Dact2 Represses PITX2 Transcriptional Activation and Cell ... · Dact2 Represses PITX2 Transcriptional Activation and Cell Proliferation through Wnt/beta-Catenin Signaling during

Dact2 Represses PITX2 Transcriptional Activation andCell Proliferation through Wnt/beta-Catenin Signalingduring OdontogenesisXiao Li, Sergio Florez, Jianbo Wang, Huojun Cao, Brad A. Amendt*

Department of Anatomy and Cell Biology, The University of Iowa, Iowa City, Iowa, United States of America

Abstract

Dact proteins belong to the Dapper/Frodo protein family and function as cytoplasmic attenuators in Wnt and TGFbsignaling. Previous studies show that Dact1 is a potent Wnt signaling inhibitor by promoting degradation of b-catenin. Wereport a new mechanism for Dact2 function as an inhibitor of the canonical Wnt signaling pathway by interacting withPITX2. PITX2 is a downstream transcription factor in Wnt/b-catenin signaling, and PITX2 synergizes with Lef-1 to activatedownstream genes. Immunohistochemistry verified the expression of Dact2 in the tooth epithelium, which correlated withPitx2 epithelial expression. Dact2 loss of function and PITX2 gain of function studies reveal a feedback mechanism forcontrolling Dact2 expression. Pitx2 endogenously activates Dact2 expression and Dact2 feeds back to repress Pitx2transcriptional activity. A Topflash reporter system was employed showing PITX2 activation of Wnt signaling, which isattenuated by Dact2. Transient transfections demonstrate the inhibitory effect of Dact2 on critical dental epithelialdifferentiation factors during tooth development. Dact2 significantly inhibits PITX2 activation of the Dlx2 and amelogeninpromoters. Multiple lines of evidence conclude the inhibition is achieved by the physical interaction between Dact2 andPitx2 proteins. The loss of function of Dact2 also reveals increased cell proliferation due to up-regulated Wnt downstreamgenes, cyclinD1 and cyclinD2. In summary, we have identified a novel role for Dact2 as an inhibitor of the canonical Wntpathway in embryonic tooth development through its regulation of cell proliferation and differentiation.

Citation: Li X, Florez S, Wang J, Cao H, Amendt BA (2013) Dact2 Represses PITX2 Transcriptional Activation and Cell Proliferation through Wnt/beta-CateninSignaling during Odontogenesis. PLoS ONE 8(1): e54868. doi:10.1371/journal.pone.0054868

Editor: Stefan Liebner, Institute of Neurology (Edinger-Institute), Germany

Received July 24, 2012; Accepted December 19, 2012; Published January 22, 2013

Copyright: � 2013 Li et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricteduse, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This work was supported by the National Institutes of Health grants DE13941 and DE18885 to B.A.A. The funder had no role in study design, datacollection and analysis, decision to publish or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: [email protected]

Introduction

The mouse tooth is an advantageous model to study organo-

genesis by analyzing molecular signaling networks that regulate

cell differentiation and proliferation. The importance of signaling

pathways including Wnts in the reciprocal interactions between

oral epithelium and mesenchyme were proved in previous studies

[1,2]. The outer and inner dental epithelia are derived from oral

epithelium, and are gradually differentiated into ameloblasts along

the posterior-anterior axis. Several transcription factors including

Pitx2, Dlx2, FoxJ1 and amelogenin (Amelx) have hierarchical

expression during tooth development [3]. Together with the

upstream signaling pathways, these mechanisms play critical roles

in the dental crown and root formation [4]. As reported

previously, Pitx2 is one of the earliest transcription markers

observed during tooth development, and it is specifically restricted

to the epithelium of the developing tooth. Pitx2 is regulated by the

Wnt/b-catenin pathway and functions in the pathway by

recruiting and independently interacting with Lef-1 and b-cateninto synergistically activate target genes, and many of these target

genes are critical for tooth development [5,6].

Dacts are intracellular proteins that can bind to many factors in

both cytoplasmic and nuclear compartments. All members of the

Dact family have N-terminal leucine zipper domains and C-

terminal PDZ binding motifs [7,8]. The orthologs of mouse Dact

family members in xenopus, zebrafish and human are highly

conserved in terms of gene structures. Studies have shown the

conservation is also prominent at the functional level. In Xenopus

laevis, xDact binds to Dvl through its C terminal PDZ binding

motif [7], and targets b-catenin for destruction by the APC, Axin,

and Gsk3a complex leading to down-regulation of b-cateninresponsive genes. In zebrafish, Dact1 negatively regulates both

canonical Wnt pathway and planar cell polarity (PCP) pathway

(also known as non-canonical Wnt pathway) [9]. But Dact2 in

zebrafish represses the PCP pathway [10] and TGFb/Nodal

pathway [11]. Mouse Dact1 degrades Dvl and antagonizes b-catenin dependent Wnt signaling in the same way as xDact in

Xenopus [9]. Mouse Dact1 functions in the similar way as xDact

by antagonizing the Wnt/b-catenin signaling, and intensively

involved in the PCP pathway [12]. On the other hand, mouse

Dact2 antagonizes TGFb signaling [13], as well as Wnt/b-cateninsignaling. However, mouse Dact2 inhibits Wnt/b-catenin signal-

ing in a distinct manner from Dact1. Dact2 doesn’t directly alter

the level of b-catenin [14].

Wnt proteins belong to a family of ligands that are able to

activate a receptor mediated signaling pathway [15,16,17]. Wnt

signaling acting through the cytoplasmic scaffold protein dishev-

elled (Dvl) stabilizes b-catenin allowing it to enter the nucleus

where it interacts with Pitx2 and Lef-1 to regulate gene expression

PLOS ONE | www.plosone.org 1 January 2013 | Volume 8 | Issue 1 | e54868

[6,18,19]. Studies showed that Wnt/b-catenin signaling was highly

conserved, and the precise control of Wnt signaling is required for

normal tooth development. Inhibition of the Wnt/b-cateninpathway led to differentiation arrest of the dental epithelial cells

and multiple other dental development defects [20,21].

Studies on craniofacial and tooth development identified Dact2

as an important factor that is highly expressed in the dental

epithelium and epithelial cells. Dact2 also has been shown to

interact with various factors, including PKC, Dvl3, b-catenin and

Lef-1, and Dact2 can form hetero/homo dimers with all three

Dact family members. However, the molecular mechanisms of

Dact2 function are still poorly understood. Dact2 is a substrate of

kinases but whether the phosphorylation of Dact2 has any

alteration of cellular function is unknown [22]. Dact2 mRNA

localization has also been shown to be restricted in the dental

epithelia including the cervical loops (stem cell niche) [23].

Because PITX2 interacts with b-catenin and Lef-1 to regulate

gene expression we asked if Dact2 interacted with PITX2 to

modulate PITX2 transcriptional activity. Furthermore, we

hypothesized that Dact2 regulated b-catenin activity in the dental

epithelium and subsequently tooth development. The Dact2 null

mice were analyzed for tooth developmental, cell proliferation

and/or differentiation defects. These studies reveal a role for

Dact2 in modulating Wnt/b-catenin signaling activity through

PITX2.

Materials and Methods

Histology and fluorescent immunohistochemistryAll animals were housed in the Program of Animal Resources of

the Institute of Biosciences and Technology, and were handled in

accordance with the principles and procedure of the Guide for the

Care and Use of Laboratory Animals. The Texas A&M Health

Science Center, Institutional Animal Care and Use Committee

approved all experimental procedures. The Dact2 null mice

(NM_172826) were obtained from the Texas Institute for

Genomic Medicine and the Dact2 gene was inactivated using the

gene trap insertion method. The insertion completely inactivated

the Dact2 gene and no Dact2 protein was produced in the mutant

mice. Murine embryos were used for histology and fluorescent

immunohistochemistry (FIHC). Samples were fixed in 4% para-

formaldehyde, dehydrated and embedded in paraffin wax.

