Journal of Surgical Research 149, 171–176 (2008)

Cyclosporine Inhibition of Angiogenesis Involves the TranscriptionFactor HESR1

Gaurang Shah, M.D.,* Frank A. Middleton, Ph.D.,† Karen L. Gentile, M.S.,† Sudipta Tripathi, Ph.D.,*David Bruch, M.S.,* Kristopher G. Maier, Ph.D.,* and Dilip S. Kittur, M.D.*,1

*Department of Surgery, SUNY Upstate Medical University, Syracuse, New York; and †Department of Neuroscience and Physiology, SUNYUpstate Medical University, Syracuse, New York

Submitted for publication March 27, 2007

doi:10.1016/j.jss.2008.03.016

Purpose. Angiogenesis is critical in normal develop-ment and in tumor growth. Experimentally, cyclospor-ine A (CyA) inhibits angiogenesis in an in vivo mousemodel and an in vitro capillary tube model. The mech-anisms behind its antiangiogenic effects are not wellcharacterized. To determine which nuclear factor, ifany, may be involved in the antiangiogenic effects ofCyA, we performed a microarray analysis of humanaortic endothelial cells (HAEC) subjected to CyA andanother calcineurin inhibitor, FK 506.

Methods. HAEC were divided into four groups: (1)HAEC incubated with CyA 2 �g/mL; (2) HAEC incu-bated with CyA 10 �g/mL; (3) HAEC incubated with FK506 1 �g/mLl for 24 h; and (4) HAEC as control. We usedAffymetrix GeneChip U133-A for gene expression analy-sis and validated our results with quantitative reversetranscription-polymerase chain reaction.

Results. At a 2 �g/mL dose, CyA treated HAEC re-vealed a 44-fold increase in the expression of hairyenhancer of split-related protein 1 (HESR1) and 1.73-fold down-regulation of transcripts encoding for thevascular endothelial growth factor (VEGF) receptor(VEGFR2). At 10 �g/mL, the expression of the HESR1transcript was 57-fold higher than control, andVEGFR2 exhibited a 1.93-fold down-regulation. Quan-titative reverse transcription-polymerase chain reac-tion confirmed a significant (P < 0.0001) increase inexpression of HESR1 in CyA treated cells. In contrast,the expression level of HESR1 was not affected by theFK 506 treatment.

Conclusion. CyA demonstrate antiangiogenic activi-ties linked to an overexpression of HESR1 transcrip-tion factor, and down-regulation of VEGFR2. Thus, use

1 To whom correspondence and reprint requests should be ad-dressed at Department of Surgery, SUNY Upstate Medical Univer-sity Hospital, 750 E. Adams St., Syracuse, NY 13210. E-mail:

kitturd@upstate.edu.

171

of high-dose CyA may provide a novel treatment inangiogenesis dependent disease. © 2008 Elsevier Inc. All rights

reserved.

Key Words: angiogenesis; cyclosporine A; HESR1;HEY1; VEGFR2.

INTRODUCTION

Angiogenesis, a process of new blood vessel forma-tion, is critical in normal tissue development as well asin tumor growth and development. Angiogenesis in-volves proliferation, migration, new lumen formationand maturation of endothelial cells [1]. The process ofangiogenesis is controlled by a complex set of positiveand negative angiogenic factors. In normal adult tis-sues, the inhibitors of angiogenesis predominate. Indeveloping tissues, rheumatoid arthritis and tumors,cellular inducers of angiogenesis predominate, in-ducing formation of new blood vessels. Interestingly,cyclosporine A (CyA), a widely used conventionalimmunosuppressive agent that is highly effective inpreventing rejection after organ transplantation,also appears to have antiangiogenic properties.

In a prior study, we implanted a mixture of Matrigel,vascular endothelial growth factor (VEGF), and basicfibroblast growth factor subcutaneously in mice andobserved an exuberant vascularization of the plug [2].The addition of CyA to this mixture effectively inhib-ited ongoing angiogenesis and also destroyed estab-lished angiogenesis. These results supported our priorstudy documenting the antiangiogenic properties ofCyA on in vitro endothelial capillaries [2, 3]. Given thisantiangiogenic property of CyA, we have previouslyproposed that this drug could be a novel anticanceragent in addition to being an immunosuppressive

agent.

