THE CONSTRUCTION AND CHARACTERIZATION OF HYPOXIA

RESPONSAE REPORTER GENES FOR USE IN TRANSGENIC MICE

Lorraine Tarnar Howard

A thesis submitted in conformity with the requirements for the degree of Master of Science

Graduate Department of Molecular and Medical Genetics University of Toronto

O Copyright by Lorraine Tamar Howard 2001

---- * - ..2 uisi@ns and Acq$sitiom et ~ o g n p h i Sewices se-s 6BTo(lraphtqu8s

The author has granted a non- exclusiw licence aUowing the National Library of Canada to reproduce, loan, distniute or sell copies of this thesis in microform, paper or electronic formats.

The author retains ownership of the copyright in ÜUs thesis. Neither the

L'auteur a accordé une Licence non exclusive pemetiant à la Biôli0thé:que nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/nlm, de reproduction sur papier ou sur format Clectronique .

L'autew conserve la propriété du droit d'auteur qui protège cette thèse.

thesis nor substantial extracts fkom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son penni ssion . autorisation.

Abstract

-=-A

THE CONSTRUCTION AND C H ~ C T E ~ Z A T I O N OF HYPOXIA RESPONSIVE

REPORTER GENES FOR USE IN TRANSGENIC MICE

Lorraine Tamar Howard

Master of Science 200 1

Molecuhr and Meàical Genetics

University of Toronto

Evidence in the literature suggests that conditions of low oxygen may have a role in the

development of the vasculature. To examine the areas of hypoxia in a deviloping mouse

embryo, traasgenes were developed coupling hypoxia responsive elements (HRE) to exogenous

promoter-reporter cassenes. Transient expression assays with these constructs show that HRE

sequences fiom different sources provide significantly different levels of induction in constant

backgrounds. Furthemore, evidence is presented to show that an HRE is not always sufficient

to confer hypoxia-sensitive activity to a transgene. Finally, preliminary evidence demonstrates

that two HRE transgenes show activity under physiologically relevant oxygen concentrations.

The use of HRE-based transgenes in the determination of embryonic hypoxia is discussed.

Acknowledgements

"You look-attrees ancf tabefttiemjust sa, (for trees are 'trees' and growing is 'to grow')"

"Yet trees are not 'trees', until so named and seen" "He sees no stars who does not see hem f h t of living silver.. ."

-- J.R.R. Tolkien, "Mythopoeia"

There are so many people that 1 would like to thank for helping me over the course of this

degree, but foremost among them is my supervisor Janet Rossant. Janet, thank you for your

support and guidance over the past three years - it bas been an incredible experience workiog in

your lab, and I consider myself extremely fortunate to have had the chance to leam from you.

Thank you also for giving me the chance to figure out what it is that 1 want to do: the most

strongly held ideas are not always the best ones. Many thanks also go to my cornmittee members

Alan Cochrane and Andras Nagy for their advice and guidance, especially when 1 hit the tough

parts. Th& you for helping me leam to become a better student.

Thanks also to al1 of the members of the Rossant lab for your fkiendship, advice, and

encouragement-you guys are great! Special thanks go to Masatsugu Ema, Laura Corson, Dan

Strumpf, and Perry (Tex?) Liao for helping me to leam several techniques, and providing

reagents, but especially for giving me moral support, advice, and encouragement!

My thesis could not be complete without mentioning the bunch at Knox College who have

made the last three years unforgettable. Among these are "Third East", including veteran

damsels Jen, Doma, Jess, and Kim, "the Crafiers" Susan, Claudia, and Rebecca, and al1 of the

people past and present who believed in the wonders of blue mice. Thanks to Daniela D'Anie110

for going above and beyond countless times. To my friend and fellow lab rat Albert Chang,

thanks for keeping me sane, especially when "sane" was somewhat relative. To my good nlend

Sheela Rupal thank you for being there, 1 kaow that you will go far along whatever path you

choose.

Finally, thank you to my family for al1 of your love, encouragement, and support. Whether it

came in the form of cwkies, a c raq phone call, deep thoughts, or a holiday visit, 1 appreciate it.

I love you-this one is for you.

iii

TABLE OF CONTENTS

................................................................................................................ II . Literature Suwey .4

...................................................................................................... 1 . Vascular Embryology 4

2 . The Drosophila trachea as a mode1 of branching morphogenesis ................................... 13

3 . Molecular determinants of mammalian vascular patteming ............................................ 25

4 . The hypoxic response in mammalian vascular development .......................................... 39

................................................................... III. Introduction to the experimental approach ..O4

CHAPTER 2: THE CONSTRUCTION AND CHARACTERIZATION OF HYPOXIA

RESPONSIVE REPORTER GENES FOR USE IN TRANSGENIC MICE

II . Discussion ..................................... ~ . o o ~ ~ o o o * o o ~ o a m ~ ~ ~ o o o o * * * o * o * o o m ~ ~ ~ m o a ~ m ~ ~ o m ~ ~ ~ o ~ m o o ~ ~ o o o ~ ~ ~ m ~ ~ ~ ~ o m o o o o o m o o o m m o o o o o ~ o 9 3

ILI. Conclusions .................................................................................m................................... 102

IV, Materials and Methods .....a.............. .... ..........................................................m........ 103

V . References ............................m........................................................m.m................................. 108

CHAPTER 3: FUTURE DIRECTIONS

............................................................................................................................ 1. Summary 112

1 I. Future Directions ............................................................................................................. 113

............................................................ 1 . An examination of HRE structure and fhction 113

............................... 2 . The optimization and implementation of an HRE based transgene 114

3 . Identification of areas of hypoxia during normal embryonic development ................... 117

III . Final Commenfg.. ......mm.................................................m...m.............................................. 120

N . References ....................................................................................................................... 121

CHAPTER 1

INTRODUCTION

1. General Introduction and Rationale: - .. . .. - - - - - -

The vasculature is one of the most important and complex organs in the mammalian body.

The first fuactional organ to form during embryonic development, the intricately branched

nehkrork of endothelial, and supporting periendothelial cells is essential for the transportation of

oxygen and nutrients to, and the removal of waste products nom the tissues. Serious dismptions

in the formation of the vascular network are lethal early in post-implantation development, while

the maintenance of vessel integrity and the control of vessel physiology and hemodynamics have

important consequences throughout embryonic and adult life.

The identification and characterization of genes involved in the development and maintenance

of the vasculature is a diverse and rapidly expanding field with numerous applications to medical

research, and the treatment of disease. Several hereditary conditions, including venous

malformations, and the Alagille syndrome have been shown to be caused by defects in genes

involved in the development of the vasculature; other diseases such as diabetic retinopathy,

ischemia, and arthritis, also have important vascular components. Especially interesthg is the

discovery that growing tumours and their metastases cospt host blood vessels to allow growth

beyond a defined size; clinical trials of anti-angiogenic cancer therapies are ongoing, with many

more to be tested in the near fiiture.

Clearly the development of a healthy, fuoctioning vasculature is of critical importance to the

survival of both embryo and adult; despite this fact, many questions remain unanswered. How

are vessels pattemed? What mechanisms ensure that al1 tissues have access to the blood? What

genes are involved in the differentiation, development, and maturation of the vascular network?

