Cytochrome P450 2C19 Polymorphisms and

Clopidogrel Management in Patients with

Coronary Artery Disease in Gaza Strip-Palestine

مرضي في Cytochrome P450 2C19لجيه ط المتعددةاالومب

فلسطيه -في قطبع غزة Clopidogrelالشراييه التبجيت المعبلجيه بعقبر

By

Ibrahim Raji Al-Astal

Supervised by

Prof.Dr. Maged M.Yassin Dr. Basim M. Ayesh

Professor of Physiology Associate professor of genetics

and molecular biology

A thesis submitted in partial fulfilment

of the requirements for the degree of

Master of Medical Technology

May / 2016

زةــغ – تــالميــــــت اإلســـــــــبمعـالج

والدراسبث العليبشئون البحث العلمي

ــــــلومــــــــــــــــــــــــــت العـــليــــــك

تــــــــــــــتحبليـــــــــــل طبيمبجستير

The Islamic University-Gaza

Research and Postgraduate Affairs

Faculty of Science

Master of Medical Technology

II

Abstract

Background: Platelets play a central role in the pathophysiology of the acute

coronary syndromes following percutaneous coronary intervention (PCI).

Clopidogrel is an oral thienopyridine derivative capable of inhibiting platelet

activation. Clopidogrel is a prodrug that is converted into an active drug by the

hepatic cytochrome CYP2C19. The CYP2C19*2 and the CYP2C19*3 polymorphic

alleles are considered to be important loss-of-function alleles resulting in diminished

response to Clopidogrel.

Objective: The aim of this study was to determine the allelic frequency of CYP2C19

wild type allele (CYP2C19*1) and its loss of function variants (alleles *2 and *3),

and their role in recurrence of cardiovascular disease in PCI patients receiving

Clopidogrel in Gaza strip.

Methods: This study is cross sectional study with convenience sample. Whole blood

samples were collected from 110 patients undergoing PCI under clopidogrel therapy.

The frequency of CYP2C19 alleles was determined by the polymerase chain reaction

with restriction fragment length polymorphism (PCR-RFLP).

Results: The frequency of CYP2C19*1, *2 and *3 alleles was 82.3%, 15.5% and

2.3% respectively. Genotyping analysis showed that, 67.3% were homozygotes for

CYP2C19*1, 27.3 % were *1/*2, 2.7% with *1/*3 genotype, 1.8% were *2/*3 and

0.9% were *2/*2. These frequencies were comparable to those of other Caucasian

populations. According to this study the poor metabolizers (PM) phenotype

frequency was 2.7 %, which is in the same range reported in Caucasians (2 to 5%)

and lower than Oriental populations 13-23%. A strong significant relation was found

between stent restenosis and carrying the variant allele CYP2C19*2 (P= 0.001). On

the other hand, there was no significant relation between stent restenosis and carrying

the variant allele CY2C19*3 (p = 0.324).

Conclusion: The CYP2C19*2 and CYP2C19*3 alleles genotyping should be

included in the workup of patient considered for Clopidogrel therapy to avoid in-

stent restenosis after PCI procedure.

Keywords: Clopidogrel; CYP2C19; Coronary artery disease; percutaneous coronary

intervention.

III

Abstract in Arabic

الممخص

المرضي لمتالزمة الشريان التاجي الحادة بعد عممية رأب الوعاء التطورالصفائح الدموية تمعب دورا رئيسا في مقدمة:

الي انزيم يحتاج Clopidogrel عقار الصفائح الدموية. نشاطعمي تثبيط Clopidogrelيعمل عقار (. PCIالتاجي )

CYP2C19 في الكبد. ومن بين االنماط األليمية اختالف نيوكموتيدة وحيدة لتنشيطوSNP) )لمجين CYP2C19 ،

.لفاعميتوالدواء فقداناحد اسباب CYP2C19*3)النمط الثالث )و ( (CYP2C19*2لمنمط الثاني تغير الشكل الجيني

في CYP2C19*3و CYP2C19*1 ،CYP2C19*2االنماط االليمية التالية معدل تكرارتحديد هدف الدراسة:

.PCIبعد عممية Clopidogrelقمب لممرضي المعالجين بواسطة لفي تجدد مشاكل ا SNPقطاع غزة وتحديد دور

ويعالجون بعقار PCI من المرضي المذين خضعوا لعممية 111عينات دم خام تم جمعيا من المواد المستخدمة:

clopidogrel طريقاستخدام ب وتم فحص االختالفات الجينية ليم PCR-RFLP (الحامض النووي إكثار جزء من

.)قاطعة متخصصة إنزيماتبواسطة قطعياالديؤكسي ريبوزي ومن ثم

كانت بالترتيب عمي النحو CYP2C19لمجين 3و 2، 1اظيرت الدراسة ان نسبة وجود الشكل الجيني رقم النتائج:

% من المرضي متماثل الزيجوت لمجين 3..3%(. واظير تحميل االنماط الجينية ان 2.3% و 11.1%، 32.3التالي)

% متغاير..2(، و (2*/1*% متغاير الزيجوت لمنمط الجيني االول مع الثاني 3..2(، و CYP2C19*1السميم )

(، 3*/2*% متخالف الزيجوت لمنمط الثاني مع الثالث)1.3(، و 3*/*1الزيجوت لمنمط الجيني االول مع الثالث )

(، ولم تظير الدراسة وجود نمط متماثل الزيجوت لمنمط الثالث 2*/2*% متماثل الزيجوت لمنمط الثاني )1.0و

و% وىذه النسب..2كانت (PM)في كفاءة االنزيم شديد (. وجد ان نسبة المرضي المذين يعانون من نقص3*/3*)

مشابية لمدراسات التي اجريت عمي العرق القوقازي. وقد وجدت عالقة ذات داللة احصائية بين الشكل الجيني

CYP2C19*2 و عممية اعادة تضيق الشريان (P= 0.001 وقد لوحظ عدم وجود عالقة ذات داللة احصائية )

CYP2C19*3 (p=0.324). بالنسبة لمشكل الجيني

في عممية متابعة يأخذ بعين االعتباريجب ان CYP2C19*3و CYP2C19*2 تحديد النماط االليمية الخالصة:

PCI.لتفادي حدوث تضيق في الشريان التاجي بعد عممية Clopidogrelالمرضي المذين سيتم اعطائيم عقار

غزة. امراض الشرايين التاجية، الجيني، ، النمطرأب الوعاء التاجي كممات مفتاحية:

IV

Dedication

I dedicate this work with my deep love to

My Parents

For their endless love, support, inspiration and continuous sacrifices

My Wife

Who has been a constant source of support and encouragement

My Lovely Kids

Tala, Ahmed, Mahmoud and ….

My Brothers and Sisters

For their encouragements

My Friends and Colleagues

V

Acknowledgements

There are a number of people to whom I express my Sincere gratitude without whom

this thesis might not have been structured, and to whom I am greatly thankful.

Dr. Basim Ayesh, the ideal thesis supervisor. His sage advice, insightful criticisms,

and patient encouragement aided the writing of this thesis in innumerable ways. I

thank Dr. Maged Yassin Whose steadfast support of this research was greatly needed

and deeply appreciated.

My deep and sincere appreciations to my colleagues in the laboratory of the

European Gaza Hospital for their support, generous assistance and valuable

comments.

To all my friends, thank you for the sense of belonging and fraternity that you

fostered.

My special deep and sincere gratitude to my parents, wife, brothers and sisters for

their encouragement, continuous support and help.

Finally, a hearty thanks to my family for their understanding, support, and sacrifice.

Without their guidance, help and patience, I would have never been able to

accomplish the work of this thesis.

VI

Table of Contents

Declaration .................................................................................................................... I

Abstract ........................................................................................................................ II

Abstract in Arabic ...................................................................................................... III

Dedication .................................................................................................................. IV

Acknowledgements ...................................................................................................... V

Table of Contents ....................................................................................................... VI

List of Tables ............................................................................................................. IX

List of Figuers .............................................................................................................. X

List of Abbrevation .................................................................................................... XI

Chapter (1): Introduction ......................................................................................... 1 1.1 Overview ............................................................................................................ 1

1.2 General objective ............................................................................................... 3

1.3 Specific objectives ............................................................................................. 3

1.4 Significance ....................................................................................................... 3

Chapter (2):Literturer Review ................................................................................. 4 2.1 Heart and coronary arteries ................................................................................ 4

2.2 Definition of coronary artery disease ................................................................ 5

2.3 Mortality rate of Cardiovascular diseases .......................................................... 5

2.4 Pathophysiology of coronary artery disease ...................................................... 6

2.5 Risk factor of coronary artery disease ............................................................... 7

2.6 Cytochrome P450 .............................................................................................. 7

2.6.1 Definition ........................................................................................................ 7

2.6.2 Nomenclature of CYP ..................................................................................... 7

2.6.3 Classification of CYP ..................................................................................... 7

2.6.4 Function of CYP ............................................................................................. 8

2.7 Cytochrome P450 2C19 ..................................................................................... 8

2.7.1 Definition and function ................................................................................... 8

2.7.2 CYP2C19 gene ............................................................................................... 8

2.7.3 Expression of CYP2C19 ................................................................................. 9

2.7.4 Polymorphism of CYP2C19 ........................................................................... 9

2.7.4.1 The CYP2C19*2 ........................................................................................ 10

2.7.4.2 The CYP2C19*3 ........................................................................................ 10

2.7.4.3 Other CYP2C19 variants that encode reduced or unknown enzymatic

activity ................................................................................................................ 10

2.7.4.4 CYP2C19 Variants that encode increased enzymatic activity................... 11

2.7.5 Impact of CYP2C19 (polymorphism) genotype on drug metabolism .......... 11

2.8 Management of coronary artery disease .......................................................... 12

2.8.1 Coronary revascularization ........................................................................... 12

2.8.1.1 Balloon angioplasty ................................................................................... 12

2.8.1.2 Percutaneous coronary intervention (PCI) ................................................. 13

2.8.2 Antiplatelet therapy ...................................................................................... 13

2.8.2.1 P2Y12 receptor antagonists ......................................................................... 14

2.9 Clopidogrel ...................................................................................................... 14

2.9.1 Definition and structure ................................................................................ 14

2.9.2 Pharmacokinetics of clopidogrel .................................................................. 15

2.9.3 Pharmacodynamic of clopidogrel ................................................................. 15

VII

2.10 Prevalence and relation of CYP2C19*2 and *3 alleles to the platelet

inhibition by clopidogrel .................................................................................... 17

Chapter (3): Materials and Methodes .................................................................... 21 3.1. Study design .................................................................................................... 21

3.2. Study population ............................................................................................. 21

3.3. Sample size ..................................................................................................... 21

3.4. Ethical consideration ...................................................................................... 21

3.5. Inclusion criteria ............................................................................................. 22

3.6. Exclusion criteria ............................................................................................ 22

3.7. Materials ......................................................................................................... 22

3.7.1. Instruments .................................................................................................. 22

3.7.2. List of reagents and chemicals ..................................................................... 23

3.7.3. Primers used in this study ............................................................................ 23

3.7.4. Disposables .................................................................................................. 24

3.8. Methods .......................................................................................................... 24

3.8.1. Data collection ............................................................................................. 24

3.8.2. Blood samples collection ............................................................................. 24

3.9. Molecular analysis .......................................................................................... 25

3.9.1. Extraction and purification of genomic DNA ............................................. 25

3.9.2. Primers reconstitution .................................................................................. 27

3.10. Detection of CYP2C19*2 and CYP2C19*3 polymorphisms by PCR-RFLP 27

3.10.1. Polymerase Chain Reaction (PCR) for CYP2C19*2 ................................. 27

3.10.2. Restriction fragment length polymorphism (RFLP) CYP2C19*2 PCR

product by Sma1 restriction enzyme .................................................................. 28

3.10.3. Polymerase chain reaction (PCR) for CYP2C19*3 ................................... 29

3.10.4. Restriction fragment length polymorphism (RFLP) of CYP2C19*3 PCR

product by BamH1 restriction enzyme ............................................................... 30

3.11. Interpretation of CYP2C19 alleles ................................................................ 30

3.12. Quality control .............................................................................................. 31

3.13. Statistical analysis ......................................................................................... 31

Chapter (4): Results ................................................................................................. 32 4.1. Characteristics of the study population: ......................................................... 32

4.1.1. Personal characteristics ................................................................................ 32

4.1.2 Clinical characteristics .................................................................................. 33

4.1.2.1 Cardiac and other chronic diseases ............................................................ 33

4.1.2.2. Complete blood count of the study population ......................................... 33

4.1.2.3 Angiographic outcomes ............................................................................. 33

4.2. PCR and RFLP results for CYP2C19 ............................................................. 34

4.2.1. CYP2C19*2 PCR product gel electrophoresis ............................................ 34

4.2.2. CYP2C19*2 restriction analysis gel electrophoresis .................................. 35

4.2.3. CYP2C19*3 PCR product gel electrophoresis ............................................ 35

4.2.4. CYP2C19*3 restriction analysis gel electrophoresis ................................... 36

4.3. The CYP2C19 Genotyping results ................................................................. 36

4.3.1. Genotyping frequency of CYP2C19*2 allele .............................................. 36

4.3.2. Genotyping frequency of CYP2C19*3 allele .............................................. 37

4.3.3. Overall genotype distribution of CYP2C19 ................................................ 37

4.3.4. Distribution of CYP2C19 genotypes frequency by gender .......................... 38

4.3.5 The CYP2C19 genotype and predicted phenotype ....................................... 39

VIII

4.4 Stent restenosis ................................................................................................ 39

4.4.1. Impact of CYP2C19 polymorphism on stent restenosis .............................. 40

4.4.1.1. Impact of CYP2C19*2 mutation on stent restenosis ................................ 40

4.4.1.2 Impact of CYP2C19*3 mutation on stent restenosis ................................. 40

4.4.2. Relationship between restenosis and hypertension ...................................... 41

4.4.3. Relation between restenosis and Diabetes mellitus ..................................... 41

4.4.4. Relation between restenosis and age ........................................................... 41

4.4.5. Relation between restenosis and gender ...................................................... 42

4.4.6 Relation between restenosis and body mass index (BMI) ............................ 42

4.4.7 Relation between restenosis and family history of CAD .............................. 43

4.4.8 Relation between restenosis and Segment of coronary legion ..................... 43

Chapter (5): Discussion ........................................................................................... 44 Discussion .............................................................................................................. 44

Chapter (6): Conclusions and Recommendations................................................. 49 6.1. Conclusions ..................................................................................................... 49

6.2. Recommendations ........................................................................................... 50

The References List ................................................................................................. 51

Annex (1): Approval of Helsinki committee .......................................................... 65

Annex (2): Approval of MOH for sample collection ............................................ 66

Annex (3): Data collection ....................................................................................... 67

IX

List of Tables

Table (2.1): Commonly CYP2C19 variant alleles and their effect on CYP2C19

protein. ................................................................................................................... 11

Table (3.1): List of laboratory instruments ............................................................... 22

Table (3.2): Lists the chemicals and reagents ........................................................... 23

Table (3.3): Nucleotide sequence of the PCR primers ............................................. 23

Table (3.4): List of disposables ................................................................................. 24

Table (3.5): Wizard genomic DNA purification kit solutions .................................. 26

Table (3.6): Materials that should be supplied by the user ....................................... 26

Table (3.7): PCR components for amplification of CYP2C19*2 ............................. 28

Table (3.8): Thermocycler program for PCR amplification of the CYP2C19*2 and

CYP2C19*3 ........................................................................................................... 28

Table (3.9): The enzymatic digestion components of amplified CYP2C19*2 ......... 29

Table (3.10): PCR components for amplification of CYP2C19*3 ........................... 29

Table (3.11): The enzymatic digestion components of amplified CYP2C19*3 ....... 30

Table (3.12): Interpretation of CYP2C19 alleles ...................................................... 30

Table (3.13): Predicted metabolism phenotypes for CYP2C19 based on example

genotypes................................................................................................................ 31

Table (4.1): Personal characteristics of the study population ................................... 32

Table (4.2): Comorbid chronic disease in the study population ............................... 33

Table (4.3): Complete blood count of the study population ..................................... 33

Table (4.4): Lesion location and type of instilled stent ............................................ 34

Table (4.5): Genotyping Frequency of CYP2C19*2 allele ...................................... 37

Table (4.6): Frequency of genotypes of CYP2C19*3 allele ..................................... 37

Table (4.7): Genotype distribution of CYP2C19 ...................................................... 38

