ARTICLE IN PRESS

Journal of Plant Physiology 165 (2008) 1783—1797

0176-1617/$ - sdoi:10.1016/j.

Abbreviationplastid termina�CorrespondE-mail addr

1Tel.: +852 2

www.elsevier.de/jplph

Consumption of oxygen by astaxanthinbiosynthesis: A protective mechanism againstoxidative stress in Haematococcus pluvialis(Chlorophyceae)

Yantao Lia,b, Milton Sommerfelda, Feng Chenb,1, Qiang Hua,�

aDepartment of Applied Biological Sciences, Arizona State University, Polytechnic Campus,7001 E. Williams Field Road, Mesa, AZ 85212, USAbDepartment of Botany, The University of Hong Kong, Pokfulam Road, Hong Kong, PR China

Received 19 September 2007; received in revised form 21 December 2007; accepted 21 December 2007

KEYWORDSAstaxanthin;Carotenogenesis;Haematococcuspluvialis;MRNA expression;Oxidative stress

ee front matter & 2008jplph.2007.12.007

s: FE, ferrous sulfate; Hl oxidase; ROS, reactiving author. Tel./fax: +1esses: sfchen@hkusua.h299 0309; fax: +852 229

SummaryHaematococcus pluvialis, a unicellular green microalga, experiences photooxidativestress when exposed to excess photon flux density (PFD) relative to the capacity ofphotosynthesis, and particularly under other adverse environmental conditions(e.g., nutrient depletion, salinity, and excess heavy metals). Under stress,Haematococcus cells synthesize and accumulate large amounts of the secondarycarotenoid astaxanthin stored in cytosolic lipid bodies. In this study, thetranscriptional expression of five astaxanthin biosynthesis genes and two plastidterminal oxidase (PTOX) genes either in high PFD or in the presence of excessivesodium acetate and/or iron was determined by real-time reverse transcription PCR,and astaxanthin accumulation was measured by HPLC. Photosynthetic oxygenevolution, lipid peroxidation, and cell mortality were also investigated under thesestress conditions. Our results indicate that the astaxanthin biosynthesis pathway mayconsume as much as 9.94% of the molecular oxygen evolved from photosynthesisunder stress via at least two distinct routes: (1) extensive oxygen-dependentprocesses leading to astaxanthin formation, and (2) conversion of molecularoxygen into water using electrons derived from carotenogenic desaturation stepsto PTOX via the photosynthetic plastoquinone (PQ) pool. Reduction of reactiveoxygen species (ROS) production by reducing subcellular molecular oxygensubstrates through the astaxanthin biosynthesis pathway may represent a novel

Elsevier GmbH. All rights reserved.

L, high light; LL, low light; PFD, photon flux density; PQ, plastoquinone; PS, photosystem; PTOX,e oxygen species; SA, sodium acetate.480 727 1484.ku.hk (F. Chen), huqiang@asu.edu (Q. Hu).9 0311.

ARTICLE IN PRESS

Y. Li et al.1784

protective mechanism to cope with oxidative stress. Reoxidation of the PQ poolby PTOX may further reduce photosynthetic electron transport chain-inducedROS formation.& 2008 Elsevier GmbH. All rights reserved.

Introduction

Reactive oxygen species (ROS), such as singletoxygen, oxygen superoxide (O2

�), hydrogen perox-ide (H2O2) and the hydroxyl radical (OH�), arecontinuously produced as by-products of photo-synthesis by energy transfer or reduced electrontransport components associated with photosystem(PS)I, PSII, and reactions linked to the photore-spiratory pathway in the chloroplast (Asada, 1994;Klotz, 2002; Mittler, 2002). ROS can potentiallyreact with major macromolecules such as DNA,lipids, and protein, resulting in cellular damage(Apostol et al., 1989; Asada, 1999). Algae may haveevolved various strategies for nonenzymatic andenzymatic detoxification mechanisms to cope withthe accumulation of these potentially toxic com-pounds under photooxidative stress. Nonenzymaticantioxidants can be carotenoids, glutathione,ascorbate, tocopherol, flavonoids, and alkaloids(Luis et al., 2006).

Many green algae, such as Haematococcus plu-vialis (Goodwin and Jamikorn, 1954; Boussibaet al., 1999; Park and Lee, 2001), Chlorococcumsp. (Liu and Lee, 2000; Ma and Chen, 2001),Chlamydomonas nivalis (Bidigare et al., 1993;Remias et al., 2005), and Chlorella zofingiensis(Orosa et al., 2000; Del Campo et al., 2004), canproduce large amounts of the red carotenoidastaxanthin under photooxidative stress conditions.It is commonly perceived that the formation oflarge amounts of astaxanthin or other keto-carote-noids in the cell is a survival strategy of theseorganisms under photooxidative stress and otheradverse environmental conditions, but the specificprotective mechanism of astaxanthin as a none-nzymatic antioxidant against ROS remains unde-fined. The mainstream hypothesis proposes thatlarge accumulations of astaxanthin esters in cyto-plasmic lipid bodies in H. pluvialis and many othergreen algae function as a ‘‘sunscreen’’ to reducethe amount of light striking the light-harvestingpigment–protein complexes and the photosyntheticreaction centers, thus potentially limiting photo-synthetic photoinhibition and photodamage causedby excess photon flux density (PFD) (Yong and Lee,1991; Hagen et al., 1993; Wang et al., 2003). Assuch, the esterification of astaxanthin with fattyacids represents a possible mechanism by which

this chromophore can be concentrated withincytoplasmic globules to maximize its photoprotec-tive efficiency (Bidigare et al., 1993). As analternative, Kobayashi et al. (1997, 1999) andKobayashi (2003) proposed that astaxanthin inH. pluvialis functions as a protective agent againstROS. However, the spatial separation of the primaryROS production site, i.e., the chloroplast, and thesite of astaxanthin deposition, i.e., cytoplasmiclipid bodies, makes the efficiency of astaxanthinas an ROS scavenger questionable. Fan et al. (1998)suggested that astaxanthin is not itself the protec-tive agent, but rather the intermediates inthe process of astaxanthin biosynthesis whichscavenge ROS.

In this study, we re-examined, using real-time reverse transcription PCR and physiologicaland biochemical methods, the physiological roleof astaxanthin biosynthesis in H. pluvialis ex-posed to excess PFD and PFD in combinationwith salt and/or iron stress. Our results indicatedthat consumption of large amounts of molecularoxygen by the astaxanthin biosynthesis pathwayrepresents a mechanism by which H. pluvialis, and,perhaps many other green algae, reduce ROSproduction under oxidative stress. Thus, astax-anthin biosynthesis pathway may function in multi-ple roles in protecting the cell against oxidativestress.

Materials and methods

Organism, growth medium, and cultureconditions

H. pluvialis Flotow NIES144 was obtained fromthe National Institute for Environmental Studies inTsukuba, Japan. A basal growth medium describedby Kobayashi et al. (1991) was used: 14.6mMsodium acetate (SA); 2.7mM L-asparagine; 2 g L�1

yeast extract; 0.985mM MgCl2; 0.135mM CaCl2;0.036mM FeSO4; pH 6.8. The cells were grown in250mL Erlenmeyer flasks containing 100mL ofgrowth medium. Cultures were incubated in aPercival growth chamber (model: 1-35LLVL; Boone,IA, USA) at 22 1C and 20 mmol photonsm�2 s�1 oflight (20W white fluorescent lamps) under a 12 h

ARTICLE IN PRESS

Reduction of oxidative stress by astaxanthin biosynthesis 1785

light:12 h dark cycle (optimal growth condition).Cultures were shaken manually twice daily. Forinduction of astaxanthin biosynthesis and red cystformation, exponentially growing cultures (celldensity of approximately 5� 105 cellsmL�1) wereexposed to continuous illumination of 250 mmolphotonsm�2 s�1 in the presence or absence of SAand ferrous sulfate (FE) at a final concentration of45mM and 450 mM, respectively. As a control, somecultures were maintained throughout the experi-ment period in continuous, low light (LL) intensityof 20 mmol photonsm�2 s�1.

