Current Protocols in Human Genetics || Infectious Diseases Testing

UNIT 9.18Infectious Diseases Testing

The clinical microbiology laboratory has long relied on conventional phenotypic tech-niques such as Gram staining and biochemical analysis to identify and characterizemicrobial pathogens. Beginning with solution hybridization in the early 1990s, however,multiple methods for nucleic acid hybridization and amplification have been introducedinto the diagnostic laboratory. With the more recent advent of technologies such asautomated DNA extraction, real-time PCR, and real-time DNA sequencing, moleculardiagnostics is poised to markedly improve the diagnosis and treatment of infections.

The molecular microbiology laboratory requires multiple methodologies to handle thewide variety of diagnostic scenarios encountered. Such diagnostic problems include (1)quantification of the pathogen burden of a known infection, (2) identification of a specificmicroorganism suspected on clinical grounds, (3) detection of a broad range of potentialpathogens, and (4) determination of a bacterial strain type in a hospital outbreak. Solutionsto these scenarios are presented in the selected molecular microbiology protocols in thisunit.

Quantitative end-point RT-PCR is a well-established means of determining the HIV-1load in plasma (see Basic Protocol 1). The protocol presented is FDA-approved for suchpurposes. Automated DNA extraction for viruses (see Support Protocol 1) allows for theefficient handling of large numbers of specimens and for the minimization of variabilityproduced by manual extraction. Optimized for HIV-1 viral load determination using BasicProtocol 1, the extraction protocol relies on a robotic extraction instrument incorporatingmagnetic bead technology.

Real-time fluorescent PCR permits the rapid detection of bacteria (see Basic Protocol 2),in this case methicillin-resistant Staphylococcus aureus (MRSA). This assay, targetedto a specific microorganism, permits detection simultaneous with amplification, unlikeend-point PCR.

Automated DNA extraction for bacteria (see Support Protocol 2) yields DNA suitablefor analysis by real-time fluorescent PCR using the same platform as for viral nucleicacid isolation.

Real-time DNA sequencing (see Basic Protocol 3) allows for the identification of bacteriathat cannot be definitively classified by routine biochemical testing. Unlike real-time PCRassays designed to detect a limited number of pathogens, this approach can theoreticallyidentify almost any pathogenic bacterium. Consequently, this emerging technique mayeventually supplant phenotypic analysis in the microbiology laboratory.

Repetitive element-based PCR (rep-PCR; see Basic Protocol 4) enables the moleculartyping of strains of a given bacterial species. Taking advantage of the repetitive elementsfound in the genomes of many bacteria, rep-PCR produces “barcode”-like patterns thatcan be analyzed to determine the degree of relatedness between isolates. Like end-pointand other conventional types of PCR, analysis follows amplification.

All protocols listed have been used successfully in the clinical microbiology laboratory.However, any laboratory adopting these techniques for the purposes of patient care is re-sponsible for validating assay performance including accuracy, precision, and sensitivity.

CAUTION: All patient specimens should be considered potentially infectious. Followuniversal precaution guidelines.

Contributed by Gregory L. Blakey, Ruth Ann Luna, and James VersalovicCurrent Protocols in Human Genetics (2005) 9.18.1-9.18.24Copyright C© 2005 by John Wiley & Sons, Inc.

ClinicalMolecularGenetics

9.18.1

Supplement 47

InfectiousDiseases Testing

9.18.2

Supplement 47 Current Protocols in Human Genetics

NOTE: All laboratory disposables should be nuclease-free. Filter pipet tips should beused to prevent cross-contamination.

BASICPROTOCOL 1

HIV-1 DETECTION AND QUANTIFICATION BY END-POINT RT-PCR(COBAS AMPLICOR HIV-1 MONITOR TEST)

HIV-1 detection and quantification by end-point RT-PCR relies on a synthetic oligonu-cleotide quantification standard, spiked in each plasma sample prior to nucleic acidextraction, to control for assay variability. The COBAS AMPLICOR, a combinationrobotic pipettor and thermal cycler (Roche Diagnostics), automates steps from reversetranscription to colorimetric signal detection. Reagents used, including a pre-made mastermix activated by the addition of manganese, are provided in the widely-used kit on whichthis protocol is based (COBAS AMPLICOR HIV-1 MONITOR test, v1.5; Roche Diag-nostics). The instrument software assesses assay run validity and calculates viral load.

Materials

Purified RNA in Roche MagNA Pure elution buffer (50 µl per sample isolated fromplasma; see Support Protocol 1)

COBAS AMPLICOR HIV-1 MONITOR kit v1.5 (Roche Diagnostics; store at4◦C) containing:HIV MONITOR master mixHIV MONITOR manganese solutionIM PS1IQ PS1SBAD3 cassetteDN4 cassetteCN4 cassette10× wash bufferHigh and low positive controls

COBAS AMPLICOR analyzer (Roche Diagnostics)COBAS AMPLICOR A-ring tubes and D-cup disposables (Roche Diagnostics)Sealable plastic bag

Extract nucleic acids1. Perform automated viral nucleic acid extraction (see Support Protocol 1).

Plasma should be separated from the cellular fraction of patient specimens no later than6 hr after collection. If not to be tested immediately, plasma should be frozen at –70◦C toprevent RNA degradation (stable indefinitely).

Prepare analyzer2. As needed, prepare 1× wash buffer by diluting 1:9 (v/v) 10× wash buffer/deionized

water.

If precipitates are present in the 10× wash buffer, heat at 30◦ to 37◦C to dissolve prior touse.

3. Fill the COBAS AMPLICOR analyzer wash buffer reservoir with 3 to 4 liters of 1×wash buffer and empty the COBAS AMPLICOR waste container.

4. Under the System option of the analyzer software, choose System Diagnostics thenPrime.

Prepare working master mix5. For 12 samples, add to one tube of HIV MONITOR master mix, 100 µl HIV

MONITOR manganese solution to yield working master mix. Vortex to mix.

Use working master mix within 4 hr.


9.18.3

Current Protocols in Human Genetics Supplement 47

Set up RT-PCR6. To each A-ring tube, add 50 µl working master mix and store A-ring tube(s) at 2◦ to

8◦C in a sealed bag.

7. To the respective A-ring tubes, add 50 µl of each of the following in order: plasmasample(s), positive controls (high and low; place on separate rings, if two rings areused), and negative control. Cap tubes and label the A-ring diagram(s) on the COBASAMPLICOR worksheet(s) accordingly.

All reagents should be at room temperature and thoroughly mixed.

For required maintenance procedures, including preparation of working wash buffer, seethe COBAS AMPLICOR analyzer operator’s manual.

8. Add the following solutions to the indicated reagent cassettes, and then load thecassettes onto the appropriate reagent rack:

2.5 ml IM PS1 to IM4 cassette (test specific rack)2.5 ml IQ PS1 to IQ4 cassette (test specific rack)5 ml SB to SB3 cassette (generic rack).

9. To the test specific reagent rack, add the AD3 cassette and to the generic reagentrack, add the DN4 and CN4 cassettes.

10. With the keypad or barcode scanner, indicate whether the reagent racks are genericor test specific, then enter lot numbers and reagent positions. Load the reagent rack.

11. On the D-cup platform, insert the D-cup rack. For every specimen and control, addsix D-cups and for every working substrate cassette, add two D-cups.

Run RT-PCR12. Click Load. When L-Aring appears, scan the A-ring barcode, press Esc, and load

the A-ring(s) on the COBAS AMPLICOR thermal cycler. Close the thermal cyclercover.

13. Using barcodes and on-screen instructions, order the A-ring(s) and print data aboutthe ring setup.

14. Compare the reagent lot numbers with the lot numbers of the ring set-up printout.Scan new lot numbers as necessary with the bar code scanner.