0022-4804/08 $34.00© 2008 Elsevier Inc. All rights reserved.

172 JOURNAL OF SURGICAL RESEARCH: VOL. 149, NO. 2, OCTOBER 2008

While the mechanisms behind the immunosuppres-sive effects of CyA have been studied extensively, thosebehind its antiangiogenic effects have not been wellcharacterized. The cytosolic and cell membrane eventsinitiated by CyA are likely to lead to nuclear regulationof genes involved in the control of angiogenesis. How-ever, to date no nuclear factors have been discoveredthat could account for the antiangiogenic effects of thisdrug. To determine which nuclear factors, if any, maybe involved in the antiangiogenic effect of CyA, weperformed a global microarray analysis of endothelialcells subjected to CyA.

MATERIALS AND METHODS

Materials

Cell culture–human aortic endothelial cells (HAEC) were pur-chased from Clonetics-BioWhittaker, Walkersville, MD) and propa-gated in endothelial cell growth media supplemented with 10 ng/mLof human recombinant epidermal growth factor, 1.0 �g/mL of hydro-cortisone, 50 �g/mL of gentamicin, 50 �g/mL of amphotericin B, 23mg/mL of bovine brain extract, and 2% fetal bovine serum (Clonetics-BioWhittaker). Subconfluent cells between passages 3 and 8 wereused. Cyclosporine A (CyA) was purchased from Novartis Pharm(East Hanover, NJ). FK 506 was purchased from Fujisawa Health-care (Deerfield, IL). Dimethyl sulfoxide (DMSO) and cremophor werepurchased from Sigma (St. Louis, MO).

Methods

HAEC were divided into 4 groups: (1) HAEC incubated with CyA2 �g/mL; (2) HAEC incubated with CyA 10 �g/mL; (3) HAEC incu-bated with FK 506 1 �g/mL for 24 h; (4) HAEC with cremophor; (5)HAEC with DMSO; (6) HAEC as control. We used the AffymetrixGeneChip U133-A for expression analysis of 22,283 human genetranscripts. All of the experiments were done in duplicate or tripli-cate.

RNA Preparation

RNA was isolated from HAEC cultures by scraping the adherentcells from the culture dish and immediately processing them withthe RNAeasy kit (Qiagen Inc., Valencia, CA). The quality of thepurified RNA was assessed using the RNA 6000 Nanochip on theAgilent 2100 bioanalyzer (Agilent Technologies, Palo Alto, CA). RNAsamples showing prominent bands at 28S and 18S with 28S:18Sratio greater than 1.5 was judged to be acceptable.

Hybridization of HAEC RNA to the HumanAffymetrix GeneChip

Each RNA sample was converted to double stranded cDNA andthen labeled by in vitro transcription with biotinylated ribonucleoti-des. The biotinylated cRNA was prepared using standard Affymetrixprotocol [4]. Fifteen �g of biotinylated cRNA was fragmented andhybridized on Affymetrix U133A Human GeneChip at 45°C and 60rpm for 16 h. The unhybridized target was washed off and the signalswere detected using phycoerythrin-conjugated streptavidin, usingthe EukGEWS2V4 protocol on the Affymetrix fluidics washing sta-tion and scanner [5].

Data Analysis

Each gene chip was initially scanned and analyzed using Af-

fymetrix Microarray Analysis Suite (MAS) version 5.13. MAS 5 “ab-

solute” and “statistical ”analyses were performed. In addition, datawere further analyzed using Robust Multichip Analysis and exam-ined for changes in relevant biological pathways using the Af-fymetrix Gene Ontology Pathway tool as well as custom writtensoftware (PathStat).