Cell enumeration and pigment analysis

Cell numbers in the cultures were determinedusing a hemacytometer under a light microscope(Olympus BH-2, Olympus, Tokyo, Japan). Pigmentcomposition of the cells was analyzed by HPLCaccording to the method of Yuan et al. (2002).Briefly, algal cells were harvested and extracted inthe solvent mixture of dichloromethane andmethanol (25:75, v/v). The pigment extracts(20 mL aliquots) were separated and analyzed byusing a Beckman Ultrasphere C18 column (250mmlong, 4.6mm i.d.; 5 mm; Beckman Instruments,Fullerton, CA, USA) at 25 1C. The mobile phaseconsisted of solvent A (dichloromethane/metha-nol/acetonitrile/water, 5.0:85.0:5.5:4.5, v/v) andsolvent B (dichloromethane/methanol/acetonitrile/water, 25.0:28.0:42.5:4.5, v/v). The flow rate was1.0mLmin�1. The three-dimensional chromato-gram was monitored from 250 to 750 nm. Astax-anthin, lutein and b-carotene were measured at480 nm and chlorophyll a and b were measured at450 nm according to Yuan (1999). Chromatographicpeaks were identified by comparing retention timesand spectra against known standards or by compar-ing their spectra with published data.

Table 1. Gene-specific oligonucleotide sequences used in t

Gene Accession Forward primer (50–30)

18S AF159369 TGCCTAGTAAGCGCGAGTCAcrtO D45881 ACGCCTACAAACCTCCAGCAcrtR-b AF162276 GGGCTGAACTGGAGCAGTTGipi AB019034 GGTACGTGACGCAGGAGGAGpsy AF305430 ACCAGACCTTCGACGAGCTGpds X86783 TCGCATCGGCCTGCTGCptox1 DQ485457 GAGCTGCACCACCTGCAGATptox2 DQ485458 GAGCTGCACCACCTGCAGAT

RNA isolation and cDNA preparation

Haematococcus cells were collected by centrifu-gation and the resulting cell pellet was frozenand subsequently ground under liquid nitrogenusing a mortar and pestle. RNA was then isolatedaccording to the miniprep RNA extraction proce-dure (Sokolowsky et al., 1990) with minor changes:RNA extract was treated with DNase-I (Invitrogen,Carlsbad, CA, USA) at 37 1C for 30min, and thenmixed thoroughly with equal volume of phenol:-chloroform (1:1). After centrifuging (10,000 rpm,10min at 4 1C), 0.75mL of 8M LiCl was addedfor precipitation. Nuclear acids were quanti-fied by NanoDrop 3.0.0 (NanoDrop, Wilmingon,DE, USA).

For real-time RT-PCR analysis, first strand cDNAsynthesis was carried out using a Taqman ReverseTranscription system according to the manufac-turer’s instructions (Applied Biosystems, FosterCity, CA, USA). 250 ng of total RNA was used in a10 mL reaction system. Controls received waterinstead of reverse transcriptase to assess anycontamination from genomic DNA.

Primer sequence selection

Primer sequences of 18–25 nucleotides werechosen for ipi, psy, pds, crtO, and crtR, using thePrimer Expresss Software Version 2.0 (AppliedBiosystems, Foster City, CA, USA) and designed toproduce 50–160 bp PCR products with a meltingtemperature of about 60 1C. Primer sequences of17–18 nucleotides for pds were obtained fromGrunewald et al. (2000) (Table 1). The followingHaematococcus genes were applied to the primerdesign: phytoene synthase (EMBL/GenBank acces-sion number AF305430), phytoene desaturase(EMBL/GenBank accession number X86783), caro-tenoids hydroxylase (EMBL/GenBank accession

his work

Reverse primer (50–30) Primer numberconcentration(nm)

CCCACCGCTAAAGTCAATCC 100AAAACACTGCGGTCCAGGTG 100GCGGAGTCATTGCTTCACAA 50TTCCCCAATCCTCGTGTTTG 250TGCCCATGACAGGCATAGTC 150GGCCAGGTGCTTGACGCT 250CTCTGAAAACGTGTACGCCAGGGA 500CTGCATGAAGTTGTACGCCACCTT 250

ARTICLE IN PRESS

Y. Li et al.1786

number AF162276), carotenoids ketolase (EMBL/GenBank accession number D45881), isopentenyldiphosphate isomerase (EMBL/GenBank accessionnumber AB019034), 18S ribosomal RNA gene(EMBL/GenBank accession number AF159369), plas-tid terminal oxidase (PTOX) 1 (EMBL/GenBankaccession number DQ485457) and PTOX 2 (EMBL/GenBank accession number DQ485458).

Generation of gene-specific real-time PCRstandards

Twenty-five ng cDNA was amplified with 100 nmof specific primer pairs by conventional PCR (95 1C,10min; 94 1C, 1min; 58 1C, 1min; 72 1C, 1min) withseveral repeats using the MasterTaq Kit (Eppendorf,USA). PCR fragments were run on a 3% agarose gel,excised and eluted using the Geneclean Kit(Q BIOgene, USA). One ShotsTOP chemicallycompetent Escherichia coli (from TAClonings Kit,Invitrogen, Carlsbad, CA, USA) was used for PCRproducts cloning. DNA fragments containing thecDNA sequence of target genes were ligated to apCR21 vector (Invitrogen, Carlsbad, CA) overnightat 14 1C. Transformation of ligates was carried outfollowing the instructions of Invitrogen. Positiveclones were screened on 50mgmL�1 Kam plates bywhite/blue selection and confirmed by whole cellPCR method with M13 primers, and the plasmid DNAwas used to prepare the templates for thestandards. The molar concentrations were calcu-lated on the basis of the mass concentration andthe length in base pairs of each fragment.Equimolar quantities of the standards were seriallydiluted 10-fold and used to generate standardcurves. Specific amplification of the targetedcDNAs was confirmed by sequencing of the PCRproducts using the dideoxy-nucleotide terminatormethod with ABI Prism Dye-terminator system(PE Biosystems, Foster City, CA, USA).

Real-time quantitative PCR using SYBR Green

Real-time PCR was performed in triplicate oncDNA samples or control samples, which were usedto confirm the absence of DNA or RNA contamina-tion, on an ABI Prism 7900 sequence detectionsystem (Applied Biosystems, Foster City, CA, USA).In each experiment, a standard dilution series ofplasmids containing specific PCR fragments or 25 ngcDNA (total RNA equivalent) of unknown sampleswere amplified in a 20 mL reaction containing1� SYBR Green PCR Master Mix (Applied Biosys-tems, Foster City, CA, USA) and each primer. Theprimer concentrations are shown in Table 1, which

were determined when specific amplification re-lative to primer–dimers was maximal in a positiveversus negative control experiment. After heatingat 50 1C for 2min and 95 1C for 10min, PCRreactions proceeded via 40 cycles of 15 s at 95 1Cand 15 s at 60 1C. Finally, dissociation stages of 15 sat 95 1C, 15 s at 60 1C and 15 s at 95 1C were used todetect any non-specific amplification products. Theexperiments (RNA isolation, cDNA synthesis fol-lowed with real-time PCR assay) were repeatedthree times independently, and the data wereaveraged.

Quantification and data analysis

Data were captured as amplification plots.Transcription levels of the target genes werecalculated from the threshold cycle by interpola-tion from the standard curve. To standardize theresults, the relative abundance of 18S rRNA wasalso determined and used as the internal standard.All calculations and statistical analyses wereperformed as described in the ABI 7900 sequencedetection system User Bulletin 2 (Applied Biosys-tems, Foster City, CA, USA).

