Embed Size (px)
Citation preview
JOURNAL OF BACTERIOLOGY, Oct. 2002, p. 5364–5375 Vol. 184, No. 190021-9193/02/$04.00�0 DOI: 10.1128/JB.184.19.5364–5375.2002Copyright © 2002, American Society for Microbiology. All Rights Reserved.
Context-Dependent Functions of the PII and GlnK SignalTransduction Proteins in Escherichia coli
Mariette R. Atkinson, Timothy A. Blauwkamp, and Alexander J. Ninfa*Department of Biological Chemistry, University of Michigan Medical School,
Ann Arbor, Michigan 48109-0606
Received 28 February 2002/Accepted 24 June 2002
Two closely related signal transduction proteins, PII and GlnK, have distinct physiological roles in theregulation of nitrogen assimilation. Here, we examined the physiological roles of PII and GlnK when theseproteins were expressed from various regulated or constitutive promoters. The results indicate that the distinctfunctions of PII and GlnK were correlated with the timing of expression and levels of accumulation of the twoproteins. GlnK was functionally converted into PII when its expression was rendered constitutive and at theappropriate level, while PII was functionally converted into GlnK by engineering its expression from thenitrogen-regulated glnK promoter. Also, the physiological roles of both proteins were altered by engineeringtheir expression from the nitrogen-regulated glnA promoter. We hypothesize that the use of two functionallyidentical PII-like proteins, which have distinct patterns of expression, may allow fine control of Ntr genes overa wide range of environmental conditions. In addition, we describe results suggesting that an additional,unknown mechanism may control the cellular level of GlnK.
Most studies of the regulation of gene expression are fo-cused on elucidating the identities of regulatory factors, themechanisms by which these factors are controlled, the natureof the targets of regulation, and the interactions of regulatoryfactors and their targets. Here, we focused on the role ofgenetic connectivities (i.e., the position within a complex ge-netic circuit) in determining the physiological function of asignal transduction protein.
The closely related PII and GlnK signal transduction pro-teins play distinct roles in the regulation of nitrogen assimila-tion in Escherichia coli (reviewed in reference 23). The PIIprotein, the product of glnB, is produced constitutively. It par-ticipates in regulating transcription of the glnA gene encodingglutamine synthetase (GS) and in regulating GS catalytic ac-tivity. In contrast, the GlnK protein, the product of glnK, isfound only in nitrogen-limited cells and does not contributesignificantly to regulation of glnA transcription. However,GlnK is required to regulate expression of Ntr genes otherthan glnA in cells that lack PII. In the absence of this regulationby GlnK, cells have a severe growth defect on defined mediumthat is correlated with overexpression of the Ntr regulon (6).
Ntr promoters, such as glnAp2, glnKp, and nacp, are ex-pressed by RNA polymerase containing the minor sigma factor�54 (reviewed in references 5 and 19). Expression from thesepromoters requires the activator NRI�P (NtrC�P), whichbinds to upstream enhancer sequences and interacts with thepromoter-bound polymerase by formation of a DNA loop. Theinteraction of the activator with the polymerase is required forthe polymerase to melt the DNA strands and form the opentranscription complex competent for transcript initiation. Pre-vious studies of glnAp2, nacp, and glnKp activation both in vivo
and in vitro have indicated that expression from these promot-ers is regulated by the concentration of NRI�P, which is am-plified as cells are starved for ammonia (reference 2 and ref-erences therein). Of these promoters, glnAp2 is the mostsensitive to activation by NRI�P, while the other promotersrequire a higher concentration of NRI�P for activation (re-viewed in reference 24).
Phosphorylation and dephosphorylation of NRI are broughtabout by the product of the glnL (ntrB) gene, NRII (NtrB)(reviewed in reference 24). The glnL and glnG genes are ad-jacent to glnA, and under nitrogen-limiting conditions activa-tion of the glnAp2 promoter leads to increased expression ofNRI and NRII (27). Under these conditions NRII acts as akinase and phosphorylates NRI. Thus, under nitrogen-limitingconditions, NRI and NRII positively regulate their own syn-thesis. Under nitrogen-excess conditions, NRI is dephosphor-ylated by NRII, and basal levels of NRI and NRII are main-tained by expression from the glnLp promoter (38). Thispromoter is recognized by the main form of RNA polymerase,E�70, and is repressed by NRI and NRI�P. Therefore, undernitrogen-excess conditions, NRI negatively regulates its ownexpression.
While the growth of E. coli on ammonia requires GS, it doesnot require NRI (29). Nevertheless, the rate of growth onammonia is higher when E. coli contains NRI and is able toincrease the level of GS by activation of glnAp2. In contrast,growth on certain poor nitrogen sources, such as arginine, notonly requires NRI but also requires the ability to raise theintracellular concentration of NRI by activation of the glnAp2promoter (27, 34). When this positive autoregulatory loop isdisrupted by genetic manipulations that provide a low, con-stant level of NRI, the regulation of glnAp2 by nitrogen statusis normal, but the cells are unable to use arginine and certainother nitrogen sources (6, 27).
The kinase and phosphatase activities of NRII are regulatedby the interaction of NRII with the related PII and GlnK
* Corresponding author. Mailing address: Department of BiologicalChemistry, University of Michigan Medical School, 1301 E. Catherine,Ann Arbor, MI 48109-0606. Phone: (734) 763-8065. Fax: (734) 763-4581. E-mail: [email protected].
5364
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
proteins (reviewed in references 23 and 24). Binding of PII orGlnK to NRII results in inhibition of the NRII kinase activityand activation of the NRII phosphatase activity, leading todephosphorylation of NRI�P. Signals of carbon and nitrogenstatus regulate the ability of PII and GlnK to either interactwith or regulate NRII. One nitrogen signal that regulates PIIactivity is glutamine, which controls the antagonistic activitiesof the signal-transducing uridylyltransferase (UTase)/uridylyl-removing enzyme (UR), the product of glnD. When the intra-cellular concentration of glutamine is low, the UTase activityof UTase/UR brings about uridylylation of PII, which preventsPII binding to NRII. When the concentration of glutamine ishigh, the UR activity of UTase/UR converts PII�UMP to PII,restoring its ability to bind to NRII. 2-Ketoglutarate, a signal ofboth carbon and nitrogen status, allosterically regulates PIIactivity. The trimeric PII protein contains three sites for thiseffector, which are bound with negative cooperativity. At loweffector concentrations, one of the three sites in the PII trimeris occupied, resulting in a conformation of PII that binds to andregulates NRII. At high effector concentrations, the negativecooperativity is overcome, and three molecules of effector bindPII, resulting in a conformation of PII that is unable to regu-late NRII. Studies of the purified GlnK protein have shownthat it is similarly controlled by uridylylation and by binding of2-ketoglutarate but that the deuridylylation of GlnK by the URactivity of UTase/UR is very slow (7).
PII and GlnK also participate in the regulation of GS activityby controlling the adenylyltransferase (ATase) (glnE product)that catalyzes the reversible adenylylation of GS. Studies withintact cells have indicated that PII and GlnK are each able tocontrol the activities of ATase, although distinct regulatoryprofiles are obtained when cells contain only PII or only GlnK(6).
Working hypothesis and questions addressed in this work.The current state of our knowledge is summarized in the cir-cuit diagram in Fig. 1, in which the connectivities betweengenes and regulatory proteins are shown. We propose thatthere is a hierarchy of ntr gene expression in E. coli that is theresult of NRI�P accumulating as cells become starved fornitrogen (Fig. 1). Transcription from the glnAp2 promoter is atthe first level of the hierarchy. This promoter is very sensitiveto activation by NRI�P. Expression from the glnHp2, glnK,nac, and ast promoters requires high intracellular concentra-tions of NRI�P that occur only under nitrogen-limiting con-ditions and is therefore at the second level.