Examination of the development of other branched structures, such as the mammalian lung, and

Drosophila trachea show that both intriasic programs and extrinsic cues are required to ensure

correct delivery of oxygen to the tissues. 1s the mammalian vasculahire pattemed solely by

intrinsic developmental programs, or cm it respond to extrinsic cues encountered over the course

of embryogenesis? 1s then a role for hypoxia in normal vascular development?

The idea that hypoxia may have a role in the developing embryo is intuitively attractive. In

the early (pre-implantation) stages of development embryonic cells obtain oxygen and nutrients

3 by diffusion. As the embryo continues to grow, it reaches a point where diffision is insufficient

to supply the tissues, forcing it to develop a more efficient method of transport. The formation a - - - -

of the yolk sac, with its extensively branched vasculatwe, is one method by which a growing

embryo can obtain oxygen and nutrients; the large surface area of the yolk sac allows diffision

of oxygen into the vasculatwe, for transport into the embryo. As the embryo continues to grow,

this too becomes insufficient, and later stages of development connect the embryo to the

matemal circulatory system through the placenta. Given this context, it is reasonable to

hypothesize that hypoxic conditions arising nahually during development might have a role in

initiating the early stages of differentiation, or guiding some of the later branching events which

occur in the developing embryo. In this thesis is descnbed the construction and in vitro analysis

of a senes of transgenes designed to examine the extent and localization of hypoxic tissues in the

developing mouse embryo.

II. - - Literature Survey 1. Vascular Embryology

Throughout human history, man bas speculated on the role of the circulatory system. Once

thought as a seat for emotion and reason, later as the source of a body's "humours", work

throughout the twentieth cenhüy has shown the cardiovascular system to be a complex,

intricately branched network. Developed through a combination of intrinsic developmental

programs, extrinsic adaptation, and hemodynamic constraints, a functioning vasculature is

essential to ensure sufficient oxygen and metabolites to al1 of the tissues in the body.

Although many groups are currently working to identiQ the specific molecular mechanisms

involved in mammalian vascular development, the fundamental principles of vesse1 growth were

discovered using the chick. Light and electron micrograph analyses, coupled with the

production of quaii-chick chimeras, pioneered by F. Dieterlen-Lievre, and N. Le Douarin, have

been critical to understanding the basic processes, morphogenetic movements and lineages that

occur to produce the vasculature lo4. Current ideas hold that a primaty capillary plexus, formed

by vasculogenesis, is remodeled through sprouting angiogenesis to form a mature branched

network (Figure 1). Furthemore, observations made on chick vascular development, coupled

witb recent embryological work by the lab of Dieterlen-Lievre have shown a close association

between the endothelial and hematopoietic lineages in specific areas of the developing chick.

This observation is one of several pieces of evidence supporting the existence of the

hemangioblast, a bipotential precursor capable of forming bodi the endothelial and hematopoietic

Iineages.

Early work on vascular development was performed by Florence Sabin in the early 1900s

I .~rom ber detailed studies of the chick blastoderm she proposed the existence of angioblasts,

specialized cells easily distinguishable fkom the surroundhg mesencbyme, that could

differentiate into cells of both the endothelial and hematopoietic lineages. She also observed

"masses of cells that.. . develop hemoglobin and become eythroblasts," which she terrned blood

islands. Interestingly, Sabin concluded that vascular lumiiia were derived fkom cytolysis and the

production of an intracellular space, rather than h m an extracellular origin.

Figure 1 : A schematic o v e ~ e w of vascular developrnent

Hematopoietic

precursor

Hematopoietic

lineages

Hemangioblast

Endothelial precursor

Primary capillary plexus

Mature branched network

- . 6

Figure 1 :An ovewiew of the stages in vascular development. A multipotential precursor cell, the

a -- hemangioblast, - produces cells - of both - the hematopoietic and endothelial lineages. Endothelhl cells migrate and divide to form the primary capillary plexus. This primitive

vascular network is remodeled to form a branched network. The association between the

endothelium and smooth muscle cells is omitted for clarity. 39

Further detail on vascular development - - would wait until the advent of electron microscopy

and the work of Gonzalez- Crussi, Hiruma, and Hirakow 295. Study of thin sections of 6-16

somite stage embryos confirmed the formation of angioblastic clusters, with lumina existing as

regions of extracellular space, gradually enclosed by endothelial cells. Gonzalez-Cmssi also

described the formation of vascular plexi, onginally lacking a basement membrane, that are

remodeled as development progresses 2. Furthemore, arterial pressure caused by flowing blood

was detected in vessels formed solely fiom endothelial cells; arguments were made that later

changes in vessel structure could be caused in part by hemodynamic pressure.

Observations made of endothelial ce11 biology have shown that immature endothelial cells

have a rounded morphology, with a small surface-area to volume ratio 2,596. As the vesse1

matures, the endothelial cells elongate to fom thin-walled tubes. These new vessels are fragile,

and gradually becorne smunded by periendothelial support cells. Detailed study of vessel

morphology has s h o w that the endothelium fashions two types of tubes. Larger vessels have

lumina originally derived fiom extracellular space, bounded by junctions behveen neighbouring

endothelial cells, or an endothelial ce11 with itself. Such contact results in a "seamed" vessel. It

has been s h o w that "unseameà" capillaries lack these areas of cell-ce11 contact, and are thought

to have intracellular lumina. The formation of multicellular and unicellular endothelial branches

is not unlike the formation of the Dmsophila tracheal network described by Shilo and Krasnow

798 (described below).

A new tool for dissecting apart the mechanisms behind vascular growth was described by the

lab of Fmcois Dieterlen-Livre in 1987 9. The QH1 monoclonal antibody was found to bind to

quail, but not chicken endothelial and hematopoietic cells. At the time of this study, it had been

shown that clusters of endothelial and hematopoietic cells, known as blood islands, arose in the

extraembryonic tissues (area opaca), and that vessels were later observed in the developing

embryo (area pellucida) 10. Pardanaud et al. used QHI immunohistochemistry on quai1

blastodiscs, to confirm that: 1) ~ ~ l ' c e l l s could be fomd in blood islands, which interconnected

to fonn the extraembryonic vasculature. 2) The embryonic vasculature fomed separately fiom

that of the extraembryonic regions, eventually connecthg to form a complete network. These

8 results confirmed, and extended earlier work on quail-chick yok sac chimeras, that had shown

tbat the embryonic and extraernbryonic vasculahire formed independently of one another.

A second important experimental tool had its roots several years earlier. In the late 1960's,

Nicole Le Douarin observed that the interphase nuclei of quai1 cells had a large aggregation of

heterochromatin in the nucleus, making them easily distinguishable nom chick cells 3. This

difference laid the foundation for a vast array of quail-chick grafting experiments; by replacing,

or inserting a piece of quai1 tissue into a chick embryo, and allowing it to develop, one could

determine to which tissues the descendants contributed. Orthotopic or heterotopic grafis could

be performed allowing cornparisons to be made between different graft tissues in a standard

environment 1 1 . Additionally, the heritable label provided by the quai1 nucleoli was

advantageous for fate mapping experiments, as it would not be diluted through ce11 divisions,

unlike the conventional fluorescent dyes 12.