Oxygen evolution and consumptionmeasurements

Green and red cells of Haematococcus wereharvested by centrifugation (3000g, 2min), andthe pellets were re-suspended in fresh acetatebasal medium to obtain either the same cellnumbers or the same chlorophyll concentrations.Oxygen evolution rate of each sample was deter-mined with an O2 Oxygraph (Hansatech InstrumentsLtd., Norfolk, UK) at 30 1C, 2000 mmol photonsm�2

s�1 using both red and white light, whereas oxygenconsumption rate was measured in cultures main-tained in the dark according to Vonshak et al.(1988). Chlorophyll concentration was about 10mgL�1.

Lipid peroxidation analysis

The extent of lipid peroxidation in cells wasestimated by measuring the formation of malon-dialdehyde (MDA) equivalents as described (Hodgeset al., 1999). Samples were homogenized withinert sand in 1:25 (g FW:mL), 95:5 or 80:20(v:v) ethanol:water, followed by centrifugation at3000g for 10min. A 1-mL aliquot of approp-riately diluted sample was added to a test tubewith 1mL of either (i) TBA solution comprisedof 20.0% (w/v) trichloroacetic acid and 0.01%

ARTICLE IN PRESS

Reduction of oxidative stress by astaxanthin biosynthesis 1787

butylated hydroxytoluene, or (ii) TBA solutioncontaining the above plus 0.65% TBA. Samples werethen mixed vigorously, heated at 95 1C in a blockheater for 25min, cooled, and centrifuged at 3000gfor 10min. Absorbances were read at 440, 532, and600 nm. Malondialdehyde equivalents were calcu-lated in the following manner:

(1)

[(Abs 532+TBA)�(Abs 600+TBA)�(Abs 532�TBA-Abs600�TBA)] ¼ A.

(2)

[(Abs 440+TBA�Abs 600+TBA) 0.0571] ¼ B. (3) MDA equivalents (nmolml�1) ¼ (A�B/157,000)� 106.

Results

Transcriptional expression profiles ofcarotenoid biosynthetic genes underdifferent stress conditions

The time course of gene expression at high PFDin the presence/absence of iron and salt stress

Haematococcus cells were maintained under theoptimal growth conditions (e.g., 20 mmol photonsm�2

s�1

and 22 1C) for 4 days. Exponentially growingcells were then subjected to a high PFD of 250 mmolphotonsm

�2

s�1

(high light (HL)) for four more days.The transcriptional expression of five carotenoidbiosynthetic genes, i.e., ipi, psy, pds, crtO, andcrtR-b, as affected by HL was monitored by real-time RT-PCR. As shown in Fig. 1, all the carotenoidgenes studied were slightly up-regulated in thecontrol culture at LL, and the maximum levels ofthe gene expression did not occur until the end ofthe experiment. A transient up-regulation of thecarotenoid genes was observed in cultures grown atHL. The maximum transcript levels of ipi, psy, pds,crtO, and crtR-b were ca. 4.4-fold, 13.9-fold, 5.4-fold, 4.8-fold, and 38.5-fold higher, respectively,than that at the onset of HL induction (0 h), and themaximum transcripts of the five genes occurred at12 h.

It has been previously shown that SA and FE at afinal concentration of 45mM and 450 mM, respec-tively, can effectively induce astaxanthin formationin H. pluvialis cells at HL (Kobayashi et al., 1991;Kobayashi et al., 1993; Steinbrenner and Linden,2001; Wang et al., 2004, 2005). To further under-stand the response of individual carotenoid biosyn-thetic genes to multiple stressors, the time courseof the carotenoid gene expression was performedunder high PFD in the presence of SA and FE(HL+SA+FE) (Fig. 1). The mRNA expression of ipiand pds responded similarly following the onset of

HL+SA+FE treatment, and approximately 6-foldincrease in the maximum transcript of the twogenes was observed at 12 h. In contrast, mRNAtranscripts of psy, crtO and crtR-b began toincrease after 6 h; yet, the maximum level wasnot attained until 48 h. While the maximumtranscripts of crtO were within similar range asthat of ipi and pds (less than 6-fold), the transcriptlevel of psy and crtR-b increased more than 24-foldat 48 h under HL+SA+FE, and the transcriptsremained more than 10-fold higher after 96 h, ascompared to 0 h. Because psy and crtR-b exhibitedconsiderably higher expression rates at the tran-scriptional level than three other genes stu-died, these two genes were subjected to furtherinvestigation.

Effect of various stressors on transcriptionalexpression of selected carotenoid genes

Although SA and FE enhance the carotenoidbiosynthetic gene expression and astaxanthin for-mation at HL, the relative contribution of the twoindividual factors to these changes was less under-stood. In this study, the effects of SA, FE, and HL,either singularly or in combination, on transcrip-tional expression of psy and crtR-b and the end-product astaxanthin were determined and theresults are shown in Table 2.

At LL, addition of FE or SA resulted in a small andgradual increase in transcripts of psy and crtR-b. HLalone resulted in rapid increase in transcripts of thegenes and the maximum transcript level occurredat 12 h. A higher transcript level was observed incultures exposed to HL in the presence of SA or FE,but the maximum transcript levels were delayed toabout 24 h. The highest amount of transcripts of psyor crtR-b was observed in cultures under HL+SA+FE,while at the same time the maximum transcriptlevel was further delayed to 48 h. Under ourexperimental conditions, the extent to which theindividual factors affected carotenoid gene expres-sion increased in the following sequence:

LLoLLþ FEoLLþ SAoHLoHLþ FE=SAoHLþ SAþ FE.

Astaxanthin production under differentstress conditions

A small, but noticeable occurrence of astax-anthin was observed in cultures under LL, resultingin the cellular content of ca. 5.63 pg asta-xanthin cell�1 after 72 h of cultivation (Fig. 2a),which consisted of ca. 13.1% of the total carote-noids (Fig. 2b). Rapid increase in astaxanthin

ARTICLE IN PRESS

0.0

0.5

1.0

1.5

2.0

2.5

0

1

2

3

4

5

6

7

0 12 24 36 48 60 72 84 960.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.0

0.2

0.4

0.6

0.8

1.0

1.2

0 12 24 36 48 60 72 84 960

20

40

60

80

100

120

140

160

Hours after induction

(pds)

(crtO)

(crtR-b)

Hours after induction

Rel

ativ

e ex

pres

sion

Rel

ativ

e ex

pres

sion

(ipi)

Rel

ativ

e ex

pres

sion

(psy)

Rel

ativ

e ex

pres

sion

Rel

ativ

e ex

pres

sion

Fig. 1. Relative expression profile of five carotenoid biosynthetic genes in Haematococcus pluvialis at high light(250 mmol photonsm�2 s�1) in the presence or absence of ferrous sulfate and SA. The five genes included: (a) ipi;(b) psy; (c) pds; (d) crtO; and (e) crtR-b. As a control, the cells were maintained throughout the experiment period atcontinuous, LL intensity of 20 mmol photonsm�2 s�1 (LL). Relative amounts were calculated and normalized withrespect to one-thousandth of 18S gene transcript levels. Data shown represent mean values obtained from threeindependent amplification reactions, and the error bars indicate the SE of the mean. Note that different scales are usedin graphs. During the first 4 days, algae grew under 20 mmol photonsm�2 s�1 of light in basal growth medium describedby Kobayashi et al. (1991). For induction of astaxanthin biosynthesis and red cyst formation, exponentially growingcultures were spiked with or without SA and ferrous sulfate at a final concentration of 45mM and 450 mM, respectively.Cultures were then exposed to continuous illumination of 250 mmol photonsm�2 s�1 (K HL+FE +SA, ’ High light, m lowlight).