Sections were cut (7 mm) and stained with Hematoxylin and

Eosin. Sections for immunohistochemistry were rehydrated and

treated with 10 mM Sodium Citrate solution for 15 min at a slow

boiling state for antigen retrieval. Subsequently sections were

Figure 1. Dact2 expression in dental and oral epithelia. (A–F) Endogenous Dact2 protein was stained using a Dact2 antibody and secondaryFITC conjugated antibody and nuclei were stained by DAPI on wild type mouse embryos. (A) E12.5 upper molar tooth germ, (B) E14.5 upper molartooth germ, (C) E16.5 oral epithelium, (D) E12.5 lower molar tooth germ, (E) E14.5 lower molar tooth germ, and (F) E16.5 first lower molar all showsepithelial expression of Dact2. (G and H) molar germs at E14.5 stained without Dact2 primary antibody as negative controls. (I) LacZ staining witheosin counter staining on E14.5 Pitx2cre/+X Rosa26+/2 mice showed Pitx2 highly expressed cell linages in the upper molar bud, indicating overlappingexpression of Dact2 with Pitx2 at the same developmental stages. White dotted lines indicate the mesenchyme-epithelium boundaries. Scale barrepresents 100 mm.doi:10.1371/journal.pone.0054868.g001

Dact2 Regulates PITX2 and Wnt Signaling


incubated with 10% goat serum-PBST for 30 min at the room

temperature, followed by overnight incubation with specific

primary antibody at dilution of 1:500 at 4uC. After the incubationthe slides were treated with FITC labeled secondary antibody

(Invitrogen) at a concentration of 1:300 for 30 min. Each antibody

incubation was followed by 3–6 PBST (phosphate-buffered saline

with tween) washes. b-catenin antibody was purchased from Santa

Cruz Biotechnology. Nuclear counter staining was performed

using a DAPI containing mounting solution after the final wash

(Vector Laboratories).

Fluorescent immunocytochemistryCells were seeded on microscope glass cover slips in 60 mm

dishes 24 h prior to fixation. Fixation was done by incubating the

cover slips in ice-cold acetone for 5 min at 4uC. Fixed cells were

washed with PBST for 5 min twice. Subsequently the cover slips

were incubated in 10% normal goat serum-PBST 30 min at room

temperature, and then in specific primary antibodies at 4uC. Afterovernight incubation, cells were rinsed by PBST for 3 times, 5 min

each. Then the cells were incubated with FITC labeled secondary

antibody for 30 min at 37uC. Finally the cells were washed with

PBST for 3 times, 5 min each, and counter stained by DAPI

containing mounting solution.

Expression and reporter constructsExpression plasmids containing the cytomegalovirus (CMV)

promoter linked to the PITX2A cDNA were constructed in

pcDNA-3.1-MycHisC (Invitrogen) [18,24,25]. b-catenin S37A

expression plasmid has been previously described [6]. Mouse Dact2

cDNA (NM_172826) was cloned and constructed into pcDNA-

3.1-MycHisC (Invitrogen) backbone, under control of the CMV

promoter. Dlx2 and amelogenin promoters in pTK-Luc have been

previously described [3,4]. 10 kb Dact2 promoter was cloned in

pTK-Luc plasmid. The 66 bp Dact2 enhancer reporter was

constructed by cloning a 66 bp DNA segment of Dact2 promoter

containing the Pitx2 binding site at (26172 to 26106 bp) into

minimal TK-Luc reporter in tandem. Mutant reporter was

constructed with the same tandem flanking promoter sequence,

except the Pitx2 binding motif GGATTA (26142 to 26136 bp)

was mutated into scrambled motif AGTTCG. All constructs were

confirmed by DNA sequencing. All plasmids were double-banded

CsCI purified.

Figure 2. Endogenous Pitx2 binds to a conservative region on the Dact2 promoter. (A) Schematic of Dact2 10 kb promoter with six PITX2binding motifs (TAATCC) indicated by arrowheads. The red arrowhead indicates the site verified by ChIP assay. The location of the sense primer andthe antisense primer are shown for amplification of the immunoprecipitated chromatin. Blue arrowheads are putative binding sites with lessconservation. The white arrowhead indicate a non-conserved Pitx2 binding motif that we tested in ChIP experiment as negative control shown inFigure S3. (B) Endogenous ChIP assay was performed in LS-8 cells. Lane 1 contains the PCR marker. Lane 2 shows the Dact2 primers-only control.Lane 3 is the immunoprecipitation using normal rabbit IgG and Dact2 primers. Lane 4 is the Pitx2 immunoprecipitated chromatin amplified using thespecific Dact2 promoter primers. Lane 5 is the chromatin input amplified using the Dact2 primers. Lane 6 shows the Msx2 promoter primers-onlycontrol. Lane 7 is the immunoprecipitation using normal rabbit IgG and Msx2 primers. Lane 8 is the Pitx2 immunoprecipitated chromatin amplifiedusing the specific Msx2 promoter primers. Lane 9 is the chromatin input amplified using the Msx2 primers. The amplified region of Msx2 promoter is2632 to 2359 bp relative to transcription start site. All PCR products were sequenced to confirm their identity. (C) The PITX2 binding element onmouse Dact2 promoter verified by ChIP was mapped to a highly conserved (.70%) region among Mouse, Human, Chimpanzee, Rhesus macaque andRat. The blue box indicates the PCR amplified region on Dact2 promoter in (B).doi:10.1371/journal.pone.0054868.g002



Cell culture, transient transfections, luciferase and b-galactosidase assaysMDPC, LS-8 cells [26], CHO cells and HEK293FT cells were

cultured in DMEM supplemented with 5% FBS, 5% BGS and

penicillin/streptomycin and transfected by electroporation. Cells

were fed and seeded in 60 mm dishes 24 hours prior of

transfection. Cells were resuspended in PBS and mixed with

2.5 mg of expression plasmids, 5 mg of reporter plasmid and 0.2 mgof SV-40 b-galactosidase plasmid. Electroporation was performed

at 380 v and 950 mF (Gene Pulser XL, Bio-Rad). Transfected cells

were incubated for 24 h (unless otherwise indicated) in 60 mm

culture dishes and fed with 10% FBS and DMEM and then lysed

and assayed for reporter activities as well as protein content by

Bradford assay (Bio-Rad). Luciferase level was measured using the

luciferase assay kit (Promega). b-galactosidase was measured using

the Galacto-Light Plus reagents (Tropix Inc.). All luciferase

activities were normalized to b-galactosidase activity.

Western blot assaysApproximately 15 mg of transfected cell lysates were analyzed in

Western blots. Following SDS gel electrophoresis, the proteins

were transferred to PVDF filters (Millipore), immunoblotted and

detected using specific antibodies and ECL reagents (GE

HealthCare). Endogenous Dact2 expression was detected with

polyclonal rabbit antibody (ProSci, Inc.) GAPDH was detected

with polyclonal mouse antibody (Millipore). b-tubulin was

detected by polyclonal rabbit antibody (Santa Cruz Biotechnolo-

gy). Myc tag was detected by polyclonal mouse antibody

(Invitrogen). Quantification of band intensity was performed by

ImageMeter software (Flashscript.biz). Intensity of each band was

normalized with corresponding loading control (i.e. GAPDH), and

then converted as relative fold value of the intensity of protein of

interest in the first lane of the blot. 6SEM were calculated based

on at least 3 different blots.