15. Follow the on-screen menus to set up the appropriate run for the number of rings.Begin the run.

16. Verify the acceptability of the run load check.

The COBAS AMPLICOR software checks the validity of the internal control (QS standard),negative control, high positive control, and low positive control. Any “INVALID” flagindicates an invalid run.

SUPPORTPROTOCOL 1

AUTOMATED VIRAL NUCLEIC ACID EXTRACTION (FOR HIV-1DETECTION AND QUANTIFICATION)

In this automated extraction protocol, following lysis/proteinase K digestion, viral nucleicacids are captured via magnetic glass beads. Impurities are then washed from the beadsand the nucleic acids eluted. Performance is straightforward, with plasma, reagents, andconsumables (such as pipet tips, tip stands, and reagent tubs) added to the appropriateracks of the instrument followed by complete software control of the robotic extractionprocess (MagNA Pure LC platform; MagNA Pure LC DNA Total Nucleic Acid IsolationKit Instruction Manual, 2004, Roche Diagnostics).


9.18.4


Materials

Blood or 200 µl plasmaNuclease-free waterMagNA Pure LC total nucleic acid isolation kit (Roche Diagnostics) including:

Elution bufferProteinase KWash buffer IWash buffer IIWash buffer IIILysis/binding bufferMagnetic glass particle suspensionQS standard from COBAS AMPLICOR HIV-1 MONITOR kit v1.5 (RocheDiagnostics)

MagNA Pure LC (Roche Diagnostics)MagNA Pure LC disposables (Roche Diagnostics):

Sample cartridgesReagent tubs (small, medium-20, medium-30, and large)Reagent tub lids (small, medium, and large)Processing cartridgesReaction tips (small and large)Tip standsDrop catchersCartridge sealsWaste bottles

CAUTION: Avoid contact with wash buffer I (contains guanidine hydrochloride) andlysis/binding buffer (contains guanidine isothiocyanate). Avoid adding bleach to ly-sis/binding buffer (produces a toxic gas).

NOTE: Heat MagNA Pure LC isolation kit solutions up to 37◦C to dissolve any precipi-tates. Store MagNA Pure LC isolation kit contents at 15◦ to 25◦C.

Prepare samples1. Centrifuge blood 10 min at 1000 × g, room temperature. Remove plasma fraction

and store indefinitely at −70◦C. If starting with plasma, proceed to step 2.

Plasma should be separated from the cellular fraction of patient specimens no later than6 hr after collection.

Spinning force and time may vary with the type of centrifuge used; adjust to completelyseparate plasma from cellular components.

2. If starting with frozen plasma, thaw plasma samples at room temperature.

3. To the first three sample cartridge positions, add, in order: 200 µl nuclease-free waterand 50 µl each of high positive control, low positive control, and negative control.

4. To the remaining sample cartridge positions, add 200 µl of each patient sample.

Isolate nucleic acid5. Add 5 ml elution buffer to one vial of proteinase K.

Store reconstituted proteinase K for 1 year at −15◦ to −25◦C or for 4 weeks at 2◦ to 8◦C.

6. Choose Total NA Serum Plasma Blood from the sample ordering screen in theMagNA Pure LC software.

7. Enter sample volume (200 µl) and dilution volume (300 µl; final volume is 400 µl).

8. Manually, via bar code, or via sample order file, enter sample numbers and names.


9.18.5


Table 9.18.1 Amount of Lysis Buffer and QS StandardAdded Corresponding to Number of Wells

No. of wells Lysis buffer (ml) QS (µl)

1–8 3.6 82.8

9–16 6.0 138

17–24 8.4 193.2

25–32 10.8 248.4

9. After selecting Start Batch, place disposables on the machine stage as indicated bythe software.

The MagNA Pure software will display a screen duplicating the layout of the machinestage. Disposable plastic components placed on the stage include an empty samplecartridge that will hold the isolated nucleic acid. As the various components needed forthe run are added, they can be checked off using the computer mouse.

10. Add the appropriate tubs to the reagent tub rack and then add the appropriate volumeof reagents to the reagent tubs as directed by the software, including adding elutionbuffer for dilution of the samples and QS standard from the HIV-1 monitor kit tothe lysis buffer (number of wells equals samples plus controls) according to Table9.18.1. Thoroughly vortex the magnetic glass particles suspension and load last.

11. Load the filled reagent tub rack.

12. Insert the filled sample cartridge, close the machine door, and verify the layout ofthe stage. Click OK.

13. Upon completion of the automated extraction process, use a cartridge seal to cover thesample cartridge containing the extracted nucleic acid. Store indefinitely at −70◦C.

Though the isolated nucleic acids are kept in a cooled block on the machine stage, removeand store the sample cartridge as quickly as possible to minimize RNA degradation.

BASICPROTOCOL 2

mecA DETECTION BY REAL-TIME FLUORESCENT PCR

The following protocol for the detection of methicillin-resistant Staphylococcus aureus(MRSA) exemplifies nonquantitative real-time PCR-based assays. DNA is extractedusing an automated method (see Support Protocol 2). Then, a master mix includingmecA-specific probes and primers, polymerase, dNTPs, and a synthetic internal controlis prepared. The mecA gene encodes a penicillin-binding protein that confers resistanceto methicillin. Master mix and samples are added to the glass capillary reaction vesselsused by the LightCycler platform (Roche Diagnostics). Increasingly found in the clinicallaboratory, the LightCycler features air heating and cooling for rapid cycling. Amplifica-tion and melting curves generated by the LightCycler software are analyzed to determineif the specimen has mecA and, hence, is resistant to methicillin. Reagents are availablefrom Roche Diagnostics in a kit form for research use (LightCycler MRSA Detection KitInstruction Manual, 2003) or as individual analyte-specific reagents (ASRs) for clinicaluse.

Materials

Extracted genomic DNA samples, LightCycler mecA template DNA (positivecontrol plasmid), bacterial positive control, and bacterial negative control (seeSupport Protocol 2)

10× LightCycler fast-start DNA master hybridization probes containing:FastStart Taq DNA polymerase


9.18.6


Reaction bufferdNTPs10 mM MgCl2

PCR-grade H2O25 mM MgCl210× LightCycler mecA primers/hybridization probes mix:mecA probe set

Probe 1 (label: LightCycler-Red 640)Probe 2 (label: fluorescein)

Internal control probe setProbe 3 (label: LightCycler-Red 705)Probe 4 (label: fluorescein)

LightCycler mecA recovery template DNA (internal control plasmid)LightCycler color compensation set

LightCycler 1.0LightCycler capillaries and stoppersLightCycler carousel2-ml tube rotor for conventional centrifuge or LC carousel centrifugeLightCycler software

NOTE: Store all reagents at −15◦ to −25◦C. Avoid repeated freeze-thaw cycles. Avoidlight exposure of fluorescently-labeled probes.

Isolate genomic DNA and prepare reaction mix1. Extract 100 µl each of samples, mecA template, bacterial positive control, and bac-

terial negative control by automated bacterial DNA extraction according to SupportProtocol 2.

2. Add 60 µl from the 10× LightCycler fast-start DNA master hybridization probesvial 1b to vial 1a. Mix by pipetting up and down.

Store for 3 months at −15◦ to −25◦C or for 1 week at 2◦ to 8◦C.

Set up PCR3. Prepare enough PCR master mix (total of samples, template positive control, bacterial

positive control, bacterial negative control, water blank control, plus 10% extra forpipetting error):

7.4 µl PCR-grade H2O1.6 µl 25 mM MgCl22 µl LightCycler mecA primer/hybridization probes mix2 µl LightCycler mecA recovery template2 µl LightCycler fast-start DNA hybridization probes15 µl total.

Mix by pipetting up and down.

4. Gently place the appropriate number of capillaries on the LightCycler carousel. Intoeach capillary, add 15 µl master mix.

5. To the respective capillaries, add, in order, 5 µl of extracted sample genomic DNA,template positive control, bacterial positive control, bacterial negative control, andwater blank control.