We propose a third level, containing at least one gene (des-ignated serA), in Fig. 1. Our rationale for proposing this addi-tional level in the cascade of Ntr gene expression is based onthe following observation. Cells lacking both PII and GlnKhave a severe growth defect on minimal medium due to theunregulated kinase activity of NRII and the absence of NRIIphosphatase activity, which results in very high NRI�P levels.This growth defect is ameliorated either by inclusion of acomplex mixture of amino acids in the growth medium (caseinhydrolysate) or by genetic manipulations that prevent the in-crease in the NRI concentration that typically results from theactivation of glnAp2 (6). It has been shown elsewhere that serAis represssed by Nac and that this repression is responsible forthe poor growth phenotype of cells lacking both PII and GlnK(9). Repression of serA, by limiting the production of glycine
and C1 units necessary for purine biosynthesis, may provide anadvantage to cells when they are exposed to extreme environ-mental stress. One role of GlnK and PII may be to preventhigh levels of nac expression and repression of serA, whichreduces growth, under favorable environmental conditions (9).
Within the context of this working hypothesis, there areseveral possible explanations for the apparent differences inthe PII and GlnK functions. Structural differences in theseproteins may result in alterations of their interactions withNRII (although no such differences were seen in vitro [7]). Forexample, some special feature of GlnK, such as sensitivity to aregulatory factor or metabolite present only in starved cells,may make it better suited for regulation of NRII under nitro-gen-limiting conditions. Alternatively, the apparently distinctfunctions of PII and GlnK may result from their differentpositions within the gene cascade and the consequent differ-ences in the timing of expression and the levels of accumula-tion. To examine this issue, we altered the positions of PII andGlnK within the Ntr gene cascade by engineering expression ofthese proteins from various promoters and examined the ef-fects of these manipulations.
MATERIALS AND METHODS
Bacteriological techniques. For preparation of Luria-Bertani (LB) broth andW-salts-based defined media, preparation of plasmid DNA, preparation of com-petent cells, transformation of cells with DNA, sequencing of plasmid DNA,PCR amplification of DNA, preparation of P1vir phage lysates, P1-mediatedtransduction, recombination of DNA on the bacterial chromosome, and long-term storage of strains we used standard techniques or previously describedtechniques (4, 6, 12, 15, 22, 33, 36). Site-specific mutagenesis was performed byusing the Altered Sites mutagenesis system (Promega Corporation) according tothe manufacturer’s instructions. The bacterial strains, plasmids, and oligonucle-otides used in this work are described in Table 1. The turbidities of bacterialcultures were measured with a Beckman DU65 spectrophotometer.
Construction of glnBp, glnKp, and glnAp fusions to the glnB and glnK struc-
FIG. 1. Hypothetical gene cascade regulating nitrogen assimilationin E. coli. The solid arrows indicate activation of genes by NRI�P. Thedashed arrows indicate the products of the genes. Lines ending in barsindicate hypothetical negative control interactions. For a discussion,see the text.
VOL. 184, 2002 CONTEXT-DEPENDENT FUNCTIONS OF PII AND GlnK 5365
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
TABLE 1. Strains, plasmids, and primers used in this study
Strain, plasmid,or primer Relevant characteristics Reference, construction,
or source
StrainsYMC10 endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs 8RB9060 endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 10K endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �mdl-glnK::Kan 6BK endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 �mdl-glnK::Kanr 6BKc endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 �mdl-glnK::Camr 6BK� endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 �mdl-glnK::Camr
trpDC700::putPA130 [�(glnKp-lacZ) Kanr Cams]6
WCH30 endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnK1 (amtB�) 1UNF3435 endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnK1 (amtB�) �glnB2306 1YMC15 endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 11BKg� endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnK1 (amtB�) �glnB2306
trpDC700::putPA130 [�(glnKp-lacZ) Kanr Cams]B� � WCH30 P1vir
B� endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 trpDC700::putPA130[�(glnKp-lacZ) Kanr Cams]
6
BA endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 glnA::Tn5 13TE� recD1903::Tn10 trpDC700::putPA130 [�(glnKp-lacZ) Kanr Cams] 6YMC10� endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs trpDC700::putPA130 [�(glnKp-
lacZ) Kanr Cams]6
YMC15� endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 trpDC700::putPA130[�(glnKp-lacZ) Kanr Cams]
YMC15 � TE� P1vir
MAKc recD �mdl-glnK::Camr 6Kc endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �mdl-glnK::Camr YMC10 � MAKc P1virYMC15K endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �mdl-glnK::Camr YMC15 � MAKc P1virYMC15B endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �glnB2306 BA � YMC15 P1virYMC15B� endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �glnB2306
trpDC700::putPA1303 [�(glnKp-lacZ) Kanr Cams]YMC15B � TE� P1vir
YMC15BK� endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �glnB2306�mdl-glnK::Camr trpDC700::putPA1303 [�(glnKp-lacZ) Kanr Cams]
YMC15B� � MAKc P1vir
YMC15K� endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �mdl-glnK::Camr
trpDC700::putPA1303 [�(glnKp-lacZ) Kanr Cams]YMC15� � MAKc P1vir
Y15Kg� endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �glnK1 (amtB�)trpDC700::putPA1303 [�(glnKp-lacZ) Kanr Cams]
YMC15� � WCH30 P1vir
TE2680 recD1903::Tn10 trpDC700::putPA1303 [Kans Camr lac] 12MABpB recD1903::Tn10 trpDC700::putPA1303 [Kanr Cams glnB8] TE2680 � pglnB8 DNAMAKpK recD1903::Tn10 trpDC700::putPA1303 [Kanr Cams glnK91] TE2680 � pglnK91 DNAMAKpB2 recD1903::Tn10 trpDC700::putPA1303 [Kanr Cams �(glnKp-glnB)] TE2680 � pglnKpB2 DNAMABpK2 recD1903::Tn10 trpDC700::putPA1303 [Kanr Cams �(glnBp-glnK)] TE2680 � pglnBpK2 DNAMAApB2 recD1903::Tn10 trpDC700::putPA1303 [Kanr Cams �(glnAp-glnB)] TE2680 � pglnApB2 DNAMAApK2 recD1903::Tn10 trpDC700::putPA1303 [Kanr Cams �(glnAp-glnK)] TE2680 � pglnApK2 DNABKcBpB endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 �mdl-glnK::Camr
trpDC700::putPA1303 [Kanr Cams glnB8]BKc � MABpB P1vir
BKcBpK2 endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 �mdl-glnK::Camr
trpDC700::putPA1303 [Kanr Cams �(glnBp-glnK)]BKc � MABpK2 P1vir
BKcKpK endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 �mdl-glnK::Camr
trpDC700::putPA1303 [Kanr Cams glnK91]BKc � MAKpK P1vir
BKcKpB2 endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 �mdl-glnK::Camr
trpDC700::putPA1303 [Kanr Cams �(glnKp-glnB)]BKc � MAKpB2 P1vir
BKcApB2 endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 �mdl-glnK::Camr
trpDC700::putPA1303 [Kanr Cams �(glnAp-glnB)]BKc � MAApB2 P1vir
BKcApK2 endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs �glnB2306 �mdl-glnK::Camr
trpDC700::putPA1303 [Kanr Cams �(glnAp-glnK)]BKc � MAApK2 P1vir
Y15KcBpB endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �mdl-glnK::Camr
trpDC700::putPA1303 [Kanr Cams glnB8]YMC15K � MABpB P1vir
Y15KcKpK endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �mdl-glnK::Camr
trpDC700::putPA1303 [Kanr Cams glnK91]YMC15K � MAKpK P1vir
Y15KcKpB endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �mdl-glnK::Camr
trpDC700::putPA1303 [Kanr Cams �(glnKp-glnB)]YMC15K � MAKpB2 P1 vir
Y15BBpB endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �glnB2306trpDC700::putPA1303 [Kanr Cams glnB8]
YMC15B � MABpB P1vir
Y15BKpK endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �glnB2306trpDC700::putPA1303 [Kanr Cams glnK91]
YMC15B � MAKpK P1vir
Y15BKpB endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �glnB2306trpDC700::putPA1303 [Kanr Cams �(glnKp-glnB)]
YMC15B � MAKpB2 P1vir
Y15BKcBpB endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �mdl-glnK::Camr
�glnB2306 trpDC700::putPA1303 [Kanr Cams glnB8]Y15BBpB � MAKc P1vir
Y15BKcKpK endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �mdl-glnK::Camr