Y. Li et al.1788

ARTICLE IN PRESS

Table 2. Maximum gene transcript level of phytoene synthase and carotenoid hydroxylase, astaxanthinconcentrations, and cell numbers of Haematococcus pluvialis during the first 48 h of growth under various stressconditions

Differentstressconditions

Maximum psytranscriptlevela

Maximum crtR-btranscript levela

Maximumexpressionpointb (h)

Astaxanthinconcentrationc

(mg g�1 dry wt)

Cell numberd

(*104 cellsmL�1)

LL 0.26870.013 6.88770.886 48 0.5970.083 51.271.06LL+FE 0.49570.02 11.97770.695 48 1.1370.033 46.8871.71LL+SA 1.28470.123 21.1371.136 48 3.4870.19 48.570.62HL 3.2370.141 71.2173.403 12 6.470.33 46.271.12HL+FE 3.41370.21 83.5572.868 24 8.5570.64 44.571.1HL+SA 3.49770.67 92.7178.702 24 9.8670.41 40.170.63HL+SA+FE 5.670.65 139.71176.177 48 9.1770.52 41.171.86

Relative amounts were calculated and normalized with respect to one-thousandth of 18S gene transcript levels. Data shown representmean values obtained from three independent amplification reactions, and the error bars indicate the SD of the mean.aGene transcript level was measured at 0, 12, 24 and 48 h.bMaximum expression point was expressed as hours after induction.cAstaxanthin was quantified after 48 h of induction.dCell number was quantified after 48 h of induction.

0 12 24 36 48 60 720

20

40

60

80

100

Hours after induction

Ast

axan

thin

(%

of

tota

l car

oten

oids

)

0 12 24 36 48 60 72

0

20

40

60

80

Hours after induction

Ast

axan

thin

con

tent

(pg

/cel

l)

Fig. 2. Astaxanthin concentration (a) and percentage of astaxanthin relative to total carotenoids (b) of Haematococcuspluvialis under different stress conditions during the first 72 h. (K HL+FE +SA, ’ high light, m low light).

Reduction of oxidative stress by astaxanthin biosynthesis 1789

occurred in cultures exposed to HL, reaching67.89 pg astaxanthin cell�1 after 72 h of stressinduction. The greatest increase in astaxanthincontent was observed in cultures exposed toHL+SA+FE, resulting in 88.87 pg astaxanthin cell�1

during the same time period (Fig. 2a). In the lattertwo cases, the percentage of astaxanthin relativeto the total carotenoids increased to approximately60.7% at HL and 93.5% at HL+SA+FE after 72 h(Fig. 2b). Note that the kinetics of astaxanthinaccumulation in HL or in HL+SA+FE was some-what different. During the first 12–24 h followingstress induction, the increase in astaxanthin wasmore rapid in HL than in HL+SA+FE. Thereafter,however, the astaxanthin content under HL+SA+FE

surpassed that in HL. Higher transcript levelsof psy and crtR-b were correlated with higherastaxanthin concentrations. As shown in Fig. 3, themaximum transcript levels of psy and crtR-bshowed a linear relationship with cellular astax-anthin content with a correlation coefficientgreater than 0.92, suggesting that astaxanthin bio-synthesis is under tight transcriptional controlof psy and crtR-b. Poor correlation (coefficientless than 0.8) of the maximum transcripts ofipi, pds, and crtO with astaxanthin contentsuggests that the expression of the latter genesfor astaxanthin biosynthesis was mainly con-trolled at a translational rather than at a transcrip-tional level.

ARTICLE IN PRESS

Ast

axan

thin

con

tent

(pg

/cel

l)

R2=0.92R2=0.95

0 1 2 3 4 5 60

20

40

60

80

100

0 20 40 60 80 100 120 140 1600

20

40

60

80

100

Maximum transcripts of psy Maximum transcripts of crtR-b

Ast

axan

thin

con

tent

(pg

/cel

l)

Fig. 3. Correlation between maximum psy and crtR-b transcripts and accumulation of astaxanthin after 48 h ofdifferent stress conditions. (a) psy and (b) crtR-b.

Y. Li et al.1790

Oxygen consumption by astaxanthinbiosynthesis

Carotenogenesis leading to astaxanthin forma-tion involves oxygenation and hydroxylation stepsthat have been confirmed to be oxygen-dependentreactions (Breitenbach et al., 1996; Fraser et al.,1997). Also, the phytoene desaturation and sub-sequent zeta-carotene desaturation steps mayprovide electrons to reduce the plastoquinone(PQ) pool, which in turn reduces molecular oxygeninto water catalyzed by PTOX’s. A metabolic net-work model indicates that 21mol of O2 is requiredper mol of astaxanthin synthesized (Kelly, 1990;Schroeder and Johnson, 1995). In order to deter-mine oxygen consumption by astaxanthin biosynth-esis, the oxygen evolution and consumption rate, asindicated by net photosynthetic oxygen evolutionand dark respiration rate, respectively, and astax-anthin content were measured.

On a per cell basis, the average oxygen evolutionrates in cultures under LL, HL, and HL+SA+FE(HL++) were ca. 2, 1, and 0.3 pmol O2 cell

�1 h�1,respectively, during the first 48 h under stress(Fig. 4a, Table 3). The average oxygen consumptionrates in cultures under LL, HL, and HL++ were ca.0.13, 0.27, and 0.36 pmol O2 cell

�1 h�1, respec-tively (Table 3). Then, the net oxygen moleculesevolved under LL, HL, and HL++ were 96 pmolO2 cell

�1 (2 pmol O2 cell�1 h�1� 48 h), 48 pmol O2

cell�1 (1 pmol O2 cell�1 h�1� 48 h), and 14.4 pmol

O2 cell�1 (0.3 pmol O2 cell

�1 h�1� 48 h), respec-tively. On the other hand, the total oxygenmolecules consumed under LL, HL, and HL++ were6.2 pmol O2 cell

�1 (0.13 pmol O2 cell�1 h�1� 48 h),

13 pmol O2 cell�1 (0.27 pmol O2 cell

�1 h�1� 48 h),and 17.3 pmol O2 cell

�1 (0.36 pmol O2 cell�1 h�1

� 48 h), respectively. Taken together, the totalphotosynthetic oxygen molecules evolved by photo-synthesis under LL, HL, and HL++ were 102.2, 61,and 31.7 pmol O2 cell

�1, respectively.During the same period of time, cellular astax-

anthin content measured in cultures under LL, HL,and HL++ were 0.0059, 0.1, and 0.15 pmol cell�1 ,respectively (Table 3). The astaxanthin content atHL was similar to that reported by others (Boussibaet al., 1999; Wang et al., 2003; Qiu and Li, 2006).Given that 21mol of O2 is required for production of1mol of astaxanthin (Kelly, 1990; Schroeder andJohnson, 1995), the total amount of oxygen con-sumed by astaxanthin biosynthesis under LL, HL, andHL++ during the 48h were 0.12pmol O2 cell

�1 (i.e.,0.0059pmol cell�1� 21 ¼ 0.12pmol cell�1), 2.1pmolO2 cell

�1 (i.e., 0.1pmol cell�1� 21 ¼ 2.1pmol cell�1),and 3.15 pmol O2 cell

�1 (i.e., 0.15 pmolcell�1�21 ¼ 3.15 pmol cell�1), respectively.

As a result, astaxanthin biosynthesis consumedabout 0.12%, 3.79%, and 9.94% of photosyntheti-cally evolved oxygen under LL, HL, and HL+SA+FE,respectively (Table 3). These results suggest thatthe process of astaxanthin biosynthesis may reducethe amounts of molecular oxygen under oxidativestress, which would otherwise potentially be usedas substrates for ROS production.