Reverse Transcription-Polymerase Chain Reaction (RT-PCR)Methods

Primers for hairy enhancer of split-related protein 1 (HESR1)(BC001873) and �tubulin (BC009509) were designed to amplify ap-proximately 100 bp products using Primer3 software as follows:HESR1 forward: GTCTCATTTGGAGTGTTGGT, reverse: GAATTT-GAGATCCGTGTGAT; �tubulin forward: TGTCATGCTCCCA-GAATTT, reverse: ATGGAAAAGACATGATCACC. For the reversetranscription reaction, 500 ng total RNA (25 �L volume in water)from three additional independent replicate control and CyA treatedcultures was incubated with 250 pmol of an oligo (dT)24 primer at70°C for 10 min. Then, 3.5 �L 10� PCR Gold buffer (Applied Bio-systems, Foster City, CA), 15 �L 25 mM MgCl2 (Applied Biosys-tems), 2 uL 25 mM dNTP, 0.5 �L RNase inhibitor (40 U/�L; Ambion,Austin, TX), and 0.63 uL SuperScript II reverse transcriptase (200U/�L, Invitrogen, Carlsbad, CA) were added. The reaction was incu-bated at 25°C for 10 min, 48°C for 30 min, 95°C for 5 min, thendiluted 5-fold with nuclease free water. A 25 uL PCR reaction con-taining 1x TaqMan Universal PCR Master Mix (Applied Biosys-tems), 0.2 �M each forward and reverse primers, 0.25 uL ofSYBRGreen dye (Molecular Probes, Carlsbad, CA) and 1 uL of thediluted RT reaction was cycled as follows: 94°C 2 min, then 40 cyclesof 94°C 45 s, 52°C 45 s, and 65°C 45 s. All PCR products were initiallyexamined using the Agilent Technologies Bioanalyzer DNA 500 labchip kit, and clearly indicated the presence of a single band in eachreaction as well as a qualitative difference in the abundance betweenthe treated and untreated samples. For quantification of transcriptdifferences, the same reaction conditions above were used in anABI-7000 Real Time Sequence Detection System (Applied Biosys-tems). One �L of the RT reaction from each of the three biologicalsamples in each condition (CyA treated and Control) was evaluatedin triplicate PCR reactions for each gene of interest on a single96-well plate. Amplification in the absence of template failed toproduce any signal that would have occurred due to primer dimer-ization and extension. End point melt-curve analysis confirmed thepresence of a single amplicon in each reaction well. Analysis of thereal time data were performed using the � CT and �-� CT methods(with �tubulin as an internal reference), as well as a repeated mea-sures analysis of variance model using the raw CT data from eachreplicate sample.

RESULTS

Of the 22,283 transcripts represented on theU133A GeneChip, the largest and most consistentchanges observed were for the transcript encodingHESR1, a basic helix-loop-helix transcription factor(Fig. 1, Table 1). At the 2 �g/mL dose, the expressionof the HESR1 transcript was nearly 44-fold higher onaverage than control HAEC. At the 10 �g/mL dose, theexpression of the HESR1 transcript was 57-fold higheron average than control HAEC samples. Cremophor(CyA vehicle) alone was also found to increase theexpression of HESR1 transcripts 8.8-fold, but DMSOdid not affect HESR1 expression (Fig. 2). In relativeterms, the expression level of HESR1 was not stronglyaffected by the FK506 treatment (Table 1). In addition,

the expression of more than 900 other transcription

O t

173SHAH ET AL.: CYCLOSPORINE INDUCES HESRI

factors (including other HESR/HEY genes) was notaffected to the same degree as HESR1 (Fig. 1, Table 1),and the levels of numerous reference genes (including�tubulin) were not markedly changed in the microar-ray experiments (not shown).

Qualitative and quantitative RT-PCR for the HESR1transcript in three additional independent samples foreach condition confirmed a robust (48-fold) and highlysignificant (F1,4 � 499.9, P � 0.0001) increase in theexpression of HESR1 in response to CyA (Table 2). Incontrast, levels of a reference gene, �tubulin, either didnot change, or decreased slightly in the CyA treatedsamples that were examined by microarray and RT-PCR (Fig. 2).

Because HESR1 has been previously shown to playan important role in capillary tube formation in HAECcultures, most probably by down-regulation of theVEGF receptors [6], we also were interested in deter-mining the expression of VEGF receptor 2 gene inHAEC treated with CyA. Indeed, we found that theVEGFR2 gene was down-regulated 1.73- to 1.93-fold inHAEC treated with CyA (Table 1). These results are,undoubtedly, correlative but are further strengthened byour finding in FK506 treated HAEC the VEGFR2 expres-sion was not down-regulated significantly (Table 1).