�glnB2306 trpDC700::putPA1303 [Kanr Cams glnK91]Y15BKpK � MAKc P1vir
Continued on following page
5366 ATKINSON ET AL. J. BACTERIOL.
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
tural genes. glnBp, glnKp, and glnAp fusions to the glnB and glnK structural geneswere constructed in three steps. First, an NdeI site was introduced at the ATGused for translation initiation by site-specific mutagenesis of the wild-type genesby using primers designed for this purpose (Table 1). The mutagenized geneswere subcloned into intermediate plasmids. Second, the desired promoters wereamplified by PCR by using primers that also introduced an NdeI site at the siteof translation initiation. The amplification products were cloned into the inter-mediate plasmids to form the promoter-structural gene fusions. At this point thefusions were sequenced to verify the constructions. In the final step, the fusionswere subcloned into pRS551 (37) and recombined into the trp locus in a singlecopy as described previously (12). Several independent isolates were examined toensure that they behaved like the isolates reported here. Fusions were thenamplified by PCR and sequenced again to verify the constructions. The fusionswere then moved into various genetic backgrounds by P1vir-mediated general-ized transduction.
�-Galactosidase and GS assays. �-Galactosidase levels are expressed in Millerunits and were determined as described by Silhavy et al. (36). The �-glutamyltransferase activity of GS was measured as described previously (32). The resultsare expressed below in nanomoles of glutamyl hydroximate formed per minuteper milligram of cell protein. Protein contents were determined as described byLowry et al. (21). For the GS assay, two cultures were used for each determi-nation, and the experiments whose results are shown in Table 3 were repeated onthree different occasions. For a given experiment, the values for duplicate cul-tures were within 10%, while the day-to-day reproducibility was 20%. Total GSactivity was determined by using reaction mixtures in which Mn2� was the solemetal ion, and unadenylylated GS activity was determined by using reactionmixtures in which Mg2� was present in large excess over Mn2�, as describedpreviously (32). In the former case both adenylylated and unadenylylated GSshould have been active, whereas in the latter case only unadenylylated GSshould have been active. However, our experience suggests that for unknown
TABLE 1—Continued
Strain, plasmid,or primer Relevant characteristics Reference, construction,
or source
Y15BKcKpB endA1 thi-1 hsdR17 supE44 �lacU169 hutCklebs glnL2302 �mdl-glnK::Camr
�glnB2306 trpDC700::putPA1303 [Kamr Cams �(glnKp-glnB)]Y15BKpB � MAKc P1vir
PlasmidspRS551 lac fusion vector 36pAlter-1 Amps mutagenesis vector Promega CorporationpUC18N pUC18, with NdeI site destroyed 6pUC18NS pUC18, with NdeI and SalI sites destroyedpglnB5 glnB PCR product cloned as BamHI fragment into pAlter-1pglnB6 NdeI site introduced at glnB start codon of pglnB5pglnB8 BamHI fragment containing glnB cloned into pRS551 from pglnB6pglnB10 glnB cloned into pUCN as EcoRI/HindIII fragment from pglnB6pglnK51 glnK PCR product cloned as BamHI fragment into pAlter-1pglnK71 NdeI site introduced at glnK start codon of pglnK5pglnK81 BamHI fragment containing glnK cloned into pUCNS from pglnK71pglnK91 BamHI fragment containing glnK cloned into pRS551 from pglnK71pglnKpB1 glnK coding region of pglnK81 exchanged for the glnB coding region from
pglnB10 as NdeI/SalI fragmentpglnKpB2 BamHI fragment containing glnKp-glnB fusion gene cloned into pRS551pglnBpK1 glnB coding region of pglnB10 exchanged for the glnK coding region of pglnK71pglnBpK2 BamHI fragment containing glnBp-glnK fusion gene cloned into pRS551pglnApB1 glnB promoter of pglnB10 exchanged for glnA promoter generated by PCR as a
KpnI/NdeI fragmentpglnApB2 BamHI fragment containing glnAp-glnB fusion gene cloned into pRS551pglnApK1 glnB coding region of glnAp-glnB fusion gene exchanged for the glnK coding
region of glnK71 as NdeI/HindIII fragmentpglnApK2 BamHI fragment containing glnAp-glnK fusion gene cloned into pRS551
Primers113D GGGGATCCGCGGCCCGGTTGGCAACATGC, primer downstream of glnB
for cloning (BamHI)7158I GCTGCAGGGATCCCTCAACTATTTGCGTAAGCTGCTGC, cloning primer
located upstream of glnB promoter (PstI/BamHI)7159I GCTGCAGGGATCCCATTGAGCGCCTGAATAGCGC, cloning primer
located upstream of glnk promoter (PstI/BamHI)5048F CGGATCCGTCGACTTCCTGTTGCTGTGTGCCAGAG, primer downstream
of glnK for cloning and sequencing (SalI/BamHI)4158J CGGTACCGGATCCCCTCCGCAAACAAGTATTGCAGAGTCCC, cloning
primer located upstream of glnA promoter (KpnI/BamHI)4157J CCATATGTTAACTCTCCTGGATTGGTCATGGTCGTCGTG downstream
primer introduces NdeI site at glnA ATG start codon for cloning the glnApromoter region (NdeI)
9829I GACCGGAGGGGACATATGAAGCTGGTGACC, internal primer for site-specific mutagenesis introducing an NdeI
site at the glnK ATG start codon9251I TTTTCAAGGAATCATATGAAAAAGATTGAT, internal primer for site-
specific mutagenesis introducing an NdeI site at the glnB ATG start codon4588E GGTCATCAGCAATCGCCAC, internal glnK sequencing primer5551E CGTCAGTAAGGCGGCTTACAC, internal glnK sequencing primer4929F GATTATCACGGTCACCAGCTTC, internal glnK sequencing primer2820 ACGGTGACCGAAGTGAAAGGC, internal glnB sequencing primer2866 CAGCTCGGTATGGCCTTTC, internal glnB sequencing primer3098 CGATCCGGCAACCCTTGACGCGG, internal glnB sequencing primer
VOL. 184, 2002 CONTEXT-DEPENDENT FUNCTIONS OF PII AND GlnK 5367
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
reasons, experiments in which there is excess Mg2� may slightly underreport theactivity of unadenylylated GS (6). Thus, the values for GS adenylylation statereported here, especially when the extent of adenylylation was low, may besystematically overestimated by up to �20%.
Immunoblotting. Crude rabbit anti-PII antibody, which cross-reacts withGlnK, was kindly provided by W. C. van Heeswijk (39). The crude antibody wasadsorbed against an extract derived from strain BK (lacking both PII and GlnK)to remove most of the antibodies reacting with other cellular components. Forthis, 3.25 g (wet weight) of pelleted strain BK from a saturated overnight culturein LB medium containing 0.2% glutamine was resuspended in 50 ml of Tris-buffered saline and disrupted by sonication. Ten microliters of crude antibodywas added to the extract and incubated for 1 h, after which the solution wasclarified by centrifugation. For immunoblotting we used the Amersham ECLWestern blotting system according to the manufacturer’s directions.
RESULTS
GlnK is required to prevent excessive Ntr gene expression incells lacking PII. The glnK gene is part of the glnK amtBoperon, and the glnK null mutation used previously was null forboth of these genes (6). In previous work, it was deduced thateither PII or GlnK was required to prevent excessive Ntr geneexpression by performing complementation experiments inwhich the ability to grow well on minimal medium was restoredto strains lacking PII, GlnK, and AmtB by multicopy plasmidsthat encoded only either PII or GlnK (6). The results of theseexperiments, along with the results of experiments showing noapparent phenotype for amtB in isolation or when it is com-bined with �glnB2306, suggested that it is the absence of GlnK,and not AmtB, that is responsible for the growth defect in cellslacking PII (6). However, in subsequent work a nonpolar nullmutation in glnK was examined in combination with�glnB2306; it was claimed that this strain grew significantlybetter than the analogous strain containing the polar mutationin glnK and thus that amtB had some role in the phenotype (1).We therefore examined the phenotype of the nonpolar nullmutation in glnK, kindly provided by W. C. van Heeswijk. Wefound that the combination of �glnB2306 and �glnK amtB�
resulted in the same growth defect that was observed when�glnB2306 was combined with �glnK �amtB (Fig. 2).