Relationship between lipid peroxidation andphotosynthetic oxygen evolution

The photosynthetic activity, as indicated by netphotosynthetic oxygen evolution, was measured in

culturesat

LL,HL,

andHL+SA

+FE(H

L++),while

atthe

same

time

cellularlip

idperoxid

ationwas

estimated

bymeasuring

theform

ationof

malon-

diald

ehyd

e(M

DA)

equivalents,

with

higherMDA

equivalents

correspond

ingto

higherlevels

oflip

idperoxid

ation(H

odges

etal.,

1999).Photosynthetic

oxygenevolution

measured

rightbefore

stress

ARTIC

LEIN

PRES

STable 3. Percentage of O2 consumed by astaxanthin biosynthesis relative to total O2 evolved through photosynthesis during the first 48 h of stress induction

Treatments Astaxanthincontent(pmol cell�1)

O2

consumptionbyastaxanthinbiosynthesisa

(pmol cell�1)

Average O2

evolution rate(pmol cell�1 h�1)

Average O2

uptake rate(pmol cell�1 h�1)

Net O2 evolution(pmol cell�1 h�1� 48 h)

Total O2 uptake(pmol cell�1 h�1� 48 h)

O2 consumptionby astaxanthinbiosynthesis (%of total O2

evolved) (%)

LL 0.0059 0.124 2 0.13 96 6.24 0.12HL 0.1 2.1 1 0.27 48 12.96 3.44HL++ 0.15 3.15 0.3 0.36 14.4 17.28 9.94

Cultures maintained at LL served as a control. O2 evolution or uptake rate was measured at 0, 6, 12, 24 and 48 h following the treatments, and the data averaged. Astaxanthin content wasmeasured at 48 h. The SDs of the data were within 10%. O2 consumption rate by astaxanthin biosynthesis relative to total oxygen evolved was calculated as follows (see footnote a below):astaxanthin content (pmol cell�1)� 21 pmol O2 cell

�1/[net oxygen evolution (average oxygen evolution rate pmol O2 cell�1 h�1� 48 h)+total oxygen uptake (average oxygen uptake rate pmol

O2 cell�1 h�1� 48 h)].

aIt was assumed that 21mol of O2 were consumed per mol of astaxanthin synthesized in the Haematococcus cell (Kelly, 1990; Schroeder and Johnson, 1995).0.0

0.20.4

0.60.8

1.00 20 40 60 80

100

R2=

0.92

Loss in photosynthesis capacity (%)

MD

A content (pm

ol/cell)

LL6hLL12hLL24hLL48hHL6hH

L12hHL24hH

L48h

HL++6h

HL++12h

HL++24h

HL++48h

0.0

0.5

1.0

1.5

2.0

2.5

Treatm

ents

Net oxygen evolution rate (pmol cell-1 h-1)

Fig.

4.Oxygen

evolutionmeasurem

ents.(a)

Net

oxygenevolution

by

Haem

atococcuspluvialis

under

variousstress

conditions.

(b)Percentage

lossof

photosynthetic

capacity

relativeto

malond

ialdehyd

e(M

DA)eq

uivalentscontents.

Culture

conditions

were

thesam

eas

describ

edin

Fig.1.

Open

column:

culturesgrow

nund

erlow

light;Gray

column:

culturesgrow

nund

erhigh

light;dark

column:

culturesgrow

nund

erHL+FE

+SA(H

L++).

Reduction

ofoxid

ativestress

byastaxanthin

biosynthe

sis1791

ARTICLE IN PRESS

01 2 3 4 5 6 7 8 9 10 11 12 13 14 15

10

20

30

40

50

60Onset of stress

Time (Days)

Cel

l num

bers

( x

104

cells

ml-1

)

Fig. 6. Growth of Haematococcus pluvialis under variousstresses. Culture conditions were the same as describedin Fig. 1, (K HL+FE +SA, ’ high light, m low light).

Y. Li et al.1792

induction was included as a control (ca. 2 pmolO2 cell

�1 h�1). The loss in photosynthesis capacitywas calculated as oxygen evolution in culturesunder stress relative to the control (assuming thecontrol value of 100%) (Fig. 4a,b). A linear relation-ship (R2 ¼ 0.92, Fig. 4b) between the MDA level andloss in photosynthetic activity was observed incultures maintained at HL, suggesting that atargeting site of photooxidative stress was thesubcellular membrane system (e.g., thylakoidmembranes), which in turn resulted in reductionor impairment of photosynthetic activities.

Relationship between lipid peroxidation andastaxanthin accumulation

A plot of the MDA level against cellular astax-anthin content, using the data presented in Figs. 2and 4, also revealed a linear relationship (R2 ¼0.81, Fig. 5), indicating that astaxanthin acts as aprotective agent to cope with oxidative stress(Figs. 4, 5).

Cell mortality

Growth kinetics for H. pluvialis cultures weremeasured under various stress conditions (Fig. 6).Under LL, the cells continued to divide for the first6 days and the cell number increased to ca.52� 104 cellsmL�1. Afterward, the cell numbersremained constant for four more days, followed bya slight decline. When exposed to HL, the cellnumbers remained roughly the same for day 1, and

0.0 0.2 0.4 0.6 0.8 1.00

20

40

60

80

100

R2=0.81

MDA content (pmol/cell)

Ast

axan

thin

con

tent

(pg

/cel

l)

Fig. 5. Cellular astaxanthin content in Haematococcuspluvialis in relation to MDA contents under various stressconditions.

then declined gradually thereafter. The mostdrastic decline in cell numbers was observed inthe culture exposed to HL+SA+FE. After 10 days ofstress induction, the cell number of cultures underHL and HL+SA+FE were ca. 24� 104 and 13.6� 104

cellsmL�1, respectively, which was ca. 49.5% and28%, respectively, of that under LL. At HL orHL+SA+FE, the cells underwent transformationfrom the green flagellates to red cysts. As a result,a majority of the cells (ca. 80%) changed fromgreen flagellates to red cysts within the first 3 daysunder HL or HL+SA+FE. In contrast, the cells underLL remained mostly green flagellates and non-motile vegetative cells.

Response of ptox under stress conditions

Two genes, ptox1 and ptox2, encoding PTOX1 andPTOX2 were previously cloned from H. pluvialis(DQ485457 and DQ485458, respectively). In thisstudy, the transcriptional expression of ptox1 andptox2 was measured in H. pluvialis cultures underdifferent stress conditions (Fig. 7). Both genesunderwent transient up-regulation upon culturesbeing transferred from LL to HL, though theexpression patterns of the two genes were some-what different. The maximum transcripts of ptox2occurred at 12 h, whereas that of ptox1 did notoccur until 48–72 h of HL induction. The maximumtranscripts of ptox2 and ptox1 increased 1.6-foldand 3.84-fold, respectively.

When subjected to HL+SA+FE, the time at whichthe maximum transcripts of ptox1 occurredwas shortened to 12 h with a slight increase in

ARTICLE IN PRESS

0 12 24 36 48 60 72 84 96 0 12 24 36 48 60 72 84 960

10

20

30

40

50

60

0

1

2

3

4

5

6(ptox1) (ptox2)

Hours after induction

Rel

ativ

e ex

pres

sion

Hours after induction

Fig. 7. Transcript levels of ptox genes in response to different environmental stress conditions. Culture conditions werethe same as described in Fig. 1. For isolation of RNA, samples were collected from different growth conditions at 0, 6,12, 24, 48, 72 and 96 h; (a) ptox1, and (b) ptox2 (K HL+SA +FE, & high light, m low light).

Reduction of oxidative stress by astaxanthin biosynthesis 1793

transcripts. On the other hand, little changeoccurred to ptox2 in terms of the maximumtranscripts and the time at which it occurred(Fig. 7).

Discussion

Regulation of carotenogenic genes inresponse to stress

By monitoring transcriptional expression of thecarotenoid genes simultaneously using quantitativereal-time RT-PCR, we were able to characterizecarotenoid genes on a pathway level rather than anindividual gene level, which has been investigatedin some previous studies using a RNA blottingmethod (Kajiwara et al., 1995; Sun et al., 1998;Linden, 1999; Grunewald et al., 2000; Steinbrennerand Linden, 2001, 2003). In accordance withprevious studies, our data indicated that themaximum transcript level of ipi occurs at about6–12 h under HL, similar to the 8 h as suggested bySun et al. (1998). Our results also agreed withSteinbrenner and Linden (2001) that the maximumtranscripts of psy and crtR-b occur at 12 h afterexposed to HL stress. Furthermore, the moresensitive real-time RT-PCR analysis was able todetect the expression of crtO and expression ofcrtR-b transcripts at the early stage of stressinduction, which was not otherwise detected by

RNA blotting (Steinbrenner and Linden, 2001,2003).

