), mouse monoclonal anit-p21 (F-5), rabbit polyclonal

anti-p27 (N-20) (for detection of the p27 N-terminus), goat polyclonal anti-p27

(C-19)-G (for detection of the p27 C-terminus), rabbit polyclonal anti-Cyclin A (H439),

rabbit polyclonal anti-CDK2 (M2), rabbit polyclonal anti-CDK4 (H-22), rabbit

polyclonal anti-CDK6 (C-21), mouse monoclonal anti-c-myc (9E10), goat polyclonal

anti-SAP49 (C-20), goat polyclonal anti-β-tubulin (N-20) (for detection of the β-tubulin

N-terminus), and goat polyclonal anti-SAP145 (A-20) antibodies were purchased from

Santa Cruz. A mouse monoclonal anti-Kip1/p27 antibody was purchased from BD

Biosciences. A mouse monoclonal anti-SAP155 antibody was purchased from Medical

& Biological Laboratories. A goat polyclonal anti-SAP130 antibody was purchased

from Abcam. An anti-biotin-HRP was purchased from Cell Signaling Technology. A

mouse monoclonal anti-HA (16B12) antibody was from BabCO. Mouse monoclonal

anti-α-tubulin (B-5-1-2), anti-SC35 and anti-FLAG (M2) antibodies were purchased

from Sigma. A rabbit polyclonal anti-IκBα antibody was purchased from

CALBIOCHEM. A rabbit polyclonal anti-SF1 antibody was purchased from CeMines.

A mouse monoclonal anti-SF3a120 antibody was purchased from Synaptic Systems. A

rabbit polyclonal anti-β-actin antibody (for detection of the β-actin N-terminus) was

purchased from IMGENEX. These antibodies were used according to the

manufacturer’s recommendation.

Synthesis of Ac-SSA

To a stirred solution of SSA (4.0 mg, 0.0077 mmol) and Et3N (10 µl, 0.072 mmol) in

CH2Cl2 (0.5 ml) was added Ac2O (5 µl, 0.05 mmol) and DMAP (1 mg, 0.008 mmol) at

0 °C. The reaction mixture was allowed to warm to room temperature and kept stirring

for 20 min. The reaction mixture was poured into saturated NH4Cl solution and

extracted with ethyl acetate. The organic layer was washed with water, saturated

NaHCO3 solution and brine. After drying with anhydrous magnesium sulfate, solvent

was removed in vacuo and the residue was chromatographed over silica gel. Elution

with hexane / ethyl acetate (1:1-1:3) gave Ac-SSA (4.0 mg, 93%).

1H NMR (500 MHz, CDCl3): δ = 1.01 (3H, d, J = 7.3 Hz, 20-H), 1.15 (3H, d, J = 6.5 Hz,

16-H), 1.39 (3H, d, J = 6.3 Hz, 5’-H), 1.39 (3H, s, 17-H), 1.72 (1H, d, J = 14.5 Hz,

2-Ha), 1.73 (3H, s, 19-H), 1.72-1.80 (1H, m, 12-H), 1.92-2.00 (2H, m, 13-H), 1.97 (3H,

s, 4-OAc), 2.04 (3H, s, 4’-OAc), 2.21 (1H, m, 10-Ha), 2.33 (1H, d, J = 14.5 Hz, 2-Hb),

2.39 (1H, m, 10-Hb), 2.49 (1H, d, J = 4.5 Hz, 18-Ha), 2.64 (1H, d, J = 4.5 Hz, 18-Hb),

3.29 (3H, s, 1-OMe), 3.51 (1H, dt, J = 2.8, 7.3 Hz, 11-H), 3.66 (1H, dq, J = 2.2, 6.5 Hz,

15-H), 3.94 (1H, m, 14-H), 4.37 (1H, dd, J = 8.0, 10.0 Hz, 5-H), 5.08 (1H, d, J = 10.0

Hz, 4-H), 5.44-5.51 (2H, m, 6-H and 9-H), 5.71 (1H, dd, J = 1.0, 11.5 Hz, 2’-H), 5.89

(1H, dd, J = 8.0, 11.5 Hz, 3’-H), 6.01 (1H, d, J = 9.0 Hz, NH), 6.25 (1H, m, 4’-H), 6.32

(1H, d, J = 15.5 Hz, 7-H). 13C NMR (125 MHz, CDCl3): δ = 12.56, 15.04, 17.82, 19.95,

20.68, 21.25, 22.98, 28.90, 29.68, 31.91, 35.81, 42.50, 47.06, 48.41, 55.31, 68.09, 68.88,

71.66, 75.94, 80.71, 98.97, 122.49, 122.80, 129.22, 134.74, 139.21, 143.61, 164.84,

170.21, 170.39. ESI-Q-TOF-HRMS m/z calcd for C30H46NO9 [M+H]+ 564.3167, found

564.3172.