GlnK regulates the expression of Ntr genes in cells contain-ing constitutive glnL (ntrB) alleles. The poor-growth pheno-type of strains lacking both PII and GlnK (strains BK) is due toexpression of one or more Ntr genes (6). The poor growthassociated with high levels of Ntr expression in these strainssuggests that all previous mutations causing constitutive ex-pression of glnA did not result in full activation of the Ntrregulon. We examined the most intensively studied such mu-tation, glnL(ntrB)2302, which results in elevated glnA expres-sion under all conditions (3). Studies with the purifiedNRII2302 protein have shown that under conditions underwhich the interaction of PII and wild-type NRII was clearlyevident, no interaction between PII and NRII2302 could bedetected (25), yet cells containing the glnL2302 mutation dis-played only a subtle growth defect and grew well on minimalmedia (3). Thus, we hypothesized that Ntr gene expression wasnot fully activated in a strain with the glnL2302 mutation,perhaps as a result of GlnK regulation of NRII2302 activity invivo.
To explore this possibility, we examined the expression of asingle-copy glnKp-lacZ fusion (single copy located in a landingpad within trp [6]) in strains YMC15� and Y15Kg� (glnL2302
and glnL2302 �glnK1 amtB�, respectively) when these strainswere grown on nitrogen-rich medium supplemented with ca-sein hydrolysate (Table 2). The glnL2302 mutation resulted inelevated expression of the glnKp-lacZ fusion on nitrogen-richmedium compared to the expression in wild-type strainYMC10� (Table 2). However, the glnKp-lacZ fusion was ex-pressed at 2.5-fold-higher levels in Y15Kg� than in YMC15�,indicating that GlnK acts to control Ntr gene expression levelsin a glnL2302 strain. The level of glnKp-lacZ expression inY15Kg� was nearly as high as the level of expression in strainBKg� (�glnB2306 �glnK1 amtB�), so we examined the growthphenotype of strains containing glnL2302 �mdl-glnK::Camr.These strains displayed poor growth on minimal medium thatwas restored by supplementation of the medium with casein
FIG. 2. Absence of both GlnK and PII results in a severe growthdefect on defined medium. Single-colony isolates from rich LB me-dium supplemented with 0.2% (wt/vol) glutamine were streaked toobtain single colonies on a nitrogen-excess plate containing glucose(0.4%), ammonium sulfate (0.2%), and glutamine (0.2%) and incu-bated at 37°C for 48 h. The relevant genotypes are as follows: YMC10,wild type; K, �mdl-glnK::Kanr; BK, �mdl-glnK::Kanr �glnB2306;WCH30, �glnK1 amtB�; and UNF3435, �glnK1 amtB� �glnB2306.
TABLE 2. �-Galactosidase expression of �(glnKp-lacZ)in adapted culturesa
Strain Relevant genotype�-Galactosidase
activity(Miller units)b
YMC10� Wild type, trp::�(glnKp-lacZ) 5BKg� �glnB2306 �glnK1 trp::�(glnKp-lacZ) 3,010YMC15� glnL2302 trp::�(glnKp-lacZ) 820Y15Kg� glnL2302 �glnK1 trp::�(glnKp-lacZ) 2,140
a Cells were grown at 37°C in nutrient-rich defined medium containing 0.4%(wt/vol) glucose, 0.2% (wt/vol) ammonium sulfate, 0.004% (wt/vol) tryptophan,and 0.1% (wt/vol) casein hydrolysate. Overnight cultures were diluted to anoptical density at 600 nm of �0.001, and �-galactosidase activity was monitoredevery 45 min until a steady-state level was achieved (usually before the opticaldensity at 600 nm was �0.150).
b Values are averages for four samples from two independent experiments.The standard deviation was less than 5% for all strains. For YMC10�, no activitywas detected under conditions under which 5 Miller units of enzyme activity wasreadily detectable.
5368 ATKINSON ET AL. J. BACTERIOL.
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
hydrolysate, similar to the growth displayed by strains BK (seebelow). The poor growth displayed by strain YMC15K(glnL2302 �mdl-glnK::Camr) compared to the growth ofYMC15 (glnL2302), along with the high level of Ntr geneexpression in strain Y15Kg� (glnL2302 �glnK1 amtB�), isconsistent with the hypothesis that the growth defect observedin a glnL2302 �glnK mutant results from very high levels of Ntrgene expression. GlnK appears to be capable of at least partialin vivo regulation of the constitutive NRII2302, preventing asevere defect in growth on minimal defined media. We ob-served that the growth defect shown by �glnB2306�mdl-glnK::Camr strains was reproducibly slightly more severethan that shown by glnL2302 �mdl-glnK::Camr strains. Theabsence of GS adenylylation state control in �glnB2306�mdl-glnK::Camr strains may accentuate the results of elevatedNtr gene expression (6).
Altering the positions of PII and GlnK in the Ntr genecascade. Given the different positions of GlnK and PII in thegenetic cascade and the similar abilities of these proteins toregulate NRII in experiments with purified components (7; Q.Sun and A. J. Ninfa, unpublished data), we investigatedwhether the different physiological roles of GlnK and PII wereindeed due to their different positions in the Ntr gene cascade.We formed fusions of the glnB structural gene to the glnA andglnK promoter regions by substitution of the structural genesequence at the ATG codon used for translation initiation(Fig. 3) (see Materials and Methods). Similarly, we formedfusions of the glnK structural gene sequence to the glnB andglnA control regions by substitution of the structural genesequence at the ATG codon used for translation initiation(Fig. 3) (see Materials and Methods). In each case, a fewnucleotides immediately upstream from the translation initia-tion site were altered to engineer an NdeI restriction site over-lapping the ATG translation initiation codon. The resultingfusions were integrated within trp as single copies and wereexamined by using cells lacking any other copies of glnB orglnK.
Altering the physiological roles of PII by altering the timingof its expression and the levels of accumulation. When PII wasexpressed from glnAp, its expression was regulated by ammo-nia, as assessed by immunoblot analysis (Fig. 4A). The level ofPII provided by expression from glnAp was slightly higher thanthe level provided by expression from glnBp in nitrogen-repletecells and was considerably higher than the level provided byexpression from glnBp in nitrogen-limited cells (Fig. 4A). Thus,both the level and the timing of PII expression were altered.Cells containing PII expressed from glnAp as their sole PII-likeprotein grew well on minimal medium lacking casein hydroly-sate (Fig. 5), but they were unable to grow on minimal mediumcontaining arginine as the sole source of nitrogen (data notshown). The expression of GS in such cells was regulated byammonia, but the level of GS was lower than the level inwild-type cells growing under the same conditions (Table 3).Thus, placing glnB into the gene cascade at the level of glnApappeared to result in a reduction in the maximum level ofNRI�P, such that the threshold needed to activate arginineutilization genes was not obtained and glnA transcription couldbe only partially activated.
In contrast, when PII was expressed from glnKp, its expres-sion was also nitrogen regulated (Fig. 4A), but the cells phe-
notypically resembled the �glnB2306 glnK� strain; that is, theexpression of glnA was not regulated by ammonia (Table 3),the cells grew well on minimal medium lacking casein hydro-lysate (Fig. 5), and the cells were able to utilize arginine as asole nitrogen source (data not shown). The regulation of glnAand other nitrogen-regulated genes seemed to be the sameregardless of whether PII or GlnK was expressed from glnKp.Indeed, even the GS adenylylation state was regulated similarlywhen PII or GlnK was expressed from glnKp (Table 3). Thus,PII was functionally converted into GlnK by engineering itsexpression from the glnK promoter. When PII was expressedfrom glnKp, the level of PII was slightly elevated in nitrogen-limited cells and slightly decreased in nitrogen-replete cellscompared to the level of PII when it was expressed from theglnB promoter (Fig. 4A). The decrease in the concentration ofPII when it was expressed from glnKp compared to when it wasexpressed from glnBp (Fig. 4A) must account for the dramaticdifferences in regulation that were observed in nitrogen-re-plete cells (Table 3).