By the late 1980's it was known that that endothelial cells could differentiate in situ to fom

vascular plexi, through a process termed vascuiogenesis. Additionally, Judah Folkman had

observed a second process of vascular modeling, in which new endothelial tubes sprouted fiom

existing vessels 13. This phenomenon, termed sprouting angiogenesis, had been extensively

snidied in tumours, but it was not as well understood in the embryonic context. Some models of

vascular development held that the bone marrow, brain, and kidney were vascularized by

angiogenesis, but it was not known if vasculogenesis occurred concurrently with angiogenesis in

the developing embryo 4. A paper published in 1989 by the Dieterlen-Lievre lab took advantage

of the Q H ~ ' antibody and the nucleolar propertîes of quai1 cells to address some of these

questions, and examine the methods by which tissues were vascularized 4.

With these points in mind, Dieterlen-Lievre's group performed a series of chicldquail grafts

to examine the "angiogenic potential" of different types of tissue. In the first experiments pieces

of chick limb bud, representative somatopleute (ectoderm/mesodemi) derived tissue, were

grafted onto a quai1 embryo 4 (Figure 2). Interestingly, when the embryos were sacrificed a few

days later, the graft tissue was vascularized by QH 1 + endothelial cells. Clearly the chick explant

had been vascularized almost exclusively by quai1 host endothelium. The reverse experiment, a

quail graft into a chick host confhed these observations, as the somatopleuric quai1 grafi was

Figure 2: Schematic diagram of chick embryo (transverse section)

-.Lw-.- -A.. - - -

1 Ec todem

Neural tube

Somatic lateral plate

mesodenn

Coelom

Splanchnic lateral plate mesoderm

Endodenn

Dorsal aorta - Notochord

10 Figure 2: Transverse section of a chick embryo, (Stage 11) showing the arrangement of

-A--- - splanchnic and somatopleuric - lateral - plate mesoderm relative to the endoderm, ectordem, and donal aorta. Figure is adapted fkom Plate 1 Id, Bellairs and Osmond

1998. 142

vascularized by the QH1' chick endothelium. Expenrnents performed with splanchnopleuric - - - - - - - =' - - -

(endoderm/mesodem) organ rudiments gave the opposite result. Embryos with sections of chick

splanchnopleure in a quai1 host gave a chick-denved vascular network; a quail gr& produced a

~ ~ l ' ( q u a i 1 denved) network in chick. A final experiment using a splenic graft (mesodennal

origin) showed similar results to that of the splanchnopleure grafts; the vasculature was able to

extend out fiom the graA and form chimeric vessels with the host endothelium. In al1 cases,

quail endothelial cells were visualized by QHI+ immunoreactivity, while non-endothelial grafted

tissue could be differentiated through the nucleolar stain. In the conclusion of their 1989 paper,

Pardanaud et al. claimed that, "rudiments composed of mesoderm and ectodenn are sites for

angiogenesis.. .while mesodermal/endodermal rudiments undergo vasculogenesis.

By the early 1990s, it had become clear that vasculogenesis and angiogenesis were processes

that occurred in parallel during development to produce the mature vasculature. Extending this

idea, the lab of Francois Dieterlen-Lievre demonstrated that the mechanism of vascularization

depended on the origins of the tissue 14915. Somatopleural tissues, such as the body wall and

limbs, were vascularized by external angioblasts, which migrated into the tissue to form a

vascular network. Intemal organs of splanchnopleuric origin (heart, h g , digestive organs)

would be vascularized by intrinsic endothelial precursors. In the mid 1990s, Pardanaud et al.

worked to M e r dissect the mechanisms of vascular development and their relationship to

hematopoiesis.

A year later, Pardanaud et al. examined the vasculogenic potential of segmental plate

mesoderm, taterat plate mesodem, and tait bnd grafts, concindmg that there were two separate

lineages of angioblastic cells which contributed to the embryo vasculature 16. The tust lineage,

a line of angioblastic cells derived fiom the sornites, and paraxial mesodem, were capable of

produciag endothelial cells, that colonized the body wall, the kidney, and die wall and roof of the

dorsal aorta. A second cell lineage, produced fkom the splanchnopleuric mesoderm was capable

of forming both endothelial and, in specific regions, hematopoietic cells; splanchnopleure-

derived angioblasts were capable of colonizing the visceral organs, and floor of the dorsal aorta,

in addition to the areas of the somatopleure. It bad long been known that the dorsal aorta was

one of the intraembryonic sites of hematopoiesis; micrographs and other studies of the vesse1

12 showed that the ventral (floor) of the vessel produced clusters of cells, which changed

morphology,-and took on some of thecharacteristics of hematopoietic cells 2. The finding that

splanchnopleuric, but not somatopleuric mesoderm could contribute to these lineages was an

important step towards understanding the origins of the vasculature, and the relationship between

the endothelial and hematopoietic lineages.

A fmal piece of work combined some of the accumulating data on molecular replators of

vascular development with the (now-classic) embryological techniques. In the most recent

experiments, the lab of Dieterlen-Lievre bave used the observation that only splanchnopleure-

derived angioblasts cm colonize the visceral organs and floor of the dorsal aorta, to assay the

developmental potential of treated somitic tissue '. As shown previously, angioblasts fkom

somitic tissue were only capable of colonizing somitopleunc tissues; such angioblasts were

unable to colonize the visceral organs, nor were they found to contribute to the endothelial or

hernatopoietic lineages on the floor of the dorsal aorta. By transiently culturing somitic tissue

with endodenn ptior to grafting, Pardanaud et al. found that they were able to change the

properties of the angioblasts, making them capable of colonizing the visceral organs, and the

floor of the dorsal aorta. Interestingly, a similar effect was observed when somitic tissue was

cultured in the presence of VEGF, TGFBl, or bFGF.

Conversely, when Pardanaud et al. transiently cultured splanchnoplewic tissue with ectodenn,

EGF, or TGFa they reduced the potential of angioblasts to migrate fiom the explant 17.

Splanchnopleuric grafts treated in this way were unable to colonize visceral organs, nor were

they capable of contributing to the hematopoietic clusters on the floor of the dorsal aorta.

Currently there are believed to be two separate sources of endothelial cells in the chick embryo,

which have differeat potentials for invasion and hematopoiesis. in one lineage, angioblasts

derived fiom somatopleural and axial mesodem produce endothelial cells that can invade the

body wall and somatopleural tissues. A second lineage, derived h m the splanchnopleure, and

dependent on a transient contact with endoderm, vascularizes the visceral organs, and is capable

of contributing to hematopoiesis in specific regions of the dorsal aorta.

While electron microscopie analysis of the developing chick vasculature has provided some

useful information on the ultrastnictwe of a vessel, it was the work of Francois Dieterlen-Lievre

13 and CO-workers that has laid the foundations towards understanding the mechanisms in vascular

forqation and patteming. Through the c l ~ s i c embryological techniques of grafting and lineage

mapping, Dieterlen-Lievre et al. have described some of the g e m layer interactions,

differentiation, and migration, that must occur to form the endothelial network. From these

origins have sprung many of the studies of the marnmalian vasculature. The terni vasculogenesis

has corne to describe the mechanism by which endothelial cells differentiate and interact to form

networks in the extraembryonic tissues, and some areas of the embryo 18. Angiogenesis, a terni

originally describing the sprouting of branches fiom pre-existing vessels, has been expanded to

include the stages of branching, remodeling, and occasionally the maturation of the vessel; in

essence the changes that occur in the vascular plexus to produce the mature branched vascular

tree.