Characterization of FR901464, SSA, biotinylated SSA and LMB

FR901464: 1H NMR (500 MHz, CDCl3): δ = 1.01 (3H, d, J = 7 Hz, 20-H), 1.11 (3H, d,

J = 7 Hz, 16-H), 1.33 (3H, d, J = 6.5 Hz, 5’-H), 1.43 (3H, s, 17-H), 1.66 (1H, d, J = 14

Hz, 2-Ha), 1.66 (1H, d, J = 10 Hz, -OH), 1.77 (1H, m, 12-H), 1.78 (3H, s, 19-H),

1.91-1.94 (2H, m, 13-H), 2.02 (3H, s, -OAc), 2.24-2.36 (2H, m, 10-H), 2.36 (1H, d, J =

14 Hz, 2-Hb), 2.55 (1H, d, J = 4.5 Hz, 18-Ha), 3.07 (1H, d, J = 4.5 Hz, 18-Hb), 3.38 (1H,

s, 1-OH), 3.53 (1H, m, 11-H), 3.58 (1H, dd, J = 10, 10 Hz, 4-H), 3.66 (1H, qd, J = 7, 2

Hz 15-H), 3.90 (1H, m, 14-H), 4.25 (1H, dd, J = 10, 7 Hz, 5-H), 5.53 (1H, br t, J = 7 Hz,

9-H), 5.66 (1H, dd, J = 7, 16 Hz, 6-H), 5.71 (1H, dd, J = 11.5, 1 Hz, 2’-H), 5.90 (1H, dd,

J = 11.5, 8 Hz, 3’-H), 5.99 (1H, d, J = 9 Hz, -NH-), 6.26 (1H, m, 4’-H), 6.37 (1H, d, J =

16 Hz, 7-H). 1HR-TOF-MS calcd for C27H42NO8 [M+H]+ 508.2910, found 508.2908.

Purity of FR901464 measured with HPLC was 95.7%.

SSA: 1H NMR (300 MHz, CDCl3) δ (ppm): 1.02 (3H, d, J = 7.2 Hz, 20-H), 1.15 (3H, d,

J = 6.5 Hz, 16-H), 1.39 (3H, d, J = 6.3 Hz, 5’-H), 1.39 (3H, s, 17-H), 1.71 (1H, d, J =

10.7 Hz, -OH), 1.74 (1H, d, J = 14.7 Hz, 2-Ha), 1.78-1.82 (1H, m, 12-H), 1.80 (3H, s,

19-H), 1.92-1.98 (2H, m, 13-H), 2.04 (3H, s, -OAc), 2.18-2.45 (2H, m, 10-H), 2.31 (1H,

d, J = 14.7 Hz, 2-Hb), 2.50 (1H, d, J = 4.5 Hz, 18-Ha), 2.99 (1H, d, J = 4.5 Hz, 18-Hb),

3.28 (3H, s, -OMe), 3.52 (1H, dt, J = 2.6, 7.1 Hz, 11-H), 3.61 (1H, dd, J = 9.5, 10.7 Hz,

4-H), 3.67 (1H, dq, J = 2.4, 6.5 Hz, 15-H), 3.94 (1H, m, 14-H), 4.05 (1H, dd, J = 7.2,

9.5 Hz, 5-H), 5.51 (1H, t, J = 6.9 Hz, 9-H), 5.65-5.75 (1H, m, 6-H), 5.71 (1H, dd, J =

1.2, 11.6 Hz, 2’-H), 5.89 (1H, dd, J = 7.7, 11.6 Hz, 3’-H), 6.00 (1H, d, J = 9.3 Hz,

-NH-), 6.26 (1H, m, 4’-H), 6.41 (1H, d, J = 15.9 Hz, 7-H).