As a control experiment, we examined the expression of PIIfrom glnBp using our engineered construct localized to the trplanding pad (Fig. 3). This experiment probed the effect ofengineering an NdeI site near the translation initiation site(Fig. 3), as well as the effect of a different chromosomal loca-tion. The constitutive expression of PII from glnBp in ourengineered construct was similar to the expression obtainedwith the natural arrangement (Fig. 4A), and the expression ofGS and the control of its adenylylation state were similar tothose seen with the natural glnBp-glnB strain (Table 3). Finally,the engineered glnBp-glnB construct restored the ability togrow on minimal medium to strain BKc (Fig. 5).
Altering the physiological roles of GlnK by altering thetiming of its expression and the levels of accumulation. GlnK,unlike PII, could not be efficiently expressed from glnBp in asingle copy. When glnK was expressed from the glnB promoter,very low levels of GlnK were produced, as indicated by immu-noblot analysis (Fig. 4B) and by the inability of the cells togrow on minimal medium lacking casein hydrolysate (Table 3and Fig. 5). GS expression was unregulated and GS was highlyadenylylated in strain BKc containing the glnBp-glnK fusion asthe sole PII-like protein, as it was in strain BKc (Table 3). TheglnBp-glnK construct that had been placed on the chromosomewas amplified by PCR and subjected to DNA sequencing (aswere the other fusions). This revealed that the entire constructwas exactly as designed. Since both the strain construction andphysiological results appeared to be unambiguous, we con-cluded that glnK, for whatever reason, could not be efficientlyexpressed from glnBp in a single copy in our experiments.These results prevented us from functionally converting GlnKinto PII by expressing it from glnBp in a single copy.
When present on a multicopy plasmid, the glnBp-glnK fusiondescribed above did express glnK. We also observed expressionwhen the glnK open reading frame was inserted into pUC18such that it was expressed from plasmid promoters (see above).The expression of GS and the regulation of its adenylylationstate in strain BKc containing the multicopy plasmid pglnK12resembled the expression of GS and the regulation of its ad-enylylation state in a glnB� �mdl-glnK::Camr strain (Table 4);that is, GlnK could be functionally converted to PII by express-ing it from a multicopy plasmid. Strain BKc containing plasmid
VOL. 184, 2002 CONTEXT-DEPENDENT FUNCTIONS OF PII AND GlnK 5369
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
FIG. 3. Design of promoter fusions. (A) Sequence of the �(glnAp-glnB) and �(glnAp-glnK) promoters. The mutation introducing the NdeI siteto the start of the gene coding regions is indicated by boldface type. The transcription start site of the �70 promoter, glnAp1, is labeled P1�. The
5370 ATKINSON ET AL. J. BACTERIOL.
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
pglnBpK1 had a lower level of GS expression, resembling thelevel of GS expression of a strain overproducing PII.
Unlike the situation observed when the glnB promoter wasused, the glnK gene was efficiently expressed from the glnKpromoter when it was placed in a single copy into the trplanding pad, although it was not expressed quite as well as itwas in the natural context (Fig. 4B). It was also expressed fromglnAp when it was placed on the chromosome (Fig. 4B). Bothof these constructs permitted strain BKc to grow without ca-sein hydrolysate supplementation (Table 3 and Fig. 5). Whenexpressed from glnAp, GlnK was nitrogen regulated, but thelevels of GlnK were lower than expected when they were com-pared to the levels of expression of PII from glnAp (compareFig. 4A and B). Immunoblot analysis suggested that the levelsof GlnK produced from glnKp and glnAp were similar in ni-trogen-starved cells (Fig. 4B), with a slightly higher level ofexpression obtained with glnKp. In nitrogen-replete cells, aslightly higher level of GlnK was expressed from glnAp thanfrom glnKp (Fig. 4B).
Although cells expressing GlnK from glnAp and glnKpshowed similar patterns of GlnK accumulation in the logphase, strains containing these constructs as the sole PII-likeproteins had distinct phenotypes. When GlnK was expressedfrom glnKp (placed on the chromosome within the trp landingpad), both GS expression and adenylylation state control werethe same as they were in RB9060 (that is, the same as whenGlnK was expressed from its own promoter in the naturalcontext) (Table 3). In contrast, cells expressing GlnK fromglnAp had a pattern of GS expression and adenylylation statecontrol that were more similar to the pattern of GS expressionand adenylylation state control of cells that contained PII andlacked GlnK (strain Kc) (Table 3). Unlike cells containing theanalogous glnAp-glnB fusion, cells containing the glnAp-glnKfusion were able to utilize arginine as a sole source of nitrogen.Together, the results show that the functions of GlnK werealtered by expressing GlnK from glnAp and that the alteredtiming of expression and levels of accumulation resulted in anovel cellular phenotype.
Regulation of NRII2302 by PII. As shown above, GlnK pro-vides regulation of Ntr gene expression in cells containingNRII2302 in place of wild-type NRII. This may be accountedfor by structural differences between GlnK and PII or by thealtered levels and timing of expression of the two proteins. Todistinguish between these hypotheses, we examined whetherPII could interact with NRII2302 by using the various engi-neered promoter-structural gene fusions described above.
We observed that upon overexpression from a multicopyplasmid, PII restored the ability of strain YMC15K to grow onminimal medium (data not shown). More importantly, we ob-served that when PII was expressed from the glnK promoter in
strain Y15KcKpB, it restored the ability to grow on minimalmedium (Fig. 6). Strain Y15KcKpB is glnL2302 �mdl-glnK::Camr and contains two copies of the glnB gene encoding PII,the natural copy and the transgene within the trp landing padthat is expressed from the glnK promoter. YMC15B, contain-ing glnL2302 and lacking PII, has no significant growth defect,suggesting that GlnK alone is able to regulate NRII2302, whenit is expressed from its own promoter (Fig. 6).
Because one copy of the glnB gene did not provide enoughPII to regulate the NRII2302 protein in strain YMC15K, weexamined the effects of two copies. Strain Y15KcBpB contain-ing glnL2302, �mdl-glnK::Camr, the natural glnB�, and a trans-gene located in trp consisting of the glnB� gene behind its ownpromoter had no significant growth defect. Thus, in wild-typecells, the level of PII obtained from the single natural copy ofthe glnB gene is just a little too low to regulate NRII2302.Together, these results show that GlnK was not specificallyneeded to prevent the poor-growth phenotype in a glnL2302background; just a sufficient concentration of a PII-like proteinwas required.
DISCUSSION
Levels and timing of expression determine activity of PIIand GlnK. Our results showed that the functions of PII andGlnK were mainly due to the timing of expression and thelevels of accumulation of these two proteins. We could convertPII to GlnK simply by expressing PII from the glnK promoter,and we could convert GlnK to PII by expressing the glnKstructural gene from a plasmid. Also, we obtained novel phe-notypes by making various alterations in the levels of expres-sion and timing of expression of the two proteins. Overexpres-sion of either protein resulted in an inability to use arginine asthe sole nitrogen source and an inability to fully activate glnAexpression in the absence of ammonia. Expression of GlnKfrom the glnA promoter as the sole PII-like protein, which didnot significantly alter the level of accumulation of the proteinbut presumably altered the timing of its expression (2), re-sulted in a phenotype that was somewhat reminiscent of thephenotype of cells that contain PII and lack GlnK. Theseresults support the hypothesis that the distinct functions of PIIand GlnK, at least for the functions measured in our experi-ments, result mainly from the expression profiles. They seem toexclude the possibility that the distinct functions of PII andGlnK result from unique structural features of these proteins.This conclusion is consistent with earlier studies showing thatPII and GlnK are similar in their abilities to regulate NRIIactivities in vitro (7).