Table (4.8): Distribution of CYP2C19 genotypes by gender ................................... 38

Table (4.9): Distribution of restenosis cases by the CYP2C19*2 allele genotype ... 40

Table (4.10): Distribution of restenosis cases according to CYP2C19*3 genotype . 41

Table (4.11): Distribution of stent restenosis patients by hypertension .................... 41

Table (4.12): Distribution of stent restenosis patients by diabetes mellitus ............. 41

Table (4.13): Distribution of stent restenosis patients by age ................................... 42

Table (4.14): Distribution of stent restenosis patients by gender ............................. 42

Table (4.15): Distribution of stent restenosis patients by BMI ................................. 42

Table (4.16): Distribution of stent restenosis patients by Family history of heart

disease .................................................................................................................... 43

Table (4.17): Relation of stent loci and in-stent restenosis ...................................... 43

X

List of figures

Figure (2.1): Coronary arteries of the heart. ............................................................... 4

Figure (2.2): Pathophysiology of coronary artery disease .......................................... 6

Figure (2.3): Cytogenetic location of CYP2C19 ........................................................ 8

Figure (2.4): Location of selected loss-of-function (*2-*8) and gain-of-function

(*17) variant alleles of CYP2C19 ............................................................................ 9

Figure (2.5): Chemical structure of clopidogrel ....................................................... 14

Figure (2.6): Pharmacokinetics of clopidogrel ......................................................... 15

Figure (2.7): Pharmacodynamic of clopidogrel ....................................................... 16

Figure (4.1): PCR products of CYP2C19*2&*3 ..................................................... 34

Figure (4.2): Restriction products for CYP2C19*2 by SmaI ................................... 35

Figure (4.3): Restriction products for CYP2C19*3 by BamH1 ............................... 36

Figure (4.4): CYP2C19 metabolizing status in the study population ....................... 39

Figure (4.5): distribution of patient according to restenosis ..................................... 39

Figure (4.6): Genotyping distribution of restenosis cases ........................................ 40

XI

List of Abbreviations

ADP The adenosine diphosphate

BMS Bare-Metal Stents

CABG Coronary Artery Bypass Graft

CAD Coronary Artery Disease

cAMP cyclic Adenosine Monophosphate

CAR Constitutive androstane receptor

cDNA Complementary DNA

COX-1 Acetylate Cyclooxygenase 1

CVD Cardiovascular Diseases

CYP Cytochrome P450

dbSNP The Single Nucleotide Polymorphism Database

DES Drug-Eluting Stents

EDTA Ethylenediaminetetraacetic acid

EGH European Gaza hospital

EM Extensive Drug Metabolizers

GATA4 Transcription factor GATA-4

GPIIb/IIIa Glycoprotein IIb/IIIa

GRα Human glucocorticoid receptor α

HNF3γ Hepatocyte nuclear factor 3-gamma

HNF4α Hepatic nuclear factors-4 alpha

IM Intermediate Metabolizers

LDL Low Density Lipoprotein

MARC Major adverse cardiac events

MOH Ministry Of Health –Palestine

PCI Percutaneous Coronary Intervention

PCR Polymerase Chain Reaction

PI3K Phosphatidylinositol 3-Kinase

PKB/Akt Serine-Threonine Protein Kinase B

PM Poor Metabolizers

PXR Pregnane X receptor

Rap1b Ras-related protein Rap-1b

RFLP Restriction Fragment Length Polymorphism

RPA Residual Platelet Aggregation

ST Stent Thrombosis

TAE Tris-acetate-EDTA

UM Ultrarapid Metabolizers

VASP Vasodilator-Stimulated Phosphoprotein

Chapter One

Introduction

1

Chapter 1

Introduction

1.1 Overview

Cardiovascular diseases (CVD) or heart diseases are a class of diseases that involve

the heart or blood vessels. Diseases under the heart disease umbrella include blood

vessel diseases, such as coronary artery disease (CAD), heart rhythm problems

(arrhythmias), heart infections and heart defects including congenital heart defects

(Gaziano, 2005; CDC, 2009 and Mozaffarian et al., 2015). Heart failure is a common

clinical syndrome that represents the final stage of a range of different heart diseases

(Anderson et al., 2007 and Ponikowski et al., 2014).

Coronary artery disease is a common form of CVD and it is the major source of

morbidity and mortality in the developing and developed countries (Walter, 2014). It

is responsible for an estimated 17.3 million deaths per year, a number that is

expected to grow to more than 23.6 million by 2030. (American heart association,

AHA, 2015). Coronary artery disease is caused by atherosclerosis which restricts

blood flow to the heart and when the blood flow is completely cut off, the result is

heart attack (CDC, 2009 and Sakakura, 2013). The pathogenesis of atherosclerosis

involves the processes of vascular injury, inflammation, degeneration and thrombosis

(Singh et al., 2006 and Weber and Noels, 2011). Percutaneous coronary intervention

(PCI) is a mainstay in the management of high-risk coronary artery disease and

requires anti-platelet therapy, depending on stent type and admission diagnosis (Zhou

et al., 2012 and Giustino et al., 2015).

Cytochrome P450 (CYP450) is the generic name given to a large family of enzymes

that metabolize most drugs and chemicals of toxicological importance. In humans,

there exist 18 mammalian CYP450 families, 44 subfamilies, and 57 putative

functional enzymes (Ingelman-Sundberg, 2005). The family members CYP1, CYP2,

and CYP3 of CYP450 represent the top candidate genes in pharmacokinetics (Yang

et al, 2010 and Knights et al., 2013). Four CYP2C genes have been identified in

humans: CYP2C8, CYP2C9, CYP2C18, and CYP2C19. CYP2C19 enzyme is one of

the hepatic cytochrome P450 enzymes that metabolizes many important clinical

2

drugs including antiulcer drug omeprazole, antiplatelet drug clopidogrel,

anticonvulsant mephenytoin bertilsson, antimalarial drug proguanilthe anxiolytic

drug diazepam, and certain antidepressants such as citalopram (Flachsbart et al.,

2011 and Lee, 2013).

There are 35 different variant alleles of CYP2C19 (OMIM, 2016). The CYP2C19*1

allele is the normal (wild-type) copy that has full enzymatic activity (Kubica et al.,

2011). The most common variant allele is named as CYP2C19*2 which result in

truncated, nonfunctional protein (Mega et al., 2009). Another common allele is

named as CYP2C19*3 which also creates a premature stop codon (Nakamoto et al.,

2007). Genetic polymorphisms of CYP2C19 are associated with impaired clopidogrel

metabolism in healthy and in patients (Sangkuhl et al., 2010).

Research on CYP2C19 enzyme among Gaza strip population is rare. Only one study

determined the frequencies of the major polymorphic CYP2C19 alleles (CYP2C19*2

and CYP2C19*3) and investigated association of their occurrence with childhood

hematological malignancies (Abu-Eid, 2006). No previous study linked CYP2C19

with the outcome of drug metabolism. The present study is the first to determine

cytochrome P450 2C19 polymorphism and to asses Clopidogrel management in

patients with CAD in Gaza Strip.

3

1.2 General objective

The general objective of the present study is to determine CYP2C19 polymorphism

and to asses clopidogrel management in patients with CAD in Gaza Strip.

1.3 Specific objectives

1. To determine the frequencies of the Cytochrome P450 2C19 wild type allele

(CYP2C19*1) and two polymorphic alleles (CYP2C19*2) and (CYP2C19*3)

in PCI patients.

2. To study the relevant clinical data of the PCI patients particularly data related

to their Clopidogrel treatment and any side effect or recurrence of

cardiovascular events.

3. To determine the importance of the loss of function alleles, if present, in

recurrence of cardiovascular events in PCI patients receiving Clopidogrel.

1.4 Significance

Cardiovascular disease is the first leading cause of death in Gaza strip and

PCI is commonly used in the management of CAD with anti-platelet therapy

clopidogrel.

CYP2C19 is responsible for Clopidogrel metabolic activation, and CYP2C19

loss-of function alleles appear to be associated with higher rates of recurrent

cardiovascular events in patients receiving clopidogrel.

The loss-of-function alleles are carried by different populations and

homozygotes, who are poor CYP2C19 metabolizers, make up 3% to 4% of

the population.

The present study is the first to assess the cytochrome P450 2C19

polymorphism and clopidogrel management in patients with CAD in Gaza

Strip, Palestine.

Chapter Two

Literature Review

4

Chapter 2

Literature Review

2.1 Heart and coronary arteries

The heart is a muscular (myocardium) organ that pumps blood throughout the blood

vessels to various parts of the body by repeated rhythmic contractions. The human

heart is located in the middle of the chest between the right and left lungs, and

slightly towards the left of the breastbone, anterior to the vertebral column and

posterior to the sternum and it is enclosed in a double-walled sac called the

pericardium (Starr et al., 2009). The heart has four chambers, two superior atria

(receiving chambers) and two inferior ventricles (discharging chambers).

Oxygenated blood returns from the lungs into the left atrium, which pumps it into the

left ventricle, whose subsequent strong contraction forces it out through the aorta

leading to the systemic circulation (Marieb, 2011). Coronary arteries arise from aorta

(Figure 2.1). The right coronary artery gives branches to the walls of the right atrium

and ventricle. The left coronary artery gives branches to supply the roots of the aorta

and pulmonary trunk and the walls of the left atrium and ventricle. The left coronary

artery bifurcates into the left anterior descending artery and the left circumflex artery.

Figure (2-1): Coronary arteries of the heart (Encyclopedia of science, 2016).

5

2.2 Definition of coronary artery disease

Coronary artery disease, also known as coronary heart disease (CHD), coronary

atherosclerosis and ischemic heart disease (IHD), which is a branch of CVD and a

common form of heart disease. Coronary artery disease is considered as an insidious

and dangerous disease in the world, and the major source of morbidity and mortality

in the developed world (Walter, 2014 and Rydén et al., 2013). It is caused by

atherosclerosis, an accumulation of fatty materials in the inner linings of arteries. The

resulting blockage restricts blood flow to the heart and when the blood flow is

completely cut off, the result is heart attack (CDC, 2009).

2.3 Mortality rate of cardiovascular diseases

According to World Health Organization fact sheet in 2015, CVD are the number

one cause of death globally, more people die annually from CVD than from any

other cause. An estimated 17.5 million people died from CVD in 2012, representing

31% of all global deaths. An estimated 7.4 million were due to CAD and 6.7 million

were due to stroke. Over three quarters of CVD deaths take place in low- and

middle-income countries. By 2030 about 23.6 million people will die from CVD,

mainly from CAD (Mozaffarian et al., 2015). Each year CVD causes over 2 million

deaths in the European Union (EU), representing 42% of all deaths in the EU (British

Heart Foundation, 2008). Cardiovascular disease accounted for 31% of all deaths in

Canada and CAD caused about half million deaths in USA (AHA, 2009). In the Arab

world, the proportion of death from CVD ranges from 17 to 21% (CDC, 2014). In

Palestine, CVD is the first leading cause of death. A total of 1088 cases from 3406 in

Gaza strip, with proportion of 31.9% died from CVD, and 1708 from 5581 with

proportion of 30.6% in the West Bank died from CVD (Ministry Of Health, 2010).

6

2.4 Pathophysiology of coronary artery disease

Coronary artery disease is caused by coronary artery atherosclerosis. The process of

arterial narrowing with atherosclerotic plaque development appears to be initiated by

endothelium injury (Hansson, 2005). Low density lipoprotein (LDL) compound

bounds to LDL receptor, internalized, and transported through the endothelium and

oxidative modification of LDL is happened in endothelium (Figure 2.2). The

macrophages remove the oxidized LDL via scavenger receptors by forming the foam

cells which are lipid filled macrophages (Rocha and Libby, 2009 and Walter, 2014).

The accumulated plaques of core lipid, thick fibrous filled with inflammatory cells as

macrophage and T cells may be ruptured in response to the physical forces of blood

flowing inside swelling of artery wall (Stocker et al., 2004). Blood platelets begin to

accumulate at the site of a vulnerable coronary plaque and to initiate thrombotic

occlusion of the coronary vessel (Gawaz, 2004 and Rocha and Libby, 2009).

Figure (2.2): Pathophysiology of coronary artery disease (Rocha and Libby, 2009).

LDL= Low density lipoprotein

7

2.5 Risk factor of coronary artery disease

The common risk factors of CAD include socioeconomic status (Cunningham,

2010), family history of the disease (Hasanaj et al. 2013 and Kulkarni 2015),

smoking (Sadeghi et al., 2013), physical activity (Stewart et al., 2013), obesity

(Lavie et al., 2009 and Abed and Jamee 2015), hypertension and diabetes (Chiha et

al., 2012 and Bhalli et al., 2015).

2.6 Cytochrome P450

2.6.1 Definition

The cytochrome P450 superfamily (also called CYP) is the generic name given to a

large family of heme-containing enzymes embedded primarily in the lipid bilayer of

the endoplasmic reticulum of hepatocytes (Bibi, 2008).

2.6.2 Nomenclature of CYP

A nomenclature system for CYP enzymes is based on the degree of similarity of

primary amino acid sequences to other CYPs, if there it have a higher amino acid

sequence homology than 40% they grouped into families (e.g. CYP1 vs. CYP2), and

those with greater than 55% homology are grouped into subfamilies (e.g. CYP2C)

(Lamb and Waterman, 2013). The root symbol CYP for cytochrome P450, an arabic

number for the CYP450 family, a letter for the subfamily, an arabic numeral for the

individual gene (e.g. CYP2C19) and when describing a CYP450 gene, all letters and

numerals are written in italics (McKinnon, 2008).

2.6.3 Classification of CYP

In humans, the enzymes responsible for drug metabolism belong to the CYP families

are CYP1, CYP2, CYP3 and CYP4. The CYP2 is the largest family of cytochrome

and includes 13 subfamilies that consist of 16 functional genes and 13 confirmed

pseudogenes. The CYP2C is the largest subfamily of CYP2 enzymes located at the

chromosomal position 10q24. Four members of this subfamily have been identified,

namely CYP2C8, CYP2C9, CYP2C18, and CYP2C19. All members of this subfamily

exhibit genetic polymorphisms, particularly, the CYP2C9 and CYP2C19 (Goldstein,

2001; Nakamoto et al., 2007 and Rainone et al., 2015).

8

2.6.4 Function of CYP

CYP enzymes are responsible for 75-80% of all phase I-dependent metabolism and

for 65-70% of the clearance of clinically used drugs (Sim and Ingelman-sundberg,

2010). The enzyme CYP2C19 functions in the metabolism of many drugs, including

antiplatelet, antidepressants and proton pump inhibitors (Li-Wan-Po et al., 2010).

2.7 Cytochrome P450 2C19

2.7.1 Definition and function

The CYP2C19 enzyme is defined as homo sapiens cytochrome P450, family 2,

subfamily C, polypeptide 19 (CYP2C19) (NCBI, 2015). The CYP2C19 enzyme is a

protein of 490 amino acids with molecular mass of 55931 Da, found primarily in the

liver (The GeneCards human gene database, 2015). The most commonly known

substrates for CYP2C19 include proton pump inhibitors (PPIs), certain

antidepressants (citalopram/escitalopram, imipramine), antiepileptics (diazepam,

mephenytoin), the antimalarial drug proguanil, the β-adrenoceptor blocker

propranolol and the antiplatelet drug clopidogrel (Chang M, 2014).

2.7.2 CYP2C19 gene

The CYP2C19 gene is located on the long (q) arm of chromosome 10 at position 24

(10q24.1–q24.3) and it has 9 coding exons and 8 introns (Figure 2.3). More

precisely, the CYP2C19 gene is located from base pair 94,762,680 to base pair

94,853,204 on chromosome 10, the cDNA is 1473-bp in length (Trenk et al., 2008

and Genetics Home Reference, 2015).

Figure (2.3): Cytogenetic location of CYP2C19 (Genetics Home Reference, 2015).

9

2.7.3 Expression of CYP2C19

The CYP2C19 is predominantly expressed in the liver and, to a lesser extent, in the

small intestine. Expression of CYP2C19 is largely mediated by hepatic nuclear

factors-4 alpha (HNF4α) and Hepatocyte nuclear factor 3-gamma (HNF3γ).

Transcriptional activation is mediated by the drug-responsive nuclear receptors

of constitutive androstane receptor (CAR), the pregnane X receptor (PXR), and the

human glucocorticoid receptor α (GRα). In-vitro expression studies have recently

shown that the transcription factor GATA-4 (GATA4) also up regulates CYP2C19

transcriptional activity (Scott et al., 2012).