Although ipi, psy, pds, crtO, and crtR-b allunderwent transient up-regulation at the transcrip-tion level under HL or HL+SA+FE, the extent towhich individual genes responded was different.Up-regulation of transcripts of all five genes waswithin an order of magnitude; however, themaximum transcripts of psy and crtR-b were atleast 2-fold greater than that of ipi, pds and crtO.Large amounts of psy transcripts may be respon-sible for preferentially converting GGPP, a commonprecursor for multiple pathways (e.g., chlorophyllor gibberellins biosynthesis pathways), to phytoeneand thus ensuring that carotenoid/astaxanthinbiosynthesis is the preferred pathway under stress.The rapid reduction in chlorophyll at the peakexpression of psy may be the result of reducedavailability of GGPP for chlorophyll biosynthesis.Indeed, psy has been previously indicated to act asa rate-limiting step for carotenoid biosynthesisduring tomato fruit ripening (Fraser and Bramley,2004), in a transgenic Synechocystis sp. strain PCC6803 (Lagarde et al., 2000) and in Arabidopsisthaliana (Stalberg et al., 2003).

Likewise, high transcripts of crtR-b seem to beresponsible for the formation of astaxanthin as thesingle predominant carotenoid species understress. Overexpression of the gene encoding crtR-b was also observed in transgenic A. thalianaexposed to HL and high temperature, resultingin enhanced tolerance to the stress conditions

ARTICLE IN PRESS

Y. Li et al.1794

(Davison et al., 2002). In E. coli and a transgenicSynechocystis, overexpression of crtR-b was re-ported to result in increasing zeaxanthin content(Ruther et al., 1997; Lagarde et al., 2000).

The fact that a linear relationship exists betweenthe maximum transcripts of psy and crtR-b and themaximum astaxanthin concentration revealed inthis study indicates that astaxanthin biosynthesismay be under direct control of psy and crtR-b at thetranscriptional level.

Previously, carotenoid biosynthesis genes, mainlycrtO, cloned from Haematococcus cells wereintroduced to Synechococcus (Harker and Hirsch-berg, 1997; Albrecht et al., 2001), tobacco flowers(Mann et al., 2000), potato tubes (Morris et al.,2006), and A. thaliana (Stalberg et al., 2003), withthe aim of producing astaxanthin in these trans-genic organisms. However, these efforts resulted inlimited success due to the extremely low yield ofastaxanthin. Based upon our results, we suggestthat co-expression of psy and/or crtR-b along withcrtO in a host organism may provide an alternativestrategy for increasing astaxanthin yield.

Carotenogenesis is stressor-specificdependent

Our results demonstrated that HL was thestrongest, whereas FE the weakest single stressorthat affected carotenoid gene expression andastaxanthin production under our experimentalconditions. It is worth noting that transcripts ofthe carotenoid genes were lower when two or threestressors were combined (i.e., HL+FE, HL+SA, orHL+FE+SA) compared with HL during the first 12 hand resulted in lower astaxanthin formation (Figs. 1and 2). An interpretation is that each individualstressor (e.g., HL, FE, or SA) may trigger specificstress-dependent molecular defense mechanism(s)(e.g., specific enzymatic defense pathways) inaddition to inducing common, shared protectivemechanism(s) (e.g., carotenogenesis, storage lipidbiosynthesis, or secondary wall formation). HL maypreferentially induce carotenogenesis, whereas SAand FE might preferentially trigger various enzy-matic reactions. When HL in combination with SA orFE or both is applied to H. pluvialis cells, moreindividual-specific defense pathways could beactivated than those triggered by HL alone, witheach contributing to overall protection and thusmay, to a lesser extent, depend upon carotenogen-esis. This hypothesis is supported by a previousstudy (Wang et al., 2004) in which the multipleenzymatic pathways were activated as the earlydefense mechanisms in H. pluvialis cells under

HL+FE+SA. However, the maximum expression ofthose enzymes lasted only 24–48 h, followed bydownregulation of these pathways (Wang et al.,2004). In the present study, the extent to which theexpression of the carotenogenesis genes in culturesunder HL+FE, HL+SA or HL+FE+SA, surpassed that ofthe culture under HL after 24 or 48 h was the resultof the persistence of the multiple stressors on onehand and reduced enzymatic defense activities onthe other, making the cells more reliant oncarotenogenesis.

O2 consumption by carotenogenesis

Carotenogenesis leading to astaxanthin forma-tion involves oxygenation and hydroxylation stepsthat have been confirmed to be oxygen-dependentreactions (Breitenbach et al., 1996; Fraser et al.,1997). Also, the phytoene desaturation and sub-sequent zeta-carotene desaturation steps mayprovide electrons to reduce the PQ pool, which inturn reduces molecular oxygen into water cata-lyzed by PTOX. A metabolic network model in-dicates that 21mol of O2 is required per mol ofastaxanthin synthesized (Kelly, 1990; Schroeder andJohnson, 1995). Provided that an estimated 1% ofthe total O2 consumption goes to ROS production inplants under normal growth conditions (Puntaruloet al. 1988; Moller 2001), the O2 consumption (ashigh as 9.94% of photosynthetically evolved oxygen,Table 3) through astaxanthin biosynthesis couldconsiderably reduce the amounts of molecularoxygen, which could potentially be used as asubstrate for ROS production. There is evidencethat increased oxygen concentration derived fromphotosynthesis interacts with reduced forms ofelectron transport components to generate excessROS under stress (Casano et al., 2000; Moller, 2001;Mittler, 2002). Therefore, we suggest that aphysiological role of astaxanthin biosynthesis inthe stress response in H. pluvialis is to reducesubcellular oxygen concentrations, in particularlowering oxygen tension surrounding the thylakoidmembrane, which in turn reduces ROS formation.

PTOX versus ROS detoxification

PTOX was suggested to be a co-factor incarotenoid desaturation and also implicated as a‘‘safety valve’’ to prevent the over-reduction of thePQ pool and formation of ROS in response tooxidative stress in several higher plants such astobacco, Arabidopsis, and in the green algaChlamydomonas reinhardtii (Carol et al., 1999;Wu et al., 1999; Niyogi, 2000; Rizhsky et al., 2002;

ARTICLE IN PRESS

H2O PTOX

Lipid bodies

O2

Chloroplastenvelop

Astaxanthinesters

Phytoene

Phytofluene

-Carotene

Neurosporene

Lycopene

PDS

ZDS

e

e

e

e

PSII PSIPQ

PQH2

e e

O2H2O

-Carotene

Cytoplasmicmembranes

Thylakoidmembrane

ROS

ROS

Excess light/Other stresses

Astaxanthinesters

Stroma

Lumen

Fig. 8. Schematic of the multiple roles of the asta-

Reduction of oxidative stress by astaxanthin biosynthesis 1795

Aluru and Rodermel, 2004; Baerr et al., 2005). Wesuggest that a similar role of PTOX occurs inHaematococcus in stress defense.

As in C. reinhardtii (Moseley et al., 2006), twoptox genes were identified from H. pluvialis. Theresponse of ptox2 to various stress conditions wassimilar to that of pds, both of which were inducedpromptly after the onset of HL or HL+SA+FE stressand reached a maximum transcript level at 12 h.However, the maximum transcript level of ptox1was delayed to 72 h under HL compared with 12 hunder HL+SA+FE. Since phytoene desaturase wassuggested to be regulated at a transcriptional levelin H. pluvialis (Grunewald et al., 2000), ptox2 mayhave encoded an enzyme that functionally coupledwith carotenoid desaturation to remove excesselectrons and molecular oxygen, while ptox1 wasactivated only when the stress condition waspersistent or became more severe.

xanthin biosynthetic pathway and the end productastaxanthin in protecting Haematococcus pluvialis fromoxidative stress. The roles include the pathway’s functionin (1) reducing subcellular oxygen levels via formingoxygen-rich astaxanthin molecules; (2) converting photo-synthetically evolved molecular oxygen into water via aconcerted electron transport from carotenogenic desa-turation steps to the photosynthetic PQ pool to PTOX; andproducing astaxanthin, with the astaxanthin (3) function-ing as a ‘‘sunscreen’’ to reduce excess PFD impinging onthe chloroplast; (4) functioning as an antioxidant for ROS;and (5) forming astaxanthin esters, which serve as carbonand energy storage.