6. Using gentle pressure, place a stopper into each capillary. To prevent cross contam-ination, avoid touching the mouths of the capillaries or the intracapillary surfaces ofthe stoppers.


9.18.7


Pressure on the capillary stoppers should be exerted downward and not at an angle.Otherwise, capillary necks may break.

7. Centrifuge the loaded carousel 5 sec at 700 × g, room temperature.

Load and run LightCycler8. Load the LightCycler and initiate the appropriate program (parameters below).

Keep reagents on ice or in a cooling block during the reaction setup. Avoid touching thesides of the capillaries.

9. Enter the following programs into the LightCycler software package and save. Asnoted below, acquisition of fluorescence signal from probes occurs during each an-nealing step, when binding should be maximal. The melting curve analysis followingamplification allows for the determination of melting temperatures by slowly heatingsamples with continuous fluorescent monitoring. Fluorescence channel settings arethe ones appropriate for the particular set of fluorophores, and vary depending onthe analyte or internal control.

Enzyme activation/DNA denaturation

Cycles: 1Analysis mode: none

Segment 1Temperature target: 95◦CIncubation time: 10 secTemperature transition rate: 20◦C/secAcquisition mode: none

Color compensation file: loaded

Amplification

Cycles: 45Analysis mode: quantification


Segment 2Temperature target: 55◦CIncubation time: 10 secTemperature transition rate: 20◦C/secAcquisition mode: single



Melting curve analysis

Cycles: 1Analysis mode: melting curve



9.18.8



Segment 3Temperature target: 45◦CIncubation time: 20 secTemperature transition rate: 0.2◦C/secAcquisition mode: none

Segment 4Temperature target: 85◦CIncubation time: 0 secTemperature transition rate: 0.2◦C/secAcquisition mode: continuous


Cooling

Cycles: 1Analysis mode: none


Fluorescence parameters

Display mode: F2/1

Analyze PCR data10. Using the LightCycler software, following the completion of the run, examine the

positive and negative control amplification and melting peak curves for appropriate-ness. Repeat runs with invalid controls.

11. Determine the melting temperatures (Tm). The peak for mecA (channel F2) and forthe internal control (channel F3) should be at 66.4◦ ±2.5◦C. Results from sampleswith no amplification in either channel are invalid and should be repeated.

Figure 9.18.1 Real-time PCR amplification curves for mecA detection. Note the positive samples,with lag, linear logarithmic, and plateau phases. Negative samples have flat tracings.


9.18.9


Figure 9.18.2 Real-time PCR melting curve peaks for mecA detection (change in fluorescenceversus temperature). Positive samples have a melting temperature of ∼66◦C. Negative sampleshave flat tracings.

An example of real-time PCR amplification curves for mecA detection is shown in Figure9.18.1. The y-axis indicates fluorescence intensity and the x-axis indicates the cyclenumber. Note the various portions of the amplification curves of the positive samples:(1) the lag phase just rising above the baseline, (2) the linear logarithmic phase, and (3)the terminal plateau phase. Negative samples have flat tracings. Real-time PCR meltingcurve peaks for mecA detection (change in fluorescence versus temperature) are shownin Figure 9.18.2. The LightCycler software produces these peaks by taking the negativederivative of the curve generated during the melting curve analysis. The point of maximalrate of change corresponds to the melting curve peak. Positive samples have a meltingtemperature of ∼66◦C, as expected. Negative samples have flat tracings.

SUPPORTPROTOCOL 2

AUTOMATED BACTERIAL DNA EXTRACTION

The principles and platform for this automated bacterial DNA extraction protocol are thesame as for viral nucleic acid isolation. A different kit, with reagents more appropriatefor bacteria, is used (MagNA Pure LC DNA Isolation Kit III Instruction Manual, 2004).In addition, various preparation steps are given to adjust for viscous, large volume, andstool samples.

Materials

0.75% dithiothreitol (DTT)Phosphate-buffered saline (PBS; APPENDIX 2D)MagNA Pure LC DNA Isolation Kit III (Roche Diagnostics) including:

Elution bufferProteinase KBacteria lysis bufferWash buffer IWash buffer IIWash buffer IIILysis/binding bufferMagnetic glass particles suspension

37◦C heating blockMagNA Pure LC (Roche Diagnostics)Vortex mixer


9.18.10


MagNA Pure LC disposables (Roche Diagnostics):Sample cartridgesReagent tubs (small, medium-20, medium-30, and large)Reagent tub lids (small, medium, and large)Processing cartridgesReaction tips (small and large)Tip standsDrop catchersCartridge sealsWaste bottles

CAUTION: Avoid contact with wash buffer I (contains guanidine hydrochloride) andlysis/binding buffer (contains guanidine isothiocyanate). Avoid adding bleach to ly-sis/binding buffer (produces a toxic gas).

NOTE: Heat MagNA Pure LC isolation kit solutions up to 37◦C to dissolve any precipi-tates. Store MagNA Pure LC isolation kit contents at 15◦ to 25◦C.

Prepare samples

For viscous samples:

1a. Add freshly prepared 0.75% DTT to mucoid samples (0.15% final concentration).

2a. Heat 30 min at 37◦C. Proceed to step 3.

For large sample volumes (>500 µl):

1b. Centrifuge 10 min at 8000 × g, room temperature.

2b. Remove all but 50 to 100 µl of the supernatant. Proceed to step 3.

For stool samples:

1c. Collect a ∼1 × 0.5–cm stool sample.

2c. Suspend in ∼500 µl phosphate-buffered saline. Proceed to step 3.

Lyse and digest samples3. Add 1.2 ml elution buffer to one vial proteinase K.

Store 1 year at −15◦ to −25◦C or 4 weeks at 2◦ to 8◦C.

4. To sample volumes up to 100 µl, add 130 µl bacteria lysis buffer and vortex. Thenadd 20 µl proteinase K.

5. Heat 10 min at 65◦C or overnight at 15◦ to 25◦C. Visually verify that the sample isdigested (lysate should be clear or nearly so).

For swab samples, an additional step is required. Following proteinase K digestion, pressthe swab tip against the side of the microcentrifuge tube to remove liquid, then discardswab. Proceed with step 6.

6. Heat 10 min at 95◦C.

Optionally for fungi or spore-forming bacteria, additionally freeze then boil the samplesthree to five times.

7. Cool to room temperature and pipet samples into a sample cartridge.

Isolate DNA8. Choose DNA III Bacteria-Standard Protocol from the sample ordering screen in the

MagNA Pure LC software.

9. Enter sample and elution volumes.


9.18.11


10. Manually, via bar code, or via sample order file, enter sample numbers and names.

11. After choosing Start Batch, place disposables on the machine stage as indicated bythe software.

The MagNA Pure software will display a screen duplicating the layout of the machinestage. Disposable plastic components placed on the stage include an empty samplecartridge that will hold the isolated nucleic acid. As the various components needed forthe run are added, they can be checked off using the computer mouse.

12. Add the appropriate tubs to the reagent tub rack and then add the appropriate volumeof reagents to the reagent tubs as directed by the software.

The magnetic glass particles suspension should be thoroughly vortexed and loaded last.

13. Load the filled reagent tub rack. Insert the filled sample cartridge, close the machinedoor, and verify the layout of the stage. Click OK.

14. Upon completion of the automated extraction process, use a cartridge seal to cover thesample cartridge containing the extracted nucleic acid. Store indefinitely at −70◦C.

BASICPROTOCOL 3

BACTERIAL IDENTIFICATION BY REAL-TIME SEQUENCING OF 16SRIBOSOMAL DNA

This real-time sequencing protocol begins with the amplification of variable regions1 and 3 (V1 and V3, respectively) of the bacterial 16S rRNA gene using biotinylatedconsensus primers. Amplicons are then captured with streptavidin-coated beads. Finally,real-time sequencing of the amplicons generates readable lengths of 30 to 50 bp per target.Real-time sequencing is based on Pyrosequencing chemistry (Biotage), which produceslight from the enzymatic conversion of pyrophosphate produced during incorporation ofdNTPs. The manufacturer provides the various enzymes involved. A special sequencerthat uses ink-jet technology to add dNTPs in a predetermined order is required. Sequencesof 16S rDNA obtained are compared to those available in the sequence databases storedwithin the Ribosomal Database Project Website at http://rdp.cme.msu.edu/index.jsp (Coleet al., 2003).