2. The DrosophiIu trachea as a mode1 of branching morphogenesis

While much work has been done to understand the fiuidaxnental principles behind vascular

development, many problems remain to be solved. Although we have an understanding of the

origins of endothelial precursors, it is not yet known how the vasculature is pattemed, how

lumina are fomed, or how the vasculature is remodeled to ensure that oxygen is delivered to al1

of the tissues. To address these issues, the labs of Mark Krasnow, Ben-Zion Shilo 8919 and

others have turned to Drosophila. The stereotyped pnmary branches, and intricate arborization

of the Drosophila trachea have proven to be valuable models for dissecting the formation of

branched networks in nature.

The Drosophila trachea is an intricately branched network of tubes used to convey oxygen

from the spiracles to the tissues of the Drosophila larvae; like the mammalian vasculature, the

Drosophila trachea is characterized by a series of stereotyped branches, and variable tracheole

formation. Growth and patternhg of the Drosophila trachea begins with the differentiation of

ten ectodermal clusters on each side of the developing embryo 8.20. These clusters invaginate to

form sacs comprised of approximately 80 cells; subsequent ce11 migration and branch formation

occurs without proüferation or apoptosis. Primary branch formation occurs with the migration of

tracheal cells to form the six major branches of each metamete: the dorsal branch, lateral tnink,

and ganglionic branches migrate along the dorsiventral axis, while the dorsal trunk and visceral

14 branches migrate anteriorally. Secondary branches form with the expression of pantip markers

in the terminal cells; these temiinal cells differentiate to fonn unicellular branches that invade the - -+L- - - - - --- - -- - - - - - - - - -

surrounding tissue. Finally, a finely ramified network of tubules are fomed nom the secondary

branches to become the terminal branches of the trachea. The formation of these seamless

tracheoles has been shown to be responsive to conditions of low oxygen in the surrounding

tissues. (Figure 3)

Three major types of cells comprise the Drosophilu trachea. Terminal cells form the

extensive network of intracellular tubes required to ensure oxygen delivery to the tissues 2 1.

Stalk cells provide the channels through which oxygen can pass, while fusion cells are required

to comect the segmented tracheal network 22. At least two fusion cells, located in the dorsal

trunk and dorsal branches send out fine processes to contact the fusion ce11 of an adjacent

tracheal metamere. In this way tracheal segments can fonn an interconnected network

throughout the embryo 23.

While early models of tracheal development proposed that modifications made to an iterative

genetic program could account for the formation of the complete tracheal network 24, current

ideas hold that several different pathways are required to produce a correctly branched,

functional, trachea. Furthetmore, work perfomed in the labs of Affolter, Shilo, and Krasnow

have shown that three distinct patteming mechanisms are active in tracheal development.

Firstly, it is known that tracheal cells are assigned to a specific branch, and that fusion cells are

specified prior to the onset of migration 22,23325. This intriasic control of tracheal branching is

produced through a combination of Dpp, EGF, and Notch signaling, resulting in the specification

of tracheal ce11 fate, and an alteration of the cellular response to directional cues. A second

method of conîrol is provided by the Brealless (btl) and Branchless ( h l ) genes. Tracheal cells

expressing the Breuihless FGF receptor migrate toward dynamic sources of the Brarchless FGF

ligand provided by the surrounding ectoderm 24; ectopic expression of Branchless results in

migration of tracheal branches towards the expressing cells. The chemotactic response of btl

expressing tracheal cells towards bnl expressing tissues shows that the trachea can be pattemed

by extrinsic cues. A third method of tracheal patternhg is a specialized form of extrinsic

response important in the migration of terminal branches. Tracheoles will grow toward areas of

low tissue oxygenation, through a modification of the bnllbtl pathway 2 1.

--A----- - - - Figure . .- . 3: An overview of the Drosophila trachea

A.

Dorsal Branch

Dorsal T d (anterior) Dorsal Trunk

(posterior)

Visceral branch

Ganglionic branc h Lateral

Tnink

Figure-% A-)A schematicdiagram ofmegmeat of thstncheaI- network. Differentiating tracbai

precmors form a cluster of approxiamately 80 cells, temed the tnicheal placode. In the

early stages of tracheal development, cells migrate nom the placode to produce a series

of stereotyped primary branches. The major branches produced from one such placode

are shown and labelled in A). The Drosophila tracheal network fonns from the

19 intercomection of 20 placodes. B) The formation of secondary and tertiary tracheal

branches. Terminal cells of a primary brancb form a pair of unicellular secondary

branches, tbat can rami@ into a network of subcellular tertiary branches. (Adapted fkom

Krasnow 1997). 8

i. Intrinsic patterning of the Drosophila trachea

The idea that tracheal ce11 fate was detemined pcior to branch formation began with the

observation that mutations in the Dpp receptors punt and thick vein (th) resulted in defects in

specific branches of the developing trachea 25. Embryos lacking tkv orpunt were able to

produce normal anterior-posterior branches, such as the visceral branch and dorsal trunk, but

were unable to produce a dorsal branch, and had defects in the branches migrating ventrally.

Ectopic expression of Dpp prevented the antenor growth of the dorsal trunk, and increased the

number of cells available to migrate dorsally. Studies of tkv and punt expression showed that

both genes were expressed in the placode prior to tracheal ce11 migration; conversely, the Dpp

ligand was expressed as a pair of stripes in the ectoderm dorsal md ventral to the tracheal pits.

Expenments performed with constitutively active and dominant negative tkv receptor confimed

that Dpp activation was necessary for tracheal cell migration. Interestingly, the time of Dpp

activity was important: ectopic Dpp receptor activation had no effect on tracheal patteming

during ce11 migration. From these data, Vincent et al. proposed that Dpp acts to regionalize the

tracheal placode, not as a chemoattractant.

A paper published by Ben Shilo's group a few months later reported that antagonism between

the EGF and Dpp pathways regionalized the tracheal placode 22. In basic EGF signaling, the

EGF receptor, der is b o n d by an active f o m of the spitz ligand. Inactive spitz is ubiquitously

expressed, and becomes functional only after cleavage by rhomboid (rho) and star; specificity of

the EGF signaling is conferred in part by the tightly regulated expression pattern of rho.

Interestingly, EGF signaling was implicated in üacheal patternhg when it was observed that rho

was expressed in tracheal pits; it was later found that mutations in rho resulted in tracheal

defects. Similarly, an examination of spi& group mutants showed that the dorsal trunk and

visceral branches were poorly developed, if not entirely absent. Finally, embryos deficient for

the EGF receptor (der&-'-) did not have correct dorsal tnink migration, and showed fusion

defects. By transgenically expressing the EGF receptor (der) in the trachea of embryos deficient

in der function, Wappner et al. were able to rescue dorsal trunk migration and fusion.