2.7.4 Polymorphism of CYP2C19

To date, 35 CYP2C19 variants have been identified (OMIM, 2016). The CYP2C19*1

normal allele is associated with functional CYP2C19-mediated metabolism (Scott et

al. 2013). Location of selected loss, reduced and gain-of-function alleles of

CYP2C19 are shown in Figure 2.4 and Table 2.1 (Scott et al., 2012).

Figure (2.4): Location of selected loss-of-function (*2–*8) and gain-of-function

(*17) variant alleles of CYP2C19. Exons are represented by numbered black boxes.

(Scott et al., 2012).

10

2.7.4.1 The CYP2C19*2

The most common loss-of-function allele is CYP2C19*2 (previously referred to as

CYP2C19m1) with frequencies of 15% in Caucasians and Africans, and 29–35% in

Asians (Table 2.1). The CYP2C19*2 result from point mutation in exon 5, with

a G-A nucleotide change at 681 of cDNA sequence (defined by a 681G>A

substitution, rs4244285) (Mega et al., 2009). This activates a new cryptic site 40

nucleotides downstream of the natural splice site. This change alters the mRNA

reading frame creating truncated, nonfunctional protein (Rogan et al., 2003).

CYP2C19*2 is inherited as an autosomal co-dominant trait (Dean L, 2013). Sub-

alleles of CYP2C19*2 have been identified that harbor additional SNPs with limited

or no added functional consequence (i.e. CYP2C19*2A, *2B, *2C, *2E, *2F, *2G,

*2H, and *2J) (Sim, 2010). Platelet responsiveness to clopidogrel in heterozygotes

(*1/*2) lies somewhere between the responsiveness in individuals with the *1/*1

genotype and that in those with the *2/*2 genotype (Scott et al., 2013).

2.7.4.2 The CYP2C19*3

Another common allele is CYP2C19*3 (previously referred to as CYP2C19m2)

(Table 2.1) which has a G-A mutation at position 636 of exon 4 that result in a

premature termination codon at amino acid 212 which also creates a Stop codon

gained (defined by a 636G>A substitution, rs4986893) producing a truncated

inactive enzyme (Danielson, 2002 and Nakamoto, 2007). Sub-alleles of CYP2C19*3

also identified that harbor additional SNPs with limited or no added functional

consequence (CYP2C19*3, *3A, *3B and *3C) (Sim, 2010). The CYP2C19*3, is rare

among Caucasian subjects but accounts with frequencies typically <1%, with the

exception of CYP2C19*3 in Asians (2-9%) (Scott et al., 2011).

2.7.4.3 Other CYP2C19 variants that encode reduced or unknown

enzymatic activity

Less frequent CYP2C19 alleles associated with absent or reduced enzyme activity

are CYP2C19*4 (rs28399504), *5 (rs56337013), *6 (rs72552267), *7 (rs72558186),

and *8 (rs41291556) (Table 2.1). These variants typically have allele frequencies less

than 1% (Scott et al., 2012).

11

Table (2.1): Commonly CYP2C19 variant alleles and their effect on CYP2C19

protein.

Allele Nucleotide changes dbSNP Enzyme activity

cDNA Gene

CYP2C19*1 Normal

CYP2C19*2 681G>A 19154G>A rs4244285 None

CYP2C19*3 636G>A 17948G>A rs4986893 None

CYP2C19*4 1A>G 1A>G rs28399504 None

CYP2C19*5 1297C>T 90033C>T rs56337013 None

CYP2C19*6 395G>A 19294T>A rs72552267 None

CYP2C19*7 12748G>A rs72558186 None

CYP2C19*8 358T>C 12711T>C rs41291556 Reduced

CYP2C19*17 –806C>T rs12248560 Increased

(Scott et al., 2012).

2.7.4.4 CYP2C19 Variants that encode increased enzymatic activity

A novel allelic variant of cytochrome P450 2C19 encoding ultrarapid enzyme

activity was described (denoted CYP2C19*17) (Rudberg et a., 2008). The

CYP2C19*17 allele is associated with increased enzymic activity. However, the

magnitude of effects is considerably smaller than has been reported with CYP2C19*2

and CYP2C19*3, albeit in opposite directions (Li-Wan-Po et al., 2010). The

rs12248560 (c. −806C>T) is the defining polymorphism of the CYP2C19*17 allele

and is a C>T transition in the promoter that creates a consensus binding site for the

GATA transcription factor family, resulting in increased CYP2C19 expression and

activity (Table 2.1). The CYP2C19*17 allele frequencies are approximately 21% in

Caucasians, 16% in African-Americans, and 3% in Asians (Scott et al., 2012).

2.7.5 Impact of CYP2C19 (polymorphism) genotype on drug metabolism

Based on the ability to metabolize CYP2C19 substrates, individuals can be

categorized as extensive drug metabolizers (EM), where they are homozygous for

the CYP2C19*1 allele, which is associated with functional CYP2C19-mediated

metabolism (*1/*1), intermediate metabolizers (IM) which contains one wild-type

12

allele and one variant allele that encodes reduced or absent enzyme function (e.g.,

*1/*2, *1/*3), resulting in decreased CYP2C19 activity, poor metabolizers (PM)

have two loss-of-function alleles (e.g., *2/*2, *2/*3, *3/*3), resulting in markedly

reduced or absent CYP2C19 activity and ultrarapid metabolizers (UM) (*1/*17,

17*/*17) (Desta et al., 2002). There are marked racial differences in the frequencies

of CYP2C19 phenotypes, with Asians having the highest frequencies of the poor

metabolizers and intermediate metabolizer phenotypes. Some studies showed that *2

and *3 could explain more than 90% poor metabolizers phenotypes but other studies

indicate that *2 and *3 could explain less than 50% of poor metabolizers (Nakamoto

et al., 2007 and Cavallari et al., 2011).

2.8 Management of coronary artery disease

The key components in the management of CAD include coronary revascularization,

antiplatelet therapy, anticoagulation and consideration of adjuvant agents including β

blockers, inhibitors of the renin angiotensin system, and 3-hydroxy-3-methyl-

glutaryl-CoA reductase inhibitors (Smith et al., 2015).

2.8.1 Coronary revascularization

2.8.1.1 Balloon angioplasty

Balloon angioplasty (called cardiac catheterization) is an invasive, non-surgical

procedure done under local anesthesia to study the coronary arteries. During the

procedure, a small hollow tube (catheter) that has a small balloon on its tip is inserted

into an artery of the wrist or groin. They inflate the balloon at the blockage site in the

artery to flatten or compress the plaque against the artery wall. Special X-ray dye or

contrast is injected through the catheter into the arteries. This will outline the

coronary arteries to show any existing blockages or narrowing. Most patients have

minimal discomfort during cardiac catheterization (American Heart Association.

2010).

13

2.8.1.2 Percutaneous coronary intervention (PCI)

Percutaneous coronary intervention is a mainstay in the management of high-risk

coronary artery disease. Initially the patient has a cardiac catheterization to

visualize the position and shape of any narrowing or blockages. If the clinical

circumstances and the cardiac catheterization findings suggest blood flow to the

heart must be modified, the majority of patients will be treated by PCI and minority

will be treated by coronary artery bypass graft (CABG) (Redwood, 2011).

During PCI, a small, hollow metal mesh tube called a stent is placed in the artery to

keep it open following initial balloon dilation. Stents are classified into drug-eluting

stents (DES) and bare-metal stents (BMS). Drug-eluting stents are used in the

majority of patients who receiving intracoronary stents (Balghith et al., 2013). In

patients with CAD, randomized controlled trials have consistently linked DES with

reduction of neointimal hyperplasia, decreased risk of restenosis compared with

BMS (Jensen et al., 2007). Drug-eluting stents decreases the frequency of repeat

revascularization procedures in patients with CAD undergoing PCI and at highest

risk for restenosis, reducing rate of death or myocardial infarction (Tu et al., 2007

and Capodanno et al., 2011). However, stenting itself requires potent peri-

procedural antithrombotic therapy and a commitment to ≥ 1–6 months of

antiplatelet therapy, depending on stent type and admission diagnosis (Zhou et al.,

2012).

2.8.2 Antiplatelet therapy

Platelets play an important role in cardiovascular disease both in the pathogenesis of

atherosclerosis and in the development of acute thrombotic events. Their importance

in vascular disease is indirectly confirmed by the benefit of antiplatelet agents in

these disorders (Norgard and Abu-Fadel, 2009). Anti-platelet medications are the

cornerstone of treatment for patients with cardiovascular disease and undergoing

percutaneous coronary intervention (PCI). (Perry and Shuldiner, 2013). For many

years, aspirin has been the mainstay of antiplatelet drug therapy in vascular disease.

As an antiplatelet agent, aspirin has been shown to greatly reduce major vascular

adverse events. Its benefit it has been linked to its ability to permanently acetylate

cyclooxygenase 1 (COX-1), preventing the conversion of arachidonic acid to

14

thromboxane A2 by the platelet. Thromboxane A2 is a strong platelet agonist and

inhibiting its production decreases overall platelet aggregation at the site of the

vascular injury. However, blocking this pathway has a limited overall effect on the

various independent pathways (i.e., collagen and adenosine diphosphate) can remain

high. The need for inhibition of other platelet activation pathways has led to the

development of additional antiplatelet drugs (Norgard and Abu-Fadel, 2009).

2.8.2.1 P2Y12 receptor antagonists

The adenosine diphosphate (ADP) receptor inhibitors are a subclass of anti-platelet

medications which include clopidogrel, prasugrel, ticagrel and ticlopidine (perry and

shuldiner, 2013). ADP is an essential agonist in hemostasis and thrombosis that

mediates its effects through the P2Y1 and P2Y12 platelet receptors. Ticlopidine and

Clopidogrel are commonly used thienopyridine anti-platelet agents that selectively

and irreversibly block the P2Y12 ADP receptor. Clopidogrel is favored over

Ticlopidine due to better patient safety and tolerability (Norgard and Abu-Fadel,

2008).

2.9 Clopidogrel

2.9.1 Definition and structure

Clopidogrel is an oral thienopyridine derivative which inhibits platelet activation

and aggregation by irreversibly blocking the platelet adenosine diphosphate (ADP)

P2Y12 receptor (Ma et al., 2011). Chemically clopidogrel is (d-methyl[2-

chlorophenyl]-5-[4,5,6,7-tetrahydrothieno] [3,2-c pyridinyl] acetate hydrogensulfate)

having the empirical formula C16H17ClNO2S.HSO4 and molecular mass

321.82 g/mol, (Figure 2.5, Gurbel and Tantry, 2007).

Figure (2.5): Chemical structure of clopidogrel (Gurbel and Tantry, 2007).

15

2.9.2 Pharmacokinetics of clopidogrel

Clopidogrel is a pro-drug that is absorbed in the intestine and activated in the liver

(Figure 2.6). The P-glycoprotein is responsible for the active intestinal transport of

clopidogrel (Giusti et al., 2010). Clopidogrel is metabolized by two main metabolic

pathways: an esterase-dependent pathway leading to hydrolysis up to 85 % of

clopidogrel into an inactive carboxylic acid derivative and a cytochrome P450

(CYP)-dependent pathway (Karaźniewicz-Łada et al., 2014) leading to formation of

its active metabolite clopi-H4. Clopi-H4 is formed in a two-step oxidative process

mediated by CYP1A2, CYP2B6, CYP2C19 and CYP3A4 (Dansette et al., 2011),

which bind to the ADP, P2Y12 receptor expressed on the platelet surface, and causes

an irreversible blockade of ADP-binding for the platelet’s life span (Ma et al., 2011).

Figure (2.6): Pharmacokinetics of clopidogrel (Giusti et al., 2010).

2.9.3 Pharmacodynamic of clopidogrel

Clopidogrel non-competitively and irreversibly inhibits the adenosine diphosphate

(ADP) P2Y12 receptor; ADP binds to the P2Y1 receptor to induce change in platelet

shape and to initiate a weak and transient phase of platelet aggregation (Angiolillo et

al., 2007 and Angiolillo and Ferreiro, 2010). The binding of ADP to its Gi-coupled

P2Y12 receptor liberates the Gi protein subunits i and . The subunit i leads to the

16

inhibition of adenylyl cyclase, which, in turn, lowers the cyclic adenosine

monophosphate (cAMP) level. This inhibits the cAMP-mediated phosphorylation of

vasodilator-stimulated phosphoprotein (VASP) (VASP-P), which inhibits glyprotein

IIb/IIIa receptor activation. The subunit activates the phosphatidylinositol 3-

kinase (PI3K), which leads to GP IIb/IIIa receptor activation through activation of a

serine-threonine protein kinase B (PKB/Akt) and of Rap1b GTP binding proteins.

The Gi-coupled P2Y12 receptor pathway results in stabilization of platelet

aggregation. Thus, blockage of P2Y12 receptor effectively inhibits such platelet

aggregation (Figure 2.7).

Figure (2.7): Pharmacodynamic of clopidogrel

AC= Adenylyl Cyclase, cAMP= cyclic Adenosine Monophosphate, VASP=

Vasodilator-Stimulated Phosphoprotein, PI3K= Phosphatidylinositol 3-Kinase,

GPIIb/IIIa= Glycoprotein IIb/IIIa, PKB/Akt= Serine-threonine Protein Kinase B,

Rap1b: Ras-related protein Rap-1b (Angiolillo and Ferreiro, 2010).

17

2.10 Prevalence and relation of CYP2C19*2 and *3 alleles to the

platelet inhibition by clopidogrel

Hulot et al., 2006 conducted a prospective pharmacogenetic study in 28 healthy

French white male volunteers treated for 7 days with clopidogrel 75 mg/day to

determine whether frequent functional variants of genes coding for candidate CYP

isoenzymes involved in clopidogrel metabolic activation (CYP2C19*2, CYP2B6*5,

CYP1A2*1F, and CYP3A5*3 variants) influence the platelet responsiveness to

clopidogrel. Results showed that pharmacodynamic response to clopidogrel was

significantly associated with the CYP2C19 genotype. Twenty of the subjects were

wild-type CYP2C19 (*1/*1) homozygotes, while the other 8 subjects were

heterozygous for the loss-of-function polymorphism CYP2C19*2 (*1/*2). Baseline

platelet activity was not influenced by the CYP2C19 genotype. In contrast, platelet

aggregation in the presence of 10 µM ADP decreased gradually during treatment

with clopidogrel 75 mg once daily in *1/*1 subjects, reaching 48.9%±14.9% on day

7 (P<0.001 vs baseline), whereas it did not change in *1/*2 subjects (71.8%±14.6%

on day 7, P=0.22 vs baseline, and P<0.003 vs *1/*1 subjects). Similar results were

found with vasodilator-stimulated phosphoprotein phosphorylation. The CYP2C19*2

loss-of-function allele is associated with a marked decrease in platelet responsiveness

to clopidogrel in young healthy male volunteers and may therefore be an important

genetic contributor to clopidogrel resistance in the clinical setting.

The relationship between genetic variation in CYP isoenzymes and the

pharmacokinetic/pharmacodynamic response to prasugrel (60 mg, n=71) and

clopidogrel (300 mg, n=74) was determined in healthy subjects from Netherlands

(Brandt et al., 2007). Genotyping was performed for CYP1A2, CYP2B6, CYP2C19,

CYP2C9, CYP3A4 and CYP3A5. In subjects receiving clopidogrel, the presence of

the CYP2C19*2 loss of function variant was significantly associated with lower

exposure to clopidogrel active metabolite, as measured by the area under the

concentration curve (AUC(0-24); P=0.004) and maximal plasma concentration

(C(max); P=0.020), lower inhibition of platelet aggregation at 4 hr (P=0.003) and

poor-responder status (P=0.030). Similarly, CYP2C9 loss of function variants were

significantly associated with lower AUC(0-24) (P=0.043), lower C(max) (P=0.006),

18

lower IPA (P=0.046) and poor-responder status (P=0.024). For prasugrel, there was

no relationship observed between CYP2C19 or CYP2C9 loss of function genotypes

and exposure to the active metabolite of prasugrel or pharmacodynamic response.