DISCUSSION

Angiogenesis is critical in diseases such as rheu-

FIG. 1. Cyclosporine A and FK506 induced expression changes. MeU133A array. Note that HESR1 is strongly increased in expression at bin DMSO and the FK506 treated condition. Ctrl, control samples; CyAtreated samples; cremophor, cremophor treated samples, DMSO, DMSavailable online.)

matoid arthritis and cancer. Positive angiogenic fac-

tors include VEGFs, FGFs, and angiopoietins (Ang)[6 –11]. VEGFs help in early stages of angiogenesis(proliferation and migration of endothelial cells)through their receptors (VEGFR1, VEGFR2) [8].FGFs, released by degradation of the extracellularmatrix, are important in the tube formation stage ofangiogenesis [7, 9 –12]. Antiangiogenic factors (e.g.,thrombospondin, angiostatin, interferon-� and -�), cy-totoxic agents (e.g., methotrexate), antibiotics (e.g.,suramin), and matrix metalloproteinase inhibitors(e.g., BB-94) are important inhibitors of angiogenesis[6]. Agents that inhibit angiogenesis or destroy estab-lished angiogenesis are becoming attractive in thequest to control angiogenesis-dependent diseases suchas rheumatoid arthritis and cancer.

TABLE 1

Treatment Effects on HESR, VEGFR2, and�Tubulin Transcripts

Mean fold change relative to

Gene CyA-02 CyA-10 FK506 Cremophor DMSO

HESR1 44.76 56.99 2.05 8.81 �1.90HESR2 1.88 1.67 1.37 — —HESRL �1.08 �1.03 �1.30 — —VEGF receptor2 �1.79 �1.93 �1.20 — —

normalized expression levels for 968 transcription factor probes on thedoses of cyclosporine (2 ug/mL and 10 ug/mL)m and cremophor but not, 2 ug/mL cyclosporin treated samples; CyA-10, 10 ug/mL cyclosporinereated samples, FK, FK506 treated samples. (Color version of figure is

anoth-02

�Tubulin �1.59 �1.20 �1.72 — —

174 JOURNAL OF SURGICAL RESEARCH: VOL. 149, NO. 2, OCTOBER 2008

CyA is known to have multiple effects on cellularsignaling, although most of these effects have beendescribed in the context of the cytoplasm of the cellwhere this drug seems to have the most impact [10].Cyclosporine binds to cyclophilin, and inhibits cal-cineurin, and in turn blocks nuclear factor of activatedT-cells (NF-AT) that results in inhibition of NF-ATregulated genes (e.g., interleukin (IL)-4, CD 40 ligand,IL-2, and interferon �) [10].

We have previously observed that CyA affects endo-thelial cell function through the endothelin pathwayand also through other signal transduction pathways[13]. CyA induces endothelial dysfunction both at lowerand higher concentrations by inhibiting the formationof the in vitro capillaries on Matrigel as well as dis-rupting fully formed capillaries [2], and is angiocidal invivo [3]. Others have also noted the antiangiogeniceffect of CyA, although some of the prior studies have

FIG. 2. HESR1 (HEY1) expression in HAEC cells treated with Cyin cyclosporine/cremophor treated HAEC on average than control. Cof HESR1 transcripts by 8.8-fold, but DMSO did not affect HESR1strongly affected by the FK506 treatment.

TAB

RT-PCR Validation of 10 ug/mL

HESR1

Treatment Replicate Area

Ctrl 1 5.99 2Ctrl 2 7.27 2Ctrl 3 6.09 2CyA 1 175.57 76CyA 2 172.12 68CyA 3 154.41 65t-test P values: 0.00002 0

Mean fold change: 25.95 25.36

yielded conflicting results [14, 15]. The most likelyreason for the lack of an antiangiogenic effect of CyA insome studies is the concentration of CyA achieved.Despite a number of studies demonstrating the anti-angiogenic effect of CyA, the mechanism by which thedrug mediates its effects on nuclear events in nonlym-phoid cells has not been elucidated.