Figure 3. PITX2 activates Dact2 expression. (A) CHO cells were co-transfected with CMV-PITX2A expression plasmids and luciferase reporterdriven by Dact2 10 kb promoter. Empty CMV-PITX2A expression plasmids were transfected in parallel as a negative control. All transfections includedthe SV-40-b-galactosidase reporter to control the transfection efficiency. Cells were incubated for 24 hrs and then assayed for luciferase and b-galactosidase activities. (B) Luciferase reporters driven by a duplicated 66 bp DNA segment of Dact2 promoter flanking the Pitx2 binding site inFig. 2A at (26172 to 26106) was co-transfected with or without CMV-PITX2A overexpression plasmid in CHO cells. A similar reporter with themutated Pitx2 binding motif was transfected in parallel as control. All luciferase activities are shown as mean-fold activation compared with the Dact2promoter plasmid co-transfected with empty CMV expression plasmid (6SEM from five independent experiments). (C) E14.5 Embryos from Pitx22/2,Pitx2 transgenic and wild type mice were harvested to generate MEF cells. These MEFs were lysed and analyzed by Western blots to showendogenous Dact2 expression levels. GAPDH expression was probed as loading controls. Protein band intensities were quantified and shown asrelative value 6SEM.doi:10.1371/journal.pone.0054868.g003



Figure 4. Dact2 attenuates PITX2 transcription activity. (A) CHO cells were transfected with CMV-PITX2A, CMV-Dact2 and luciferase reporterdriven by Amelx 2.2 kb promoter. Empty CMV expression plasmids were transfected in parallel as a negative control. (B) CHO cells were transfectedwith combinations of CMV-PITX2A, CMV-b-catenin, CMV-Dact2 and luciferase reporter driven by Dlx2 3.2 kb promoter. Empty CMV expressionplasmids were transfected in parallel as a negative control. The titration gradient of transfected Dact2 expression plasmids are from 0.5 mg to 8 mg in2-fold increment. The luciferase activities were normalized by co-transfected b-galactosidase and 6SEM was from five independent experiments. (C)Dlx2 was transfected instead of PITX2A to show Dact2 attenuation is specific to PITX2 transcription activity. All luciferase activities were normalized by



Chromatin Immunoprecipitation (ChIP) assayThe ChIP assays were performed as previously described using

the ChIP Assay Kit (Upstate) with the following modifications

[6,27]. LS-8 cells were plated in 60 mm dishes and fed 24 h prior

to the experiment, harvested and plated in 60 mm dishes. Cells

were cross-linked with 1% formaldehyde for 10 min at 37uC. AllPCR reactions were done with an annealing temperature of 58uC.Specific primers for amplifying the Pitx2 binding site in the Dact2

promoter were as follow: sense: 59- ACTAACGGGAGCCCT-

GACAT -39 and antisense: 59 -GGAGGCATTTTTCT-

CAATGG-39. All the PCR products were evaluated on a 2%

agarose gel in TBE for expected size (292 bp) and confirmed by

sequencing. As controls the primers were used without chromatin,

normal rabbit IgG was used replacing the specific primary

antibody to reveal non-specific immunoprecipitation of the

chromatin. The primers for amplifying the Msx2 promoter were

as follow: sense: 59 -AAGGGAGAAAGGGTAGAG- 39 and

antisense: 59 -CCCGCCTGAGAATGTTGG-39. The expected

product size was 273 bp. The primers for amplifying the non-

conserved binding motif at -3719 bp on Dact2 promoter were as

follow: 59 -CCTCTGGAAGCAGGAGAGTG- 39 and antisense:

59 -CACTCTCCTGCTTCCAGAGG-39. The expected product

size was 236 bp. The primary antibody used in this assay was

polyclonal rabbit Pitx2 antibody (Capra Science). Evolutional

conservation analysis was performed using online tool (http://

ecrbrowser.dcode.org/), [28].

Immunoprecipitation AssayLS-8 oral epithelial cells were used to demonstrate endogenous

Dact2 and Pitx2 interaction. Cells were harvested and disrupted

by repeated aspiration through a 25-gauge needle. Cellular debris

was pelleted at 4uC. An aliquot of lysate was saved for analysis as

input control. The supernatant was transferred to a fresh 1.5-ml

microcentrifuge tube on ice and precleared using the mouse IgG.

Precleared lysate was incubated with protein A/G-agarose beads

for 1–2 h at 4uC. After a brief centrifugation, supernatant was

transferred to a new tube, and immunoprecipitation was

performed with rabbit Pitx2 antibody (Capra Science). The

supernatant was incubated with protein A/G-agarose beads at

4uC for overnight. Immunoprecipitates were collected by brief

centrifugation and washed 3 times with PBS and resuspended in

15 ml of H2O and 3 ml of 6X SDS loading dye. Samples were

boiled for 5 min and resolved on a 12% polyacrylamide gel.

Western blotting was performed with anti-Dact2 antibody and

HRP-conjugated antibody to detect immunoprecipitated proteins.

GST Pulldown AssaysGST-PITX2A-FL (full length), GST-PITX2A-HD (homeodo-

main), GST-PITX2A-ND38 and GST-PITX2A-C173 fusion

proteins were expressed in bacteria, purified and immobilized on

Glutathione-Sepharose beads. Protein binding beads were sus-

pended in binding buffer (20 mM HEPES, pH 7.5, 5% glycerol,

50 mM NaCl, 1 mM EDTA, 1 mM DTT with 1% milk and

400 mg/ml ethidium bromide). Purified bacterial expressed Dact2

proteins were added to 10–30 mg of immobilized GST fusion

proteins in a total volume of 100 ml and incubated for 30 min at

4uC. The beads were pelleted and washed 5 times with 200 ml ofbinding buffer. The bound proteins were eluted by boiling in SDS

sample buffer and separated on a 12% SDS-polyacrylamide gel.

Immunoblotting detected Dact2 protein using Dact2 antibody

(ProSci) and ECL reagents from GE Healthcare.

Cell proliferation assaysMEF cells were harvested from E13.5 littermates and subjected

to cell proliferation assay before passage 3. 1.56105 cells of each

line were seeded in 60 mm plates on day 0. Cells were then

trypsinized and counted after 24, 48, 72 and 96 hours by a Coulter

Z1 cell counter (Beckman Coulter, Inc). Experiments were run in

4 replicates.

Real-time PCR assaysRNA extraction was performed using RNeasy Mini kit from

Qiagen. RT-PCRs were performed using iScript Select cDNA

synthesis kit from BioRad. Real-time PCRs were performed using

iQ SYBR Green Supermix kit, and all Ct values were normalized

by b-actin level. Both isoforms of endogenous Dact1 were

co-transfected b-galactosidase and 6SEM were from at least three independent experiments. (D) Dact2and PITX2A transfected CHO cells were lysedand analyzed by Western blot, probing for transfected PITX2A. b-catenin expression is shown by Western blot in transfected cells. b-tublin wasprobed as loading control.doi:10.1371/journal.pone.0054868.g004

Figure 5. Dact2 is a potent inhibitor of Wnt/b-catenin signaling. 293FT cells were transfected with CMV-Lef-1, CMV-PITX2A, CMV-Dact2overexpression plasmids and TOPFlash reporters. In parallel experiments FOPFlash reporter were transfected as negative control. All luciferaseactivities were normalized by co-transfected b-galactosidase and 6SEM were from five independent experiments.doi:10.1371/journal.pone.0054868.g005



measured using forward (59- AGCCTCGTGCAGAAGAAAAC -

39) and reverse (59- CAGAGCCAACCTCTTGCTTT -39)

primers. Dact2 was measured using forward (59-

GGCTGACGGGCATGTTC -39) and reverse (59-

CCCCACGTCAGCTGGAA -39) primers. Dact3 was measured

using forward (59- GAGCTGAGACCTGCTCATCC -39) and

reverse (59- GAGCTGAGACCTGCTCATCC -39) primers.

Primers to measure Ccnd2 were forward (59- GTTCTGCA-

GAACCTGTTGAC -39) and reverse (59-

ACAGCTTCTCCTTTTGCTGG -39). Primers for Ccnd1 and

c-Myc were previously described [29]. All PCR products were

examined by melt curves and sequenced.

RNA interferenceShort-hairpin (sh) RNA plasmids carrying sequence targets on

the Dact2 mRNA, 59-TGGATGTGAGCAGGTCTTCTT-39 was

used to transfect LS-8 cells to specifically knock down Dact2

mRNA. This shRNA sequence was previously described and

proven effective [14]. Control shRNA was targeting firefly

luciferase and did not match any mouse cDNA (by a BLAST

search). Transfection of cells was performed using 5 mg plasmid

per 16106 cells, and cultured for 48 hours before harvesting.

Statistical AnalysisTwo-tailed unpaired Student’s t test was used to determine the

difference between two sets of values. Error bars were expressed as

mean 6 SE. All experiments were repeated at least thrice.

Ethics StatementAll animals were housed at the Institute of Biosciences and

Technology under the care of the Program of Animal Resources,

and were handled in accordance with the principles and procedure

of the Guide for the Care and Use of Laboratory Animals. All

experimental procedures were approved by the Texas A&M

Health Science Center, Institutional Animal Care and Use

Committee. Protocol number 09001, mouse models for tooth

development.