Trenk et al. (2008) investigated whether the loss of function CYP2C19*2

polymorphism is associated with high (>14%) residual platelet aggregation (RPA) on

clopidogrel and whether high on-clopidogrel RPA impacts clinical outcome after

elective coronary stent placement. The study included 797 consecutive Germany

patients undergoing PCI, who were followed-up for one year. Adenosine-

diphosphate-induced (5 mumol/l) RPA was assessed after a 600-mg loading dose and

after the first 75-mg maintenance dose of clopidogrel before discharge. CYP2C19

genotype was analyzed by real-time PCR. Of the patients included, 552 (69.3%)

were CYP2C19 wild-type homozygotes (*1/*1) and 245 (30.7%) carried at least one

*2 allele. Residual platelet aggregation at baseline did not differ significantly

between genotypes. On clopidogrel, RPA was significantly (P<0.001) higher in *2

carriers than in wild-type homozygotes (23.0% [interquartile range (IQR) 8.0% to

38.0%] vs. 11.0% [IQR 3.0% to 28.0%] after loading; 11.0% [IQR 5.0% to 22.0%]

vs. 7.0% [IQR 3.0% to 14.0%] at pre-discharge). Between *2 carriers and wild-type

homozygotes, significant (P<0.001) differences in the proportion of patients with

RPA >14% was found, both after loading (62.4% vs. 43.4%) and at pre-discharge

(41.3% vs. 22.5%). Residual platelet aggregation >14% at pre-discharge incurred a

3.0-fold increase (95% confidence interval 1.4 to 6.8; p = 0.004) in the one-year

incidence of death and myocardial infarction.

In their study entitled “Cytochrome P-450 polymorphisms and response to

clopidogrel”, Mega et al (2009) found that 30% of the study population, carriers of at

least one CYP2C19 reduced-function allele, had a relative reduction of 32.4% in

plasma exposure to the active metabolite of clopidogrel, as compared with

noncarriers (P<0.001). Carriers also had an absolute reduction in maximal platelet

aggregation in response to clopidogrel that was 9% points less than that seen in

noncarriers (P<0.001). Among clopidogrel-treated subjects in Therapeutic Outcomes

by Optimizing Platelet Inhibition with Prasugrel–Thrombolysis in Myocardial

19

Infarction, carriers had a relative increase of 53% in the composite primary efficacy

outcome of the risk of death from cardiovascular causes, myocardial infarction, or

stroke, as compared with noncarriers (12.1% vs. 8.0%; hazard ratio for carriers, 1.53;

95% confidence interval [CI], 1.07 to 2.19; P=0.01) and an increase by a factor of 3

in the risk of stent thrombosis (2.6% vs. 0.8%; hazard ratio, 3.09; 95% CI, 1.19 to

8.00; P=0.02).

Buzoianu et al. (2010) studied CYP2C19*2, *3 and *4 variants in 200 healthy,

unrelated Romanian volunteers, using Polymerase Chain Reaction- restriction

Fragment Lengh Polymorphism (PCR-RFLP) and tetra-primer PCR techniques.

Forty eight individuals (24%) were CYP2C19*2 heterozygotes, while a homozygous

genotype CYP2C19*2/*2, has been demonstrated in 3 individuals (1.5%). No

CYP2C19*3 variant has been found. CYP2C19*4 was found only in a

CYP2C19*2/*4 compound heterozygous individual. The allele frequencies for

CYP2C19*2, *3 and *4 were 13.75%, 0% and 0.25%, respectively.

The CYP2C19*1, *2 and *3 variants were assessed by PCR-RFLP assay in a

representative sample of 161 unrelated healthy Lebanese volunteers (Jureidini et al.,

2011). The allele frequencies of CYP2C19*2 and *3 were 0.13 and 0.03. Carriers of

the CYP2C19*2 or *3 represented 24.2% of the subjects. In addition, Ellison et al.

(2012) found that the frequency of the CYP2C19 genotype combinations were

CYP2C19 *1/*1 (93%), *1/*2 (6%), and *2/*2 (1%) in Egyptian population. The

observed allele frequency of CYP2C19 681G>A was found 3.8%.

Yousef et al. (2012) determined the frequencies of important allelic variants of

CYP1A1, CYP2C9, CYP2C19, CYP3A4 and CYP3A5 in the Jordanian population and

compare them with the frequency in other ethnic groups. Genotyping of CYP1A1(m1

and m2), CYP2C9 (2 and 3), CYP2C19 (2 and 3), CYP3A4 5, CYP3A5 (3 and 6), was

carried out on Jordanian subjects. Different variants allele were determined using

PCR-RFLP. CYP1A1 allele frequencies in 290 subjects were 0.764 for CYP1A1 1,

0.165 for CYP1A1 2A and 0.071 for CYP1A1 2C. CYP2C9 allele frequencies in 263

subjects were 0.797 for CYP2C9*1, 0.135 for CYP2C9*2 and 0.068 for CYP2C9*3.

20

For CYP2C19, the frequencies of the wild type (CYP2C19*1) and the nonfunctional

*2 and *3 alleles were 0.877, 0.123 and 0, respectively. Five subjects (3.16 %) were

homozygous for 2/2. Regarding CYP3A4 1B, only 12 subjects out of 173 subjects

(6.9 %) were heterozygote with none were mutant for this polymorphism. With

respect to CYP3A5, 229 were analyzed, frequencies of CYP3A5 1, 3 and 6 were

0.071, 0.925 and 0.0022, respectively. Comparing our data with that obtained in

several Caucasian, African-American and Asian populations, Jordanians are most

similar to Caucasians with regard to allelic frequencies of the tested variants of

CYP1A1, CYP2C9, CYP2C19, CYP3A4 and CYP3A5.

Abid et al. (2013) investigated the genetic variant of the gene CYP 2C19 in 100

Tunisian patients and assessed the involvement of this genetic profile in the

occurrence of major cardiovascular events (MACE) during the follow-up period. The

patients were divided into 2 groups: those with at least one CYP2C19*2 allele (*2

carriers) and non-carriers. The mean age of patients was 56.7±10.5 years. The

prevalence of CYP2C19*2 allele was 11.5%. Hospital mortality was estimated at

3%. No statistically significant differences were noted between the two groups

regarding the occurrence of intra hospital MACE. The mean follow up was 7.5 ±

4.87 months for the entire study population. The rate of MACE during the follow-up

of patients receiving clopidogrel was 8.2% throughout the study population: 5.3% in

the *2 non-carriers versus 18.2% in the *2 carriers with a statistically significant

difference (P=0.075) at the risk of error of 10%. Concerning the occurrence of stent

thrombosis, there was no significant statistical difference between the two study

groups.

The prevalence of CYP2C19*2 and ABCB1 C3435T polymorphisms in 100

unrelated Palestinian subjects and 100 unrelated Turkish subjects was examined by

the amplification refractory mutation system (Nassar et al., 2014). Results showed an

ABCB1 3435 T allele frequency of 0.46 (95% CI 0.391 to 0.529) in the Palestinian

sample and 0.535 (95% CI 0.4664 to 0.6036) in the Turkish sample. CYP2C19*2

allele frequency was 0.095 (95% CI 0.0558 to 0.134) in the Palestinian sample and

0.135 (95% CI 0.088 to 0.182) in the Turkish sample.

Chapter Three

Material and Methods

21

Chapter 3

Material and Methods

3.1. Study design

A cross sectional study with convenience sample.

3.2. Study population

The study population involved all patients attending the European Gaza Hospital

(EGH), Cardiac Catheterization Department for follow up after percutaneous

coronary intervention and are being managed with the antithrombotic drug

Clopidogrel. The samples were collected during the period from the beginning of

March to the end of May 2014.

3.3. Sample size

A total of 110 patients were recruited from the Cardiology Department of EGH. The

sample covered the five main Governorates of Gaza strip: North Gaza, Gaza city,

Mid-Zone, Khan Younis and Rafah. The sample consisted of 73 males and 37

females with ages ranging from 34 to 88 years old with mean age of 60.2 ± 11.2

years.

3.4. Ethical consideration

The study was approved by the Palestinian Ethical Committee (Helsinki Ethics

Committee). (Appendix 1). Also, the approval of the Ministry of Health (MOH)

(Appendix 2) was obtained. Patient's consents were obtained orally to undergo this

study and collecting blood samples for analysis, after explaining the aim and

objectives of the study.

3.5. Inclusion criteria

Patients with the following 3 criteria were recruited in the study

Acute coronary syndrome patients who underwent PCI

Unrelated men and women patients

Patients treated with clopidogrel and aspirin

22

3.6. Exclusion criteria

Patients untreated with clopidogrel

3.7. Materials

3.7.1. Instruments

Table 3.1 list of instruments used to carry out the experimental work. All instruments

are located at the laboratories of the biotechnology department of the Islamic

University of Gaza.

Table (3.1): List of laboratory instruments

Item Manufacturer

Thermocycler Biometra, Germany

Electrophoresis chambers and tanks

(horizontal) BioRad, USA

Electrophoresis power supply BioRad, USA

Microcentrifuge BioRad, USA

Microwave oven LG, Korea

Freezer, refrigerator ORSO, pharml-spain

Safety cabinet Hereaus, Germany

Micropipettes (0.1-2.5μl / 0.5-10μl / 5-50μl /

20-200μl / 100-1000μl) Eppendrof, Germany

Gel documentation system Vision, Scie-Plas Ltd, UK

Digital camera Canon (Japan)

Vortex mixer Labnet, USA

Nano-drop spectrophotometer Implen, Germany

23

3.7.2. List of reagents and chemicals (Table 3-2)

Table (3.2): Lists the chemicals and reagents

Reagents and chemicals Manufacturer

Primers Hy.Labs®, (Rehovot, Israel)

Wizard Genomic DNA purification kit Promega, (Madison, USA)

Ladder (size marker) 100bp GeneDire X, USA

GoTaq® Green Master Mix Promega, (Madison, USA)

SmaI and BamHI Restriction enzymes New England BioLab, Canada

Agarose gel Promega, (Madison, USA)

Ethedium promide Promega, (Madison, USA)

Ultra-pure water (nuclease free) Promega, (Madison, USA)

Tris Acetate EDTA (TAE) (50X) Promega, (Madison, USA)

Ethanol >96% (Sigma USA).

Absolute Isopropanol (Sigma USA).

3.7.3. Primers used in this study (Table 3.3)

Table (3.3): Nucleotide sequence of the PCR primers

Primers Reference

ID Sequence (5, to 3

,)

CYP2C19*2-F CAGAGCTTGGCATATTGTATC

Yang et al., 2004

CYP2C19*2-R GTAAACACACAACTAGTCAATG

CYP2C19*3-F AAATTGTTTCCAATCATTTAGCT

CYP2C19*3-R ACTTCAGGGCTTGGTCAATA

24

3.7.4. Disposables (Table 3-4)

Table (3.4): List of disposables

Item Manufacturer

Steril 1.5ml eppendrof safe-lock

microcentrifuge tube Eppendrof

®, USA

Sterile thin-wall polypropylene PCR

tubes with attached caps for labeling Labcon USA

Disposable tips (different sizes from

0.2µl to 1000µl) Different manufacturers

2.5 K3 EDTA tubes ZMC, China

Syringe 5ml Homed – China

23 gauge needle Homed – China

3.8. Methods

3.8.1. Data collection

Data were recorded on a predesigned form (Appendix 3) after explaining the aim of

the study and obtaining the patient consent to participate in the study and donate a

blood sample. Personal data were verbally collected from the patient (name, age,

address, education level, family history of heart disease). Current and previous

clinical and laboratory data were collected from the medical record of the patient.

Similarly, the collected data included the medications and doses administered since

the PCI procedure. The patients were contacted by telephone to follow up for the

patient general condition and for any cardiovascular problems or complications that

might occurred during the last 6 months following PCI

3.8.2. Blood samples collection

Whole blood samples were collected from 110 patients in EDTA tubes.

Approximately 2.5 ml venous blood samples were collected in each tube from each

patient.

25

3.9. Molecular analysis

3.9.1. Extraction and purification of genomic DNA

DNA was extracted from blood samples using the Wizard Genomic DNA

purification Kit (Promega, Madison, WI. USA), according to the manufacturer

instructions protocol. The kit contents are listed in Table 3.5, and materials that

should be supplied by the user are indicated in Table 3.6. The extraction procedure is

as follows:

Cell Lysis

A volume of 300µl well mixed blood was added into a 1.5 ml microcentrifuge

tube containing 900 µl of the cell lysis solution (lyses of red blood cells). The

components were mixed by inverting the tube gently and the mixture was

incubated at room temperature for 10 minutes. During the incubation period, the

tube was periodically mixed (2-3 times) by inversion.

The mixture was centrifuged at 13,000 rpm for 20 seconds, then the supernatant

was removed and discarded without disrupting the pellet. The pellet was then

resuspended by vigorous vortexing ( for 10-15 seconds).

Nuclei lysis and protein precipitation

A volume of 300 µl nuclei lysis solution (lyses of white blood cells and their

nuclei) were added to the resuspend pellet and mixed by 5- 6 times pipetting to

obtain viscous cell extract.

One hundred µl protein precipitation solution (precipitates all the cellular and

nuclear proteins) were added to the lysate and vigorously mixed by vortex. The

extract was then centrifuged at 13,000 rpm for 3 minutes to precipitate the dark

brown protein pellet.

DNA precipitation and rehydration

The supernatant was then transferred to a clean 1.5 ml microcentrifuge tube

containing 300 µl isoprobanol and was mixed gently by inversion until white

thread-like strands of DNA formed a visible mass, then centrifuged at 13000 rpm

for 1 minute to pellet the DNA.

26

The supernatant was removed and 300µl of 70% ethanol were added and gently

inverted several times to wash the DNA pellet, then centrifuged at 13,000 rpm for

1 minute.

The ethanol was aspirated carefully using a micropipette, and then the tube was

inverted on a clean absorbent paper.

The pellet was air-dried for 10-15 minutes. The DNA pellet was rehydrated by

addition of 100µl DNA rehydration solution and incubation at 65 oC for 1 hour.

Finally The DNA was stored at -20 oC until performing PCR.

Table (3.5): Wizard genomic DNA purification kit solutions

Solutions Volume

Cell lysis solution 100 ml

Nuclei lysis solution 50 ml

Protein precipitation solution 25 ml

DNA rehydration solution 50 ml

RNase solution (4mg/ml) 250 µl

Table (3.6): Materials that should be supplied by the user

Sterile 1.5 ml microcentrifuge tubes

Water bath

Isopropanol, room temperature.

70% ethanol, room temperature.

Microcentrifuge.

27

3.9.2. Primers reconstitution

The primers were reconstituted to obtain 100 pmol/µl stock concentration from

which working primer dilutions were prepared at 5 pmol/µl concentration by

combining 5 µL of each reconstitute and 95 µL of ultra-pure water.

3.10. Detection of CYP2C19*2 and CYP2C19*3 polymorphisms by

PCR-RFLP

The procedure were performed according to previously published protocols (Yang et

al ., 2004), using the forward primer (CYP2C19*2-F), which anneals in intron 4 (71

bp upstream from the intron 4/exon 5 junction), and the reverse primer (CYP2C19*2-

R), which anneals in intron 5 (73 bp downstream from the exon 5/intron 5 junction).

After PCR amplification, the DNA fragments of exon 5 were digested with SmaI

before electrophoresis in 2.5% agarose gel for detection of the CYP2C19*2

fragments. For the identification of CYP2C19*3, the forward primer (CYP2C19*3-F)

anneals in intron 3 (21 bp upstream of the intron 3/exon 4 junction), and the reverse

primer (CYP2C19*3-R) in intron 4 (88 bp downstream of the exon 4/intron 4

junction). The PCR products for detecting CYP2C19*3 were digested with BamHI

and analyzed using gel electrophoresis.

3.10.1. Polymerase Chain Reaction (PCR) for CYP2C19*2

PCR for the CYP2C19*2 polymorphism, was carried out in a 25 µl reactions. The

reaction components were combined in 0.2 ml PCR tubes as described in (Table 3-7).

The tubes were then placed in a thermocycler and PCR amplification was performed

according to the program provided in (Table 3-8).

28

Table (3.7): PCR components for amplification of CYP2C19*2

Reagent Volume (μl) Final concentration

GoTaq® Green Master Mix (2X) 12.5 1X

CYP2C19*2-F (5 pmol/µl) 1 0.2 pmol/µl

CYP2C19*2-R 1 0.2 pmol/µl

DNA (25- 40 ng/µl) 3 About 100 ng in total

Nuclease free water 7.5

Total 25

Table (3.8): Thermocycler program for PCR amplification of the CYP2C19*2 and

CYP2C19*3

Step Temperature (ºC) Time Cycles

Initial denaturation 94 3 m 1

Denaturation 94 30 s

37 Annealing 52 30 s

Extension 72 40 s

Final extension 72 5 m 1

4 Hold

3.10.2. Restriction fragment length polymorphism (RFLP) CYP2C19*2

PCR product by Sma1 restriction enzyme

The resulting 321-bp product of CYP2C19*2 PCR was digested in a 20μl reaction

mixture as depicted in Table 3.9. The reaction mixture was incubated at 25 °C for 1 h

followed by an inactivation step at 75 °C for 15 minutes. The digestion products

were analyzed by electrophoresis in a 2.5 % agarose gel and compared to 100 pb

DNA ladder.