Our studies of the constitutive glnL2302 allele support thisconclusion. We observed that GlnK plays an important role in
�10 and �35 RNA polymerase binding sites are underlined. The transcription start site of the �54-dependent promoter, glnAp2, is labeled P2�.The �54 binding site is underlined and italicized. The NRI binding sites are enclosed in boxes. The two high-affinity NRI binding sites are indicatedby boldface type. (B) Sequence of the �(glnKp-glnK) and �(glnKp-glnB) promoters. The putative �54 binding site is underlined, and the putativeNRI binding sites are enclosed in boxes. The mutation introducing the NdeI site to glnK91 is indicated by boldface type. The wild-type (WT) glnKand glnB DNA and amino acid sequences are shown at the bottom. (C) Sequence of the �(glnBp-glnB) and �(glnBp-glnK) promoters. Thetranscription start sites are labeled P1� to P3� (P1� is the major transcript). Putative �10 sequences for �70 promoters are underlined. Themutation introducing the NdeI site to glnB8 is indicated by boldface type. The wild-type glnB and glnK DNA and amino acid sequences are shownat the bottom (20, 26, 31).
VOL. 184, 2002 CONTEXT-DEPENDENT FUNCTIONS OF PII AND GlnK 5371
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
regulating Ntr gene expression in cells containing the glnL2302allele. However, PII could fulfill this role if its expression wasmodestly increased. Recently, strain YMC15 (glnL2302) wasused for genome-wide expression analysis to identify membersof the Ntr regulon (40). At the time, it was believed that themutation in this strain was constitutive for Ntr expression andthus that it would be useful for identification of all Ntr genes.Our results suggest that the levels of Ntr gene expression mayhave been underestimated and that some nitrogen-regulatedgenes may have been missed in the earlier genome-wide ex-pression analysis (40).
The glnL2302 mutation results in conversion of alanine 129of NRII to threonine (3). Recent work suggests that residue129 of NRII is part of the central domain of NRII, which formsa four-helix bundle in the dimer (18). This portion of NRII hasboth the phosphotransferase and phosphatase activities ofNRII (18), yet PII does not bind to this domain but ratherbinds to the C-terminal ATP-binding domain of NRII (28).Thus, the NRII2302 protein contains an intact PII-binding siteand presumably binds PII normally. A hypothesis to explainthese observations is that the NRII2302 protein is partiallydefective in NRII phosphatase activity, such that a higher frac-tion of the protein must be complexed with PII in order to getphysiologically significant levels of the NRII phosphatase ac-tivity. Our experiments suggest that the level of PII resulting
FIG. 4. Immunoblot analysis of PII and GlnK expression from var-ious promoters. Cells were grown on different media (Gg, glucose-glutamine medium [nitrogen limiting]; GNg, glucose-ammonia-glu-tamine medium [nitrogen excess]) to an optical density at 600 nm of0.5. An aliquot of each culture was assayed for GS activity; resultssimilar to those shown in Table 3 were obtained (data not shown).Cells from 1 ml of culture were pelleted, frozen at �20°C, resuspendedin 0.9% NaCl, and disrupted by sonication. Protein concentrationswere determined by the method of Lowry et al., and 6 �g (A) or 10 �g(B) of each extract was used. Electrophoresis was on sodium dodecylsulfate–16% polyacrylamide gels. (A) Expression of PII from variouspromoters in cells lacking GlnK. (B) Expression of GlnK from variouspromoters in cells lacking PII. The source of each extract is shown atthe bottom. The leftmost lanes contained electrophoresis size stan-dards; the three rightmost lanes on each blot contained differentamounts of purified PII (A) or GlnK (B). The positions of the PII andGlnK bands are indicated on the right.
FIG. 5. Growth phenotypes of strains containing PII or GlnK ex-pressed from various promoters in cells containing wild-type NRII.Cells were incubated at 37°C for 42 h on defined minimal mediumcontaining 0.4% (wt/vol) glucose, 0.2% (wt/vol) ammonium sulfate,glutamine, and 0.004% (wt/vol) tryptophan (GNgt) or on the samemedium containing in addition 0.04% Casamino Acids (GNgtCAA).The strains used (and their relevant genotypes) were as follows: 1, BKc(�glnB2306 �mdl-glnK::Camr); 2, BKcBpB (�glnB2306 �mdl-glnK::Camr trp::glnB8); 3, BKcKpK (�glnB2306 �mdl-glnK::Camr trp::glnK91);4, YMC10 (wild type); 5, RB9060 (�glnB2306); 6, Kc (�mdl-glnK::Camr); 7, BKcBpK2 [�glnB2306 �mdl-glnK::Camr trp::�(glnBp-glnK)];8, BKcKpB2 [�glnB2306 �mdl-glnK::Camr trp::�(glnKp-glnB)]; 9, BK-cApB2 [�glnB2306 �mdl-glnK::Camr trp::�(glnAp-glnB)]; and 10, BK-cApK2 [�glnB2306 �mdl-glnK::Camr trp::�(glnAp-glnK)].
5372 ATKINSON ET AL. J. BACTERIOL.
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
from its expression from its natural promoter is insufficient forphysiologically significant levels of the phosphatase activityfrom the NRII2302 protein, that double this level of PII resultsin sufficient phosphatase activity to limit Nac expression, andthat the high level of PII that results from its expression fromthe glnK promoter is sufficient to bring about a level of phos-phatase activity that limits Nac expression, permitting the cellsto grow well on minimal medium. We are currently testing thishypothesis by quantifying the interaction of PII and GlnK withpurified NRII2302 protein and reexamining the abilities ofthese proteins to activate the NRII2302 phosphatase activity.
The PII and GlnK proteins act through NRII to control theconcentration of NRI�P in response to signals of nitrogen andcarbon availability (6). The position of PII outside the regu-lated gene circuitry is reminiscent of the position of LacI out-side the regulated lac circuitry. In both systems, low basal levelsof expression of the gene circuitry and the ability to attain ahigh state of induction may require that the negative regulatorbe present at a constant concentration. The presence of neg-ative regulators inside (glnK) and outside (glnB) the gene cas-cade may reflect the fact that NRI and NRII are expressedfrom multiple promoters also located both inside (glnAp2) andoutside (glnLp) the Ntr gene circuitry. A low constitutive levelof expression of either protein resulted in effective regulation
of glnA expression by ammonia. Thus, the role of PII appearsto be control of the kinase and phosphatase activities of NRIIunder conditions under which nitrogen starvation is not severe.Under these conditions, the concentration of NRII is low,reflecting limited activation of glnAp2, and the level of PIIexpressed constitutively from glnBp is sufficient to maintainprecise control of NRII. However, upon activation of glnAp2,the intracellular concentration of NRII and NRI rises about 5-to 10-fold (2, 4, 30). If the system is fine-tuned, as seems likelybased on a comparison of Fig. 4 and Table 3, this increase inthe NRII concentration may prevent effective control of NRIIby PII. We hypothesize that the role of GlnK is to control theintracellular concentration of NRI�P under nitrogen starva-tion conditions, when the cells have elevated levels of NRIIand NRI. This control by GlnK prevents the NRI�P concen-tration from reaching the maximum level observed in the ab-sence of both PII and GlnK and by so doing prevents expres-sion of high levels of nac and the attendant repression of serA,which limits growth on defined medium lacking casein hydro-lysate (9). The use of both PII and GlnK by E. coli may benecessary to permit fine control of the NRI�P concentrationover a broad range.
Whether GlnK has another role in addition to regulation ofNRII, such as acting on a receptor that is not subject to controlby PII, was not addressed by our studies. This possibility issuggested by the specific role of GlnK in the regulation ofnitrogen fixation in the related organism Klebsiella pneumoniae(16, 17). Our conclusions concerning the functional identity ofPII and GlnK are limited to the regulation of NRII and ATase,as studied in this work. Our experiments also did not resolvethe question of whether GlnK and PII act solely through NRII(or NRII2302) to regulate expression of Ntr genes. Since strainYMC15K displays the poor-growth phenotype characteristic ofNtr overexpression yet contains PII, it seems that PII’s abilityto prevent this phenotype in wild-type cells is due to its abilityto elicit the NRII phosphatase activity. It is certainly possiblethat GlnK also acts through another cellular receptor to reg-ulate Ntr gene expression and permit growth of the cells undernitrogen-limiting conditions. However, if this is so, then PII isalso able to regulate the (unknown) receptor(s), as PII wasable to serve as GlnK when it was expressed from the glnKpromoter.