Results

Dact2 is expressed in the dental epitheliumTo characterize factors in dental development, we extracted

tooth germ total RNA from epithelium and mesenchyme of P0

wild type mice and genomic microarrays were employed to

distinguish epithelial from mesenchyme specific factors. Several

epithelial markers such as Pitx2 and Enamlin (Enam) were highly

expressed in dental epithelium, and mesenchyme markers such as

Bmp2 and Pax9 were highly expressed in dental mesenchyme.

Interestingly, the expression of Dact2 was significantly higher (4.45

fold) in dental epithelium compared to mesenchyme (Fig. S1A).

Western blots confirmed endogenous Dact2 expression in the

dental epithelial-like LS-8 cell line, in contrast with the mesen-

chyme odontoblast-like MDPC cells (Fig. S1B). A previous report

revealed 3 members of the Dact gene family have correlated

expression pattern in various tissues, and they form homo/hetero

dimers among each other [22]. To determine whether Dact1 and

Dact3 are co-expressed in the dental epithelium, we extracted

RNA from LS-8 cells and found Dact2 and Dact1 have high

expression levels, while Dact3 transcripts are barely detectable

(Fig. S1C). In-situ studies have shown abundant Dact2 transcripts

restricted in both incisor and molar epithelia, but Dact1 and Dact3

transcripts are present in the mesenchyme [23]. Dact1 and Dact3

Figure 6. Dact2 protein localizes to the cytoplasm and nuclear compartments in LS-8 cells. Endogenous immunofluorescence staining onLS-8 cells was performed. (A) Dact2 protein was probed by Dact2 primary antibody and labeled with FITC. (B) Nuclei were stained by DAPI. (C)Merged signals of FITC and DAPI. (D, E and F) Single cell was viewed under 100X objective. (G, H and I) Parallel experiments using normal rabbit IgGas mock primary antibody to show secondary antibody specificity. All scale bars represent 25 mm.doi:10.1371/journal.pone.0054868.g006



Figure 7. Dact2 and Pitx2 physically interact. (A) LS-8 cells were used for endogenous immunoprecipitation assays. Western Blots shows thehigh expression levels of Dact2 and Pitx2A in the 10 times diluted input LS-8 cell lysate. The right lane of the IP Western Blot shows Dact2 proteinpulled down by Pitx2 antibody. Left lane shows the parallel IP performed using normal rabbit IgG as negative control. (B) Schematics of the genestructures of PITX2A truncations used in GST pull down assay. (C) Coomassie blue staining of the purified PITX2A truncated proteins fused with GSTtag (bands with the correct sizes marked by *). (D) Dact2 Western blot of the GST pull-down assay. Dact2 pure protein was incubated with differenttruncated PITX2A in lane 1, 3, 5 and 7. Incubation of corresponding truncated PITX2A only controls were in lane 2, 4, 6 and 8. Lane 9 contains 10%Dact2 pure protein input. Results indicated Dact2 binds PITX2A through the homeodomain.doi:10.1371/journal.pone.0054868.g007

Figure 8. Knock down of Dact2 activates endogenous Pitx2 target genes. (A) Knocking down of endogenous Dact2 in LS-8 cells by shRNAwas shown by Western Blot. Negative control shRNA transfected cells show no change. GAPDH was probed as loading controls. Protein bandintensities were quantified and shown as relative value 6SEM. (B) mRNAs were extracted from LS-8 cells transfected with Dact2 shRNA or NC shRNA,and subjected to RT-PCRs and real-time PCRs. Relative expression levels of Dlx2 and Amelx were analyzed and correlated with Dact2 expression level.All Real-time PCRs were performed in triplicates and repeated six times.doi:10.1371/journal.pone.0054868.g008



are highly expressed in the dental mesenchyme MDPC cells

(Fig. S1C).

To demonstrate Dact2 expression during odontogenesis, we

performed immunohistochemistry using sagittal sections of El2.5,

E14.5 and E16.5 upper and lower molars and oral epithelium.

Fluorescent immunochemical staining was performed on a series

of sections across the whole tooth germ to avoid positional bias and

secondary antibody only staining was performed in parallel to

ensure antibody specificity. Dact2 protein was specifically ex-

pressed in the dental epithelium and adjacent oral epithelium

during incisor and molar development, consistent with the in situ

hybridization results in previous reports (Fig. 1A–H) [8,23].

Dact2 expression correlates with Pitx2Since Dact2 expression was observed in the dental epithelium,

we asked whether it correlates with the expression of Pitx2. Pitx2 is

one of the earliest transcription factors to initiate tooth formation,

and strongly interacts with b-catenin to synergistically activate

Wnt downstream genes [6]. Epithelial specific Pitx2 expression

was observed at E14.5 using the Pitx2cre/+Rosa26+/2mouse (Fig. 1I

and Fig. S2), and was previously shown by IHC [30]. These data

demonstrate that Pitx2 and Dact2 are co-expressed in the dental

epithelium during development. We next asked if Dact2 was part

of the Wnt/Pitx2 transcriptional activator mechanism.

Figure 9. Dact2 down-regulates Wnt responsive proliferation markers. (A) MEF cells from Dact22/2, Dact2+/2 and Dact2+/+ embryos werelysed and analyzed by Western blots. GAPDH was probed as loading controls. Protein band intensities were quantified and shown as relative value6SEM. (B) mRNAs extracted from MEF cells were subjected to RT-PCRs and real-time PCRs. Specific primers for proliferation markers Ccnd1, Ccnd2 andc-Myc were used in the real-time PCRs to evaluate the relative expression level of these proliferation markers. All real-time PCRs were performed intriplicates and repeated five times.doi:10.1371/journal.pone.0054868.g009

Figure 10. Dact2 represses cell proliferation. (A) 96-hour cell proliferation assays were performed with Dact22/2, Dact2+/2 and Dact2+/+ MEFcells at passage 3. All cell counting were performed in triplicate. (B) Microscopic photos of seeded MEF cells at the beginning and end of theproliferation assay.doi:10.1371/journal.pone.0054868.g010



PITX2 activates Dact2 expressionWe analyzed the sequence of the 59 flanking region of the Dact2

gene and found several potential Pitx2 binding sites. After an

evolutional conservation screening a putative binding site at -

6142 bp was found with a high degree of conservation among

mouse, rat, human and chimp (Fig. 2A, C). Chromatin

immunoprecipitation (ChIP) assays performed in LS-8 cells

demonstrate endogenous Pitx2 binding to this site on the Dact2

promoter (Fig. 2B). A set of primers flanking this Pitx2 binding site

(GGATAA) were able to amplify the Dact2 promoter from

chromatin input (Fig. 2B, lane 5), as well as from the Pitx2

immunoprecipitated chromatin (lane 4), demonstrating Pitx2

specifically binds to the element in the Dact2 promoter. A PCR

with DNA pulled down by normal IgG was examined as a negative

control (Fig. 2B, lane 3). Since Pitx2 does not regulate Msx2,

a negative control experiment was done in parallel using the same

ChIP DNA pulled down by Pitx2 antibody and control IgG to

amplifyMsx2 promoter region with specificMsx2 primers. (Fig. 2B,

lane 8). In addition, we performed another control experiment by

testing a Dact2 promoter fragment containing a putative binding

site (23753 to 23517 bp) with no significant conservation

(Fig. S3A). The result shows no enrichment in Pitx2 antibody

pull down DNA (Fig. S3B).