29

Table (3.9): The enzymatic digestion components of amplified CYP2C19*2

Solutions Volume Final conc.

Restriction enzyme, Sma1 (20 u/ micro) 0.3 µl 0.3 u/ micro

10xbuffer 2 µl 1X

PCR product 13 µl 13

H2O 5 µl

Total 20 µl

Sma1 cuts the 321-bp PCR products containing the wild type allele into 212-bp and

109-bp fragments and does not cut PCR products containing the mutant allele. The

CYP2C19*2 homozygotes should yield one band (321 bp) while the CYP2C19*2

heterozygotes should produce three bands (321 bp, 212 bp, and 109 bp)

3.10.3. Polymerase chain reaction (PCR) for CYP2C19*3

PCR for the CYP2C19*3 polymorphism, was carried out in a 25 µl reactions, as

described in (Table 3-10). The reaction components were combined in 0.2 ml PCR

tubes. The tubes were placed in a thermocycler and PCR amplification was

performed according to the same program of CYP2C19*2 provided in (Table 3-8).

Table (3.10): PCR components for amplification of CYP2C19*3

Reagent Volume (μl) Final concentration

GoTaq® Green Master Mix (2X) 12.5 1X

CYP2C19*3-F 1 0.2 pmol/µl

CYP2C19*3-R 1 0.2 pmol/µl

DNA 3 About 100 ng in total

Nuclease free water 7.5

Total 25

30

3.10.4. Restriction fragment length polymorphism (RFLP) of CYP2C19*3

PCR product by BamH1 restriction enzyme

The resulting 272-bp product was digested in 30μl volumes with BamH1 as indicated

in Table 3-11. The restriction enzyme was allowed to work at 37 °C for 3 hrs, and

then inactivated at 70 °C for 15 minutes. The digestion products were analyzed by

electrophoresis on a 2.5% agarose gel and identified by comparison to 100-bp DNA

ladder. BamH1 does not cut the PCR products containing the mutant allele but it cuts

the PCR products containing the wild type allele into 175bp- and 96-bp fragments.

The CYP2C19*3 homozygote should yield one band (271 bp) while the CYP2C19*3

heterozygotes should produce three bands (271 bp, 175 bp, and 96 bp).

Table (3.11): The enzymatic digestion components of amplified CYP2C19*3

3.11. Interpretation of CYP2C19 alleles

Each of the two variant allele is caused by a substitution of one nucleotide in turn a

substitution of the amino acid (Table 3-12), leading to different effect in the

enzymatic activity (Table 3-13).

Table (3.12): Interpretation of CYP2C19 alleles

Allele Nucleotide

substitution Amino acid substitution

CY2C19*1 wild type

CY2C19*2 c.681G>A (rs4244285) Cryptic splice acceptor activation

CY2C19*3 c.636G>A (rs4986893) Stop codon gained (nonsense

codon)

(Danielson, 2002)

Solutions Volume Final conc.

Restriction enzyme, BamH1 (20 u/ mico 0.3 µl 0.3 u / micro

10xbuffer 2 µl 1 x

PCR product 13 µl

H2O 15 µl

Total 30 µl

31

Table (3.13): Predicted metabolism phenotypes for CYP2C19 based on example

genotypes

Genotype Predicted metabolism phenotype

CYP2C9-1*/1* Extensive metabolizer (EM)

CYP2C9-1*/2* Intermediate metabolizer (IM)

CYP2C9-1*/3*

CYP2C9-2*/2*

Poor metabolizer (PM) CYP2C9-2*/3*

CYP2C9-3*/3*

(Danielson, 2002)

3.12. Quality control

Negative control samples were applied in each run of PCR along with patients

samples without addition of any DNA material but using a nuclease free water

instead. This blank control served to confirm the quality of testing procedure for

PCR, and the purity of the reagents and lack of contamination. A random sample of

genomic DNA was used as positive controls for the restriction enzyme SmaI and

BamHI, to confirm the enzyme activity and its ability to cut DNA.

3.13. Statistical analysis

The IBM SPSS software version 22, and Microsoft Excel software were used to

perform all the analyses and charts. Descriptive statistics were reported as absolute

frequencies and percentages for qualitative data. In the case of expected frequencies,

more than 5 Chi-square were used and if less than 5 the Fisher’s exact test in the case

of expected frequencies less than 5. All the statistical tests were two sided; a p value

of <0.05 was considered as statistically significant. Multivariate analysis, correlation

coefficient, odds ratios, p value (two-sided tests) and 95% CI were used to describe

the strength of association.

Chapter Four

Results

32

Chapter 4

Results

4.1. Characteristics of the study population:

4.1.1. Personal characteristics

The study enrolled 110 patients, 73 of them were males (66.40%) and 37 were

females (33.60%; Table 4-1). The mean age of the patients was 60.2 ± 11.2, ranging

from 34 to 88 years. The mean age of males was 58.2 ± 11.3 years and that of

females was 64 ± 10 years. According to the residence area, the Northern area has

the lowest frequency 7 of the cases representing 6.5%, followed by the Middle area

with 19 cases (17.3%), Gaza strip with 33 patients (30%), and the Southern area

(Rafah and Khanyouns) with 51 patients (46.4%). Distribution of participants by

education level shows that 32/110 (29.1%) were illiterate, 47/110 (42.7%) were with

school level education, 30/110 (27.3%) were with university level and only one case

(0.9%) with postgraduate education. The average BMI for both genders was 29.3 ±

4.3, of them females had higher BMI than males with mean 32.5 ± 4.1 and 27.71 ±

3.5 respectively.

Table (4.1): Personal characteristics of the study population

Characteristics Frequency % or ±SD

Gender Male 73 66.4%

Female 37 33.6%

Age (Year) 110 60.2 ± 11.2

Education level

Illiterate 32 29.1%

School level 47 42.7%

University

level 30 27.3%

Postgraduate 1 0.9%

Resident area

North Gaza 7 6.5%

Gaza city 33 30%

Mid-Zone 19 17.3%

South Gaza 51 46.4%

Body mass index

(kg/m2)

Male 73 27.7 ± 3.5

Female 37 32.5 ± 4.1

33

4.1.2 Clinical characteristics

4.1.2.1 Cardiac and other chronic diseases

In addition to the cardiac disease, 65.5 % of the enrolled patients had diabetes

mellitus and 69.1% had hypertension (Table 4-2). More than half (60%) had no

family history of heart disease.

Table (4.2): Comorbid chronic disease in the study population

Frequency (%)

Yes No

Diabetes mellitus 72 (65.5%) 38 (34.5%)

Hypertension 76 (69.1%) 34 (30.9%)

4.1.2.2. Complete blood count of the study population

Complete blood count result for the study population were in the normal range for

both genders (Table 3.4).

Table (4.3): Complete blood count of the study population

Mean ± SD

WBC (*109/L) 8.8 ± 2.5

RBC (106/µL) 4.34 ± 0.6

Hb (mg/dl) 12.6 ± 3.9

HCT( %) 38.4 ± 20.5

PLT (103/ µL) 236.8 ± 74.7

WBC= White Blood Cell, RBC= Red Blood Cell, Hb= Hemoglobin, HCT=

Hematocrit, PLT= platelet.

4.1.2.3 Angiographic outcomes

As presented in (Table 4-4), the most frequent lesion found with angiography was in

the left anterior descending artery (LDA) followed by the right coronary artery

(RCA), the left circumflex artery (LCX), the obtuse marginal (OM) and finally the

ramus circumflexes (RCX). Bare metal stents (BMS) were instilled in 96.4% of the

patient, while drug eluting stent (DES) were instilled only in 3.6% patients (Table 4-

4).

34

Table (4.4): lesion location and type of instilled stent

Type of stent Frequency Percent

Lesion location

LDA 49 44.5%

LCX 19 17.3%

OM 6 5.5%

RCA 31 28.2%

RCX 5 4.5%

Stent integrity BMS 106 96.4%

DES 4 3.6%

BMS= Bare Metal Stent, DES= Drug Eluting Stent, LAD= Left Anterior

Descending Artery, LCX= Left Circumflex Artery, RCA= Right coronary artery,

RCX= Ramus Circumflexes, OM= Obtuse Marginal.

4.2. PCR and RFLP results for CYP2C19

4.2.1. CYP2C19*2 PCR product gel electrophoresis

After running on 2% agarose gel the PCR product of CYP2C19*2 was identified as

321 bp DNA fragment using 100 bp DNA ladder along with negative control as

shown in Figure 4.1.

Figure (4.1): PCR products of CYP2C19*2&*3

L=100 bp ladder, lanes 1-7 amplified CYP2C19*2 fragment (321 bp)= Lane 9 - 15

amplified CYP2C19*3 fragment (272 bp), lanes 8 and 16= blank negative control.

CYP2C19*2 CYP2C19*3

35

4.2.2. CYP2C19*2 restriction analysis gel electrophoresis

The PCR product for CYP2C19*2 was introduced to restriction analysis with the

restriction enzyme Sma1. It cut the wild type allele containing 321bp (CYP2C19*1)

into 212-bp and 109-bp fragments and did not cut PCR products containing the

mutant allele (CYP2C19*2). When running on agarose gel CYP2C9*1 shows two

bands while CYP2C19*2 shows one band and the heterozygous shows three band

(Figure 4-2).

Figure (4.2): Restriction products for CYP2C19*2 by SmaI.

L: 100 bp ladder; lanes 1,3 & 4: Normal Homozygote fragment 212 and 109 bp;

Lane 3: Heterozygote fragment 321, 212 and 109bp; lane 5: blank negative control.

4.2.3. CYP2C19*3 PCR product gel electrophoresis

After running on 2% agarose gel the PCR product of CYP2C19*3 was identified as

272 bp DNA fragment using 100 bp DNA ladder along with negative control as

shown in Figure 4-1.

36

4.2.4. CYP2C19*3 restriction analysis gel electrophoresis

The PCR products for CYP2C19*3 were introduced to restriction analysis with the

restriction enzyme BamH1. It cuts the 272bp wild type allele (CYP2C19*1) but does

not cut PCR products containing the mutant allele (CYP2C19*3). When running on

agarose gel restriction digestion of a homozygote CYP2C19*1 gives two bands (175

bp and 96 bp), a homozygote CYP2C19*3 gives one band (272bp) and the

heterozygous gives three band (272bp, 175bp and 96bp) as shown in Figure 4.3.

Figure (4.3): Restriction products for CYP2C19*3 by BamH1.

L: 100 bp ladder; lane 1,2,3 and 4: Normal Homozygote fragment 175-bp and 96-

bp, lane 5: a blank negative control.

4.3. The CYP2C19 Genotyping results

4.3.1. Genotyping frequency of CYP2C19*2 allele

Table 4-5 illustrates the genotype frequencies of CYP2C19*2. The frequency of the

wild type homozygtes (GG) was 70.0 %, the heterozygotes (GA) was 29.1% while

the frequency of the homozygotes for the polymorphic allele (AA) was 0.9%.

CYP2C19*3

37

Table (4.5): Genotyping Frequency of CYP2C19*2 allele

Genotype of CYP2C19 Frequency %

(*1/*1) GG 77 70.0

(*1/*2) GA 32 29.1

(*2/*2) AA 1 0.9

4.3.2. Genotyping frequency of CYP2C19*3 allele

Table 4-6 illustrate the genotype frequencies and percent of Cyp2C19*3. The

frequency of the wild type GG was 95.5 %, the heterozygote GA was 4.5% and no

homozygotes for the polymorphic allele AA were found.

Table (4.6): Frequency of genotypes of CYP2C19*3 allele

Genotype Frequancy %

(*1/*1) GG 105 95.5

(*1/*3) GA 5 4.5

(*3/*3) AA 0 0.0

4.3.3. Overall genotype distribution of CYP2C19

The results of the study indicate that more half of study population (67.3%) were

homozygotes for the wild type allele (*1/*1); 27.3 % were heterozygotes to the

CYP2C19*2 allele (i.e. 1*/2*); 2.7% were heterozygotes to the CYP2C19*3 allele

(1*/3*); 1.8% were compound heterozygotes (2*/3*) and 0.9% homozygotes for

2*/2* mutant allele. On the other hand, the *3/*3 genotype was not detected in the

present study population. By assuming random mating of population in Gaza strip

and applying the Hardy-Weinberg equation for three alleles, the allelic frequency of

the wild type allele *1 was 82.3%, while the frequency of the polymorphic allele *2

was 15.5% and that of the polymorphic allele *3 was 2.3%. The three alleles are in

equilibrium and their frequency is not significantly different from the expected

Hardy-Weinberg frequency (p-value = 0.325; Table 4.7). The calculated chi-square

of our data at 0.05 significant level is 4.69, and the critical value from the chi-square

test table is 7.815. So our calculated chi test is less than critical value from the table,

indicating that our population is in Hardy– Weinberg equilibrium.

38

Table (4.7): Genotype distribution of CYP2C19

Genotype Observed Frequency ¥Expected frequency % by

Hardy–Weinberg law P_value

(*1/*1) 74 74.46

0.325

(*1/*2) 30 27.97

(*1/*3) 3 4.11

(*2/*2) 1 2.63

(*2/*3) 2 0.77

(3*/*3) 0 0.06 ¥ the expected frequency was calculated based on Hardy–Weinberg law

4.3.4. Distribution of CYP2C19 genotypes frequency by gender

The number of male cases in this study was 73 cases, of them, 63% (46/73) were

carrying the wild type allele (*1/*1), 30.1% (22/73) were (*1/*2), 4.1% (3/73) were

(*1/*3) and 2.7% (2/73) were compound heterozygotes (*2/*3) (Table 4.9). The

calculated allele frequency of CYP2C19*1, *2 and *3 alleles in males was found

80.1%, 16.1% and 3.1% respectively. The females were 37 cases, of them, 76%

(28/37) were carrying the (*1/*1) genotype, 21.6% (8/37) were carrying the (*1/*2)

genotype and only one case homozygotes to the *2 allele (*2/*2). The calculated

allele frequency of CYP2C19*1, and *2 alleles in females was 86.5% and 13.5 %

respectively. No *3 allele was found in the females in this study population. The

statistical analysis of shows no statistically significant difference in distribution of

the CYP2C19 genotypes between males and females (P-value 0.332; Table 4.8).

Table (4.8): Distribution of CYP2C19 genotypes by gender

Gender CYP2C19

Total P-value *1/*1 *1/*2 *2/*2 *1/*3 *2/*3

Male 46 22 0 3 2 73

0.332 Female 28 8 1 0 0 37

Total 74 30 1 3 2 110

39

4.3.5 The CYP2C19 genotype and predicted phenotype

According to the genotype status, the metabolizing status of CYP2C19

polymorphism may be classified into three phenotypes, extensive metabolizer (EM)

carrying normal function (wild-type) alleles (CYP2C19*1/*1), intermediate

metabolizer (IM) carrying one loss-of-function allele (*1/*2 or *1/*3) and poor

metabolizer (PM) carrying two loss-of-function alleles (*2/*2, *2/*3 or *3/*3). In

the present study the distribution of patients by the CYP2C19 phenotypes was: 67%

EM, 30% IM and 3% PM (Figure 4.4).

Figure (4.4): CYP2C19 metabolizing status in the study population

4.4 Stent restenosis

Overall, 9 out of the 110 patients enrolled in this study (8.2%) experienced at least

one event of stent restenosis (Figure 4.5). Six of them were carrying the *1/*2

genotype, one case had the *1/*3 genotype, one case the *1/*1 genotype and one

case had the *2/*2 genotype (Figure 4.6).

Figure (4.5): distribution of patient according to restenosis

EM 67.3%

IM 30%

PM 2.7%

9

101

0

20

40

60

80

100

120

Yes No

40

Figure (4.6): Genotyping distribution of restenosis cases

4.4.1. Impact of CYP2C19 polymorphism on stent restenosis

4.4.1.1. Impact of CYP2C19*2 mutation on stent restenosis

The distribution of cases with stent restenosis event by CYP2C19*2 genotype is

presented in Table 4.9. Most of the restenosis cases (7/9) were either hetero- or

homozygous for the polymorphic allele *2. This distribution was found statistically

significant ( (1) = 10.65, P-value = 0.001) [5% (CI), .019-0.5, p=0.001].