18 Several experiments demonstrated that Dpp and EGF act antagonistically to pattern the

@achea. Firstly ectopic local or trachea1 specific Dpp activation resulted in the loss of the dorsal

tnink, and a reduction in the visceral branch; furthemore, instead of remaining in the tracheal

placode, these cells contribute to the dorsal branch. In the converse experiment, activated spi&

did not alter branch identity in wild-type embryos. When the experiment was repeated in

embryos with reduced levels of Dpp signalhg (tkv +/O), Wappner et al. observed normal dorsal

trunk and visceral branch formation, with a corresponding reduction in the dorsal and visceral

branches. If the EGF and Dpp pathways were antagonistic to one another, then one would expect

the phenotype caused by a hypomorphic mutation in one pathway to be rescued by a reduction in

signaling by the other. To test this prediction, Wappner et al. examined the trachea of embryos

carrying hypomorphic alleles of punt and flb. Double mutant embryos had general

abnonnalities, but were able to produce a continuous dorsal t d . From these data Wappner et

al. concluded that the EGF pathway was essential to assign tracheal cells to the dorsal trunk and

visceral branch fate; the Dpp pathway detennined the cells that would form the dorsal and lateral

tnink branches. Thus the EGF and Dpp pathways act antagonistically to one another to confer

branch identity and pattern the cells of the tracheal placode.

A second exarnple of intriasic patteming came fiom the Sarnakovlis lab 23. In this paper, it

was reported that the decrease in dorsal bmch production in tkv " embryos was accompanied by

a decrease in expression of the fusion ce11 markers headcuse (hdc) and escargot (ex), and fusion

ce11 defects. To m e r examine this phenornenon, Steneberg et al. specifically disrupted Dpp

signaling in fusion cells, and found an increase in fusion defects. Conversely, ectopic activation

of Dpp in tracheal cells resulted in the production of extra fusion cells in a few of the dorsal, and

dorsaI trunk branches studied; fiom this work Steneberg et al. concluded that Dpp was capable of

inducing fusion ce11 fate in the trachea. Interestingly, Notch signaling became implicated in the

detemination of fusion ce11 fate an en'ancer trap screen for genes expressed in fusion cells

identified Delta (a Notch ligand). Using a temperature sensitive Notch mutant, it was observed

that trachea deficient in notch signaling produced additional fusion cells at the expense of stalk

cells. Conversely, ectopic expression of the notch receptor throughout the trachea resulted in

conectly branched metameres that were unable to fuse. Such trachea lacked the expression of

fusion ce11 markers. From these data, Steneberg et al. concluded that Notch-Delta signaling was

essential for the correct specificatioa of the nision cell. In this case, the Delta-expressing fusion

ce11 is thought to activate the Notch receptor on neighbouring cells, preventing them fiom

19 adopting the fusion ce11 fate. Samakovlis' group M e r hypothesize that activated Notch

prevents - - - stalk cells fiom responding to the - Dpp - signal. Although fùrther experiments must be

performed to test this model, it is clear that inûinsic responses to Dpp, Spitz, and Notch signaling

are essential to pattern the tracheal placode, and eaable fuiun branch cells to respond to the

correct developmental cues.

ii. Extrinsic patterning of the Drosophila trachea

While intrinsic mechanisms clearly play a role in establishing ceIl fates, they do not determine

the position of a branch relative to the suiroundhg tissue. Extrinsic patteming mechanisms, such

as the chernotactic responses mediated by Branchless/Breathless interactions are critical for the

correct development of the trachea. The Breathless gene was first identified by Shilo's group,

who noticed that embryos lacking the Breathless gene product were unable to produce a

branched trachea 26. Further studies of the btl locus showed that it encoded a homologue of

mammalian FGFR-1; homozygous mutations at this locus inhibited the correct migration, but not

the early differentiation of tracheal cells, in addition to causing defects in the glial cells of the

midline and the salivary glands 27,*8. Studies of downstream effectors of Breathless signaling

showed that the FGF receptor activates the RaslRaf pathway through DoflStumps 20. Further

work with embryos expressing mutant and cbimeric foms of btl demonstrated that 1 ) btl was

required for the onset of tracheal migration, but not for the determination of the tracheal placode;

2) btl was not required continuously for tracheal morphogenesis, but appeared to be required at

specific stages in the branching sequence 27. Finally, Reichman-Fned et al. concluded that btl

bad a "permissive" but wt an " i n s ~ t i v e " role in patterning the trachea.

While work to this point had demonstrated that btl was necessary for the formation of

primary, secondary, and terminal branches, it was not known if this requirement was for the

correct quantitative or spatial regulatioa of the receptor. Further studies on btl fùnction

demonstrated that constitutively active btl receptor expressed at high levels could not rescue

defects in btl deficient embryos 28. In fact, while tracheal-specific expression of wild-type btl

was sufiicient to rescue the tracheal defects in btl " embryos, expression of constitutively active

btl interfered with the rescue of such embryos. It was also obsewed that the trachea of wild-type

embryos were formed incorrectly on the addition of constitutively active btl receptor. Lee et al.

20 concluded fiom these and other experiments that the Breathless receptor tyrosine kinase is

requued for the cell migration fonning the primary, secondary, and terminal branches. In this - -- -- - - - .

paper, it is also speculated that Breathless activity may be required in a space-specific manner,

since hi@ levels of active Breathless are not sufficient to pattern the trachea.

Evidence for btl-mediated chernotaxis was described with the discovery and characterization

of the Branchless ligand, published by the lab of Mark Krasnow in 1996 24. Identified through

an enhancer-trap screen, embryos carrying strong bnl mutant alleles produced tracheal sacs, but

were unable to complete normal branching. Furthemiore, the bnl locus was haploinsufficient,

with heterozygotes also missing some branches. Sequence information, coupled with genetic

and biochemical tests suggested that bnl was an FGF homologue that could act through the btl

receptor to stimulate branching. The possibility of bnl mediated chemotaxis arose when it was

observed that bnl was expressed by ectodemal (and some mesodennal) cells surrounding the

tracheal sec, at the positions of fùture branch outgrowth. Further analysis of the Bnl expression

pattern has shown it to be highly dynamic: as tracheal branches grow toward bnl expressing

clusters, bnl expression is decreased in the original cells, and is activated in new areas.

Experiments in which bnl was ectopically expressed in wild type and bnl deficient embryos

showed that tracheal branches grew toward the source of bnl in most of the segments of the

embryo. While much more work needs to be perfomed to understand the genetic control of bnl,

it is clear that bnl-btl mediated chemotaxis is essential for the correct patteming of the

Drosophila trachea (Figure 4).