Inhibition of angiogenesis by CyA provides a noveland potent strategy to stop the growth of cancers. How-ever, CyA has a profound inhibitory effect on the im-mune system, which could negate its potential antican-cer effect since the growth of cancers is also regulatedby the immune surveillance mechanisms. Thus, it iscrucial to find distal targets of the antiangiogenic ef-fects of this drug so as to devise agents with potentantiangiogenic but not immunosuppressive actions.

Interestingly, PSC 833 (valspodar), the nonimmuno-suppressive cyclosporine derivative and CyA were

r FK506. The expression of the HESR1 transcript was 16-fold higherophor (CyA vehicle) alone was also found to increase the expressionression. In relative terms, the expression level of HESR1 was not

2

A Effect on HESR1 Expression

�Tubulin nM Ratio

Area nM HESR1:�Tubulin

86.32 40.38 0.065488.38 39.60 0.074760.76 29.86 0.090857.98 29.01 2.646051.26 23.13 2.965445.06 24.64 2.6534

004 0.04842 0.04466 0.00001

A oremexp

LE

Cy

nM

.64

.96

.71

.76

.59

.38

.00

�1.53 �1.43 35.80

175SHAH ET AL.: CYCLOSPORINE INDUCES HESRI

found to have cytotoxicity activity at a clinicallyachievable concentration in prostate, breast, and leu-kemia cell lines, further supporting the idea that CyA’santiangiogenic effects are independent of its immuno-suppressive effects [16].

We designed our present experiments to elucidatethe mechanism of CyA’s antiangiogenic effect as dem-onstrated by its in vitro inhibition of capillary tubesand its in vivo inhibition and disruption of angiogene-sis. Toward this end, we analyzed the expression of22,283 human genes on the Affymetrix microarrayplatform in HAEC treated with CyA. We used ourother finding that FK506, an agent that has a similarcytosolic action on lymphoid cells as CyA. We comparedthe expression of genes affected by CyA with thoseaffected by FK 506 in HAEC. We found that CyAtreatment (CyA in cremophor) results in robust up-regulation of the HESR1 transcript, a transcriptionfactor known to influence capillary tube angiogenesis,while FK 506 has no such effect. Taken together withour previous findings that CyA interferes with capil-lary tube formation in vitro and angiogenesis in vivo,the present results strongly suggest that the antian-giogenic effects of CyA are mediated in the nucleus bythe transcription factor HESR1.

HESR1 is a basic helix-loop-helix transcription fac-tor that plays an integral role in capillary tube forma-tion by endothelial cells. The nomenclature as well asthe expression of this transcription factor is complex. Itis related to the hairy/enhancer of split/HES familyand has several names (e.g., Hey-1/Hrt-1/Chf-2/gridlock). We have chosen to address this factor as HESR1for the sake of simplicity. HESR1 is expressed in alladult tissues but its expression is particularly high inthe vascularized tissues such as the heart, brain, aorta,and capillaries. More relevant is its expression in en-dothelial cells, in which it is absent during the prolif-eration and migration phase of the angiogenic responsebut is expressed during capillary tube formation. In-terestingly, although its expression coincides with cap-illary tube formation, overexpression of this transcrip-tion factor leads to an inhibition of capillary tubeformation. Thus, a regulated expression of this factorappears to be critical in the formation and mainte-nance of capillary tubes in vitro [17].

In our experiments, CyA treatment of HAEC led toan overexpression of HESR1, suggesting that this is aprimary mechanism by which CyA inhibits capillarytube formation. However, transcription factors such asHESR1 regulate multiple genes, making it difficult toascribe the antiangiogenic effects of CyA directly tothis overexpression. Thus, the precise mechanisms bywhich this overexpression inhibits the capillary tubeformation by CyA will need further elucidation. How-ever, since our results in the same experiments also

show that the VEGFR2 is down-regulated in HAEC

treated with CyA, it seems reasonable to conclude thatsustained overexpression of HESR1 in HAEC treatedwith CyA is a mechanism behind the antiangiogeniceffects of CyA.