Materials

PCR-grade waterdNTPs (GeneAmp, Applied Biosystems)25 mM MgCl2 (Applied Biosystems)10× PCR buffer (GeneAmp, Applied Biosystems)V1 primers (10 µM for PCR; 3 µM for sequencing):

Bio-pBR5′ Biotin-GAA GAG TTT GAT CAT GGC TCA GpBR-V1 TTA CTC ACC CGT CCG CCA CT

AmpliTaq Gold LD DNA polymerase (Applied Biosystems)V3 primers (10 µM for PCR; 3 µM for sequencing):

Bio-B-V3 Biotin-ACG ACA GCC ATG CAG CAC CTpJBS.V3 GCA ACG CGA AGA ACC TTA CC

10 ng/µl purified genomic bacterial DNAPositive control DNABinding buffer (Biotage)Streptavidin-Sepharose HP (Amersham Biosciences)70% ethanolWashing buffer (Biotage)


9.18.12


Denaturation solution (Biotage)Annealing buffer (Biotage)PSQ 96 SQA reagent kit (Biotage) containing:

Enzyme mixtureSubstrate mixturedATPαS, dCTP, dGTP, and dTTP

0.2-ml PCR tubesVortex mixerConventional thermal cycler96-well plateMicrotiter plate shaker/mixerReagent troughsVacuum prep tool (Biotage)PSQ 96 sequencing plates (Biotage)80◦C heating blockPyrosequencer (Biotage)PSQ 96 reagent cartridge (Biotage)

NOTE: Store the enzyme mixture, substrate mixture, and all PCR reagents at −20◦C.Store the remaining reagents except ethanol and water at 4◦C.

Perform PCR1. On ice, prepare enough PCR master mix for the V1 reaction (which includes total

number of samples, positive control, negative control, plus 10% extra for pipettingerror); the following volumes listed are per reaction:

32.75 µl PCR-grade water4 µl dNTPs5 µl 25 mM MgCl25 µl 10× buffer1 µl 10 µM Bio-pBR5′ primer1 µl 10 µM pBR-V1 primer0.25 µl AmpliTaq Gold LD DNA polymerase49 µl total.

Mix master mixes completely.

2. On ice, prepare enough PCR master mix for the V3 reaction (which includes totalnumber of samples, positive control, negative control, plus 10% extra for pipettingerror); the following volumes listed are per reaction:

32.75 µl PCR-grade water4 µl dNTPs5 µl MgCl25 µl 10× PCR buffer1 µl 10 µM Bio-B-V3 primer1 µl 10 µM pJBS.V3 primer0.25 µl AmpliTaq Gold LD DNA polymerase49 µl total.

Mix master mixes completely.

3. Into the respective, labeled 0.2-ml PCR tubes, add 49 µl master mix.

4. To the respective tubes, add, in order: 1 µl of 10 ng/µl purified genomic bacterialDNA sample, 1 µl positive control, and 1 µl negative control (water).


9.18.13


5. Set up and run PCR on a conventional thermal cycler using the following parameters:

1 cycle: 10 min 95◦C (initial denaturation)35 cycles: 40 sec 95◦C (denaturation)

40 sec 55◦C (annealing)60 sec 72◦C (extension)

1 cycle: 60 sec 72◦C (final extension)indefinite 4◦C (hold)

Prepare pyrosequencing samples6. Prepare enough MMX mix for each sample by combining 40 µl binding buffer and

3 µl streptavidin-Sepharose per sample.

Warm sample preparation reagents to room temperature. Homogenize the streptavidin-Sepharose HP bead solution by shaking.

7. Add 40 µl PCR product (from step 5) and 40 µl MMX mix to each well of a 96-well plate well. Shake plate for 5 min at room temperature on a microtiter plateshaker.

8. Add 180 ml PCR-grade water, 180 ml 70% ethanol, 180 ml washing buffer, and120 ml denaturation solution to separate reagent troughs.

9. Attach a vacuum to the vacuum prep tool, and place the tool into the PCR-gradewater trough for 30 sec to prime.

The troughs are plastic trays that hold the reagent needed, so that the vacuum prep toolcan be inserted.

10. Immediately after removing the 96-well plate from the shaker, lower the vacuumprep tool into the plate wells.

11. Insure that all beads have been suctioned into the vacuum prep tool by partiallylifting the tool out of the 96-well plate.

12. Place the vacuum prep tool for 5 sec each into the reagent troughs in the fol-lowing order: 70% ethanol, denaturation solution, and washing buffer. Release thevacuum.

Prepare sequencing plates13. Into each well of the PSQ 96 sequencing plate, pipet 40 µl annealing buffer.

14. Into each V1 sample well, pipet 5 µl of 3 µM pBR-V1.

15. Into each V3 sample well, pipet 5 µl of 3 µM pJBS.V3.

16. Insert the vacuum prep tool into the sequencing plate, and rub the filter probes againstthe well bottoms in a circular motion to free the attached beads.

17. Rinse the vacuum prep tool in PCR-grade water.

18. Place the sequencing plate 6 min on an 80◦C heating block. Then, cool the plate5 min at room temperature.

Sequence samples19. Add 620 µl PCR-grade water to both the enzyme mixture and the substrate mixture.

Swirl, not vortex, to mix. Let stand 5 to 10 min at room temperature.

Alternatively, warm mixtures prepared previously to room temperature.

Enzyme and substrate mixtures should not be thawed more than once.


9.18.14


Figure 9.18.3 Pyrogram of a 16S rDNA sequence. Peak intensities are proportional to the number of bases of the listedcomposition at a given position within the sequence. The highlighted peak indicates a homopolymeric stretch of cytosines(sequence: CGTGTACCCCGAAGGGCCTTACCGTTCGACTTGCATGTGTTAGC).

20. Enter the requested information on the PSQ Instrument Control screen on thepyrosequencer.

21. Select cyclic-AGCT as the nucleotide dispensation order under Process Parameters.

22. Fill the PSQ 96 reagent cartridge as specified under Volumes Info.

23. Load the sequencing plate and the reagent cartridge.

24. Begin the run.

Analyze sequences25. Inspect the pyrograms for each sample, identifying the extent of the reliable sequence.

26. Go to the Internet site http://rdp.cme.msu.edu/index.jsp (Ribosomal Database Projecthome page).

27. Select Sequence match.

28. For each sample, enter the sequence for V1 and conduct searches with the “comple-mented” version against the RDP database.

29. For each sample, enter the sequence for V3 and conduct searches with the “as theyare” version against the RDP database.

30. Accept all matches with the highest similarity score (preferably 1.000).

31. Verify any sustained base repeats in the sample sequences.

32. Review results of the positive and negative controls for appropriateness.

When an isolate yields more than one match with a similarity score of 1.000, correlationwith biochemical testing results may allow assignment of a most probable genus orspecies.

An example pyrogram of a 16S rDNA sequence is shown in Figure 9.18.3. The x-axisindicates the base incorporation order. A peak is present only if a base was incorporatedat that position within the sequence. Unlike conventional sequencing electropherograms,peak intensities are proportional to the number of bases of the listed composition at agiven point in the dNTP addition cycle. The tallest peak shown, near the beginning ofthe sequence, indicates a homopolymeric stretch of cytosines (sequence: CGTGTACCC-CGAAGGGCCTTACCGTTCGACTTGCATGTGTTAGC). Peak intensities diminish as thereaction progresses.