Table (4.9): Distribution of restenosis cases by the CYP2C19*2 allele genotype

Genotype Restenosis P_Value

Yes No

10.65 0.001 (*1/*1) 2 75

# (*1/*2) or (*2/*2) 7 26

Total 9 101 #(*1/*2) & (*2/*2) were combined together in one category for the sake of statistical

analysis

4.4.1.2 Impact of CYP2C19*3 mutation on stent restenosis

In contest of the CYP2C19*3 allele genotypes, there are only five cases carrying the

(1*/3*) genotype representing 4.5% of all enrolled cases in the present study. Of

these heterozygotes, only one case suffered from restenosis, representing 11.1% (1/9)

of the restenosis cases (Table 4.10). This distribution was found statistically not

significant (p-value = 0.324).

(*1/*1) (*1/*2) (*1/*3) (*2/*2)

Frequency 1 6 1 1

0

1

2

3

4

5

6

7

41

Table (4.10): Distribution of restenosis cases according to CYP2C19*3 genotype

Genotype Restenosis P_Value

Yes No

0.324 *1/*1 8 97

*1/*3 1 4

Total 9 101

4.4.2. Relationship between restenosis and hypertension

Out of the nine patients who developed restenosis, 7 were hypertensive (77.8%) and

the rest were non-hypertensive. This distribution was statistically not significant

(P=0.556; Table 4.11).

Table (4.11): Distribution of stent restenosis patients by hypertension

Restenosis P_Value

Yes (%) No (%) Total

0.556 Hypertension Yes 7 (77.8) 69 (68.3) 76

No 2 (22.2) 32 (31.7) 34

Total 9 101 110

4.4.3. Relation between restenosis and Diabetes mellitus

Seven cases of the restenosis patients were diabetic (77.8%) compared to 64.4% of

the patients with no restenosis. This difference however, was not statistically

significant (p-value = 0.417; Table 4.12).

Table (4.12): Distribution of stent restenosis patients by diabetes mellitus

Restenosis P-Value

Yes (%) No(%) Total

0.417 DM Yes 7 (77.8) 65 (64.4) 72

No 2 (22.2) 36 (35.6) 38

Total 9 101 110

4.4.4. Relation between restenosis and age

The mean age for restenosis cases was 54.6 ± 9, and for non-stenosis cases was

60.7±11.3 years, The statistical analysis shows no statistical significance in this

distribution (p-value = 0.115 Table 4.13).

42

Table (4.13): Distribution of stent restenosis patients by age

Restenosis P-Value

Yes No

0.115 Mean Age (year) 54.6 ± 9 60.7 ± 11.3

Total 9 101

4.4.5. Relation between restenosis and gender

Out of 110 patients, 73 were men. Similarly, of the 9 patients who developed

restenosis, 8 were men (11%) and one was a woman (2.7%). However, this higher

rate of restenosis in men than in women, after the percutaneous treatment was

statistically not significant (P-value = 0.136; Table 4.14).

Table (4.14): Distribution of stent restenosis patients by gender

Restenosis P-Value

Yes (%) No(%) Total

0.136 Gender Male 8 (11) 65 (89) 73

Female 1 (2.7) 36 (97.3) 37

Total 9 101 110

4.4.6 Relation between restenosis and body mass index (BMI)

The BMI mean for restenosis cases was 27 ± 2.6 kg/m2, and for non-stenosis cases

was 29.5 ± 4.4 kg/m2. The statistical analysis shows no significance relation in this

distribution (p-value = 0.103, Table 4.15).

Table (4.15): Distribution of stent restenosis patients by BMI

Restenosis P-Value

Yes (kg/m2) No (kg/m

2)

0.103 BMI 27 ± 2.6 29.5 ± 4.4

Total 9 101

43

4.4.7 Relation between restenosis and family history of CAD

As indicated in Table 4.16 the 9 patients who developed restenosis, 1 (11.1%) had a

positive family history of CAD. There was no significant relationship between

family history and risk of restenosis (P=0.062).

Table (4.16): Distribution of stent restenosis patients by Family history of heart

disease

Restenosis P-Value

Yes (%) No(%) Total

0.062 Family history

of heart disease

No 8 (88.9) 58 (57.4) 65

Yes 1 (11.1) 43 (42.6) 44

Total 9 101 110

4.4.8 Relation between restenosis and Segment of coronary legion

Out of 110 patients, in-stent restenosis occurs in two arteries, 4/9 cases in the LAD

artery (44.5%) and 5/9 cases RCA artery (55.5%). There was no statistically

significant relationship between the type of lesion and restenosis (P=0.343; Table 4-

17).

Table (4.17): Relation of stent loci and in-stent restenosis

Restenosis P-Value

Yes (%) No(%) Total

0.343 Stent loci

LAD 4(44.4) 45(41.6) 49

RCA 5(55.6) 31(40.7) 36

LCX 0 19 (18.8) 19

OM 0 6 (5.9) 6

Total 9 101 110

LAD= Left Anterior Descending Artery, LCX= Left Circumflex Artery, RCA= Right

Coronary Artery, RCX= Ramus Circumflexes, OM= Obtuse Marginal.

Chapter Five

Discussion

44

Chapter 5

Discussion

Cardiovascular diseases are globally the killer number one, representing 31% of all

global deaths in 2012. Of these deaths an estimated 7.4 million were due to coronary

heart disease (WHO, 2015 and Mathers et al., 2008). The current standard

management for CAD is a dual antiplatelet therapy (aspirin and clopidogrel), in

addition to coronary reperfusion or revascularization (Husted , 2015; Ferreiro and

Angiolillo, 2012). Knowledge of the individual’s genotype can be used to optimize

clopidogrel antiplatelet therapy (Hagymási et al., 2011). The pharmacodynamic

response to clopidogrel varies widely from subject to subject, and about 25% of

patients treated with standard clopidogrel doses display low inhibition of ADP-

induced platelet aggregation (Matetzky et al., 2004). This poor response to

clopidogrel is associated with an increased risk of recurrent ischemic events (Hulot et

al., 2006).

Genetic polymorphisms in CYP2C19, an enzyme required for clopidogrel

bioactivation have been shown to be associated with clopidogrel antiplatelet

effectiveness, and represents a risk factor for recurrent ischemic cardiac events

(Nakata et al., 2013). The polymorphism associated with cloidogrel therapy exhibits

marked racial heterogeneity, with the PM phenotype representing 13-23% of oriental

populations, but only 2-5% of Caucasian populations. Two defective CYP2C19

alleles (CYP2C19*2 and CYP2C19*3) have been described, which account for more

than 99% of Oriental PM alleles and approximately 87% of Caucasian PM

alleles (OMIM, 2016).

To the best of our knowledge, this is the first study in Palestine reporting the impact

of CYP2C19 loss-of-function alleles, CYP2C19*2 and CYP2C19*3, in association

with stent restenosis in CVD patients managed with PCI and clopidogrel as

antiplatelet therapy.

The importance of this study relates to the fact that an understanding of the

distribution of SNPs is crucial for the future application of pharmacogenomic to

45

different population groups. Such applications have recently been performed in

warfarin therapy (Ross et al., 2010).

The small number of patients who experienced stent restenosis (n=9) may have

resulted from the fact that they were given 300 mg of clopidegrel prior to the PCI

and maintained at 75 mg/day for the six later months. Administration of 300 mg

loading dose immediately before PCI is sufficient to prevent major adverse cardiac

events (MARC) (Wolfram et al., 2006). One-third of patients however, may have a

suboptimal antiplatelet response early after intervention using this treatment regimen

(Gurbel et al., 2003).

In this study, the frequency of CYP2C19*1, *2 and *3 alleles was 82.3%, 15.5% and

2.3% respectively. The allelic frequency of CYP2C19*2 is lower than those reported

in Oceanian 61%, South/Central Asian 34%, East Asians 29%, Indian 34% and

Chinese 31% (Xie et al., 2013; Shalia et al., 2013 and Scott et al., 2011). On the

other hand, the frequency of CYP2C19*2 allele was found consistent with Middle

Eastern populations including the Egyptian (11.0%), Saudi (11.2), Lebanese (13%)

Jordanian (16%) , Israeli Jewish (15%), and Tunisian (11.5%); and with African

American (12%), Turkish (13.5%), Iranian (14%), and other Caucasians and

European populations (15%) (Nassar et al., 2014; Abid et al., 2013; Saeed and Mayet

2013; Strom et al., 2012; Zalloum et al., 2012; Jureidini et al., 2011; Scott et al.,

2011; Zand et al., 2005; Hamdy et al., 2002 and Sviri et al., 1999). CYP2C19*2

frequency in our population was slightly different from previous data in Gaza strip,

which showed lower frequency of CYP2C19*2 allele 9.6% and 5.7% among

pediatric hematological malignancy and healthy controls respectively (Sameer et al.,

2009). It was also different from 9.5% that in West bank and Jerusalem Palestinian

population (Nassar et al., 2014). The Palestinian population of Gaza strip may be

considered an inbreeding population because of the political disconnection of the

strip from other Palestinian areas, and the cultural tendency of the community to

mate in a consanguineous way. These factors may contribute to frequency difference

between our study population and west bank Palestinian population.

The CYP2C19*3 allele frequency in our study population is higher than those

recorded in Egyptian (0.2%) and Israeli (1%) (Sviri et al., 1999 and Hamdy et al.,

46

2002), and lower than those reported in Asians (8%), Oceanian 15% (Scott et al.,

2011). On the other hand, this allele was not detected in Belgian, Beninese,

Jordanian, Saudi and Iranian (Al-Jenoobi et al., 2013 and Shalia et al., 2013; Scott et

al., 2011; Zand et al., 2005; Allabi et al., 2003). Our result is consentient with

previous data from Gaza strip (3%) reported by Sameer et al., (2009).

The distribution of CYP2C19 variants in the Palestinian population is consistent with

the relatively high frequency of CYP2C19*2 allele all around the world. Buzoianu et

al., 2010 suggested that this mutation is old and has occurred before the separation of

Caucasians, Oriental and Black populations. By contrast, the CYP2C19*3 allele,

which was very low in our population, is specific to Asian and Oceanian ethnical

groups. The low frequency, or sometimes absence of this allele in different

Caucasians populations confirms the Asian specificity of this mutation and suggests

that this allele occurred quite recently, after the differentiation of Caucasian and

Oriental groups (Buzoianu et al., 2010).

According to the present study the PM phenotype frequencies in Palestinian patients

were 2.7 % which is in consistence with the range reported in Caucasians (2 to 5%)

and lower than in Oriental populations 13-23% (Tassaneeyakul et al., 2002 and

Goldstein et al., 1997).

Despite the small number of patients with stent restenosis, our findings show that

there is a significant relation between stent restenosis and carrying the variant allele

CY2C19*2 ( (1) = 10.65, P-value = 0.001) [5% (CI), .019-0.5, p=0.001]. Similar

results were previously presented by Sibbing et al (2009) who also stated that

CYP2C19*2 carrier status is significantly associated with an increased risk of ST

following coronary stent placement. In other words, we may assume that

the CYP2C19*2 genotype accounted for approximately 6.4% (7/110) of the variation

in clopidogrel response among the present study population.

Our data provides further support to previous reports linking the

CYP2C19*2 genotype and ADP-stimulated platelet aggregation in response to

clopidogrel (Hulot et al., 2006 and Yamamoto et al., 2011).

47

The CYP2C19*3 allele is the second common type among the reduced-function

genes. Our findings however, indicated that there is no significant relation between

stent restenosis and carrying this variant allele (P= 0.324).

Many other factors may exist and favor ST besides genetic polymorphism of

CYP2C19. They include DM, Hypertension, gender, age and BMI.

Patients with DM have higher cardiovascular poor predictor outcomes in all modes

of cardiovascularization (Mathew et al, 2004; West et al, 2004 and Bach et al., 1994).

Coronary in-stent restenosis after PCI occurs more frequently in diabetic individuals

than in non-diabetics (Scheen and Warzée ., 2004). However, our result show no

statistically significant relation between diabetic patient and stent thrombosis after

PCI (P = 0.417). These results are contradicted by a meta-analysis data from 55

studies including 128,084 patients which suggested there was a remarkable negative

effect of DM on coronary stent implantation (Qin et al., (2013), and supported by

meta-analysis which showed that the apparent effect of diabetes on restenosis rates

published in the literature was overrated and reduced to approximately one-half after

adjusting for the difference in age (Gilbert et al, (2004). Also work of Mohan and

Dhall, (2010), suggested that diabetes is not a strong predictor of restenosis.

Out of the nine patients who developed restenosis in this study, 7 were hypertensive.

This distribution was statistically not significant p-value= 0.556. As stated by others,

lack of negative impact of hypertension may result from the significant improvement

of the autonomic nerve function and ambulatory blood pressure indices of patients

with hypertension and coronary heart disease after PCI (yang et al., 2015). On the

contrary, hypertension was proposed by others to be an important predictor of

restenosis (Bach et al., 1994 and Mohan and Dhall, 2010).

Previous studies examining gender differences in patients undergoing coronary

angioplasty have reported that women had a higher in-hospital mortality and were at

increased risk for an adverse outcome in comparison with men (Kahn et al., 1992;

Bell et al., 1993; Watanabe et al., 2001 and Watanabe et al., 2001). On the other

48

hand, this relationship was claimed by other researchers not to exist, and sex and age

were not found to be predictors of restenosis (Jacobs et al., (2002) and Mohan and

Dhall, (2010), Macdonald et al., (1990). Our results advocate no relation between

gender and age and restenosis (p-value= 0.631 and 0.115 respectively).

The BMI mean for restenosis cases was 27 ± 2.6 kg/m2, and for non-stenosis cases

was 29.5 ± 4.4 kg/m2. The statistical analysis, shows no significance relation in this

distribution P-value = 0.103, which consistence with result obtained by Mohan and

Dhall, 2010). Wang et al., (2015) found that there is relationship between increase

the BMI and repeat revascularization for patients who underwent PCI.

Ou of the nine patients who developed restenosis, 4 developed restenosis in the LAD

and 5 in the RCA artery, and no restenosis occurs in the LCX and OM arteries. There

was no statistically significant relationship between the type of lesion and restenosis

(P=0.26).

Chapter six

Conclusions &

Recommendations

49

Chapter 6

Conclusions and Recommendations

6.1. Conclusions

The present study focused on the polymorphisms of CYP2C19 gene in 110 unrelated

men and women patients managed with PCI and treated with Clopidogrel in Gaza

strip- Palestine. The following conclusions can be drown from the study outcomes

The allelic frequencies of CYP2C19 alleles*1 (82.3%), *2 (15.5%) and *3

(2.3%) and frequency of PM 2.7% are in accordance with other Caucasian

populations, while none of the enrolled subjects was homozygous for

CYP2C19*3.

A significant relationship was found between in-stent restenosis, found in

8.2% of patients and carrying the CYP2C19*2, but not the CYP2C19*3

allele.

Other risk factors for in-stent restenosis including hypertension, diabetes

mellitus, age, sex and body mass index were not found to be significant

relation in our populations.

50

6.2. Recommendations

The data presented in this study will help physicians prescribing clopidogrel or

considering other antiplatelet therapy by providing an approximate percentage of

poor metabolizers. It is therefore recommended to:

Test the polymorphisms CYP2C19*2 and CYP2C19*3 for patients with in-

stent restenosis. This would allow physicians to give a genotype-guided

treatment, which could be more cost-effective and result in a reduction of

clinical adverse outcomes.

Further studies must be performed to evaluate the role of other alleles

CYP2C19 genes as possible determinants recurrent of stenosis.

51

The Reference List

Abed, Y., & Jamee, A. (2015). Characteristics and risk factors attributed to coronary

artery disease in women attended health services in Gaza-Palestine:

Observational Study. World Journal of Cardiovascular Diseases, 5, 9-18.

Abid, L., Laroussi, L., Bahloul, A., Siala, A., Abdelhédi, R., Kharrat, N., Hentati, M.,

& Kammoun, S. (2013). Impact of cytochrome P450 2C19* 2 polymorphism on

the clinical cardiovascular events after stent implantation in patients receiving

clopidogrel of a southern Tunisian region. World Journal of Cardiovascular

Diseases, 3 (1), 4-10.