To verify whether this binding is functional, we performed

transient co-transfection in cells with PITX2 expression and

a luciferase expression plasmid driven by the 10 kb Dact2

promoter. Cells transfected with PITX2 activated the Dact2

promoter about 8-fold (Fig. 3A). A 66 bp DNA segment of Dact2

promoter containing the PITX2 binding site in Fig. 2A at (26172

Figure 11. b-catenin cellular localization is changed in the dental epithelium of Dact2 null mice. (A and E) E18.5 WT and Dact22/2 lowerincisors were examined by immunohistochemistry for b-catenin expression. Boxed region were examined under higher magnification. (B and F)Detailed views of the labial dental epithelium were shown. b-catenin was labeled with FITC. (C and G) Nuclei were stained with DAPI. (D and H)Merged signals of FITC and DAPI are shown. Arrowheads indicate the differentially localized b-catenin. MES, mesenchyme; OD, odontoblasts; AB,ameloblast; SI, stratum intermedium.doi:10.1371/journal.pone.0054868.g011

Figure 12. Model for the mechanism of Dact2. Dact2 is a direct downstream target gene of Pitx2 and Wnt signaling. Dact2 negatively feedsback and represses the transcriptional activity of Pitx2, and in turn inhibits Wnt/b-catenin signaling responsive proliferation. Dact2 also inhibits Wntsignaling responsive cell proliferation.doi:10.1371/journal.pone.0054868.g012



to 26106 bp) was cloned into TK-Luc reporter in tandem. A

similar reporter was constructed with the same tandem flanking

promoter sequence, except the binding motif GGATTA (26142

to 26136) in this reporter was mutated into scrambled motif

AGTTCG. Luciferase assays in Fig. 3B conducted on CHO cells

transfected with PITX2A and each of these two reporters showed

a loss of PITX2 activation when the binding motif was mutated

(Fig. 3B).

Furthermore, endogenous Dact2 expression was increased in

PITX2C transgenic mouse embryonic fibroblast (MEF) cells

compared to wild type MEF cells (Fig. 3C). Furthermore, Dact2

expression was very low in Pitx2 knockout MEF cells. These data

strongly suggest that endogenous Pitx2 activates Dact2 expres-

sion.

Dact2 represses PITX2 transcriptional activityTo understand the function of Dact2, cell transfections were

performed with Dact2 and PITX2 over expression plasmids and

luciferase reporter constructs under the control of Dlx2 and

amelogenin promoters. Dlx2 is an ameloblast differentiation

marker under Pitx2 regulation in the transcriptional hierarchy of

tooth development [3,31]. Amelogenin (Amelx) is a structural

protein that contributes to the enamel formation during the late

stage of tooth development, which is also under transcriptional

control of Pitx2. The luciferase reporters driven by Amelx and

Dlx2 promoters were analyzed for Dact2 function. PITX2A

activates the Amelx promoter at ,22-fold and Dact2 alone does

not activate the Amelx promoter in transfected cells (Fig. 4A).

However, Dact2 represses PITX2 activation of the Amelx

promoter, from 22-fold to 14-fold activation (Fig. 4A).

Because Dact2 is involved in Wnt/b-catenin signaling we asked

if Dact2 repression of PITX2 transcriptional activity was

modulated by b-catenin. PITX2 and b-catenin interact to increase

the activity of PITX2 and co-expression of both activate the Dlx2

promoter at 30-fold whereas co-expression of Dact2 and b-catenindid not activate the Dlx2 promoter in LS-8 cells (Fig. 4B). The

Dact2 expression plasmid was titrated against constant amounts of

PITX2 and b-catenin plasmids (2.5 mg) and the Dlx2 reporter

(5 mg). As the Dact2 plasmid concentration was increased from

0.5 mg, 1 mg, 2 mg, 4 mg and 8 mg, this correlated with increased

repression of PITX2 transcriptional activity in the presence of b-catenin (Fig. 4B). Dose dependent inhibitory effect of Dact2 also

exists when b-catenin is not ectopically expressed. Thus, Dact2

inhibition of PITX2 is not b-catenin dependent and is not affected

by the interaction between b-catenin and PITX2. Dact2 does not

repress Dlx2 activation of the Dlx2 promoter indicating that the

repression by Dact2 is specific to PITX2 (Fig. 4C).

To rule out the possibility that PITX2 was degraded after over

expression of Dact2, Western blots were performed using PITX2A

and Dact2 co-transfected LS-8 cells. Transfected PITX2A levels

remained constant with different amounts of transfected Dact2

(transfected PITX2 was observed using the Myc antibody, top

blot, Fig. 4D). b-catenin over expression is shown by Western blot

(Fig. 4D).

Dact2 is a potent modulator of Wnt/b-catenin signalingPitx2 interacts with b-catenin and Lef-l independently and

synergistically activates the target genes of Wnt/b-cateninsignaling by recruiting b-catenin and Lef-l to the same transcrip-

tional activation complex [5,6]. We employed the Topflash

reporter plasmid, which is a widely used indicator of Wnt/b-catenin signal transduction to determine the role of Dact2 in

regulating Wnt/b-catenin activation of transcription. The Top-

flash reporter contains the luciferase gene driven by multiple

TCF/LEF binding sites and the Fopflash plasmid contains point

mutations in the TCF/LEF binding sites, which abolish binding of

Lef-1 and was used as a negative control. Transfected Lef-1

(2.5 mg) activated the Topflash reporter (5 mg) by about 8-fold, andtransfected Dact2 (2.5 mg) strongly repressed this activation (Fig. 5).

Co-transfection of PITX2A and Lef-1 activated Topflash at 90-

fold and addition of Dact2 repressed this activation to ,60-fold

(Fig. 5). Dact2 expression repressed the PITX2 and Lef-1

synergistic activation of Topflash by 30%. These results indicate

that Dact2 represses the activation of tooth development factors

and the Wnt/b-catenin pathway in general by interfering with

PITX2 and Lef-1 transcriptional activity.

This repression by Dact2 can be rescued in a dose dependent

manner by introducing Dact2 shRNA (Fig. S4A). This result

verifies that repression of Topflash is specificity due to Dact2

function. We noticed the mild activation on Fopflash by over-

expressing Dact2. But this activation cannot be reversed by

introducing Dact2 shRNA (Fig. S4B).

Dact2 is both cytoplasmic and nuclear localized and co-localizes with Pitx2 in the nucleusThe Dact1 protein shuttles between the nucleus and cytoplasm

[32]. Because Dact2 and Dact1 proteins have high homology,

Dact2 may also have this property. We performed endogenous

immunofluorescence staining on LS-8 cells. Dact2 labeled with

FITC appears in both nuclear and cytoplasm compartments in

discrete loci (Fig. 6A–F). Evidence from Xenopus showed xDact

proteins are present in both cytoplasm and nuclear compartments

[7]. An IgG mock control staining was used in parallel to

demonstrate the specificity of Dact2 staining (Fig. 6G–I). LS-8 cells

transfected with Dact2 shRNA were also stained for Dact2

protein. Compared to non-transfected LS-8 cells (Fig. S5A) and

LS-8 cells transfected with scrambled shRNA (NC shRNA)

(Fig. S5B), the overall level of Dact2 expression was significantly

reduced by Dact2 shRNA (Fig. S5C), demonstrating the specificity

of Dact2 staining.

LS-8 cells express both Dact2 and Pitx2 and we used LS-8 cells

to conduct endogenous immunoprecipitation assays. We were able

to successfully pull down Dact2 proteins in the whole cell lysate by

using a PITX2 antibody, compared to the IgG mock negative

control (Fig. 7A).

A GST-pull down assay was used to confirm the PITX2-Dact2

interaction. Dact2 protein and immobilized GST-PITX2A fusion

proteins were expressed in bacteria purified and used in the pull-

down assays. Schematics showed the gene structures of PITX2A

truncations (Fig. 7B). A coomassie blue staining of the purified

GST-PITX2A proteins is shown (bands with the correct sizes

marked by asterisk) (Fig. 7C). Dact2 bound to immobilized GST-

PITX2-Full length, GST-PITX2-homeodomain, GST-PITX2-

ND38 but not GST-PITX2- C173. Protein incubations without

Dact2 were done as negative controls (Fig. 7D). This pull-down

result suggests that Dact2 binds PITX2A through the home-

odomain. Collectively, the above evidence demonstrates that

Dact2 and Pitx2 co-localize in the cell, and physically interact

under physiological conditions and in vitro. Pitx2, Lef-1 and b-catenin are associated as a complex when activating downstream

gene expression [6]. A recent study employed IP assays to prove

that Dact2 protein interacts with b-catenin and Lef-1 [22]. These

data demonstrate that Dact2 is a part of the Pitx2- Lef-1- b-catenin complex and that Dact2 represses PITX2 transcriptional

activity through a direct physical interaction.