Additional mechanism(s) for the regulation of GlnK expres-sion. Our experiments in which the glnK structural gene wasfused to glnBp and glnAp revealed that for both fusions, thelevel of GlnK activity was lower than expected. Immunoblot-
TABLE 3. GS expression in adapted cultures
Strain Relevant genotypeGS transferase activity ina:
Ggtrypb GNgtryp
YMC10 Wild type 1,478 (4.1)c 221 (8.7)RB9060 �glnB 1,889 (4.2) 1,516 (11.4)Kc �glnK 1,661 (4.2) 247 (9.8)BKcd �glnB �glnK 1,864 (11.7) 2,270 (11.9)BKcBpB �glnB �glnK �(glnBp-glnB) 1,462 (3.9) 180 (9.0)BKcKpK �glnB �glnK �(glnKp-glnK) 1,910 (4.5) 1,421 (11.4)BKcBpK2d �glnB �glnK �(glnBp-glnK) 1,775 (12) 2,005 (11.6)BKcKpB2 �glnB �glnK �(glnKp-glnB) 1,676 (4.2) 1,559 (11.4)BKcApB2 �glnB �glnK �(glnAp-glnB) 1,010 (4.0) 191 (7.4)BKcApK2 �glnB �glnK �(glnAp-glnK) 1,594 (3.8) 379 (9.7)
a Cultures were grown overnight, diluted to an optical density at 600 nm of�0.02, and grown at 30°C to an optical density at 600 nm of �0.5.
b The media used were glucose-glutamine-tryptophan medium (Ggtryp) andglucose-ammonia-glutamine-tryptophan medium (GNgtryp). In all cases, tryp-tophan was present at a concentration of 0.004% (wt/vol), glucose was present ata concentration of 0.4% (wt/vol), and the nitrogen source was present at aconcentration of 0.2% (wt/vol).
c The number in parentheses is the adenylylation state expressed as the aver-age number of adenylylated subunits per GS dodecamer.
d Strain grew very poorly, with a doubling time of 4 h.
TABLE 4. GS expression in adapted cultures
Strain Relevant genotypeGS transferase activity ina:
Ggb GNg
YMC10 Wild type 1,280 (4.1)c 210 (7.7)Kc �glnK 1,450 (3.9) 230 (8.2)RB9060 �glnB 1,790 (4.2) 1,090 (11)BKc/pglnK12 �glnB �glnK/pUC18-glnK 1,500 (4.2) 110 (6.6)BKc/pglnBpK1 �glnB �glnK/pUC18-�(glnBp-glnK) 250 (4.5) 50 (6.9)
a Cultures were grown overnight, diluted to an optical density at 600 nm of �0.02, and grown at 30°C to an optical density at 600 nm of �0.5.b The media used were glucose-glutamine medium (Gg) and glucose-ammonia-glutamine medium (GNg). In all cases, glucose was present at a concentration of 0.4%
(wt/vol) and the nitrogen source was present at a concentration of 0.2% (wt/vol).c The number in parentheses is the adenylylation state expressed as the average number of adenylylated subunits per GS dodecamer.
VOL. 184, 2002 CONTEXT-DEPENDENT FUNCTIONS OF PII AND GlnK 5373
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
ting also showed that the level of expression of glnK from glnApwas lower than expected. Indeed, our synthetic fusion of theglnK structural gene to glnKp, in which an NdeI site had beenengineered to overlap the natural ATG start codon for glnK,expressed noticeably lower levels of GlnK than the naturalarrangement expressed (Fig. 4B). Since our fusions were pro-duced by substitution of the structural genes at the ATG trans-lational initiation codon, these results raise the possibility thatan additional mechanism may regulate the intracellular con-centration of GlnK and the possibility that a negative regula-tory signal may be contained within the glnK structural gene.By analogy with phage antitermination systems (35), we spec-ulate that such a negative regulatory element may limit GlnKexpression when it is separated from an antagonistic elementpresent in the glnK promoter or leader mRNA. Mutation ofthe region flanking the natural translational start site for glnK,by engineering an NdeI restriction site overlapping the trans-lational start codon, may diminish the effectiveness of thisregulatory mechanism in the otherwise natural context.
GlnK provides effective regulation of ATase in vivo. Previousbiochemical studies of the regulation of ATase by PII andGlnK suggested that these two proteins were distinct in termsof the ability to activate the ATase activities (7). However, in
this study, using intact cells, we observed that regulation of theGS adenylylation state was the same when either PII or GlnKwas expressed from the glnK promoter (Table 3). At present,the molecular basis for this discrepancy is unknown, and sev-eral hypotheses may be offered. For example, the cells may atall times contain a factor required for GlnK activity, which waslacking in vitro. Alternatively, GlnK may be partially inacti-vated by the purification methods described so far, such that itretains the ability to interact with NRII but loses the ability tointeract with ATase in vitro.
Additional complexities of the experimental system. Recentresults of Weiss and colleagues (14) have shown that undercertain conditions PII and GlnK may form heterotrimers invivo. For this reason, the key experiments in our study wereconducted with cells containing only a single PII-like protein.Nevertheless, it is possible that heterotrimer formation influ-enced the results of our control experiments with wild-typecells and resulted in additional complexities in the control ofPII and GlnK function, which were not addressed in our stud-ies.
ACKNOWLEDGMENT
This work was supported by Public Health Service grant GM57393to A.J.N.
REFERENCES
1. Arcondeguy, T., W. C. van Heeswijk, and M. Merrick. 1999. Studies on theroles of GlnK and GlnB in regulating Klebsiella pneumoniae NifL-dependentnitrogen control. FEMS Microbiol. Lett. 180:263–270.
2. Atkinson, M. R., T. A. Blauwkamp, V. Bondarenko, V. Studitsky, and A. J.Ninfa. 2002. Activation of the glnA, glnK, and nac promoters as Escherichiacoli undergoes the transition from nitrogen excess growth to nitrogen star-vation. J. Bacteriol. 184:5349–5354.
3. Atkinson, M. R., and A. J. Ninfa. 1992. Characterization of mutations in theglnL gene of Escherichia coli affecting nitrogen regulation. J. Bacteriol.174:4538–4548.
4. Atkinson, M. R., and A. J. Ninfa. 1993. Mutational analysis of the bacterialsignal-transducing protein kinase/phosphatase nitrogen regulator II (NRIIor NtrB). J. Bacteriol. 175:7016–7023.
5. Atkinson, M. R., and A. J. Ninfa. 1994. Mechanism and regulation of tran-scription from sigma-54 dependent promoters, p. 323–342. In R. Conawayand J. Conaway (ed.), Transcription mechanisms and control. Raven Press,New York, N.Y.
6. Atkinson, M. R., and A. J. Ninfa. 1998. Role of the GlnK signal transductionprotein in the regulation of nitrogen assimilation in Escherichia coli. Mol.Microbiol. 29:431–447.
7. Atkinson, M. R., and A. J. Ninfa. 1999. Characterization of the GlnK proteinof Escherichia coli. Mol. Microbiol. 32:301–313.
8. Backman, K., Y.-M. Chen, and B. Magasanik. 1981. Physical and geneticcharacterization of the glnA-glnG region of the Escherichia coli chromosome.Proc. Natl. Acad. Sci. USA 78:3743–3747.
9. Blauwkamp, T. A., and A. J. Ninfa. 2002. Nac-mediated repression of theserA promoter of Escherichia coli. Mol. Microbiol. 45:351–363.
10. Bueno, R., G. Pahel, and B. Magasanik. 1985. Role of glnB and glnD geneproducts in regulation of the glnALG operon of Escherichia coli. J. Bacteriol.164:816–822.
11. Chen, Y.-M., K. Backman, and B. Magasanik. 1982. Characterization of agene, glnL, the product of which is involved in the regulation of nitrogenutilization in Escherichia coli. J. Bacteriol. 150:214–220.