9.18.15


BASICPROTOCOL 4

BACTERIAL STRAIN IDENTIFICATION BY REP-PCR (DIVERSILAB)

Repetitive DNA elements may be conserved and dispersed in bacterial and fungalgenomes. Selected repetitive DNA elements or sequences serve as targets for PCR-basedDNA typing or chromosomal profiling strategies (Versalovic et al., 1991). Outwardly-facing oligonucleotide primers may be designed to be complementary to each repetitivesequence. Such rep-PCR primers may be used to synthesize DNA during PCR amplifi-cation and generate amplicons that vary in size depending on the distances between therepetitive elements. The DNA or chromosomal profiles may be generated by gel/capillaryelectrophoresis or microfluidics-based chip separation, and comparison analysis done byvarious computer algorithms.

As organism-specific primers are used for each rep-PCR (DiversiLab, Bacterial Bar-codes), the pathogen-of-interest is identified beforehand by other means. Then, ampli-cons are generated by rep-PCR from an extracted DNA sample and evaluated with the2100 Bioanalyzer (Agilent), a microfluidics platform that separates DNA fragments. TheDiversiLab software evaluates the fragment patterns generated for similarity.

Materials

DiversiLab rep-PCR Kit (Bacterial Barcodes) for PCR containing:Rep-PCR MM1Organism-specific primer mixPositive control C3Negative control

10× PCR buffer with 15 mM MgCl2 (GeneAmp, Applied Biosystems)AmpliTaq DNA polymerase (Applied Biosystems)25 ng/µl purified genomic DNADiversiLab rep-PCR kit (Bacterial Barcodes) for microfluidic separation

containing:DNA gel matrixDNA dye concentrateSpin filtersDNA ladderDNA markerDNA chips

1.5-ml microcentrifuge tubes0.2-ml PCR tubesThermal cyclerBioAnalyzer model 2100 with chip priming station and vortex mixer (Agilent

Technologies) and LabChip software

Perform PCR1. In a 1.5-ml microcentrifuge tube, prepare enough PCR master mix (total number of

samples, positive control, negative control, and 10% extra for pipetting error) usingthe following volumes per reaction:

18.0 µl Rep-PCR MM12.5 µl 10× PCR buffer with 15 mM MgCl22.0 µl organism-specific primers0.5 µl AmpliTaq DNA polymerase23 µl total.

Mix master mix completely. Set up PCR reaction on ice.

2. Into the respective, labeled 0.2-ml PCR tubes, pipet 23 µl master mix.


9.18.16


Table 9.18.2 Kit-Specific Annealing Temperatures forPCR

DiversiLab kit Annealing temperature (◦C)

Enterobacter 55

Serratia 55

Staphylococcus 45

Stenotrophomonas 50

Escherichia 50

Candida 53

Acinetobacter 55

Non-Fermentative 60

Pseudomonas 50

Salmonella 50

3. To the respective tubes, add, in order: 2 µl of 25 ng/µl bacterial DNA, 2 µl positivecontrol, and 2 µl negative control.

4. Run PCR on a thermal cycler using the following program (halt the thermal cyclerat 94◦C prior to adding tubes):

1 cycle: 2 min 94◦C (initial denaturation)35 cycles: 30 sec 94◦C (denaturation)

30 sec See Table 9.18.2 (annealing)90 sec 70◦C (extension)

1 cycle: 3 min 70◦C (final extension)Indefinite 4◦C (hold).

5. Store the reaction products at 4◦C to −20◦C if not proceeding immediately toanalysis.

Set up DNA matrix6. Mix 400 µl DNA gel matrix and 20 µl DNA dye concentrate in a 1.5-ml microcen-

trifuge tube and vortex.

PCR amplicons are separated by microfluidics in a DNA LabChip device originallydeveloped by Caliper Technologies and included in the DiversiLab kits. The microfluidics-based separation is performed in a BioAnalyzer 2100 (Agilent). DNA standard markers(used for normalization of sample runs) and 1 µl of the Chip Kit molecular weight ladder(200-, 400-, 600-, 800-, 1000-, 2000-, 3000-, and 4000-bp DNA markers) are used witheach run.

7. Load the resultant gel-dye mix on a spin filter. Centrifuge 10 min at 1500 × g, roomtemperature.

Reagents should be at room temperature for a minimum of 30 min prior to use. Store thegel-dye mix up to 4 weeks at 4◦C. Avoid light exposure of the DNA dye concentrate andthe gel-dye mix.

8. Vortex room temperature DNA ladder and DNA marker, and briefly centrifuge theDNA ladder, DNA marker, and gel-dye mix.

9. Insert a new DNA chip into the chip priming station and set the chip priming stationsyringe plunger to 1 ml. Move the syringe clip to the highest setting.


9.18.17


10. Into the bottom of the chip well labeled with a white “G” within a black circle, pipet9 µl gel-dye mix. Close and lock the chip priming station lid.

11. Push the chip priming station syringe plunger until it engages the syringe clip.

12. Release the syringe from the syringe clip after precisely 30 sec.

13. After movement of the syringe plunger has ceased, open the chip priming stationand examine the channels on the back of the chip (load a new chip if bubblesare observed). If no bubbles are observed, reinsert the DNA chip into the primingstation.

14. Into the bottom of the two wells labeled with a black “G” within a circle, pipet 9 µlgel-dye mix.

Separate PCR products15. Into the well labeled with a ladder and into the 12 sample wells, pipet 5 µl DNA

marker.

16. Into the well labeled with a ladder, pipet 1 µl DNA ladder.

17. Into the respective 12 sample wells, pipet 1 µl PCR products (from step 5).

18. Into any unused sample wells, pipet 1 µl DNA marker.

19. Vortex the DNA chip in the BioAnalyzer Mixer at 2400 rpm for precisely 1 min.

20. Within 5 min, load the DNA chip into the BioAnalyzer.

Use a reverse-pipetting technique when adding the gel-dye mix and DNA marker to theDNA chip. At least 30 min prior to use, turn on the BioAnalyzer. The LabChip softwareshould be open prior to chip loading.

21. Using the LabChip software, from the Assay menu, choose DiversiLab.

22. Enter the DNA chip number when beginning the run.

Analyze data23. Check the run for errors (Run Summary window).

24. Analyze the data using the DiversiLab software.

25. Clean the BioAnalyzer with deionizer water, as directed by the manufacturer.

The DiversiLab software (version 2 and above) and the Pearson correlation coefficientdetermine distance matrices, and the unweighted-pair-group method with arithmeticmean (UPGMA) creates dendrograms. Reports include electropherograms or virtualgel images in combination with a dendrogram to show relationships among bacterialstrains.

An example dendrogram resulting from rep-PCR analysis of 23 Pseudomonas aeruginosaisolates is shown in Figure 9.18.4. The DiversiLab software analyzes the banding patternsgenerated by the Agilent BioAnalyzer (left) to determine relatedness. Similar isolates (suchas specimens 1 to 3, 5 to 16, and 19 to 20) are grouped together, suggestive of a commonclone for each group. Dendrogram branches that are distant from one another indicate alack of similarity.

Mixed cultures may produce unreliable or uninterpretable results.


9.18.18


Figure 9.18.4 Dendrogram resulting from rep-PCR analysis of 23 Pseudomonas aeruginosaisolates. Similar isolates are grouped together, suggestive of a predominant common clone.

COMMENTARY

Background InformationPhenotypic methods such as microscopic

morphology, culture characteristics on variousmedia, and biochemical panels are still the pri-mary tools of the clinical microbiology labo-ratory. In many cases, these conventional ap-proaches to microbial identification and char-acterization are sufficient. However, molecu-lar biologic techniques are increasingly usedfor the diagnosis and characterization of in-fectious diseases because of increased sensi-tivity, automation, and faster turnaround time.In addition, methods such as end-point or real-

time PCR can be used to quantitatively monitorpathogen burden.