Multilevel protective role of astaxanthinbiosynthesis pathway against oxidativestress

Based upon our results, along with the evidenceprovided by others, we propose that astaxanthinbiosynthesis, in conjunction with the photosyn-thetic electron transport chain coupled with PTOX,exerts multilevel protective mechanisms againstoxidative stress. In addition to previously proposedphysiological roles as a ‘‘sunscreen’’, antioxidantand/or carbon and energy storage, the astaxanthinbiosynthetic pathway and the end product astax-anthin have additional protective roles under stress(Fig. 8): The roles include reduction of ROSproduction by (1) reducing subcellular oxygenconcentration via forming oxygen-rich astaxanthinmolecules; and (2) converting chloroplast oxygenmolecules into water via a concerted electrontransport from carotenogenic desaturation steps tothe photosynthetic PQ pool to PTOX. These rolesconsumed as high as ca. 9.94% of the total oxygenevolved by photosynthesis under photooxidativestress (Table 3). In this context, carotenogenesis inH. pluvialis has a similar protective mechanism asthe alternative oxidases, which prevent electronsfrom reducing O2 to O2

� and reduce the overall levelof O2, the substrate for ROS production (Mittler,2002). In addition, the esterification of astaxanthinwith fatty acids may be a strategy by whichastaxanthin is sequestered into cytosolic lipidbodies where the pigment may serve as ‘sunscreen’to reduce light penetration into the chloroplast andthus reduce chloroplast-based ROS formation understress. Reduction in polarity of astaxanthin esters

may further stabilize the structure and function oflipid bodies.

However, the protective roles of astaxanthinbiosynthesis can only reduce to a certain extent,but not eliminate or reverse the effect of oxidativestress on the cells. As stress persists, oxidative stresswill eventually result in cell deterioration (Fig. 4, 5)and photooxidative death (Fig. 6). Therefore, thecellular content of astaxanthin may reflect theextent to which Haematococcus suffers from oxida-tive stress, and also the extent to which the cellsdefend themselves under stress conditions.

Acknowledgments

We thank Dr. J. Wang (Arizona State University) forhis valuable technical assistance. This work was parti-ally supported by the Research Grants Council of HongKong, the University of Hong Kong Outstanding YoungResearcher Award, Outstanding Research StudentSupervisor Award, and the Science Foundation Arizo-na’s Small Business Catalytic Program.

ARTICLE IN PRESS

Y. Li et al.1796

References

Albrecht M, Steiger S, Sandmann G. Expression of aketolase gene mediates the synthesis of canthaxanthinin Synechococcus leading to tolerance against photo-inhibition, pigment degradation and UV-B sensitivityof photosynthesis. Photochem Photobiol 2001;73:551–5.

Aluru MR, Rodermel SR. Control of chloroplast redox bythe IMMUTANS terminal oxidase. Physiol Plant2004;120:4–11.

Apostol I, Heinstein PF, Low PS. Rapid stimulation of anoxidative burst during elicitation of cultured plantcells. Role in defense and signal transduction. PlantPhysiol 1989;90:109–16.

Asada K. Production and action of active oxygen speciesin photosynthetic tissues. In: Foyer CH, MullineauxPM, editors. Causes of photooxidative stress andamelioration of defense systems in plants. BocaRaton: CRC Press; 1994. p. 77–104.

Asada K. The water-water cycle in chloroplasts: scaven-ging of active oxygens and dissipation of excessphotons. Annu Rev Plant Physiol Plant Mol Biol 1999;50:601–39.

Baerr JN, Thomas JD, Taylor BG, Rodermel SR, Gray GR.Differential photosynthetic compensatory mechanismsexist in the immutans mutant of Arabidopsis thaliana.Physiol Plant 2005;124:390–402.

Bidigare RR, Ondrusek ME, Kennicutt MC, Iturriaga R,Harvey HR, Hoham RW, et al. Evidence for a photo-protective function for secondary carotenoids of snowalgae. J Phycol 1993;29:427–34.

Boussiba S, Bing W, Yuan JP, Zarka A, Chen F. Changes inpigments profile in the green alga Haematococcuspluvialis exposed to environmental stresses. Biotech-nol Lett 1999;21:601–4.

Breitenbach J, Misawa N, Kajiwara S, Sandmann G.Expression in Escherichia coli and properties of thecarotene ketolase from Haematococcus pluvialis.FEMS Microbiol Lett 1996;140:241–6.

Carol P, Stevenson D, Bisanz C, Breitenbach J, SandmannG, Mache R, et al. Mutations in the Arabidopsis geneimmutans cause a variegated phenotype by inactivat-ing a chloroplast terminal oxidase associated withphytoene desaturation. Plant Cell 1999;11:57–68.

Casano LM, Zapata JM, Martin M, Sabater B. Chloror-espiration and poising of cyclic electron transport –

plastoquinone as electron transporter between thyla-koid NADH dehydrogenase and peroxidase. J BiolChem 2000;275:942–8.

Davison PA, Hunter CN, Horton P. Overexpression of beta-carotene hydroxylase enhances stress tolerance inArabidopsis. Nature 2002;418:203–6.

Del Campo JA, Rodriguez H, Moreno J, Vargas MA, Rivas J,Guerrero MG. Accumulation of astaxanthin and luteinin Chlorella zofingiensis (Chlorophyta). Appl MicrobiolBiotechnol 2004;64:848–54.

Fan L, Vonshak A, Zarka A, Boussiba S. Does astaxanthinprotect Haematococcus against light damage? ZNaturforsch(C) 1998;53:93–100.

Fraser PD, Bramley PM. The biosynthesis and nutritionaluses of carotenoids. Prog Lipid Res 2004;43:228–65.

Fraser PD, Miura Y, Misawa N. In vitro characterization ofastaxanthin biosynthetic enzymes. J Biol Chem 1997;272:6128–35.

Goodwin TW, Jamikorn M. Studies in carotenogenesis II.Carotenoid synthesis in the alga Haematococcuspluvialis. Biochem J 1954;57:376–81.

Grunewald K, Eckert M, Hirschberg J, Hagen C. Phytoenedesaturase is localized exclusively in the chloroplastand up-regulated at the mRNA level during accumula-tion of secondary carotenoids in Haematococcuspluvialis (Volvocales, Chlorophyceae). Plant Physiol2000;122:1261–8.

Hagen C, Braune W, Vogel K, Hader DP. Functional aspectsof secondary carotenoids in Haematococcus lacustris(Girod) Rostafinski (Volvocales). V. Influences onphotomovement. Plant Cell Environ 1993;16:991–5.

Harker M, Hirschberg J. Biosynthesis of ketocarotenoidsin transgenic cyanobacteria expressing the algal genefor beta-C-4-oxygenase, crtO. FEBS Lett 1997;404:129–34.

Hodges DM, DeLong JM, Forney CF, Prange RK. Improvingthe thiobarbituric acid-reactive-substances assay forestimating lipid peroxidation in plant tissues contain-ing anthocyanin and other interfering compounds.Planta 1999;207:604–11.

Kajiwara S, Kakizono T, Saito T, Kondo K, Ohtani T, NishioN, et al. Isolation and functional identification of anovel cDNA for astaxanthin biosynthesis from Haema-tococcus pluvialis, and astaxanthin synthesis in Es-cherichia coli. Plant Mol Biol 1995;29:343–52.