Dact2 knock down increases endogenous geneexpressionTo further investigate the effect of Dact2 on repressing the

transcriptional hierarchy during tooth development, we generated

shRNA expression plasmids to specifically knock down endoge-

nous Dact2 in dental epithelial cells and evaluate gene expression.

The shRNA expression plasmids were transfected in LS-8 cells

and Dact2 protein detected by Western blot. A decreased level of

endogenous Dact2 was seen compared to the mock shRNA

transfected cells (Fig. 8A). As we expected, higher Dlx2 and Amelx

mRNA levels were observed with decreased Dact2 (Fig. 8B). As

a control the shRNA to Dact2 inhibited Dact2 expression

approximately 60% compared to controls (Fig. 8B). The 20%

decrease in gene regulation seen in Dlx2 and Amelx could

potentially be higher if Dact2 was completely absence. These

data suggest that Dact2 acts as a differentiation repressor in tooth

epithelia by regulating Dlx2 and Amelx expression through a Wnt/

b-catenin/Pitx2 pathway.

Dact2 represses cell proliferationWe analyzed the Dact2 null mice and only subtle phenotypes

were observed, which was consistent with a previous study [13].

We isolated MEF cells from E13.5 littermate embryos with

genotypes of Dact22/2, Dact2+/2 and wild type. Dact2 protein

was detected by Western blot in wild type MEFs and both the

Dact2+/2 and Dact22/2 isolated MEFs showed reduced or

undetectable Dact2 expression, respectively (Fig. 9A). Cyclin-

D1 (Ccnd1), Cyclin-D2 (Ccnd2) and c-Myc are direct down-

stream target genes of the Wnt/b-catenin pathway [33,34,35,36].

We evaluated these genes in MEFs by real-time PCR, and their

mRNA levels were significantly down regulated, with the

exception of c-Myc (Fig. 9B). As shown before, Cyclin-D1 and

Cyclin-D2 were identified as downstream genes of Pitx2 [36].

Thus, activation of cyclin-D1 and cyclin-D2 by Pitx2 were

subject to the inhibition by Dact2.

A series of cell proliferation assays were performed and the

proliferation rates of MEF cells were negatively correlated with

Dact2 expression levels. The deletion of Dact2 in MEF cells

significantly increased the proliferation rates of these cells

compared to wild type MEF cells (Fig. 10A). The cells plated on

culture dishes and grown for 1 and 5 days are shown (Fig. 10B).

These data indicated that Dact2 serves as a repressor of cell

proliferation.

Dact2 regulates b-catenin localization in the dentalepitheliumAnalyses of b-catenin localization in E18.5 wild type and

Dact22/2 tooth germs shows b-catenin expression throughout the

lower incisor dental epithelium from the cervical loops (Cl) (stem

cell niche) to the differentiated ameloblast (Am) cells at the apical

tip of the growing incisor (Fig. 11A, E). Interestingly, b-cateninnuclear localization is reduced in the Dact2 null differentiated

ameloblast (Am) cells (Fig. 11F) compared to wild type (Fig. 11B).

b-catenin is redistributed to the apical and basal regions of the

polarized ameloblasts cells deficient in Dact2. b-catenin is

concentrated at the apical and basal ends of the polarized

ameloblasts and increased in the stratum intermedium (SI) in the

Dact2 null E18.5 incisors (Fig. 11F). These data suggest that Dact2

regulates b-catenin cytoplasmic and nuclear distribution in

differentiated ameloblast cells. Interestingly, the levels of b-cateninare unchanged in the cervical loops of the Dact2 null mice

compared to wild type embryos (data not shown).

Discussion

The Dact proteins appear to stabilize b-catenin through

unknown mechanisms and can act as inhibitors or activators of

Wnt/b-catenin signaling [7,37,38]. In Zebrafish Dact2 (Dpr2) is

expressed on the dorsal side of the embryo and is required for

morphogenetic movements during gastrulation [10,11]. Dact2

(Dpr2) expression in Zebrafish is regulated by b-catenin signaling

and inhibits Nodal signaling during morphogenesis [10,11].

Xenopus Dpr binds to Dsh and stabilizes the b-catenin degrada-

tion pathway, which results in the degradation of soluble b-catenin. The loss of soluble b-catenin inhibits the activation of

downstream b-catenin dependent target genes [7]. The inhibition

of Dpr activates b-catenin responsive genes [7]. Xenopus Dpr

phosphorylation promotes Wnt/b-catenin signaling activity and

the unphosphorylated form inhibits Wnt/b-catenin activity [39].

Thus, phosphorylation of Dact proteins regulates their activity

and Wnt/b-catenin signaling. Furthermore, mammalian Dact1

inhibits the binding of Lef-1 with b-catenin and promotes the

interaction of Lef-1 with histone deacetylase (HDAC1) a co-

repressor [9,38].

Dact2 null mice have been previously reported and similar to

our analyses the embryos developed normally and grew to

adulthood without obvious phenotypic defects [13]. Dact2 was

shown to inhibit TGFb signaling in both mice and zebrafish

[13,40]. The Dact2 null mice revealed a specific effect in the

epidermal keratinocytes and a role in wound healing [13]. Dact2

appears to inhibit re-epithelialization by modulating TGFbsignaling [13]. Our study provides new mechanisms for Dact2

through its interaction with the Pitx2 transcription factor.

Dact2 expression and regulation by Pitx2Dact2 expression has been shown during tooth development and

Dact2 transcripts are restricted to the dental epithelium [8,23].

Dact2 expression was observed throughout tooth development in

the dental epithelium from E11.5 to P2. Dact2 expression was

detected in cells of the epithelial enamel organ including the

stellate reticulum, stratum intermedium and cervical loop (stem

cell niche) as well as the inner and outer dental epithelium [23].

Interestingly, Dact2 transcripts are downregulated in differentiated

ameloblasts and completely lost by P8 in the tooth germ [23].

However, the mechanism of Dact2 during tooth development was

not addressed and in this report we reveal new molecular

mechanisms for Dact2 during tooth morphogenesis.

The transcriptional regulation of Dact2 was reported to be

through a Wnt/b-catenin pathway but the direct activation was

unknown. We demonstrate that Pitx2 directly regulates endoge-

nous Dact2 expression. Pitx2 interacts with many transcription

factors to regulate gene expression [3,5]. Dact2 represses Pitx2

transcriptional activation of genes involved in both early (Dlx2 and

FoxJ1) and late (amelogenin) tooth development. We show that

this repression is independent of the interaction of Pitx2 with b-catenin. Thus, Dact2 expression is activated by Pitx2 and feeds

back to repress Pitx2 transcriptional activity. It was previously

shown that Dact2 inhibits Lef-1 interaction with b-catenin,however, Dact2 does not appear to inhibit the interaction of

Pitx2 with b-catenin or Lef-1, but modulates their synergistic

transcriptional activities.

Dact2 interacts with Pitx2Dact2 is both nuclear and cytoplasm localized in the cell and

colocalizes with Pitx2 in the nucleus. Dact2 binds to Pitx2

directly and knockdown of Dact2 expression results in an

increase in Pitx2 target gene expression. Our data demonstrate



that Dact2 regulates gene expression during tooth development

by a direct interaction with Pitx2. This regulation of gene

expression appears to be linked with Wnt/b-catenin signaling

through b-catenin interactions with Lef-1 and Pitx2. From our

studies and previous reports it is clear that Dact2 is interacting

directly with transcription factors as well as regulating the

function of soluble b-catenin in the cell.

Dact2 regulates cell proliferation and b-cateninlocalizationWe demonstrate that Dact2 represses cell proliferation and

these data are similar to the report of decreased Dact2 expression

causing a re-epithelialization during wound healing [13]. These

cell processes are linked to b-catenin and cyclin D1 and D2

expression and we show that Dact2 represses both cyclin D1 and

D2. Analyses of b-catenin expression and cellular localization

during lower incisor development revealed a redistribution of b-catenin in Dact2 null differentiated ameloblast cells. In the

differentiated ameloblast cells Dact2 allows for b-catenin accu-

mulation in the nuclei and membrane components. Without

Dact2, b-catenin is localized to the apical and basal ends of the

ameloblasts as well as the stratum intermedium. Dact2 appears to

be required for the nuclear localization of b-catenin in these

differentiated cells to allow for its interaction with Pitx2 and Lef-1

transcription factors. This would be required to activate gene

expression during late tooth morphogenesis.