The protocols presented in this unit rep-resent typical applications for viral and bac-terial disease. Many FDA-approved kits,which may include assay controls, are avail-able for a wide range of pathogens. Manymore assays employ analyte-specific reagents(ASRs), which are commercially available as-say components produced according to goodmanufacturing practices. Finally, innumerableentirely laboratory-developed assays havebeen adopted.


9.18.19


The overall approach to designing or im-plementing a molecular microbiologic assayshould address the questions concerning as-say attributes, analytical issues, clinical or re-search utility, and operator experience.

Assay availability. Is an appropriate kit orASR available? If not, is enough genomic dataavailable for the selected pathogen to designassay components such as primers and probes?

Platform selection. Which platforms, suchas real-time PCR or real-time sequencing, aremost appropriate for the proposed assay? Canmultiple assays be performed on a commonplatform?

Clinical and research applicability. Willthe test provide superior information orturnaround time compared to conventional di-agnostics? Are reagent or equipment costs anissue?

Local molecular biologic expertise. Arethose who will perform the assay well-versedin basic molecular biologic bench work?

HIV-1 detection and quantification bycompetitive RT-PCR

The development of antiretroviral therapiesin the mid-1990s prompted the need for molec-ular methods to quantitate the level of HIV in-fection. Highly sensitive assays that monitorHIV-1 RNA levels (“viral load”) have becomecommercially available. The predominant for-mat is the COBAS AMPLICOR HIV-1 MON-ITOR Test (Roche Diagnostics), which usesquantitative reverse transcription-polymerasechain reaction (RT-PCR). A viral load remainsbelow the lower limits of detection with suc-cessful maintenance of antiretroviral therapy.A rising viral load in a patient compliant withthe antiretroviral regimen may indicate theemergence of a resistant virus and suggest theneed for HIV-1 drug resistance testing. Viralload testing may also prove useful for evalu-ating infants born to HIV-infected mothers,since IgG antibodies against HIV from themother will cross the placental barrier and in-terfere with serological testing in infants.

End-point PCR enables laboratories toquantify virus or determine viral loads in bodyfluids. Viral RNA is converted to DNA, andthe cDNA is amplified with primers targetingthe gag gene in addition to synthetic controltarget DNA. A biotinylated primer is used inend-point PCR, and biotinylated PCR productsare transferred to microtiter plates. PCR prod-ucts are denatured, and the biotinylated strandsare hybridized with oligonucleotides comple-mentary to internal sequences (between PCRprimers). The hybridized, duplex DNA com-

plexes are detected by the addition of strepta-vidin conjugated with the enzyme horseradishperoxidase (HRP). Substrate addition permitscolorimetric detection by absorbance spec-trophotometry.

Viral loads are quantitated by comparingnumerical values with that obtained for inter-nal quantitative standards (QS) and reportedas copies per milliliter. The amount of virusin the blood may fluctuate in any individual,and meaningful differences require changes of>0.5 log or three-fold differences. The rela-tively high coefficients of variation make it dif-ficult to interpret minor changes in viral loads.Changes in viral loads may indicate the lackof effective treatment, lack of compliance, oremergence of antiviral resistance.

Automated RNA extraction, coupled to au-tomated competitive RT-PCR, has been shownto be comparable to manual extraction (Holzlet al., 2003).

Quantitative end-point PCR methods willbe supplanted in the future by real-time PCRmethods but remain the standard approach fordetermining viral loads in human specimens.For a comparison of the various platforms inuse for HIV-1 viral load testing, see Hill andCaliendo (2004).

Automated nucleic acid extraction versusconventional manual extraction methods

Automated nucleic acid extraction meth-ods provide reduced: potential sample cross-contamination, sample-to-sample extractionvariability, and manual labor time (Kessleret al., 2001).

The MagNA Pure LC platform can processup to 32 samples simultaneously. The MagNAPure LC has been used for nucleic acid ex-traction from viruses (Knepp et al., 2003) andfungi (Loeffler et al., 2002), with sensitivitiescomparable to manual methods.

Real-time fluorescent PCR by LightCycler(mecA detection)

Real-time PCR has a wide variety of appli-cations in the clinical microbiology laboratory(MacKay, 2004; Niesters, 2004). The Light-Cycler real-time PCR platform used for thedetection of MRSA can employ several detec-tion strategies including (1) nonspecific, in-tercalating fluorophores such as SYBR green,(2) fluorophore-labeled hybridization probessuch as fluorescent resonance energy transfer(FRET) probes, or (3) fluorophore-labeled hy-drolysis probes such as Taq Man probes.

Advantages of real-time PCR over conven-tional PCR include: quicker turnaround time,


9.18.20


especially with the rapid cycling of the Light-Cycler platform, more accurate quantificationthrough the use of specific probes for bothtarget and internal control sequences, and de-creased risk of contamination secondary tomonitoring of the reaction in a closed systemwithout subsequent manipulation.

Primer design is crucial for reliable real-time PCR assays (Peters et al., 2004). Freelyavailable software such as Primer3 (Rozen andSkaletsky, 2000) allows primers without unde-sirable chemical characteristics to be designed.Interactions between template, primers, andprobes can be simulated in silico using thecommercially available package Visual OMP(DNA Software).

The target for the MRSA assay, mecA, con-fers resistance to methicillin via the produc-tion of penicillin binding protein 2a. Specificprimers are used to amplify a 315-bp portionof mecA. A pair of hybridization probes bindsto this target sequence, allowing detection viaFRET. Importantly, real-time testing may de-tect inducible methicillin resistance that maybe missed by conventional methods (Versa-lovic, 2003).

Prior to nucleic acid extraction, samples arespiked with a synthetic oligonucleotide to con-trol for DNA extraction efficiency and PCRinhibition. A separate FRET probe set detectsthis internal control.

For a more in-depth discussion of technicalissues surrounding real-time PCR, see Wittwerand Kusukawa (2004).

Nosocomial infections produced by MRSAare responsible for considerable morbidity andmortality. As such, prompt identification of anoutbreak of MRSA (via detection of the mecAgene) facilitates implementation of appropri-ate infection control procedures to prevent fur-ther spread within a hospital.

Bacterial identification by real-timesequencing of ribosomal 16S DNA

A useful tool in the phylogenetic analysisof bacteria, 16S rDNA sequencing can alsobe used to identify clinical isolates when phe-notypic methods are inadequate (Kolbert andPersing, 1999). 16S rRNA gene sequencingcan also allow identification of new pathogensfrom routine clinical specimens (Drancourtet al., 2004).

Pyrosequencing is a real-time, nonelec-trophoretic, primer extension sequencingmethod. Using automated ink-jet technology,dNTPs are added to samples one base at atime. If incorporated, the resultant pyrophos-phate is converted to ATP, via sulfurylase,

which in turn produces light, via luciferase.Prior to the addition of the next base, unincor-porated dNTPs are degraded by apyrase (Ron-aghi et al., 1998). Advantages of pyrosequenc-ing over Sanger sequencing include: (1) higherthroughput obtained with a 96- or 384-wellplate setup with turnaround times of minutesper reaction (2) readability of the bases imme-diately following the sequencing primer, and(3) direct use of unpurified PCR products.

A disadvantage of pyrosequencing is a typ-ical read length of 30 to 50 bp per reaction. Animproved chemistry recently released by themanufacturer may double or triple this length,with the potential for improved discriminatorypower.

A broad range of bacteria can be identi-fied by DNA pyrosequencing following am-plification of 16S rRNA V1 and V3 regionswith biotinylated consensus primers (Jonas-son et al., 2002). The resultant amplicons arecaptured using streptavidin-coated beads andthen sequenced. Other uses of pyrosequencingin microbiology include the identification offungi via 18S rRNA (Gharizadeh et al., 2004),typing of human papillomavirus (Gharizadehet al., 2001), detection of lamivudine-resistanthepatitis B virus (Lindstrom et al., 2004), andcharacterization of protease inhibitor-resistantHIV-1 (O’Meara et al., 2001).