Wolf and Schuh have recently published an interesting twist on the idea of chemotactic

responses in the Drosophila trachea 2 . in theu paper, they observe that a single hunchback (hb)

expressing ceIl could be observed at the posterior-lateral margin of each tracheal cluster. In situ

analyses of this ceIl over several stages of branching morphogenesis suggest that it could connect

the posterior and anterior branches of the dorsal mink, behaving as a "bridge" to ensure proper

comection of the two branches. This hypothesis was supported by the finding that ectopic

expression of hunchback in a cell near the tracheal placode resulted in the misdirection of the

dorsal trunk branch, and the incomct fusion of the anterior and posterior branches. Further

support for an alternate chemotactic mechanism comes fiom studies of trachea formation in bnl,

Figure 4: Extrinsic patternhg of the Drosophila trachea

Figure 4: The tnicheal placode is patterned by extnnsic mechanisms. Branchless (black) is

- - - - -= expressed in cells surrounding the tracheal placode (white). As the tracheal branches

begin to grow toward areas of Branchless expression, Branchless is down regulated in the

original cells (broken lines), and upregulated in a new population of cells (black). 8

Figure adapted fiom Krasnow 1997. 8

23 btl, and hb embryos. Firstly, areas of dorsal tmnk formation have been observed in embryos

lacking h l OF btl funetim, dorsal tnink- bim defetts-have been noted in irb deficient embrycm.

Secondly bnllbtl expression is unaffected in hb deficient embryos, just as hb expression is

normal in bnl or btl deficient embryos. Finally, tunel staining of hb deficient embryos show that

the bridge cells form bnefly, and rapidly undergo apoptosis. From these data, Wolf and Schuh

propose that a hunchbuck expresshg bridge ce11 guides the migration and fusion of the dorsal

txunk, irrespective of the areas of bnl or btl expression; the absence of functional hb results in

bridge cell apoptosis and dorsal mi& fusion defects. While further work must be done to

support or refute the bridge ce11 hypothesis, it does provide new and intriguing possibilities for

the extriasic regulation of tracheal patteming.

iii. Hypoxia and extrinsic patteming

How is an organ modified to fulfill the specific requirements of the organism? Int~itively we

recognize that muscle structure and function can be altered by exercise, and that erythrocyte

content in blood is altered by chronic exposure to reduced oxygen levels *1,3*. How do organs

respond to chemical and physical cues fiom the surrounding environment? A seminal paper

published in 1999 demonstrated that conditions of low oxygen act to pattern the terminal

branches of the trachea; such a mechanism may have important implications for the patteming of

other branched organs, including the mammaüan vasculature 2 1.

To examine the effect of oxygen concentration on the production of terminal branches

exnbryos were grown tmâer 5%, 2t%, and 60.h oxygen and scored for the number of tenninal

branches 21. Through this work, Jarecki et al. demonstrated an inverse correlation between the

concentration of oxygen and the number of terminal branches; 68% more branches were formed

in embryos grown under 5% oxygen compared with those grown under 21% oxygen.

Additionally, branches produced in embryos grown under low oxygen tended to be long, highly

branched, and tortuous when compared witb branches produced under normoxia. By creating

tracheal clones deficient in terminal branching (blistered 3 or lumen formation (synuptobrevin - '-1, Jarecki et al. obsewed that branches fiom neighbouriog segments grew into areas that were

insufficiently oxygeaated by the mutant trachea. To begin to elucidate a mechanism, bnl

expression was examined during the stages of terminal branching. In situ analysis of bnl

24 expression during terminal branching showed that it was nomally expressed in a few cells in al1

tracheated tissues; ubiquitous expression of bnl resulted in tangled masses of tracheal branches. - -- - - -

These observations were consistent with the idea that bnl might be acting as a chemoattractant

for trachea terminal branches. Further expenments demonstrated that bnl protein is upregulated

in larva grown under 5% oxygen compared with siblings grown at 21%. More convhcingly,

areas of poor tracheation, presumed to be hypoxic, expressed increased levels of bnl. Although

more work must be done to understand the mechanisms by which bnl expression is up-regulated

by hypoxia, Jarecki et al. have demonstrated that conditions of low oxygen are instrumental in

patterning the terminal branches of the Drosophifu trachea. Such a finding may be important to

understanding the formation of the mammalian vasculahire.

Over the past decade, the Drosophila trachea has proven to be a valuable mode1 of the

formation of branched networks in vivo. Like the tracheal network, the mammalian vasculature

is comprised of large, multicellular primary, unicellular secondary, and subcellular tertiary

branches. Both the Drosophila trachea and the mammalian vasculature have structures that are

stereotyped between organisms, in addition to more variable components. From a physiologic

perspective, both systems use a semi-iterative tree structure to ensure an extensive area of

coverage, for the delivery of oxygen, and recovery of carbon dioxide. Furthemore, the

formation of a functional lumen of defined size is required for each system. Finally, both

systems are able to adjust to the tissue requirements of the organism after the organ has begun to

fuaction. While it is not yet known if the genetic mechanisms controlling tracheal development

will have direct parallels with those controlling mammalian vascular development, it is clear that

the general mechanisms of intrinsic, extrinsic, and possibly hypoxic regulation are important in

vascular dwelopmcnt and pattcrning. Thm rcprtstntative signaling pathways: VEGF, hg-Tic,

and Ephtin, will be discussed as examples of the current understanding of mammalian vascular

patteminp.

3. Mdecular determinants of mammalian vascular patternhg - =L - A -

i. The VEGF pathway

Originally identified as a vascular permeability factors, the VEGF family of growth factors

are a group of homodimeric glycoproteins whose carefully regulated activity is essential for the

formation and modeling of the vasculahire 31332. Four VEGF genes (A-D) have been identified

in humans, with a fiAh (VEGF-E) produced by members of the poxviridae 31933. Five isofonns

of the VEGF-A gene are produced by altemate splicing in humans; the mouse VEGF gene has

been shown to produce three isofonns of 120, 164, and 1 88 amino acids (a.a.) 34335. Of these

the 120, and 164 a.a. proteins are the most abundant, witb the 164 a.a. isoform acting as the

strongest mitogen. Additionally, it bas been found that the VEGF isoforms differ in the ability to

interact with heparin sulfate proteoglycans; the larger VEGF isoforms can bind heparin, and

associate with the extracellular matrix, while the smallest isoform has been shown to diffuse

freely (discussed in 31). It has been hypothesized that the different isoforms could act in

combination to mediate endothelial ce11 mitogenesis, differentiation, and proliferation.

VEGF ligands have been shown to bind to three major receptors, VEGFR-l/flt-1, VEGFR-

2 / f k 1, and VEGFR-3/flt4, in addition to at least one "accessory receptor", Neuropilin- 1 3 132.

The VEGFRI -3 receptors are characterized by the presence of seven immunoglobulin-like

domains used for binding to the VEGF ligand, and an inhacellular kinase domain (Figure 5).

VEGF binding induces homodimerization of the VEGFR-I and VEGFR-2 receptors 32, followed

by autophosphorylation and activation of the downstream signaling cascade. A single report

claims to show VEGF-mediated heterodimerization of soluble VEGFR-1IFlt-1, and the

extracellular domain of VEGFR-2/Flk-1, however, this finding is unsubstantiated, and its

relevance in vivo is unclear 36. Of the two most-well characterized teceptors, VEGFR-I and 2,

it bas been shown that VEGFR-1 has a ten-fold higher affiity for VEGF than VEGFR-2 32.