The model we proposed contains a negative auto-regulation

loop, in which Dact2 represses the activation of its own promoter

through inhibiting Pitx2 transcriptional activity. Since both Pitx2

and Dact2 are highly conserved between mouse and zebrafish, this

mechanism provides an explanation for the morpholino knock-

down experiments conducted in zebrafish resulting a possible

negative auto-regulation of zebrafish Dact2 [11].

It was well established that excessive Wnt signaling leads to

supernumery teeth formation, while insufficient Wnt signaling

leads to arrest of early tooth development [20,41,42,43,44].

Without the inhibition of Dact2 on Wnt/b-catenin signaling in

Dact22/2 mouse, a supernumery teeth phenotype was expected.

Although consistent with the previous study [13], it is surprising

that Dact22/2 mice don’t exhibit any significant phenotype in the

craniofacial region. This may be due to the functional redundancy

within Dact paralogs, especially when Dact1 and Dact2 are both

highly expressed in the dental epithelium. Although Dact1 and

Dact2 both are able to inhibit Wnt/b-catenin signaling, the direct

targets of inhibitor interaction are divergent. Dvl proteins are

targeted by Dact1 and reside in the Wnt/b-catenin pathway at

a higher hierarchy, which means the regulation of Wnt target gene

expression is in a macro scale. However, Pitx2 is targeted by Dact2

and acts as an effector downstream of the Wnt/b-catenin pathway,

which means Dact2 regulates a narrower spectrum of Wnt target

genes in a more precise manner (Fig. 12). These data indicate

Dact2 plays a role in Wnt signaling regulation as a ‘‘fine tune’’

mechanism, while Dact1 serves an ‘‘on and off’’ switch. This is

a possible reason for the lack of a severe developmental phenotype

in Dact22/2 mice.

Supporting Information

Figure S1 Dact2 expressed in dental and oral epithelia.(A) Microarray analyses of epithelial and mesenchyme compart-

ments of P1 mouse incisors. Shown is a heat map of mRNA

expression. Dact2 gene is highly expressed in the tooth epithelium.

Known epithelial and mesenchymal markers are shown in the

bottom as controls. (B) Western blots showed that endogenous

Dact2 protein highly expresses in the LS-8 cells, which is an oral

epithelial cell line. In contrast, no detectable expression was seen

in the MDPC cells, an odontoblast-like cell line. (C). Real-time

PCRs were performed with LS-8 cells and MDPC cells to show

the relative expression of three Dact family genes. Expression levels

of Dact genes were normalized to b-actin across two cell lines. All

real-time PCRs were performed in triplicates and repeated at five

times.

(TIF)

Figure S2 Dact2 expression pattern overlaps with Pitx2during tooth development. (A) LacZ staining with eosin

counter staining on E14.5 Pitx2 cre/+ Rosa26+/2 mice lower incisor

germ. (B) Immunohistochemistry showed endogenous Dact2

protein stained by FITC conjugated antibody in E14.5 lower

incisor germ. Nuclei were stained by DAPI. White dotted lines

indicate the mesenchyme-epithelium boundaries of incisor germs.

Scale bar represents 100 mm.

(TIF)

Figure S3 Nonconserved Pitx2 binding motif in theDact2 promoter does not bind Pitx2. (A) Schematic of the

location of the nonconserved binding site on Dact2 10 kb promoter

at 23719 bp indicated by a white arrowhead. The location of the

sense primer (23753 bp) and the antisense primer (23517 bp) are

shown for amplification of the immunoprecipitated chromatin. (B)DNA from endogenous ChIP assay performed in Figure 2 was

used to evaluate the enrichment of this nonconserved binding

motif. Lane 5 contains the PCR marker. Lane 1 shows the Dact2

primers-only control. Lane 2 is the amplified fragment from

immunoprecipitation using normal rabbit immunoglobulin G.

Lane 3 is Pitx2 antibody immunoprecipitated chromatin amplified

using the specific Dact2 promoter primers. Lane 4 is the chromatin

input amplified using the Dact2 primers. Missing band in lane 3

indicate this putative binding site is not functional. All PCR

products were sequenced to confirm their identity.

(TIF)

Figure S4 Dact2 shRNA rescues Dact2 inhibition of theTOPFlash reporter. (A) Combinations of CMV-Lef1, CMV-

PITX2A, CMV-Dact2 and Dact2 shRNA were co-transfected in

CHO cells with TOPflash reporter. ++ indicate double dosage of

transfected Dact2 shRNA plasmid. (B) FOPflash reporter were

transfected instead of TOPflash with combinations of CMV-Lef1,

CMV-Dact2 and Dact2 shRNA. No shRNA rescuing effect was

seen in the results, indicating FOPflash activation was not specific

due to Dact2 overexpression. All luciferase activities are shown as

mean-fold activation compared with the reporter plasmid co-

transfected with empty CMV expression plasmid (6 SEM from

five independent experiments).

(TIF)

Figure S5 shRNA knocks down Dact2 protein in LS-8cells. (A) Dact2 protein was probed by Dact2 primary antibody

and labeled with FITC in non-transfected LS-8 cells. (B) Similar

level of Dact2 protein staining was seen in NC-shRNA transfected

LS-8 cells. (C) Dact2 protein staining was significantly lower in

Dact2 shRNA transfected LS-8 cells. Results support efficiency of

Dact2 shRNA, as well as the specificity of Dact2 antibody in

immunocytostaining experiments shown in Fig. 1 and Fig. 6. All

cells were counter staining with DAPI to show nuclei. Scale bars

represent 50 mm.

(TIF)



Acknowledgments

We thank the Texas Institute for Genomic Medicine and the Texas A&M

Health Science Center for the Dact2 null mice, Dr. William Shalot for

technical advice and members of the Amendt and Rick Finnell laboratories

for helpful discussions. We thank Shankar R. Venugopalan, Myriam

Moreno and Ndidi Uzor for technical assistance.

Author Contributions

Conceived and designed the experiments: XL BAA. Performed the

experiments: XL SF JW HC. Analyzed the data: XL BAA. Contributed

reagents/materials/analysis tools: XL SF JW HC BAA. Wrote the paper:

XL BAA.

References

1. Pispa J, Thesleff I (2003) Mechanisms of ectodermal organogenesis. Dev Biol

262: 195–205.

2. Tucker A, Sharpe P (2004) The cutting-edge of mammalian development; how

the embryo makes teeth. Nat Rev Genet 5: 499–508.

3. Venugopalan SR, Li X, Amen MA, Florez S, Gutierrez D, et al. (2011)

Hierarchical interactions of homeodomain and forkhead transcription factors in

regulating odontogenic gene expression. J Biol Chem 286: 21372–21383.

4. Green PD, Hjalt TA, Kirk DE, Sutherland LB, Thomas BL, et al. (2001)

Antagonistic Regulation of Dlx2 Expression by PITX2 and Msx2: Implications

for Tooth Development. Gene Expr 9: 265–281.

5. Vadlamudi U, Espinoza HM, Ganga M, Martin DM, Liu X, et al. (2005)

PITX2, b-catenin, and LEF-1 Interact to Synergistically Regulate the LEF-1

promoter. J Cell Sci 118: 1129–1137.

6. Amen M, Liu X, Vadlamudi U, Elizondo G, Diamond E, et al. (2007) PITX2

and b-catenin Interactions Regulate Lef-1 Isoform Expression. Mol Cell Biol 27:

7560–7573.

7. Cheyette BNR, Waxman JS, Miller JR, Takemaru K-I, Sheldahl LC, et al.

(2002) Dapper, a Dishevelled-Associated Antagonist of beta-Catenin and JNK

Signaling, Is Required ofr Notochord Formation. Dev Cell 2: 449–461.

