Upload
doreen-grant
View
213
Download
1
Tags:
Embed Size (px)
Citation preview
COT 6930HPC and Bioinformatics
Introduction to Molecular Biology
Xingquan ZhuDept. of Computer Science and Engineering
Outline
Cell DNA
DNA Structure DNA Sequencing
RNA (DNA-> RNA) Protein
Cells are fundamental working units of every living system. A cell is the smallest structural unit of an organism that is capable of
independent function Unicellular organism (Any living being consisting of a single cell): mainly bacteria Multicellular organism (Organisms consisting of more than one cell): Plant and animal
All cells have some common features Membrane, cytoplasm
Cell is able to survive and multiply independently in appropriate environment There are estimated about 6x1013 (60 trillions) cells in a human body, of
about 210 distinct cell types Cells may have different sizes: a human red blood cell may be 5 microns in
diameter while some neurons are about 1 m long (from spinal cord to leg) Name a cell visible with naked eyes..
Life begins with Cell
Cell
Living organisms (on Earth) require ability to Separate inside from outside (lipids) Build 3D machinery to perform biological functions (proteins) Store information on how to build machinery (DNA)
The basic unit of life Every living thing is made of cells. Every cell comes from a pre-existing cell All of life’s functions are cellular
Every organism is composed of one of two radically different types of cells: prokaryotic cells or eukaryotic cells.
Prokaryotic cells are simpler than eukaryotic cells
Prokaryotes are (mostly) single cellular organisms
Eukaryotic cell has a nucleus, separated from the rest of the cell by a membrane
Eukaryotes can be single cellular (Yeast) or multicellular (animals, plants)
Organisms – Eukaryotes and Prokaryotes
Organisms – Eukaryotes and Prokaryotes
Prokaryotes Eukaryotes
Single cell Single or multi cell
No nucleus Nucleus
No organelles Organelles
One piece of circular DNA Chromosomes
No mRNA post transcriptional modification
Exons/Introns splicing
Structure of a Eukaryotic Cell
• Nucleus contains chromosomes, which are the carrier of the genetic material
• Organelles like centrioles, lysosomes, golgi complexes are enclosed compartments within the cell and are responsible for particular biological processes
• Area of the cell outside the nucleus and the organelles is called the cytoplasm
Composition of Cells
Cell membrane Boundary between cell and outside world Cell membranes consist of two layers of lipid
molecules with hydrophobic ends facing in (keeps water out)
Nucleus Contain genetic material Separated from the rest of the cell by a nuclear
membrane
The nucleus1. nuclear envelope2. nucleolus3. chromosomes
chromosomes
All Cells have common Cycles
Growth of a single cell and its subsequent division is called the cell cycleM: Mitosis
Prokaryotes, particularly bacteria, are extremely successful at multiplying.
Multicellular organisms typically begin life as a single cell. The single cell has to grow, divide and differentiate into different cell types to produce tissues and in higher eukaryotes, organs
All cells come from pre-existing cells
Molecular Biology: Studying life at the molecular level
DNA Protein RNA
mRNA rRNA tRNA
Protein synthesis Protein transcription Protein translation
Molecules of Life All Life depends on 3 critical molecules –
DNA, RNA, and Protein All 3 are specified linearly
DNA and RNA are constructed from nucleic acids (nucleotides) Can be considered to be a string written in a four-letter
alphabet (A C G T/U) Proteins are constructed from amino acids
Strings in a twenty-letter alphabet of amino acids
DNA RNA protein phenotype
Central dogma of molecular biology
DNA, RNA, Protein
Self replication and genetic code
DNA DNA → DNA (Replication)RNA DNA → RNA (Transcription / Gene Expression)Protein RNA → Protein (Translation)
Outline
Cell DNA
DNA Structure DNA Sequencing
RNA (DNA-> RNA) Protein
DNA (Deoxyribonucleic Acid ) Structure Physical structure
Double (stranded) helix Sugar & phosphate groups form backbone Complementary bases (A-T, C-G) connected by hydrogen bond 5’ = end w/ free phosphate group 3’ = end w/ free oxygen group
DNA
Composition Sequence of nucleotides Deoxyribonucleotide = deoxyribose sugar + phosphate group +
base
Nucleotide Bases
Nucleotides
The five-carbon sugar (a pentose) in nucleotides has two types Deoxyribose, which has a hydrogen atom attached to its #2 carbon atom
(designated 2') : DNA Ribose, which has a hydroxyl group atom there: RNA
DNA structure
Why 5’ and 3’
Deoxyribonucleotide = deoxyribose sugar + phosphate group + base
The deoxyribose sugar in DNA is a pentose, a five-carbon sugar. Four carbons and an oxygen make up the five-membered ring; the other carbon branches off the ring. The carbon constituents of the sugar ring are numbered 1'-4' (pronounced "one-prime carbon"), starting with the carbon to the right of the oxygen going clockwise. The fifth carbon (5') branches from the 4' carbon.