Interestingly, WGFR-1 undergoes little detectable phosphorylation when bound to VEGF, whiie

VEGF binding to WGFR-2 results in autophosphorylation at four major sites, followed by the

activation of the Raf/MapK pathway 31.32. In terms of the other receptors, Neuropilin-1 is

thought to act as a CO-receptor with VEGFR-2, while VEGFR-3 signaling is not well understood.

26 Figure 5: Schematic oveMew of the interactions between the VEGF receptors and their ligands

VEGF-A VEGF-A VEGF-A (121,165) (121, 145,165) (165)

VEGF-C VEGF-B VEGF-D

VEGF-C VEGF-D

VEGFR- 1 VEGFR-2 Neuropilin- 1 VEGFR-3 (Flt- 1) W. 1) (Flt-4)

Figure 5: Interactions between the VEGF ligands, and their recepton. The VEGF receptors are

, -- shown with white circles representing the seven immunoglobulin domains, and black

boxes representing the intracellular kinase domains. Listed are some of the different

VEGF ligands that are known to interact with the receptors. This figure was adapted

from Neufeld et al. 1 999. 32

- White it had long been known that VEGF pathway was involved with the differentiation,

proliferation, migration, swival, and pemeability of the vasculature, it is only recently that

researchers have begun to understand how VEGF mediates such a diverse array of effects 1937-

39. Studies of mice with targeted deficiencies in VEGF, VEGFR-1, and VEGFR-2 have shed

some light on this subject. Embryos lacking a single copy of the VEGF gene die very early in

embryonic development with poorly developed dorsal aortae, a reduced density of mesenchymal-

and intersornitic vessels, and defects in remodeling the vasculature 40,41. Embryos homozygous

for the targeted allele had an even more severe phenotype, often lacking the dorsal aortae

altogether, in addition to other major problems forming the vasculature. Mice with targeted

mutations in VEGFR-2 are unable to produce endothelium, and have a marked deficiency in

hematopoiesis 42. Although some expression of VEGFR- 1, and VEGFR-3 was observed in

these mutants, Lac2 expressing cells were found to have a cell-autonomous defect preventing

them fiom fomiing mature endothelial cells, or a vasculature. VEGFR-1 deficient mice differ in

phenotype fiom both the VEGF, and VEOFR-2 knock-out mice 43. In these cases, homozygous

mutant ernbryos make endothelial and hematopoietic cells, but fonn disorganized vessels, dying

by day 9.5. Closer examination of these mutants has shown that the VEGFR-1 mutant

phenotype stems &om a non-ceIl autonomous defect in which extra mesenchymal cells take on a

hemangioblastic fate 44. Interestingly, mice homoygous for a kinase deficient VEGFR-1 show

defects in monocyte migration, but not in vascular development 45.

Currently there are several models proposed to account for the activity of VEGF and its

receptors m vascular development. O h diat VEGFR-I binds VEGF with htgh affhity, and

acts non-ce11 autonomously, it has been proposed that VEGFR-1 expressing cells "soak up"

VEGF, preventing smounding cells fiorn acquinng a hemangioblastic fate 44946. VEGFR-1

deficient cells are less able to bind VEGF, and are unable to prevent neighbouring cells fkom

responding to the signal, resulting in the formation of excess hemangioblasts, and the resultant

"overcrowded" vessels. While this mechanism is not a direct parallel with the intrinsic

patternhg mechanisms elucidated from the Dmophila trachea, there are some similarities. The

use of the VEGFR-1 receptor to prevent neighbouring cells from adopting the hemangioblast

fate, and ultimately responding to developmental cues has a similar effect to the Delta-expressing

29

fusion cells of the trachea preventing neighbouring stalk cells fkom adopting fusion ceIl fate 23.

- Aithoughthe mechanimu d i f f ~ ~ b a t h cases involve a specinc cell type (mesenchymdstalk cell)

undergohg an intrinsic response that renders it unable to respond to later patteming cues.

A second model for VEGF activity stems fiom the observations that VEGF acting through the

VEGFR-2 receptor can stimulate endothelial ce11 chemotaxis; this finding parallels the

chernotactic effects of Branchless FGF on tracheal cells. It has long been known that endothelial

cells could proliferate in response to VEGF, and would migrate toward a point source of VEGF

in vitro 3734'. In one ceIl culture model, in which glomerular endothelial cells were cultured

with rat metanephnc explants, it was found that the endothelium "aligned" and invaded the

explant. Addition of a VEGF, but aot a PBS soaked glass bead resulted in directional migration

of the endothelial cells toward the point source 48. Evidence for a role of VEGF mediated

chemotaxis in vivo was reported by Cleaver and Krieg 49. In Xenopus, the hypochord, an

endodem derivative induced by the notochord, is known to produce a low weight isofonn of

VEGF, thought to stimulate the formation of the dorsal aorta. Through lineage tracing, Cleaver

and Krieg demonstrated that aagioblast precursors arose in the lateral plate mesodemi, and

migrated toward the hypochord, to f o m the dorsal aorta. Removal of the lateral plate mesoderm

fkom both sides of the embryo resulted in the loss of the dorsal aorta, while removal of the lateral

plate mesoderm fiom a single side resulted in defects in the dorsal aorta specific to the operated

side. Although this group did not ablate the hypochord, or block the system with anti-VEGF

antibodies to test their hypothesis, they did show that when angioblast-fiee tissue expressing

VEGF was implanted near to the hypochord, the angioblasts migrated to the site of ectopic

expression. Thus, the VEGF pathway can act to pattern the vasculature through chemotaxis in

vivo.

Just as the hypoxic regdation of Branchless activity was shown to be important to patteming

the Drosophila trachea, hypoxic activation of the VEGF pathway may be important to the

development of the vasculature. Certain observations are suggestive. Firstly, VEGF was

originally identified as a vascular permeability factor expressed in tumour cells; later studies on

tumour development and in a vast array of ce11 lines has shown that VEGF is up-regulated in

cells exposed to hypoxic conditions 50. Work perfomed to dissect the process has shown that

VEGF is upregulated at the transcriptional level through the activity of the HIF pathway

. 30 (described below); additionally, the transcript is stabilized through the binding of the HuR

- - protein 5 1 - 5 3 Given the knowledge that the &ueloping embryo is exquisitely sensitive to

changes in VEGF expression, it is reasonable to hypothesize that areas of embryonic hypoxia,

and associated upregulation of VEGF, may be important to vascular development. In this vein, it

bas been shown that levels of VEGFR-1 mRNA, and VEGFR-2 protein, are also increased in

cells experiencing hypoxia 54955.

Studies of Drosophikr tracheal morphogenesis have demonstrated that both intrinsic and

extrinsic patteming are required to form a mature branched network. Similar mechanisms are

being elucidated in the mammalian vasculature; VEGF-mediated differentiation, chemotaxis, and

hypoxia-responsiveness are three methods by which the VEGF pathway models the vasculature.