Bacterial strain identification by rep-PCR(DiversiLab)

Many molecular methods have been usedfor DNA typing, including pulsed-field gelelectrophoresis (PFGE) and ribotyping. PCR-based DNA typing methods facilitate rapidand convenient epidemiologic studies includ-ing strain tracking, confirmation of strain iden-tity, and determination of clonal relationshipsamong pathogenic isolates (Rademaker andSavelkoul, 2004). The key advantages of PCR-based typing include reduced demands forDNA or organism quantities and the genera-tion of sufficiently complex profiles for mean-ingful strain comparisons. The combinationof automated DNA extraction and PCR-basedtyping may allow high-throughput studies ofbacterial populations in clinical laboratories.

With repetitive-sequence-based PCR,primers complementary to conserved anddispersed repetitive DNA elements (typically<100 bp) are used in each PCR reaction.PCR primers may be exact sequence ordegenerate oligonucleotide combinationsdesigned to initiate DNA synthesis betweencontiguous repetitive sequences. Because theoutwardly-facing primers will be separated by


9.18.21


various distances depending on the separationof repetitive elements on the chromosome,the PCRs yield products of different sizes.The differently sized products can be frac-tionated by agarose gel electrophoresis ormicrofluidics chips (Healy et al., 2005).

The chromosomal DNA profiles can becompared using various algorithms. Similaritycoefficients can be generated using various ap-proaches. The Pearson correlation coefficientconsiders both the presence/absence of bandsand relative intensities at specific positions.Once similarity coefficients are generated, thedendrograms are rendered based on differentclustering algorithms. UPGMA is a widely ac-cepted algorithm for constructing hierarchicaldendrograms and facilitates the analyses ofgroups of strains that may be related or similar.

Critical Parameters andTroubleshooting

Automated nucleic acid extractionDifferent specimen types must be extracted

using algorithms that are optimized for purifi-cation of DNA/RNA from different samples.

Adequate quality control must be per-formed with each run using “idealized” cells orsamples of interest to ensure that adequate nu-cleic acid extraction was performed. Nucleicacid concentrations may be determined fol-lowing sample runs to periodically check rel-ative yields using automated instrumentation.

When performing quantitative analyses,calculations must take into account the sampleinput and elution volumes used for extraction.


Samples may contain inhibitors that affectthe ability to accurately quantitate viral loads.To perform adequate quality control for quan-titative assays, low quantity and high quantitypositive controls should be used with each runin addition to negative controls.

Viral loads should be compared longitudi-nally with the same method since differentmethods may generate significantly differentvalues.

Meaningful changes should usually exceed0.5 log or three-fold differences in viral loadsdue to large coefficients of variation.

Upper and lower limits of detection mustbe established by each laboratory dependingon specific details of assay validation, the dy-namic (linear) range, and particular methodused. Viral loads should not be reported if lev-els exceed the upper limit of detection.


Pure cultures are desirable to prevent unin-terpretable results.

Failure of the internal control to amplifymay indicate the presence of PCR inhibitors.

Melting curve profiles and peaks that dif-fer from expected patterns may indicate thepresence of cross-reactive target genes thatyield amplicons with the primer-probe sets ofinterest.

Melting curve peaks at lower than ex-pected temperatures in some assays may rep-resent probe hybridization site polymorphisms(Schaade et al., 2001).


Pyrosequencing requires pure bacterial cul-tures. Mixed cultures may produce inaccurateor uninterpretable results.

As some closely related bacterial speciesmay not be distinguishable using pyrosequenc-ing of only the V1 and V3 regions, resultsshould be correlated with conventional micro-biologic data such as the results of biochemicalpanels.

Caution should be used in the interpreta-tion of sequences containing homopolymers;manual editing of sequences may be required.

Reagents, including water, harboring con-taminating bacterial nucleic acids may pro-duce false-positive results in pyrosequencingreactions (Grahn et al., 2003).


Adequate quality control dictates the inclu-sion of strains of known profiles that are qual-itatively different from test strains. This QCstrain can serve to validate DNA profiling re-sults and serve as an outlier in the dendrogramgeneration.

DNA profiles should include multiplebands and represent patterns of sufficient com-plexity such that meaningful comparisons canbe made.

Size markers are useful for assessing res-olution of size fractionation for each samplerun. It is important that size markers flank thearea of interest. Upper and lower limits must beestablished for assessing DNA profiles (typi-cally ∼100 to 1000 bp). Small amplicons maybe difficult to compare if bands are diffuse, andthese products may result from primer-dimerformation. Larger products may be difficult toreproduce and may yield artifactual bands.


9.18.22


Anticipated ResultsAs required by laboratory methods used

clinically, these methods are robust andshould only rarely fail to yield useful data.FDA-approved kits, such as the COBASAMPLICOR quantitative HIV-1 test, tend tohave the most strictly defined, clear-cut rangeof results. Other assays may occasionally re-quire more interpretation; correlation withclinical or other laboratory data may be helpfulin these instances.


The COBAS AMPLICOR software (RocheDiagnostics) will return numeric results whenthe viral load falls within the assay’s dynamicrange of 400 to 750,000 copies/ml. Otherwise,an invalid result will be generated. Clinically,changes less than three-fold may not indicatea meaningful change.


Specimens negative for mecA will fail toamplify, that is, no amplification curve will beproduced. In these cases, the internal controlmust produce an amplification curve and theexpected melting temperature for the assay tobe deemed valid. Rarely, the internal controlwill fail to amplify because of PCR inhibitors.Positive samples will produce an amplificationcurve and the expected melting temperature inthe appropriate fluorescence channel.


Isolates that yield sufficient readable se-quences may yield a unique match with theRDP database for both 16S V1 and V3 regions.These cases can be assigned a species-levelidentification. Those samples with multipledatabase matches require correlation with phe-notypic data to formulate a species or genuslevel identification.


Isolates derived from a common clone willproduce identical (or nearly so) band patterns,which are identified as such by the Diversi-Lab software. Unrelated isolates will producedissimilar fragment patterns.

Time ConsiderationsThe time considerations indicated below

are approximate time periods for each assay.Specific time allotments may differ among lab-

oratories depending on technical expertise andavailable resources.

For automated bacterial DNA extraction,the hands-on time required is 30 min and thetotal extraction time is ∼2 hr.

For automated viral nucleic acid extraction,the hands-on time required is 30 min and thetotal extraction time is ∼2 hr.

HIV-1 detection and quantification by com-petitive quantitative RT-PCR require a hands-on time of 45 min and the total time requiredis 7 hr.

Real-time fluorescent PCR by the LightCy-cler (mecA detection) requires a hands-on timeof 15 min and the total time required is ∼1 hr.

Bacterial identification by real-time se-quencing of ribosomal 16S DNA requires twoseparate steps. The PCR requires a total time of60 min and sequencing requires a total time of1.5 hr. Data interpretation requires a total timeof 30 min. The total time required to performthis protocol is ∼6.7 hr.

Bacterial strain identification by rep-PCR(DiversiLab) requires a PCR total time of 2.5hr. Separation by the BioAnalyzer requires atotal time of ∼1 hr. Interpretation of the datatakes 15 min. The total time required for thisprotocol is ∼4.25 hr.

Literature CitedCole, J.R., Chai, B., Marsh, T.L., Farris, R.J. Wang,

Q., Kulam, S.A., Chandra, S., McGarrell, D.M.,Schmidt, T.M., Garrity, G.M., and Tiedje, J.M.2003. The Ribosomal Database Project (RDP-II): Previewing a new autoaligner that allowsregular updates and the new prokaryotic taxon-omy. Nucl. Acids Res. 31:442-443.

Drancourt, M., Berger, P., and Raoult, D. 2004. Sys-tematic 16S rRNA gene sequencing of atypi-cal clinical isolates identified 27 new bacterialspecies associated with humans. J. Clin. Micro-biol. 42:2197–2202.