DNA - Denaturation, Hybridization
DNA For bioinformatics
DNA can be represented as a sequence of letters (A,C,G,T)
5’ A T A C G T A 3’ 3’ T A T G C A T 5’ (matching strand, redundant)
Terms Base pair (bp) – one pair of DNA bases (1 letter) Gene – section of DNA that produces a functional product Chromosome – physical linear sequence of DNA Genome – entire collection of DNA for an organism
E Coli 1 chromosome 5 x 106 bases (5 Mbps) Drosophila 8 chromosomes 2 x 108 bases (200 Mbps) Human 48 chromosomes 3 x 109 bases (3 Bbps)
DNA Replication
DNA can be replicated DNA strands are split DNA polymerase (enzyme) reads one strand (template) Builds new (complementary) strand to form duplicate DNA
DNA fascinating factEach cell has 2m of DNA
Average person has 75 trillion cells = 75 * 1012
Length of DNA in a person = 150 * 1012 m
Each person has enough DNA to go to the sun and back 500 times
Organization of DNA in chromosomes
homologous
3 bases/ amino acid
27,000 bases/ protein (1 gene)
3,000,000,000 base pairs/ genome
20,000 genes/ genome
Histone proteins
Human Genome Project
Genome
Gene: Contiguous subparts of single strand DNA that are templates for producing proteins. Chromosomes: compact chain
s of coiled DNA
Genome: The set of all genes in a given organism.
Noncoding part: The function of DNA material between genes is largely unknown.
Source: www.mtsinai.on.ca/pdmg/Genetics/basic.htm
More Terminology
The genome is an organism’s complete set of DNA. A bacteria contains about 600,000 DNA base pairs Human and mouse genomes have some 3 billion.
Human genome has 23 pairs of chromosomes. Each chromosome contains many genes.
Gene Basic physical and functional units of heredity. Specific sequences of DNA bases that encode
instructions on how to make proteins.
DNA sequences in the human genome
DNA homologies98.7%
Outline
Cell DNA
DNA Structure DNA Sequencing
RNA (DNA-> RNA) Protein
DNA Sequencing (Sanger’s Dideoxy Method) Method for identifying short DNA sequences Algorithm
Replicate DNA with (color-labeled) dideoxy-nucleotides Creates fragments of DNA
Apply gel electrophoresis Separates fragments based on size
Machine scans gel Records level of color found at each position
Software calls bases Predicts base at each position
Limitations Upper bound of 700-800 bases on sequence length Larger DNA sequences will need to be assembled
DNA Sequencing Dideoxynucleotides
Similar to normal nucleotide base Missing 3’ hydroxyl group terminates DNA sequence May be chemically modified to fluoresce under UV light
DNA Sequencing
Example for GCGAATGTCCACAACGCTACAGGTG Replicate DNA in the presence of dideoxy-Cytidine (ddC) Replication terminates when ddC is used instead of C Produces the following DNA fragments
GC GCGAATGTC GCGAATGTCC GCGAATGTCCAC GCGAATGTCCACAAC GCGAATGTCCACAACGC GCGAATGTCCACAACGCTAC
DNA Sequencing
Gel electrophoresis Place DNA fragments in gel Apply electric field Speed of fragment is determined
by size Smaller = faster Larger = slower
After given time Fragments are separated in gel Fragments are sorted by size
(number of bases)
Gel electrophoresis
DNA Sequencing
DNA Sequencing
Outline
Cell DNA
DNA Structure DNA Sequencing
RNA (DNA-> RNA) Protein
Central Dogma of Biology: DNA, RNA, and the Flow of Information
TranslationTranscription
Replication
Ribonucleic acid (RNA)
Composition Sequence of nucleotides Ribonucleotide = ribose sugar + phosphate group + base
Major difference between DNA and RNA RNA: usually single stranded RNA: ribose sugar, DNA: Deoxyribose sugar RNA: Uracil (U) instead of Thymine (T)
DNA → RNA (Transcription / Gene Expression) RNA polymerase (enzyme)
Finds gene initiation marker (codon) on DNA strand Reads DNA strand containing marker Builds (complementary) strand of messenger RNA (mRNA) Stops when gene end marker (codon) found
Resulting RNA sequence = transcript
Ribonucleotides
The five-carbon sugar (a pentose) in nucleotides has two types Deoxyribose, which has a hydrogen atom attached to its #2 carbon atom
(designated 2') : DNA Ribose, which has a hydroxyl group atom there: RNA
Transcription Example (1)
Transcription Example (2)
Transcription Example (3)
Transcription Example (4)
Transcription Example
What is Enzyme?
Proteins that catalyze (i.e. accelerate) chemical reactions They are not living things Two types of Enzyme
Join specific molecules together to form new molecules Break specific molecules apart into separate molecules
Things about Enzyme Enzymes are specific: Performing only one specific job, about
3000 types enzymes identified so far Enzymes are catalysts: Can perform that same job over and over
again, millions of times, without being consumed in the process. Enzymes are efficient: Enzymes are natural: Once they have done their job, enzymes
break down swiftly and can be absorbed back into nature
Outline
Cell DNA
DNA Structure DNA Sequencing
RNA (DNA-> RNA) Protein