Abu-Eid, S.I. (2006). CYP2C19 Polymorphism in childhood hematological

malignancy (Unpublished Master Thesis). The Islamic University of Gaza, Gaza.

Al-Jenoobi, F.I., Alkharfy, K.M., Alghamdi, A.M., Bagulb, K.M., Al-Mohizea,

A.M., Al-Muhsen, S., & Al-Dosari, M.S. (2013). CYP2C19 genetic

polymorphism in Saudi Arabians. Basic and clinical pharmacology and

toxicology, 112(1), 50-54.

Allabi, A.C., Gala, J.L., Desager, J.P., Heusterspreute, M., & Horsmans, Y. (2003).

Genetic polymorphisms of CYP2C9 and CYP2C19 in the Beninese and Belgian

populations. British journal of clinical pharmacology, 56(6), 653-657.

American College of Cardiology Foundation/American Heart Association (2009).

Guideline for Assessment of Cardiovascular Risk in Asymptomatic adult.

Circulation, 122, 584-636.

American Heart Association (2010). Cardiac Catheterization and Angiogram.

Retrieved in September 2015 from: https://www.heart.org/idc/groups/heart-

public/@wcm/@hcm/documents/downloadable/ucm_317626.pdf.

American Heart Association. (2015). Heart disease and stroke statistics at a glance.

Retrieved in October 2015 from: https://www.heart.org/idc/groups/ahamah-

public/@wcm/@sop/@smd/documents/downloadable/ucm_470704.pdf

Anderson, J.L., Adams, C.D., Antman, E.M., Bridges, C.R., Califf, R.M., Casey,

D.E., & Chavey, W.E. (2007). Guidelines for the management of patients with

unstable angina/non–ST-elevation myocardial infarction. Journal of American

College of Cardiology, 50(7), e1-e157.

52

Angiolillo, DJ, Fernandez, A, Bernardo, E, Alfonso, F, Macaya, C, Bass, T.A., &

Costa, M.A (2007).Variability in individual responsiveness to clopidogrel:

clinical implications, management, and future perspectives. Journal of the

American College of Cardiology, 49(14), 1505-1516.

Angiolillo, D.J., & Ferreiro, J.L. (2010). Platelet adenosine diphosphate P2Y12

receptor antagonism: benefits and limitations of current treatment strategies and

future directions. Revista Española de Cardiología (English Edition), 63(1), 60-

76.

Bach, R., Jung, F., Kohsiek, I., Özbek, C., Spitzer, S., Scheller, B., & Schieffer, H.

(1994). Factors affecting the restenosis rate after percutaneous transluminal

coronary angioplasty. Thrombosis research, 74, S55-S67.

Balghith, M., Alghmadi, A.M., Ayoub, K.M., Saleh, A.A., Aziz, M.S., Algahtany,

M., Almasood, F., & Albargy, G.M. (2013). Stent thrombosis is a major concern

in clinical practice: A single Saudi center experience. Journal of the Saudi Heart

Association, 25(4), 233-238

Bell, M.R., Holmes, D.R., Berger, P.B., Garratt, K.N., Bailey, K.R., & Gersh, B.J.

(1993). The changing in-hospital mortality of women undergoing percutaneous

transluminal coronary angioplasty. The journal of American medical association

(JAMA), 269(16), 2091-2095.

Bhalli, M.A, Lalbadshah., & Babar, M.A. (2015). Coronary artery disease; frequency

of risk factors among healthy male paramedical staff. The Professional Medical

Journal, 22(2), 244-249.

Bibi, Z. (2008). Role of cytochrome P450 in drug interactions. Nutrition and

Metabolism, 5(27), 1-20.

Brandt, J.T., Clos,e S.L., Iturria, S.J., Payne, C.D., Farid, N.A., Ernest, C.S., Lachno,

D.R., Salazar, D., & Winters, K.J. (2007). Common polymorphisms of

CYP2C19 and CYP2C9 affect the pharmacokinetic and pharmacodynamics

response to clopidogrel but not prasugrel. Journal of Thrombosis

Hemostasis, 5(12), 2429-2436.

53

British Heart Foundation (2008). European Cardiovascular Disease Statistics.

International cardiovascular disease statistics, Statistical fact sheet populations,

Retrvied in October 2015 from:

https://www.bellevuecollege.edu/artshum/materials/inter/Spring04/SizeMatters/I

nternatCardioDisSTATsp04.pdf.

Buzoianu, A.D., Trifa, A.P., Popp, R.A., Militaru, M.S., Militaru, C.F., Bocşan, C.I.,

& Pop, I.V. (2010). Screening for CYP2C19* 2,* 3 and* 4 gene variants in a

Romanian population study group. Farmacia, 58(6), 806-812.

Capodanno, D., Dipasqua, F., & Tamburino, C. (2011). Novel drug-eluting stents in

the treatment of de novo coronary lesions. Vascular Health and Risk

Management, 7, 103-118.

Cavallari, L., Jeong, H., & Bress, A. (2011). Role of cytochrome P450 genotype in

the steps toward personalized drug therapy. Pharmacogenomics and

Personalized Medicine, 4, 123-136.

Centers for Disease Control and Prevention CDC. (2009). Heart Disease. Coronary

Artery Disease. Retrieved in December 2015 from:

http://www.cdc.gov/heartdisease/coronary_ad.htm.

Centers for Disease Control and Prevention (CDC). (2014). Global Health: CDC

24/7, Saving lives, protecting people. Retrieved in August 2015 from:

http://www.cdc.gov/globalhealth/index.html.

Chang, M. (2014). CYP2C19 polymorphisms in drug metabolism and response.

(Unpublished Thesis for doctoral degree). Clinical Pharmacology Karolinska

Institutet, Stockholm, Sweden.

Chiha, M, Njeim, M., & Chedrawy, E.G.(2012). Diabetes and coronary heart

disease: A Risk Factor for the Global Epidemic: International Journal of

Hypertension. 2012, 1-7.

Cuisset, T., Morange, P.E., & Alessi, M.C. (2012). Recent advances in the

pharmacogenetics of clopidogrel. Human genetics, 131(5), 653-664.

Cunningham, J. (2010). Socioeconomic disparities in self-reported cardiovascular

disease for Indigenous and non-Indigenous Australian adults; analysis of national

survey data, Cunningham Population Health Metrics. 8, (31), 1-11.

54

Dangas, G., Mehran, R., Guagliumi, G., Caixeta, A., Witzenbichler, B., Aoki, J.,

Peruga, J.Z., Brodie, B.R., Dudek, D., Kornowski, R., Rabbani, L.E., & Rabbani,

L. E. (2009). Role of clopidogrel loading dose in patients with ST-segment

elevation myocardial infarction undergoing primary angioplasty: results from the

HORIZONS-AMI (harmonizing outcomes with revascularization and stents in

acute myocardial infarction) trial. Journal of the American College of

Cardiology, 54(15), 1438-1446.

Danielson, P.B. (2002). The cytochrome P450 superfamily: biochemistry, evolution

and drug metabolism in humans. Current drug metabolism, 3(6), 561-597.

Dansette, P.M., Rosi, J., Bertho, G., & Mansuy, D. (2011): Cytochromes P450

catalyze both steps of the major pathway of clopidogrel bioactivation, whereas

paraoxonase catalyzes the formation of a minor thiol metabolite isomer.

Chemical research in toxicology, 25(2), 348-356.

De Silva, D.A., Woon, F.P., Moe, K.T., Chen, C.L., Chang, H.M., & Wong, M.C.

(2008). Concomitant coronary artery disease among Asian ischaemic stroke

patients. Annals Academy of Medicine, 37(7), 573-575.

Dean, L. (2013). Clopidogrel Therapy and CYP2C19 Genotype; Medical Genetics

Summaries. National Center for Biotechnology Information. Retrieved in May

2015 from: http://www.ncbi.nlm.nih.gov/books/NBK84114/.

Desta, Z., Zhao, X., Shin, J.G., & Flockhart, D.A. (2002). Clinical significance of the

cytochrome P450 2C19 genetic polymorphism. Clinical pharmacokinetics,

41(12), 913-958.

Drepper, M.D., Spahr, L., & Frossard, J.L. (2012). Clopidogrel and proton pump

inhibitors-where do we stand in 2012?. World journal of

gastroenterology, 18(18), 2161.

Ellison, C.A., Abou El-Ella, S.S., Tawfik, M., Lein, P.J., & Olson, J.R. (2012).

Allele and genotype frequencies of cyp2b6 and cyp2c19 polymorphisms in

egyptian agricultural workers. Journal of Toxicology and Environmental Health.

Part A, 75(4), 232–241.

Encyclopedia of science (2011). Coronary artery. Retrieved in January 2016 from:

http://www.daviddarling.info/encyclopedia/C/coronary_artery.html

55

Ferreiro, J.L., & Angiolillo, D.J. (2012). New directions in antiplatelet

therapy. Circulation: Cardiovascular Interventions, 5(3), 433-445.

Flachsbart, f., Ufer, M., Kleindorp, R., Nikolaus, S., Schreiber, S., & Nebel, A.

(2011). genetic variation in the CYP2C monooxygenase enzyme subfamily

shows no association with longevity in a german population. Journal of

Gerontology: Biological Sciences 66A, 11, 1186-1191.

Gawaz, M. (2004). Role of platelets in coronary thrombosis and reperfusion of

ischemic myocardium. Cardiovascular research, 61(3), 498-511.

Gaziano, T. (2005). Cardiovascular Disease in the Developing World and Its Cost-

Effective Management. Circulation, 112, 3547-3553

Genetic Home Reference (2015). CYP2C19. Retrieved in August 2015 from

http://ghr.nlm.nih.gov/gene/CYP2C19.

Gilbert, J., Raboud, J., & Zinman, B. (2004). Meta-analysis of the effect of diabetes

on restenosis rates among patients receiving coronary angioplasty

stenting. Diabetes Care, 27(4), 990-994.

Giusti, B., Gori, A.M., Marcucci, R., Saracini, C., Vestrini, A., & Abbate, R. (2010).

Determinants to optimize response to clopidogrel in acute coronary

syndrome. Pharmacogenomics and Personalized Medicine, 3, 33–50.

Giustino, G., Baber, U., Sartori, S., Mehran, R., Mastoris, I., Kini, A.S., Sharma,

S.K., Pocock, S.J., & Dangas, G.D. (2015). Duration of Dual Antiplatelet

Therapy Following Drug-Eluting Stent Implantation: A Systematic Review and

Meta-Analysis of Randomized Controlled Trials. Journal of the American

College of Cardiology, 15, 345-349.

Goldstein, J.A. (2001). Clinical relevance of genetic polymorphisms in the human

CYP2C subfamily. British Journal of Clinical Pharmacology, 52(4), 349–355.

Goldstein, J.A., Ishizaki, T., Chiba, K., de Morais, S.M., Bell, D., Krahn, P.M., &

Evans, A.P. (1997). Frequencies of the defective CYP2C19 alleles responsible

for the mephenytoin poor metabolizer phenotype in various Oriental, Caucasian,

Saudi Arabian and American black populations. Pharmacogenetics and

Genomics,7(1), 59-64.

Gurbel, P.A., & Tantry, U.S. (2007). Clopidogrel resistance?. Thrombosis

research, 120(3), 311-321.

56

Gurbel, P.A., Bliden, K.P., Hiatt, B.L., & O’Connor, C.M. (2003). Clopidogrel for

coronary stenting response variability, drug resistance, and the effect of

pretreatment platelet reactivity. Circulation, 107(23), 2908-2913.

Hamdy, S.I., Hiratsuka, M., Narahara, K., El-Enany, M., Moursi, N., Ahmed, M.E.,

& Mizugaki, M. (2002). Allele and genotype frequencies of polymorphic

cytochromes P450 (CYP2C9, CYP2C19, CYP2E1) and dihydropyrimidine

dehydrogenase (DPYD) in the Egyptian population. British journal of clinical

pharmacology, 53(6), 596-603.

Hansson, G. K. (2005). Mechanisms of disease Inflammation, Atherosclerosis, and

Coronary Artery Disease. New England journal of medicine, 352, 16 .

Hasanaj, Q.B., Wilson, J., Little, J., & Montazeri, J.C. (2013). Family History:

Impact on Coronary Heart Disease Risk Assessment beyond Guideline-Defined

Factors. Public Health Genomics, 16(5), 208-14.

Hossain, P., Kawa,r B., & El-Nahas, M. (2007). Obesity and Diabetes in the

Developing World- A Growing Challenge, The New England Journal of

Medicine, 356(3), 213-215.

Hulot, J.S., Bura, A., Villard, E., Azizi, M., Remones, V., Goyenvalle, C., Aiach M.,

Lechat, P., & Gaussem, P. (2006). Cytochrome P450 2C19 loss-of-function

polymorphism is a major determinant of clopidogrel responsiveness in healthy

subjects. Blood, 108(7), 2244-2247.

Ingelman-Sundberg, M. (2005). The human genome project and novel aspects of

cytochrome P450 research. Toxicology and Applied Pharmacology 207, 52-56.

Jacobs, A.K., Johnston, J.M., Haviland, A., Brooks, M.M., Kelsey, S.F., Holmes,

D.R., & Detre, K.M. (2002). Improved outcomes for women undergoing

contemporary percutaneous coronary intervention: a report from the National

Heart, Lung, and Blood Institute Dynamic registry. Journal of the American

College of Cardiology, 39(10), 1608-1614.

Jensen, L.O., Maeng M., Kaltoft, A., Thayssen, P., Hansen H.H., Bottcher M.,

Lassen J.F., Krussel L.R., Rasmussen K., & Hansen K.N. (2007). Stent

thrombosis, myocardial infarction, and death after drug-eluting and bare-metal

stent coronary interventions. Journal of the American college of cardiology,

50(5), 463-470.

57

Jik, D., Park, A., Bae, B., Shin, E., Park, S., & Jang, Y. (2012). Association of

cyp2c19*2 and *3 genetic variants with essential hypertension in koreans. Yonsei

Medical Journal, 53(6), 1113-1119.

Jureidini, I.D., Chamseddine, N., Keleshian, S., Naoufal, R., Zahed, L., & Hakime,

N. (2011). Prevalence of CYP2C19 polymorphisms in the Lebanese

population. Molecular Biology Reports, 38(8), 5449-5452.

Kahn, J.K., Rutherford, B.D., McConahay, D.R., Johnson, W.L., Giorgi, L.V.,

Shimshak, T.M., & Hartzier, G.O. (1992). Comparison of procedural results and

risks of coronary angioplasty in men and women for conditions other than acute

myocardial infarction. The American journal of cardiology, 69(14), 1241-1242.

Karaźniewicz-Łada, M., Danielak, D., Burchardt, P., Kruszyna, Ł., Komosa, A.,

Lesiak, M., & Główka, F. (2014). Clinical Pharmacokinetics of Clopidogrel and

Its Metabolites in Patients with Cardiovascular Diseases. Clinical

Pharmacokinetics, 53(2), 155–164.

Knights, K.M., Rowland, A., & Miners J.O. (2013). Renal drug metabolism in

humans: the potential for drug–endobiotic interactions involving cytochrome

P450 (CYP) and UDP glucuronosyl transferase (UGT). British Journal of

Clinical Pharmacology, 76 (4), 587-602.

Kubica, A., Kozinsk, M., Grzesk, G., Fabiszak, T., Navarese, E., & Goch, A. (2011).

Genetic determinants of platelet response to clopidogrel. Journal of Thrombosis

and Thrombolysis, 32 (4), 459-466.

Kulkarni, P. (2015). Family history of coronary artery disease as an additional risk

factor associated with coronary artery disease: A Descriptive Observational

Study. Journal of Clinical Trials in Cardiology, 2, 1-3.

Lamb, D.C., & Waterman, M.R. (2013). Unusual properties of the cytochrome P450

superfamily. Philosophical Transactions of the Royal Society B. Biological

Sciences, 368(1612), 20120434.

Lavie, J.C., Richard, V.M., Hector, O.V., & Louisiana. (2009). Obesity and

Cardiovascular Disease Risk Factor, Paradox, and Impact of Weight. Loss

Journal of disease: an international perspective. European Heart Journal,

34(42), 3286-3293

58

Lee, S.J. (2013). Clinical application of CYP2C19 pharmacogenetics toward more

personalized medicine. Frontiers in Genetics, 3, 1-13.

Li-Wan-Po, A., Girard, T., Farndon, P., Cooley, C., & Lithgow, J. (2010).