8. Fisher DA, Kivimae S, Hoshino J, Suriben R, Martin P-M, et al. (2006) Three

Dact Gene Family members Are Expressed During Embryonic Development

and in the Adult Brains of Mice. Dev Dyn 235: 2620–2630.

9. Zhang L, Gao X, Wen J, Ning Y, Chen Y-G (2006) Dapper 1 antagonizes Wnt

signaling by promoting dishevelled degradation. J Biol Chem 281: 8607–8612.

10. Waxman JS (2004) Zebrafish Dapper1 and Dapper2 play distinct roles in Wnt-

mediated developmental processes. Development. 5909–5921.

11. Zhang L (2004) Zebrafish Dpr2 Inhibits Mesoderm Induction by Promoting

Degradation of Nodal Receptors. Science 306: 114–117.

12. Suriben R, Kivimae S, Fisher DAC, Moon RT, Cheyette BNR (2009) Posterior

malformations in Dact1 mutant mice arise through misregulated Vangl2 at the

primitive streak. Nat Genet 41: 977–985.

13. Meng F, Cheng X, Yang L, Hou N, Yang X, et al. (2008) Accelerated re-

epithelialization in Dpr2-deficient mice is associated with enhanced response to

TGFb signaling. J Cell Sci 121: 2904–2912.

14. Lee W-C, Hough MT, Liu W, Ekiert R, Lindstrom NO, et al. (2010) Dact2 is

expressed in the developing ureteric bud/collecting duct system of the kidney

and controls morphogenetic behavior of collecting duct cells. Am J Physiol Renal

Physiol 299: F740–751.

15. Cadigan KM, Nusse R (1997) Wnt signaling: a common theme in animal

development. Genes Dev 11: 3286–3305.

16. Nelson WJ (2004) Convergence of Wnt, b-Catenin, and Cadherin Pathways.

Science 303: 1483–1487.

17. Wehrli M, Dougan ST, Caldwell K, O’Keefe L, Schwartz S, et al. (2000) arrow

encodes an LDL-receptor-related protein essential for Wingless signalling.

Nature 407: 527–530.

18. Amendt BA, Sutherland LB, Russo AF (1999) Multifunctional Role of the Pitx2

Homeodomain Protein C-Terminal Tail. Mol Cel Biol 19: 7001–7010.

19. Logan CY, Nusse R (2004) The Wnt signaling pathway in development and

disease. Annu Rev Cell Dev Biol 20: 781–810.

20. Liu F, Chu EY, Watt B, Zhang Y, Gallant NM, et al. (2008) Wnt/beta-catenin

signaling directs multiple stages of tooth morphogenesis. Dev Biol 313: 210–224.

21. Chen J, Lan Y, Baek J-A, Gao Y, Jiang R (2009) Wnt/beta-catenin signaling

plays an essential role in activation of odontogenic mesenchyme during early

tooth development. Dev Biol 334: 174–185.

22. Kivimae S, Yang XY, Cheyette BNR (2011) All Dact (Dapper/Frodo) scaffold

proteins dimerize and exhibit conserved interactions with Vangl, Dvl, and

serine/threonine kinases. BMC Biochemistry 12: 33.

23. Kettunen P, Kivimae S, Keshari P, Klein OD, Cheyette BNR, et al. (2010)

Dact1–3 mRNAs exhibit distinct expression domains during tooth development.Gene Expr Patterns 10: 140–143.

24. Amendt BA, Sutherland LB, Semina E, Russo AF (1998) The Molecular Basis ofRieger Syndrome: Analysis of Pitx2 Homeodomain Protein Activities. J Biol

Chem 273: 20066–20072.

25. Cox CJ, Espinoza HM, McWilliams B, Chappell K, Morton L, et al. (2002)Differential Regulation of Gene Expression by PITX2 Isoforms. J Biol Chem

277: 25001–25010.26. Chen LS, Couwenhoven RI, Hsu D, Luo W, Snead ML (1992) Maintenance of

Amelogenin Gene Expression by Transformed Epithelial Cells of Mouse Enamel

Organ. Archs oral Biol 37: 771–778.27. Diamond E, Amen M, Hu Q, Espinoza HM, Amendt BA (2006) Functional

Interactions Between Dlx2 and Lymphoid Enhancer Factor Regulate Msx2.Nuc Acids Res 34: 5951–5965.

28. Ovcharenko I, Nobrega MA, Loots GG, Stubbs L (2004) ECR Browser: a tool

for visualizing and accessing data from comparisons of multiple vertebrategenomes. Nuc Acids Res 32: W280–286.

29. Zhang Z, Wlodarczyk BJ, Niederreither K, Venugopalan S, Florez S, et al.(2011) Fuz Regulates Craniofacial Development Through Tissue Specific

Responses to Signaling Factors. PLoS ONE 6: e24608.30. Hjalt TA, Semina EV, Amendt BA, Murray JC (2000) The Pitx2 Protein in

Mouse Development. Dev Dyn 218: 195–200.

31. Cao H, Wang J, Li X, Florez S, Huang Z, et al. (2010) MicroRNAs play a criticalrole in tooth development. J Dent Res 89: 779–784.

32. Gao X, Wen J, Zhang L, Li X, Ning Y, et al. (2008) Dapper1 Isa Nucleocytoplasmic Shuttling Protein That Negatively Modulates Wnt

Signaling in the Nucleus. J Biol Chem 283: 35679–35688.

33. He T-C, Sparks AB, Rago C, Hermeking H, Zawel L, et al. (1998) Identificationof c-MYC as a Target of the APC Pathway. Science 281: 1509–1512.

34. Shtutman M, Zhurinsky J, Simcha I, Albanese C, D’Amico M, et al. (1999) Thecyclin D1 gene is a target of the beta-catenin/LEF-1 pathway. Proc Natl Acad

Sci USA 96: 5522–5527.35. Tetsu O, McCormick F (1999) b-Catenin regulates expression of cyclin D1 in

colon carcinoma cells. Nature 398: 422–426.

36. Huang Y, Guigon CJ, Fan J, Cheng S-Y, Zhu G-Z (2010) Pituitary homeobox 2(PITX2) promotes thyroid carcinogenesis by activation of cyclin D2. Cell Cycle

9.37. Gloy J, Hikasa H, Sokol SY (2002) Frodo interacts with Dishevelled to transduce

Wnt signals. Nat Cell Biol 4: 351–357.

38. Hikasa H, Sokol SY (2004) The involvement of Frodo in TCF-dependentsignaling and neural tissue development. Development 131: 4725–4734.

39. Teran E, Branscomb AD, Seeling JM (2009) Dpr Acts as a molecular switch,inhibiting Wnt signaling when unphosphorylated, but promoting Wnt signaling

when phosphorylated by casein kinase Idelta/epsilon. PLoS ONE 4: e5522.40. Su Y, Zhang L, Gao X, Meng F, Wen J, et al. (2007) The evolutionally

conserved activity of Dapper2 in antagonizing TGF-beta signaling. FASEB J 21:

682–690.41. van Genderen C, Okamura RM, Farinas I, Quo R-G, Parslow TG, et al. (1994)

Development of several organs that require inductive epithelial-mesenchymalinteractions is impared in LEF-1-deficient mice. Genes Dev 8: 2691–2703.

42. Andl T, Reddy ST, Gaddapara T, Millar SE (2002) WNT signals are required

for the initiation of hair follicle development. Dev Cell 2: 643–653.43. Jarvinen E, Salazar-Ciudad I, Birchmeier W, Taketo MM, Jernvall J, et al.

(2006) Continuous tooth generation in mouse is induced by activated epithelialWnt/beta-catenin signaling. Proc Natl Acad Sci USA 103: 18627–18632.

44. Wang X-P, O’Connell DJ, Lund JJ, Saadi I, Kuraguchi M, et al. (2009) Apcinhibition of Wnt signaling regulates supernumerary tooth formation during

embryogenesis and throughout adulthood. Development 136: 1939–1949.



Documents

Dact2 Represses PITX2 Transcriptional Activation and Cell ... · Dact2 Represses PITX2 Transcriptional Activation and Cell Proliferation through Wnt/beta-Catenin Signaling during