Gharizadeh, B., Kalantari, M., Garcia, C.A.,Johansson, B., and Nyren, P. 2001. Typing ofhuman papillomavirus by Pyrosequencing. Lab.Invest. 81:673-679.

Gharizadeh, B., Norberg, E., Loffler, J., Jalal, S.,Tollemar, J., Einsele, H., Klingspor, L., andNyren, P. 2004. Identification of medically im-portant fungi by the Pyrosequencing technology.Mycoses 47:29-33.

Grahn, N., Olofsson, M., Ellnebo-Svedlund, K.,Monstein, H.-J., and Jonasson, J. 2003. Identi-fication of mixed bacterial DNA contaminationin broad-range PCR amplification of 16S rDNAV1 and V3 variable regions by pyrosequencingof cloned amplicons. FEMS Microbiol. Lett.219:89-91.

Healy, M., Huong, J., Bittner, T., Lising, M., Frye,S., Raza, S., Schrock, R., Manry, J., Renwick,A., Nieto, R., Woods, C., Versalovic, J., andLupski, J.R. 2005. Microbial DNA typing by


9.18.23


automated repetitive-sequence-based PCR. J.Clin. Microbiol. 43:199-207.

Hill, C.E. and Caliendo, A.M. 2004. Viral loadtesting. In Molecular Microbiology: Diagnos-tics Principles and Practice (D.H. Persing, F.C.Tenover, J. Versalovic, Y.-W. Tang, E.R. Unger,D.A. Relman, and T.J. White, eds.) pp. 475-487.ASM Press, Washington, DC.

Holzl, G., Stocher, M., Leb, V., Stekel, H., andBerg, J. 2003. Entirely automated quantifica-tion of human immunodeficiency virus type 1(HIV-1) RNA in plasma by using the ultrasensi-tive COBAS AMPLICOR HIV-1 Monitor Testand RNA purification on the MagNA Pure LCinstrument. J. Clin. Microbiol. 41:1248-1251.

Jonasson, J., Olofsson, M., and Monstein, H.-J.2002. Classification, identification and subtyp-ing of bacteria based on pyrosequencing andsignature matching of 16S rDNA fragments.APMIS 110:263-272.

Kessler, H.H., Muhlbauer, G., Stelzl, E., Daghofer,E., Santer, B.I., and Marth, E. 2001. Fully auto-mated nucleic acid extraction: MagNA Pure LC.Clin. Chem. 47:1124-1126.

Kolbert, C.P. and Persing, D.H. 1999. RibosomalDNA sequencing as a tool for identificationof bacterial pathogens. Curr. Opin. Microbiol.2:299-305.

Knepp, J.H., Geahr, M.A., Forman, M.S., and Val-samakis, A. 2003. Comparison of automated andmanual nucleic acid extraction methods for de-tection of enterovirus RNA. J. Clin. Microbiol.41:3532-3236.

LightCycler MRSA Detection Kit Instruction Man-ual, version 2. 2003. Roche Diagnostics.

Lindstrom, A., Odeberg, J., and Albert, J. 2004.Pyrosequencing for detection of lamivudine-resistant hepatitis B virus. J. Clin. Microbiol.42:4788-4795.

Loeffler, J., Schmidt, K., Hebart, H., Schumacher,U., and Einsele, H. 2002. Automated extrac-tion of genomic DNA from medically importantyeast species and filamentous fungi by usingthe MagNA Pure LC system. J. Clin. Microbiol.40:2240-2243.

Mackay, I.M. 2004. Real-time PCR in the mi-crobiology laboratory. Clin. Microbiol. Infect.10:190-212.

MagNA Pure LC DNA Isolation Kit III (Bacteria,Fungi) Instruction Manual. 2004. Roche Diag-nostics.

MagNA Pure LC Total Nucleic Acid Isolation KitInstruction Manual. 2004. Roche Diagnostics.

Niesters, H.G.M. 2004. Molecular and diagnosticclinical virology in real time. Clin. Microbiol.Infect. 10:5-11.

O’Meara, D., Wilbe, K., Leitner, T., Hejdeman,B., Albert, J., and Lundeberg, J. 2001. Mon-itoring resistance to human immunodeficiencyvirus type 1 protease inhibitors by pyrosequenc-ing. J. Clin. Microbiol. 39:464-473.

Peters, I.R., Helps, C.R., Hall, E.J., and Day, M.J.2004. Real-time PCR: Considerations for effi-

cient and sensitive assay design. J. Immunol.Methods 286:203-217.

Rademaker, J.L.W. and Savelkoul, P. 2004. PCRamplification-based microbial typing. In Molec-ular Microbiology: Diagnostics Principles andPractice (D.H. Persing, F.C. Tenover, J. Versa-lovic, Y.-W. Tang, E.R. Unger, D.A. Relman,and T.J. White, eds.) pp. 197-221. ASM Press,Washington, DC.

Ronaghi, M., Uhlen, M., and Nyren, P. 1998. A se-quencing method based on real-time pyrophos-phate. Science 281:363-365.

Rozen, S. and Skaletsky, H.J. 2000. Primer3 onthe WWW for general users and for biologistprogrammers. In Bioinformatics Methods andProtocols: Methods in Molecular Biology (S.Krawetz and S. Misener, eds.) pp. 365-386. Hu-mana Press, Totowa, NJ.

Schaade, L., Kockelkorn, P., Ritter, K., and Kleines,M. 2001. Detection of cytomegalovirus DNA inhuman specimens by LightCycler PCR: Melt-ing point analysis is mandatory to detect virusstrains with point mutations in the target se-quence of the hybridization probes. J. Clin. Mi-crobiol. 39:3809.

Versalovic, J. 2003. Is real-time detection of drug-resistant Staphylococcus aureus worth consid-ering? Arch. Pathol. Lab. Med. 127:784-785.

Versalovic, J., Koeuth, T., and Lupski, J.R. 1991.Distribution of repetitive DNA sequences ineubacteria and application to fingerprinting ofbacterial genomes. Nucl. Acids Res. 19:6823-6831.

Wittwer, C.T. and Kusukawa, N. 2004. Real-timePCR. In Molecular Microbiology: DiagnosticsPrinciples and Practice (D.H. Persing, F.C. Ten-over, J. Versalovic, Y.-W. Tang, E.R. Unger,D.A. Relman, and T.J. White, eds.) pp. 71-84.ASM Press, Washington, DC.

Key ReferencesHill and Caliendo, 2004. See above.

A brief overview of viral load testing for not onlyHIV-1, but also hepatitis B and C viruses, cy-tomegalovirus, and Epstein-Barr virus using quan-titative PCR.

Mackay, 2004. See above.

Current review of real-time PCR and its applica-tions.

Wittwer and Kusukawa, 2004. See above.

Discussion of technical aspects of real-time PCR,aided by numerous tables and graphs.

Jonasson et al., 2002. See above.

First description of 16S rDNA pyrosequencing.

Healy et al., 2005. See above.

Definitive work on microbial typing with rep-PCRby its inventors.

Internet Resourceshttp://www.amptestdirectory.org

Infectious diseases test directory of the Associationfor Molecular Pathology.


9.18.24


http://www.roche-applied-science.com/lightcycler-online

Useful information from Roche Diagnostics for theLightCycler platform.

http://www.biotagebio.com

Pyrosequencing site of Biotage.

http://rdp.cme.msu.edu/index.jsp

Ribosomal Database Project site of the Center forMicrobial Ecology of Michigan State University.

http://www.bacbarcodes.com

Information on the DiversiLab system from Bacte-rial Barcodes.

Contributed by Gregory L. BlakeyBaylor College of MedicineHouston, Texas

Ruth Ann Luna and James VersalovicBaylor College of Medicine and

Texas Children’s HospitalHouston, Texas

Documents

Current Protocols in Human Genetics || Infectious Diseases Testing