Pharmacogenetics of CYP2C19: functional and clinical implications of a new

variant CYP2C19*17. British Journal of Clinical Pharmacology, 69(3), 222-230.

Online Mendelian Inheritance in Man (OMIM). (2016). Cytochrome p450, subfamily

2C, polypeptide 19; CYP2C19. Retrieved in January 2016 from:

http://www.cypalleles.ki.se/cyp2c19.htm

Ma, T.K.W., Lam, Y.Y., Tan, V.P., & Yan, B.P. (2011). Variability in response to

clopidogrel: how important are pharmacogenetics and drug interactions?. British

Journal of Clinical Pharmacology, 72(4), 697–706

Macdonald, R.G., Henderson, M. A., Hirshfeld, J.W., Goldberg, S.H., Bass, T.,

Vetrovec, G., & Hill, J.A. (1990). Patient-related variables and restenosis after

percutaneous transluminal coronary angioplasty-A report from the M-HEART

Group. The American journal of cardiology, 66(12), 926-931.

Marieb, E.M. (2011). Essentials of Human Anatomy and Physiology, 10th Edition,

Amazon.com.

Matetzky, S., Shenkman, B., Guetta, V., Shechter, M., Beinart, R., Goldenberg, I.,

Novikov, I., Pres, H., Savion, N., Varon, D., & Hod, H. (2004). Clopidogrel

resistance is associated with increased risk of recurrent atherothrombotic events

in patients with acute myocardial infarction. Circulation, 109(25), 3171-3175.

Mathers, C., Fat, D.M., & Boerma, J.T. (2008). The global burden of disease: 2004

update. World Health Organization.

Mathew, V., Gersh, B.J., Williams, B.A., Laskey, W.K., Willerson, J.T., Tilbury,

R.T., Davis, B., & Holmes, D.R. (2004). Outcomes in patients with diabetes

mellitus undergoing percutaneous coronary intervention in the current era A

report from the prevention of restenosis with tranilast and its outcomes

(PRESTO) trial. Circulation, 109(4), 476-480.

McKinnon, R., Sorich, M., & Ward, M. (2008). Cytochrome P450 Part 1:

Multiplicity and Function. Journal of Pharmacy Practice and Research, 38(1),

55-57.

59

Mega, J.L., Close, S.L., Wiviott, S ., Shen, L., Hockett, R.D., Brandt, J.T., Walker,

J.R., Antman, E.M., Macias, M., Braunwald, E., & Sabatine, M.S. (2009):

Cytochrome p-450 polymorphisms and response to clopidogrel. New England

Journal of Medicine, 360(4), 354-362.

Mohan, S., & Dhall, A. (2010). A comparative study of restenosis rates in bare metal

and drug-eluting stents. International Journal of Angiology, 19(2), e66.

Mozaffarian, D., Benjamin, E.J., Go, A.S., Arnett, D.K., Blaha, M.J., Cushman, M.,

& Howard, V.J. (2015). Heart Disease and Stroke Statistics-2016

Update. Circulation. Retrieved in September 2015 from:

https://circ.ahajournals.org/content/early/2014/12/18/CIR.0000000000000152.ful

l.pdf

Nakamoto, K., Kidd, J., Jenison, R., Klaassen, C., Wan J., Kidd A., & Zhong, X.

(2007). Genotyping and haplotyping of CYP2C19 functional alleles on thin-film

biosensor chips. Pharmacogenetics and Genomics, 17(2), 103-114.

Nassar, S., Amro, O., Abu-Rmaileh, H., Alshaer, I., Korachi, M., & Ayesh, S.

(2014). ABCB1 C3435T and CYP2C19* 2 polymorphisms in a Palestinian and

Turkish population: A pharmacogenetic perspective to clopidogrel, Meta gene, 2,

314-319.

National Center for Biotechnology Information. (2015): CYP2C19 cytochrome

P450, family 2, subfamily C, polypeptide 19 [ Homo sapiens (human) ]. Retrived

in September 2015 from:

http://www.ncbi.nlm.nih.gov/gene?Db=gene&Cmd=DetailsSearch&Term=1557

#bibliography.

Norgard, N.B., & Abu-Fadel, .M. (2008). Future Prospects in Anti-Platelet Therapy:

A Review of Potential P2Y12 and Thrombin Receptor Antagonists: Recent

Patents on Cardiovascular Drug Discovery, 3(3), 194-200.

Norgard, N.B., & Abu-Fadel, .M. (2009). Comparison of prasugrel and Clopidogrel

in patients with acute coronary syndrome undergoing percutaneous coronary

intervention. Dove press journal: vascular health and risk management, 5, 873-

82.

60

North of England Hypertension Guideline Development Group. (2004). Essential

hypertension: managing adult patients in primary care. United Kingdom.

University of Newcastle upon Tyne.

Palestinian Ministry of Health. (2010). Annual Report .Health status in Palestine

(2010). State of Palestine, Ministry of Health; Health Management Information

Center (HMIS).

Ponikowski, P., Anke,r S.D., AlHabib, K.F., Cowie, M.R., Force, T.L., Hu,

S., Jaarsma, T., Krum, H., Rastogi, V., Rohde, L.E., Samal, U.C., Shimokawa,

H., Siswanto, B.B., Sliwa, K., & Filippatos, G. (2014). Heart failure: preventing

disease and death worldwide. ESC Heart Failure, 1, 4-25.

Qin, S.Y., Zhou, Y., Jiang, H.X., Hu, B.L., Tao, L., & Xie, M.Z. (2013). The

association of diabetes mellitus with clinical outcomes after coronary stenting: a

meta-analysis. PloS one, 8(9), e72710.

Rainone, A., De Lucia, D., Morelli, C., Valente, D., Catapano, O., & Caraglia, M.

(2015). Clinically Relevant Of Cytochrome P450 Family Enzymes For Drug-

Drug Interaction In Anticancer Therapy. World Cancer Research Journal, 2 (2),

524.

Rocha, V.Z. and Libby, P. (2009). Obesity, inflammation, and atherosclerosis.

Cardiology, 6, 399-409.

Rogan, P.K., Svojanovsk, S., & Leeder, J.S. (2003). Information theory-based

analysis of CYP2C19, CYP2D6 and CYP3A5 splicing mutations.

Pharmacogenetics and Genomics, 13(4), 207-218.

Rudberg, I., Mohebi, B., Hermann, M., Refsum, H., & Molden, E. (2008). Impact of

the ultrarapid CYP2C19* 17 allele on serum concentration of escitalopram in

psychiatric patients. Clinical Pharmacology and Therapeutics, 83(2), 322-327.

Rydén, L., Grant, P.J., Anker, S.D., Berne, C., Cosentino, F., Danchin, N., & Marre,

M. (2013). ESC Guidelines on diabetes, pre-diabetes, and cardiovascular

diseases developed in collaboration with the EASD. ESC guidelines. European

Heart Journal. 34(39), 3035-3087.

Sadeghi, R., Adnani, N., Erfanifar, A., Gachkar, L., & Maghsoomi, Z. (2013):

Premature Coronary Heart Disease and Traditional Risk Factors-Can We Do

Better?. International Cardivascular Research Journal , 7(2), 46-50.

61

Saeed, L.H., & Mayet, A.Y. (2013). Genotype-Phenotype analysis of CYP2C19 in

healthy Saudi individuals and its potential clinical implication in drug

therapy. International journal of medical science, 10(11), 1497-502.

Sakakura, K., Nakano, M., Otsuka, F., Ladich, E., Kolodgie, F., & Virmani R.

(2013). Pathophysiology of Atherosclerosis Plaque Progression. Heart, Lung and

Circulation, 22(6), 399-411

Sangkuhl, K., Klein, T.E., & Altman, R.B. (2010). Clopidogrel pathway.

Pharmacogenet Genomics, 20 (7), 463-465.

Scott, S., Sangkuhl, K., Gardner, E., Stein, C., Hulot, J.S., Johnson, J., Roden, D.M.,

Klein, T.E., Sabatine, M.S., Johnson, J.A., & Shuldiner, A. (2011). Clinical

Pharmacogenetics Implementation Consortium Guidelines for Cytochrome

P450-2C19 (CYP2C19) Genotype and Clopidogrel Therapy. Clinical

Pharmacology and Therapeutics, 90(2), 328–332.

Scott, S.A., Sangkuhl, K., Shuldiner, A.R., Hulot, J.S., Thorn, C.F., Altman, R.B., &

Klein, T.E. (2012). PharmGKB summary: very important pharmacogene

information for cytochrome P450, family 2, subfamily C, polypeptide 19.

Pharmacogenetics and Genomics, 22(2), 159-165.

Scott, S.A., Sangkuhl, K., Stein, C.M., Hulot, J.S., Mega, J.L., Roden, D. M., Klein

TE., Sabatine, M.S., Johnson, J.A., & Shuldiner, A.R. (2013). Clinical

Pharmacogenetics Implementation Consortium Guidelines

for CYP2C19 Genotype and Clopidogrel Therapy: 2013 Update. Clinical

Pharmacology and Therapeutics, 94(3), 317–323.

Sim, S.C. (2010). The human cytochrome P450 (CYP) allele nomenclature database.

Retrieved in December 2015 from http://www.cypalleles.ki.se/cyp2c19.htm.

Sim, S.C., & Ingelman-Sundberg, M. (2010). The Human Cytochrome P450 (CYP)

Allele Nomenclature website: a peer-reviewed database of CYP variants and

their associated effects. Human Genomics, 4(4), 278–281.

Singh, S., Ramesh, V., Sonal, S., Nakul, S., Satyendra, T., & Suraksha, A. (2006).

Cardiovascular Risk Factors in North Indians: A Case-Control Study. American

Journal of Biochemistry and Biotechnology, 2(1), 19-24.

62

Smith, J.N., Negrelli, J.M., Manek, M.B., Hawes, E.M., & Viera, A.J. (2015).

Diagnosis and Management of Acute Coronary Syndrome: An Evidence-Based

Update. The Journal of the American Board of Family Medicine, 28(2), 283-293.

Starr, C., Evers, C., & Starr, L. (2009). Biology: Today and Tomorrow With

Physiology, Cengage Learning, 422.

Stewart, R., Held, C., Brown, R., Vedin, O., Hagstrom, E., Lonn ,E., Armstrong, P.,

Granger, C.B., Hochman, J., Davies, R., Soffer, J., Wallentin, L., & Lane, H.

(2013). Physical activity in patients with stable coronary heart disease: an

international perspective. European Heart Journal, 34(42), 3286-3293.

Stocker, R., John, F., & Keaney, J. (2004): Role of Oxidative Modifications in

Atherosclerosis. Physiology Review, 84,1381-1478.

Sviri, S., Shpizen, S., Leitersdorf, E., Levy, M., & Caraco, Y. (1999). Phenotypic-

genotypic analysis of CYP2C19 in the Jewish Israeli population. Clinical

pharmacology and therapeutics, 65(3), 275-282.

The GeneCards human gene database. (2015). CYP2C19 Gene(Protein Coding).

Retrieved in September 2015 from: http://www.genecards.org/cgi-

bin/carddisp.pl?gene=CYP2C19.

Trenk, D., Hochholzer, W., Fromm, M.F., Chialda, L.E., Pah, A., Valina, C.M.,

Stratz, C., Schmiebusch, P., Bestehorn, H.P., Büttner, H.J., & Neumann, F.J.

(2008). Cytochrome P450 2C19 681G>A Polymorphism and High On-

Clopidogrel Platelet Reactivity Associated With Adverse 1-Year Clinical

Outcome of Elective Percutaneous Coronary Intervention With Drug-Eluting or

Bare-Metal Stents FREE. Journal of the American College of Cardiology,

51(20),1925-1934.

Tu, J.V., Bowen, J., Chiu, M., Ko, D.T., Austin, P.C., He, Y., Hopkins, R., Tarride,

J.E., Blackhouse, G., & Lazzam, C. (2007). Effectiveness and safety of drug-

eluting stents in Ontario. New England Journal of Medicine, 357(14), 1393-

1402.

Walter, A. (2014). Unstable Angina, E Medicine. Retrieved in May 2015 from:

http://www.emedicine.com/ med/byname/unstable-angina.htm

63

Wang, Z.J., Gao, F., Cheng, W.J., Yang, Q., & Zhou, Y.J. (2015). Body Mass Index

and Repeat Revascularization After Percutaneous Coronary Intervention: A

Meta-analysis. Canadian Journal of Cardiology, 31(6), 800-808.

Watanabe, C.T., Maynard, C., & Ritchie, J.L. (2001). Comparison of short-term

outcomes following coronary artery stenting in men versus women. The

American journal of cardiology, 88(8), 848-852.

Weber, C., & Noels, C. (2011). Attherosclerosis: current pathogenesis and

therapeutic options: Nature medicine, 17(11), 1410-1422.

Wolfram, R.M., Torguson, R.L., Hassani, S.E., Xue, Z., Gevorkian, N., Pichard, A.

D., Salter L.F., & Waksman, R. (2006). Clopidogrel loading dose (300 versus

600 mg) strategies for patients with stable angina pectoris subjected to

percutaneous coronary intervention. The American journal of cardiology, 97(7),

984-989.

World Health Organization (2015). Cardiovascular diseases (CVDs): fact sheet.

Retrieved in January 2015 from

http://www.who.int/mediacentre/factsheets/fs317/en/.

Yang, J., Yang, X., Liu, W., & Cao, T. (2015). Effects of percutaneous coronary

intervention on the ambulatory blood pressure of patients with hypertension and

coronary heart disease. Irish Journal of Medical Science (1971-). 184(4), 845-

850.

Yang, X., Zhang, B., Molony ,G., Chudin, E., Hao, K., Zhu,J., Gaedigk, A., Suver,

C., Zhong, H., Leeder, S., Guengerich, F.P., Stephen, C., strom., Schuetz E.,

Thomas H., Rushmore., Roger G, Ulrich., Slatter G., Schadt E.E., Kasarskis, A.,

& Lum, P.Y (2010). Systematic genetic and genomic analysis of cytochrome

P450 enzyme activities in human liver. Genome Research, 20(8), 1020-1036.

Yang, Y.S., Wong, L.P., Lee, T.C., Mustafa, A.M., Mohamed, Z., & Lang, C.C.

(2004). Genetic polymorphism of cytochrome P450 2C19 in healthy Malaysian

subjects. British Journal of Clinical Pharmacology, 58(3), 332–335.

Yousef, AM., Bulatova, NR., Newman, W., Hakooz, N., Ismail, S., Qusa, H., Zahran

F., Anwar AN., Hasan F., Zaloom I., Khayat G., Al-Zmili R., Naffa, R., & Al-

Diab, O. (2012). Allele and genotype frequencies of the polymorphic cytochrome

64

P450 genes (CYP1A1, CYP3A4, CYP3A5, CYP2C9 and CYP2C19) in the

Jordanian population. Molecular biology reports, 39(10), 9423-9433.

Zalloum, I., Hakooz, N., & Arafat, T. (2012). Genetic polymorphism of CYP2C19 in

a Jordanian population: influence of allele frequencies of CYP2C19* 1 and

CYP2C19* 2 on the pharmacokinetic profile of lansoprazole. Molecular biology

reports, 39(4), 4195-4200.

Zand, N., Tajik, N., Hoormand, M., Moghaddam, A.S., & Milanian, I. (2005): Allele

frequency of CYP2C19 gene polymorphisms in a healthy Iranian

population. Iranian Journal of Pharmacology and Therapeutics, 4(2), 124-127.

Zhou, Y., Wei, X., Lu, J., Ye, X.F., Wu, M.J., XU, J.F., Qin, Y.Y., & He, J. (2012).

Effects of combined aspirin and clopidogrel therapy on cardiovascular outcomes:

A systematic review and meta-analysis. PLoS One, 7(2).

65

Annex (1): Approval of Helsinki committee

66

Annex (2): Approval of MOH for sample collection

67

Annex (3): Data collection

Personal

Data……………………………………….. Date ……………………………….

Name

(optional) ………………………. Age ……. Hospital Number ………..

Mobile ……………………….. Gender ……. Residence Area ……….

Weight ……………………… Height …… Education level ………..

Medical Data

Surgical Operation

Yes No Years # Comments

PCI (stand) ……. …. …… …. …………………………

Open Heart Surgery …… …. ……. …. ……………………………

Medication

Yes No dose day Period

Clopidogrel ….. ….. …….. ……… …………………………………

Aspirin ….. ….. …….. ……… . ………………………………

Laboratory data

WBC ………………….

RBC ………………….

Hb ………………….

PLT ………………….