Biotin-SSA: 1H NMR (300 MHz, CDCl3) δ (ppm): 1.01 (3H, d, J = 6.9 Hz, 20-H), 1.15

(3H, d, J = 6.6 Hz, 16-H), 1.2-2.1 (23H, m, 2-Ha, 12-H, 13-H, -OH, methylenes), 1.38

(3H, d, J = 6.6 Hz, 5’-H), 1.39 (3H, s, 17-H), 1.76 (3H, s, 19-H), 2.04 (3H, s, -OAc),

2.1-2.45 (9H, m, 2-Hb, 10-H, three -C(O)CH2), 2.53 (1H, d, J = 4.8 Hz, 18-Ha), 2.71 (1H,

d, J = 12.5 Hz, biotin -S-CH-), 2.90 (1H, dd, J = 4.8, 12.5 Hz, biotin -S-CH-), 3.07 (1H,

d, J = 4.8 Hz, 18-Hb), 3.1-3.35 (5H, m, biotin -S-CH-, two -NCH2-), 3.45-3.75 (7H, m,

4-H, 11-H, 15-H, acetal -OCH2-, -NCH2-), 3.92 (1H, m, 14-H), 4.07 (1H, dd, J = 6.8,

9.5 Hz, 5-H), 4.31 (1H, m, biotin -N-CH-), 4.49 (1H, m, biotin -N-CH-), 5.45-5.55 (2H,

m, H-9, -NH-), 5.66 (1H, dd, J = 6.8, 15.6 Hz, 6-H), 5.74 (1H, d, J = 11.7 Hz, 2’-H),

5.89 (1H, dd, J = 7.8, 11.7 Hz, 3’-H), 6.1-6.20 (2H, m, two -NH-), 6.27 (1H, m, 4’-H),

6.3-6.37 (1H, m, -NH-), 6.35 (1H, d, J = 15.6 Hz, 7-H). 6.42 (1H, m, -NH-), 6.67 (1H,

m, -NH-).

LMB: ESI-Q-TOF-HRMS m/z calcd for C33H48NaO6 [M+Na]+ 563.3349, found

563.3343.

Plasmid construction

The cDNA fragments of wild-type p27 and p27* were amplified from a cDNA library

and a genomic DNA of HeLa cells by PCR using the following primers. Sense primer:

5’-gggaattcggatccatggactacaaggacgacgacgacaagctcgagatgtcaaacgtgc-3’; p27 wild-type

anti-sense primer: 5’-gggaattcttaaagcttcgtttgacgtcttctg-3’; and p27* anti-sense primer:

5’-gggaattcttaaagcttaacaccctccagcagg-3’. The amplified PCR products were digested

with BamHI and EcoRI and subcloned into the pcDNA3.1 vector (Invitrogen). For

construction of the p27-int-HA plasmid, PCR was carried out using a genomic DNA of

HeLa cells as a template and the following primers. p27-XhoI-ATG:

5’-gccgccctcgagatgtcaaacgtgcgagtg-3’; p27*-HA rev:

tgggacgtcgtatgggtaaccagcgtagtctgggacgtcgtatgggtaacaccctccagcaggcaaag;

p27-3'-HindIII: 5’-ggcggcaagcttcgtttgacgtcttctgag-3’; and p27*-HA:

gacgtcccagactacgctggttacccatacgacgtcccagactacgcttaaccttagcttgcttttcg. The second PCR

was carried out using p27-XhoI-ATG and p27-3'-HindIII primers, and the two PCR

products of the first PCR as templates. The amplified PCR products were digested with

XhoI and HindIII and subcloned into the pcDNA3.1/myc-His(-) A vector (Invitrogen).

The fragment of β-globin was amplified from a genomic DNA of HeLa cells by PCR

using the following primers. Hbg_ATG(Hind3)F (sense):

5’-CCCAAGCTTatggtgcatctgactcctg-3’ and Hbg_ex2(Xho1)R (antisense):

5’-CCGCTCGAGTTAgtgcagcttgtcacag-3’. The amplified PCR product was digested

with HindIII and XhoI and subcloned into the pcDNA3-FLAG vector.

Mass spectrometry

Following Coomassie Brilliant Blue staining, bands corresponding to the SSA binding

proteins were excised, and the gel pieces were destained with 50% CH3CN in 50 mM

NH4HCO3 solution. After removal of the supernatant, cysteine residues were reduced

with DTT, carbamido methylated with IAA, and the proteins were digested with trypsin

at 37 ºC overnight. The tryptic peptides were recovered by sequentially adding three

solvent systems containing 50% CH3CN and 1% TFA, 20% HCOOH, 25% CH3CN and

15% i-PrOH, and 80% CH3CN. The supernatants were collected and pooled into one

tube, reducing the volume in vacuo. The dried tryptic peptides were suspended in 2%

CH3CN and 0.1% TFA and applied to the following LC-MS/MS system.

Chromatographic separation was accomplished with the MAGIC 2002 HPLC system

(Michrom BioResources). Peptide samples were loaded onto a Cadenza C18

custom-packed column (0.2x50 mm, Michrom BioResources), and eluted using a linear

gradient of 5–60% CH3CN in 0.1% HCOOH for 30 min at a flow-rate of 1 ml/min.