Kelly S. A design tool for the analysis of biochemicalreaction networks utilizing stoichiometric structure.M.S. thesis. Madison: University of Wisconsin; 1990.

Klotz LO. Oxidant-induced signaling: effects of peroxyni-trite and singlet oxygen. Biol Chem 2002;383:443–56.

Kobayashi M. Astaxanthin biosynthesis enhanced byreactive oxygen species in the green alga Haemato-coccus pluvialis. Biotechnol Bioprocess Eng 2003;8:322–30.

Kobayashi M, Kakizono T, Nagai S. Astaxanthin productionby a green alga, Haematococcus pluvialis accompa-nied with morphological changes in acetate media.J Ferment Bioeng 1991;71:335–9.

Kobayashi M, Kakizono T, Nagai S. Enhanced carotenoidbiosynthesis by oxidative stress in acetate-inducedcyst cells of a green unicellular alga, Haematococcuspluvialis. Appl Environ Microbiol 1993;59:867–73.

Kobayashi M, Kakizono T, Nishio N, Nagai S, Kurimura Y,Tsuji Y. Antioxidant role of astaxanthin in the greenalga Haematococcus pluvialis. Appl Microbiol Biotech-nol 1997;48:351–6.

Lagarde D, Beuf L, Vermaas M. Increased production ofzeaxanthin and other pigments by application ofgenetic engineering techniques to Synechocystis spstrain PCC 6803. Appl Environ Microbiol 2000;66:64–72.

Linden H. Carotenoid hydroxylase from Haematococcuspluvialis: cDNA sequence, regulation and functional

ARTICLE IN PRESS

Reduction of oxidative stress by astaxanthin biosynthesis 1797

complementation. Biochim Biophys Acta – Gene StructExpression 1999;1446:203–12.

Liu BH, Lee YK. Secondary carotenoids formation by thegreen alga Chlorococcum sp. J Appl Phycol 2000;12:301–7.

Luis P, Behnke K, Toepel J, Wilhelm C. Parallel analysis oftranscript levels and physiological key parametersallows the identification of stress phase gene markersin Chlamydomonas reinhardtii under copper excess.Plant Cell Environ 2006;29:2043–54.

Ma RYN, Chen F. Enhanced production of free trans-astaxanthin by oxidative stress in the cultures of thegreen microalga Chlorococcum sp. Process Biochem2001;36:1175–9.

Mann V, Harker M, Pecker I, Hirschberg J. Metabolicengineering of astaxanthin production in tobaccoflowers. Nat Biotechnol 2000;18:888–92.

Mittler R. Oxidative stress, antioxidants and stresstolerance. Trends Plant Sci 2002;7:405–10.

Moller IM. Plant mitochondria and oxidative stress:electron transport, NADPH turnover, and metabolismof reactive oxygen species. Annu Rev Plant PhysiolPlant Mol Biol 2001;52:561–91.

Morris WL, Ducreux LJM, Fraser PD, Millam S, Taylor MA.Engineering ketocarotenoid biosynthesis in potatotubers. Metab Eng 2006;8:253–63.

Moseley JL, Chang CW, Grossman AR. Genome-basedapproaches to understanding phosphorus deprivationresponses and PSR1 control in Chlamydomonas re-inhardtii. Eukaryot Cell 2006;5:26–44.

Niyogi KK. Safety valves for photosynthesis. Curr OpinPlant Biol 2000;3:455–60.

Orosa M, Torres E, Fidalgo P, Abalde J. Production andanalysis of secondary carotenoids in green algae. JAppl Phycol 2000;12:553–6.

Park EK, Lee CG. Astaxanthin production by Haemato-coccus pluvialis under various light intensities andwavelengths. J Microbiol Biotechnol 2001;11:1024–30.

Puntarulo S, Sanchez RA, Boveris A. Hydrogen peroxidemetabolism in Soybean embryonic axes at the onset ofgermination. Plant Physiol 1988;86:626–30.

Qiu BS, Li Y. Photosynthetic acclimation and photopro-tective mechanism of Haematococcus pluvialis (Chlor-ophyceae) during the accumulation of secondarycarotenoids at elevated irradiation. Phycologia 2006;45:117–26.

Remias D, Lutz-Meindl U, Lutz C. Photosynthesis, pig-ments and ultrastructure of the alpine snow algaChlamydomonas nivalis. Eur J Phycol 2005;40:259–68.

Rizhsky L, Hallak-Herr E, Van Breusegem F, RachmilevitchS, Barr JE, Rodermel S, et al. Double antisense plantslacking ascorbate peroxidase and catalase are lesssensitive to oxidative stress than single antisenseplants lacking ascorbate peroxidase or catalase. PlantJ 2002;32:329–42.

Ruther A, Misawa N, Boger P, Sandmann G. Production ofzeaxanthin in Escherichia coli transformed withdifferent carotenogenic plasmids. Appl MicrobiolBiotechnol 1997;48:162–7.

Schroeder WA, Johnson EA. Singlet oxygen and peroxylradicals regulate carotenoid biosynthesis in Phaffiarhodozyma. J Biol Chem 1995;270:18374–9.

Sokolowsky V, Kaldenhoff R, Ricci M, Russo V. Fast andreliable mini-prep RNA extraction from Neurosporacrassa. Fungal Genet Newslett 1990;36:41–3.

Stalberg K, Lindgren O, Ek B, Hoglund AS. Synthesis ofketocarotenoids in the seed of Arabidopsis thaliana.Plant J 2003;36:771–9.

Steinbrenner J, Linden H. Regulation of two carotenoidbiosynthesis genes coding for phytoene synthase andcarotenoid hydroxylase during stress-induced astax-anthin formation in the green alga Haematococcuspluvialis. Plant Physiol 2001;125:810–7.

Steinbrenner J, Linden H. Light induction of carotenoidbiosynthesis genes in the green alga Haematococcuspluvialis: regulation by photosynthetic redox control.Plant Mol Biol 2003;52:343–56.

Sun Z, Cunningham FX, Gantt E. Differential expression oftwo isopentenyl pyrophosphate isomerases and en-hanced carotenoid accumulation in a unicellularchlorophyte. Proc Natl Acad Sci USA 1998;95:11482–8.

Vonshak A, Guy R, Poplawsky R, Ohad I. Photoinhibitionand its recovery in 2 strains of the cyanobacteriumSpirulina platensis. Plant Cell Physiol 1988;29:721–6.

Wang B, Zarka A, Trebst A, Boussiba S. Astaxanthinaccumulation in Haematococcus pluvialis (Chlorophy-ceae) as an active photoprotective process under highirradiance. J Phycol 2003;39:1116–24.

Wang SB, Chen F, Sommerfeld M, Hu Q. Proteomicanalysis of molecular response to oxidative stress bythe green alga Haematococcus pluvialis (Chlorophy-ceae). Planta 2004;220:17–29.

Wang SB, Chen F, Sommerfeld M, Hu Q. Isolation andproteomic analysis of cell wall-deficient Haematococ-cus pluvialis mutants. Proteomics 2005;5:4839–51.

Wu DY, Wright DA, Wetzel C, Voytas DF, Rodermel S. Theimmutans variegation locus of Arabidopsis defines amitochondrial alternative oxidase homolog that func-tions during early chloroplast biogenesis. Plant Cell1999;11:43–55.

Yong YYR, Lee YK. Do carotenoids play a photoprotectiverole in the cytoplasm of Haematococcus lacustris(Chlorophyta)? Phycologia 1991;30:257–61.

Yuan JP. Characteristics and chromatographic separationof astaxanthin and its esters from the microalgaHaematococcus pluvialis. Ph.D. thesis. Hong Kong:The University of Hong Kong; 1999.

Yuan JP, Chen F, Liu X, Li XZ. Carotenoid composition inthe green microalga Chlorococcum. Food Chem 2002;76:319–25.