12. Elliot, T. 1992. A method for constructing single-copy lac fusions in Salmo-nella typhimurium and its application to the hemA-pfrA operon. J. Bacteriol.174:245–253.
13. Feng, J., M. R. Atkinson, W. McCleary, J. B. Stock, B. L. Wanner, and A. J.Ninfa. 1992. Role of phosphorylated metabolic intermediates in the regula-tion of glutamine synthetase synthesis in Escherichia coli. J. Bacteriol. 174:6061–6070.
14. Forchhammer, K., A. Hedler, H. Stobel, and V. Weiss. 1999. Heterotrimer-ization of PII-like signalling proteins: implications for PII-mediated signaltransduction systems. Mol. Microbiol. 33:338–349.
15. Hattori, M., and Y. Sakaki. 1986. Dideoxy sequencing using denaturedplasmid templates. Anal. Biochem. 152:232–238.
16. He, L., E. Soupene, A. J. Ninfa, and S. Kustu. 1998. Physiological role for the
FIG. 6. Growth phenotypes of strains containing PII or GlnK ex-pressed from various promoters in cells containing NRII2302. Strainswere incubated at 37°C for 42 h on defined minimal medium con-taining 0.4% (wt/vol) glucose, 0.2% (wt/vol) ammonium sulfate, glu-tamine, and 0.004% (wt/vol) tryptophan (GNgt) or on the same me-dium containing in addition 0.1% Casamino Acids (GNgtCAA). Thestrains used (and their relevant geneotypes) were as follows: 1, YMC15(glnL2302); 2, YMC15B (glnL2302 �glnB2306); 3, YMC15K (glnL2302�mdl-glnK::Camr); 4, Y15KcKpK (glnL2302 �mdl-glnK::Camr trp::glnK91); 5, Y15KcBpB (glnL2302 �mdl-glnK::Camr trp::glnB8); 6,Y15KcKpB [glnL2302 �mdl-glnK::Camr trp::�(glnKp-glnB)]; 7, YMC10(wild type); 8, YMC15BK� [glnL2302 �glnB2306 �mdl-glnK::Camr
trp::�(glnKp-lacZ)]; 9, Y15BKcKpK (glnL2302 �glnB2306 �mdl-glnK::Camr trp::glnK91); 10, Y15BKcBpB (glnL2302 �glnB2306 �mdl-glnK::Camr trp::glnB8); and 11, Y15BKcKpB [glnL2302 �glnB2306 �mdl-glnK::Camr trp::�(glnKp-glnB)].
5374 ATKINSON ET AL. J. BACTERIOL.
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
GlnK protein of enteric bacteria: relief of NifL inhibition under nitrogen-limiting conditions. J. Bacteriol. 180:6661–6667.
17. Jack, R., M. De Zamaroczy, and M. Merrick. 1999. The signal transductionprotein GlnK is required for NifL-dependent nitrogen control of nif geneexpression in Klebsiella pneumoniae. J. Bacteriol. 181:1156–1162.
18. Jiang, P., M. R. Atkinson, S. Chatchawan, Q. Sun, and A. J. Ninfa. 2000.Functional dissection of the dimerization and enzymatic activities of Esche-richia coli nitrogen regulator II and their regulation by the PII protein.Biochemistry 44:13433–13449.
19. Kustu, S., E. Santero, J. Keener, D. Popham, and D. Weiss. 1989. Expressionof sigma 54 (ntrA)-dependent genes is probably united by a common mech-anism. Microbiol. Rev. 53:367–376.
20. Liu, J., and B. Magasanik. 1993. The glnB region of the Escherichia colichromosome. J. Bacteriol. 175:7441–7449.
21. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Proteinmeasurement with the Folin phenol reagent. J. Biol. Chem. 193:265–275.
22. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: alaboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor,N.Y.
23. Ninfa, A. J., and M. R. Atkinson. 2000. PII signal transduction proteins.Trends Microbiol. 8:172–179.
24. Ninfa, A. J., P. Jiang, M. R. Atkinson, and J. A. Peliska. 2000. Integration ofantagonistic signals in the regulation of nitrogen assimilation in Escherichiacoli. Curr. Top. Cell. Regul. 36:31–75.
25. Ninfa, A. J., and B. Magasanik. 1986. Covalent modification of the glnGproduct, NRI, by the glnL product, NRII, regulates the transcription of theglnALG operon in Escherichia coli. Proc. Natl. Acad. Sci. USA 83:5909–5913.
26. Ninfa, A. J., L. J. Reitzer, and B. Magasanik. 1987. Initiation of transcriptionat the bacterial glnAp2 promoter by purified E. coli components is facilitatedby enhancers. Cell 50:1039–1046.
27. Pahel, G., D. M. Rothstein, and B. Magasanik. 1982. Complex glnA-glnL-glnG operon of Escherichia coli. J. Bacteriol. 150:202–213.
28. Pioszak, A. A., P. Jiang, and A. J. Ninfa. 2000. The Escherichia coli PII signaltransduction protein regulates the activities of the two-component systemtransmitter protein NRII by direct interaction with the kinase domain of thetransmitter module. Biochemistry 44:13450–13461.
29. Reitzer, L. J. 1996. Ammonia assimilation and the biosynthesis of glutamine,
glutamate, aspartate, asparagine, L-alanine, and D-alanine, p. 391–407. InF. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B.Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger(ed.), Escherichia coli and Salmonella: cellular and molecular biology, 2nded. ASM Press, Washington, D.C.
30. Reitzer, L. J., and B. Magasanik. 1983. Isolation of the nitrogen assimilationregulator, NRI, the product of the glnG gene of Escherichia coli. Proc. Natl.Acad. Sci. USA 80:5554–5558.
31. Reitzer, L. J., and B. Magasanik. 1985. Expression of glnA in Escherichia coliis regulated at tandem promoters. Proc. Natl. Acad. Sci. USA 82:1979–1983.
32. Rhee, S. G., P. B. Chock, and E. R. Stadtman. 1985. Glutamine synthetasefrom Escherichia coli. Methods Enzymol. 113:213–241.
33. Saiki, R. K. 1990. Amplification of genomic DNA, p. 13–20. In M. A. Innis,D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols, a guideto methods and applications. Academic Press, San Diego, Calif.
34. Schneider, B. L., A. K. Kiupakis, and L. J. Reitzer. 1998. Arginine catabo-lism and the arginine succinyltransferase pathway in Escherichia coli. J.Bacteriol. 180:4278–4286.
35. Sen, R., R. A. King, and R. A. Weisberg. 2001. Modification of the propertiesof elongating RNA polymerase by persistent association with antiterminatorRNA. Mol. Cell 7:993–1001.
36. Silhavy, T. J., M. L. Berman, and L. W. Enquist. 1984. Experiments withgene fusions, p. 107–111. Cold Spring Harbor Laboratory, Cold Spring Har-bor, N.Y.
37. Simons, R. W., F. Houman, and N. Kleckner. 1987. Improved single copy andmulticopy lac-based cloning vectors for protein and operon fusions. Gene53:85–96.
38. Ueno-Nishio, S., S. Mango, L. J. Reitzer, and B. Magasanik. 1984. Identifi-cation and regulation of the glnL operator-promoter of the complex glnALGoperon of Escherichia coli. J. Bacteriol. 160:379–384.
39. van Heeswijk, W. C., S. Hoving, D. Molenaar, B. Stegeman, D. Kahn, andH. V. Westerhoff. 1996. An alternative PII protein in the regulation ofglutamine synthetase in Escherichia coli. Mol. Microbiol. 21:133–146.
40. Zimmer, D. P., I. Soupene, H. L. Lee, V. F. Wendisch, A. B. Khodursky, B. J.Peter, R. A. Bender, and S. Kustu. 2000. Nitrogen regulatory protein C-controlled genes of Escherichia coli: scavenging as a defense against nitrogenlimitation. Proc. Natl. Acad. Sci. USA 97:14674–14679.
VOL. 184, 2002 CONTEXT-DEPENDENT FUNCTIONS OF PII AND GlnK 5375
on May 7, 2018 by guest
http://jb.asm.org/
Dow
nloaded from