Samples were ionized with a Nanoflow-LC ESI, and MS/MS spectrum data were

obtained with an LCQ-Deca XP ion trap mass spectrometer (Thermo Electron). The

Mascot database searching software (Matrix Science) was used for the identification of

SSA-binding proteins.

Primer sets

Primer sequences used in RT-PCR experiments are:

5’-TCAAACGTGCGAGTGTCTAACG-3’ (exon 1, sense) and

5’-GGATGAAAAACCCACTACCTCC-3’ (intron 2, antisense) for p27 pre-mRNA

(Fig. 3d and Supple. Fig. 4b lower panel);

5’-GCCGCCCTCGAGATGTCAAACGTGCGAGTG-3’ (exon 1, sense) and

5’-GGCGGCAAGCTTCGTTTGACGTCTTCTGAG-3’ (exon 2, antisense) for p27

mature mRNA (Supple. Fig. 4b upper panel);

5’-GGTGGGCATGGGTCAGAAGGAT-3’ (exon3, sense) and

5’-GGAAATGAGGGCAGGACTTAGCTT-3’ (intron 4, antisense) for β-actin;

5’-CTATAAACCTTCCCTTCTGCCAG-3’ (intron 2, sense) and

5’-CAGGGTATTCTTCTCGCATCTTGCTG-3’ (exon 4, antisense) for β-tubulin;

5’-GAAAGACGAGGAGTACGAGCAG-3’ (exon 1, sense),

5’-CTGGAAGTTGAGGAAGGCCAGG-3’ (exon 2, antisense),

5’-GGCAAGGTGTAGGGGGG-3’ (exon 3, antisense),

5’-ACATCAGCACCCAAGGACACCA-3’ (exon 4, antisense),

5’-TGTGAACTCCGTGAACTCTGAC-3’ (exon 5, antisense) and

5’-GGCCTCCAAACACACAGTCATC-3’ (exon 6, antisense) for IκBα; and

5’-CTGTGGGGCAAGGTGAAC-3’ (exon 1, sense) and

5’-CAGGAGTGGACAGATCCC-3’ (exon 2, antisense) for β-globin.

In vitro kinase assay

Wild-type FLAG-p27 or FLAG-p27* were purified from the lysate of HEK293T cells

transfected with pcDNA3-FLAG-p27 or pcDNA3-FLAG-p27* by immunoprecipitating

the FLAG-tagged protein using the anti-FLAG antibody (clone M2). The

immunoprecipitates were suspended in kinase buffer and boiled for 5 min. The boiled

FLAG-p27 or FLAG-p27* was mixed with CDK2 immunopurified from cells using an

anti-CDK2 antibody (Santa Cruz), [γ-32P]ATP and histone H1 (Roche), and incubated

for 20 min at 30 °C. The samples were analyzed by autoradiography and Western

blotting.

In vivo kinase assay

For detection of the CDK2-inhibitory activity of exogenously expressed p27* in cells,

HEK293T cells were transfected with pcDNA3.1, pcDNA3.1-FLAG-p27, or

pcDNA3.1-FLAG-p27*. The protein complex was precipitated from the transfected

cells with the anti-CDK2 antibody, and the kinase activity in the complex was measured

by the in vitro kinase assay. For comparison of the CDK-inhibitory activity of p27*

induced by the drug treatment, HEK293T cells were treated with MeOH, FR901464, or

SSA, or transfected with pcDNA3.1, pcDNA3.1-FLAG-p27, or pcDNA3.1-FLAG-p27*,

and then the kinase activity in the CDK2 complex was measured.

FR901464 and spliceostatin A stability assay

Five mg of FR901464 and spliceostatin A were incubated with Dulbecco's modified

Eagle's medium containing 10% heat-inactivated fetal bovine serum (Sigma) for 0, 1, 3

and 6 h at 37 ºC. Compounds were extracted with ethyl acetate, dried and dissolved in

methanol. The residual amounts of the compounds were determined with a Waters 600

LC system using UV absorption at 254 nm.

NMD assay

HeLa cells were transfected with either β-globin WT or β-globin NS39, together with

an internal control plasmid β-globin wt+300+e3. The transfected cells were treated

with MeOH (6 h), FR901464 (6 h, 10 ng/ml) or cycloheximide (6 h, 100 ng/ml).

Northern blotting was performed using mRNAs prepared from the transfected cells.

DIG-labeled β-globin mRNA transcribed in vitro was used for the probe.