Further support for this conclusion comes from ourfinding that FK506 does not induce HESR1 expressionin HAEC. FK506 inhibits the calcineurin pathways, asdoes CyA. In this and other aspects, such as inhibitionof the IL-2 gene, the two drugs have a similar mecha-nism of action, at least in lymphoid cells. This differ-ence is confirmed in the action of the two agents onHESR1; the overexpression of HESR1 by CyA and notby FK506.

In contrast to the multitude of cytosolic effects ofCyA, the nuclear effects of this drug have been thoughtto be restricted to the NF�B pathway leading to aninhibition of the IL-2 gene and IL-2 receptor. Thisnuclear pathway accounts for the immunosuppressiveaction of this drug, but not for its antiangiogenic effect,since IL-2 does not play a significant role in angiogen-esis.

Our finding that HESR1 is a potential distal, nucleartarget of CyA’s antiangiogenic action provides a basisfor future experiments to devise specific antiangiogenicagents that could stop the growth of cancers.

REFERENCES1. Hanahan D, Folkman J. Patterns and emerging mechanisms

of the angiogenic switch during tumorigenesis. Cell 1996;86:353.

2. Wilasrusmee C, Da Silva M, Singh B, et al. Morphological andbiochemical effects of immunosuppressive drugs in a capillarytube assay for endothelial dysfunction. Clin Transplant 2003;17(Suppl 9):6.

3. Wilasrusmee C, Yusupov I, Ondocin P, et al. Angiocidal effect ofcyclosporine A: A new therapeutic approach for pathogenic an-giogenesis. Int Angiol 2005;4:372.

4. Affymetrix Microarray Suite User’s Guide, version 5.0. 2001.Santa Clara, CA: Affymetrix, 2001.

5. Affymetrix GeneChip Expression Analysis Technical Manual,2001. Santa Clara, CA: Affymetrix, 2001.

6. Campbell SC. Advances in angiogenesis research: Relevance tourological oncology. J Urol 1997;158:1663.

7. de Vries C, Escobedo JA, Ueno H, et al. The fms-like tyrosinekinase, a receptor for vascular endothelial growth factor. Sci-ence 1992;255:989.

8. Fong GH, Rossant J, Gertsenstein M, et al. Role of the Flt-1receptor tyrosine kinase in regulating the assembly of vascularendothelium. Nature 1995;376:66.

9. Shalaby F, Rossant J, Yamaguchi TP, et al. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice.Nature 1995;376:62.

10. Millauer B, Wizigmann-Voos S, Schnurch H, et al. High affinityVEGF binding and developmental expression suggest Flk-1 asa major regulator of vasculogenesis and angiogenesis. Cell1993;72:835.

11. Friesel RE. Maciag T. Molecular mechanisms of angiogenesis:Fibroblast growth factor signal transduction. FASEB J 1995;9:919.

12. O’Brien T, Cranston D, Fuggle S, et al. Two mechanisms of

176 JOURNAL OF SURGICAL RESEARCH: VOL. 149, NO. 2, OCTOBER 2008

basic fibroblast growth factor-induced angiogenesis in bladdercancer. Cancer Res 1997;57:136.

13. Wilasrusmee C, Shah G, Kittur S, et al. Signal transductionpathway in endothelial dysfunction. J Surg Infect 2004;5:9.

14. Hernandez GL, Volpert OV, Iniguez MA, et al. Selective inhi-bition of vascular endothelial growth factor-mediated angiogen-esis by cyclosporine A: Roles of the nuclear factor of activated T

cells and cyclooxygenase 2. J Exp Med 2001;193:607.

15. Iurlaro M, Vacca A, Minischetti M, et al. Antiangiogenesis bycyclosporine. Exp Hematol 1998;26:1215.

16. Kreis W, Budman DR, Calabro A. A re-examination of PSC833 (valspodar) as a cytotoxic agent and in combinationwith anticancer agents. Cancer Chemother Pharmacol 2001;47:78.

17. Henderson AM, Wang SJ, Taylor AC, et al. The basic helix-loop-helix transcription factor HESR1 regulates endothelial cell

tube formation. J Biol Chem 2001;276:6169.