Despite this work, many more experiments will have to be done to determine exactly how VEGF

mediated endothelial survival, proliferation, tube formation, and hemangioblast differentiation

are used in the developing endothelium.

ii. Angiopoietins and Tie receptors in mammalian vascular patteming

While the VEGFNEGFR pathway is a major player in mammalian vascular development, the

activities of the Tie receptors and angiopoietin ligands illustrate other mechanisms by which the

vasculature is pattemed. Tie-1 and Tie-2 were onginally identified by Martin Breitman's group,

in a screen for tyrosine kinase receptors expressed by endothelial cells 56. Sequence analysis

showed the receptors to have a pair of immunoglobulin domains flanking three EGF-like repeats

in the extracellular region, with a split kinase domain intracellularly 57958. Work on the

biochemistry of the Tie receptors has shown that Tie-2 forms homodimers on binding the

Angiopoietin- 1 ( h g - 1, see below) ligand, upon which it becomes autophosphorylated and

interacts with a docking protein (Dok-R) 58-60. Several other proteins have been shown to

interact with Tie-2 including Grb7, Grb 14, p85, Grb2, and Shp2 60. Recent work performed in

human, porcine, and bovine ceIl culhue systems suggests that activated Tie-2 might activate Akt

through PI3 Kinase 61. Much less is known about signalhg through the Tie- 1 receptor, and the

identity of the Tie-1 ligand(s) remains unknown 59.

31 In 1996, George Yancopoulos and colleagues published a set of papers describing the cloning

aiibchatacterizatioo of A n g i ~ p o i e ~ L, a ligand for Tie-2 62263. Ang-1 was f d to be a

secreted glycoprotein containing a novel N-terminus, a coiled-coiled domain, and a fibrinogen-

like motif 62. Yancopoulos' group reported 97.6% identity between the human and mouse ORF.

Later papers described the discovery of three other true angiopoietins: proteins containing the

coiled-coil, and fibrinogen domains that possess the ability to bind to the Tie-2 receptor 64965.

Several other proteins have been identified which have homology to the angiopoietins, but lack

the capability to bind Tie-2 65. The function of these angiopoietin-related proteins is under

scrutiny.

Studies of the interactions between Ang-1-4 and the Tie-2 receptor have shown that Ang- 1

and Ang-4 can act as agonists, siimulating Tie-2 autophosphorylation and activity of downstream

pathways 65966. h g - 2 and Ang-3 have been s h o w to mediate little receptor activation in

endothelial cells, and cm antagonize Ang-1 mediated Tie-2 activation (Figure 6). While much

of the activation data was obtained through ce11 culture systems, experiments performed with

Ang-2 transgenic mice have suggested a role for h g - 2 antagonism in vivo 64. Interestingly,

several groups have observed that both Ang-1 and Ang-2 can activate Tie-2 receptor ectopically

expressed in fibroblast cells 66'6'. The in vivo relevance of this fuiding is unclear, and it has

been suggested that the contradictory tindings are due to the activity of an as-yet-unidentified

accessory protein. Dissection of the fuoctional domains of h g - 1 and Ang-2 indicated that Ang-

1 may act as a homotrimer, and Ang-2 as a homodimer; in both cases, interactions are mediated

by the coiled-coi1 and N-terminal domains 68. Studies of chimeric proteins have demonstrated

that agonist/antagonist activity is coaferred by the receptor binding fibrinogen-like domain 68.

Studies of transgenic mice clearly show a role for the Tie receptors and angiopoietin ligands

in the development of the vasculature 58369. Unlike the VEGFR mice, which had problems

forming the primary vascular network, Dumont et al. report that embryos deficient in Tie-2 die

by day 9.5-10 with heart and vesse1 remodeling defects58. Specifically, the endocardiurn of Tie-

2 4 embryos had reduced trabeculation, and areas in which the endothelial cells had

disassociated fiom the myometrium. Blood vessels appeared to be enlarged, with fewer

branches, and abnormally homogeneous large and mal1 branches 58369. Micrograph analyses of

32 Figure 6: Schematic overview of the interactions between the Tie-1 and Tie-2 receptors and the

Tie-2 Tie- l

33 Figure 6: As described in the text, Angiopoietin-1 (Ang-1) has been shown to bind to the Tie-2

recepfot te act as an egonisthendocheüaC cells. An@ acts as an antagonia to Ang-l

mediated activation in endothelial cells, although it has been shown to act as an agonist in

Tie-2 expressing fibroblast cells. Ang-3 and Ang-4 are thought to be divergent

counterparts of the same gene in mouse and human. Interestingly, while both Ang-3 and

Ang-4 bind to the Tie-2 receptor, Ang-3 acts to antagonize, and Ang-4 acts to stimulate

the activity of the Tie-2 receptor. The major domains of the Tie-1 and Tie-2 are

represented in the diagram: black boxes correspond to the intracellular split kinase

domains, gray boxes correspond to the EGF-like repeats, and the circles represent the

imrnunoglobulin-like domains. Figure adapted from Yancopoulos et al. 2000. 75

34 ~ie-2-/- vessels showed that ~ie-2-'- endothelial cells were more rounded in appearance, and were

less associaîed with either the periendothehi suppoacells, or with the extracellular matrix 6.

Dumont et al. also comment upon a reduced number of endothelial cells in Tie-2 mutant

embryos, but did not conclude whether such a difference was due to a decrease in proliferation,

or an increase in apoptosis of the endothelial cells 58. Other studies by Dumont and others

suggests that the Tie-2 receptor does not play a role in stimulating endothelial ce11 proliferation

58960,67970. Instead, Tie-2, and the angiopoietins may encourage endothelial ce11 swival by

preventing apoptosis due to anoikis (detachment fiom extraembiyonic support) 60,61967969,

~ie-1' targeted transgenic mice demonstrated a different role for the receptor in vascular

development. Unlike the Tie-2 and VEGFR phenotypes, most Tie-1 knockout mice die between

day 13.5 and P l with localized hemorrhaging and tissue edema 69971972. ~ie-1'" pups die

shortly after birth due to breathing difficulties, possibly caused by the failure of alveolar

expansion. Closer examination of the Tie 1-" embryos revealed an excm of vascular branches

formed with no apparent increase in ce11 proliferation (as estimated by PECAM staining).

Stained sections sbowed a 1.5 to 2.5 fold increase in vesse1 number, with micrograph analyses

revealing abnormal endothelial filopodia projecting into the vascular lumen 6369. Studies of

chimeras made between Tie-1 -/- ES cells and wild-type morulae demonstrate that Tie-1 is

required ce11 autonomously during the later stages of development 72. Tie-1 deficient

endothelial cells were capable of contributing to the dorsal aorta, hem, and lung, between day

10.5 and 15.5, but were unable to contribute to the vasculature of the midbrain, kidney, adrenal

gland, bladder, or intestine at this time. Interestingly, studies of high percentage adult chimeras

rhowed the absence of Tie-1 -1- endotheliak eells in the capillaries. These findinp extend the

observations made on the original Tie-1 -/- mouse, in which large vessels were normal in

appearance, with defective morphology only at the sites of hemorrhage 71. Interestingly, both

Tie-1 -/- and Tie 2 -1- mice show abnormal tissue fold architecture; this finding will become

important in the later discussion of tie-mediated interssusceptive growth as a mechanism by

which Tie/Ang interactions cm pattern the vasculature.

Transgenics overexpressing or abrogating angiopoietin fiuiction have also demonstrated a role

in vascular remodeling and maturation 63. Like the ~ ie -2" embryos, h g l " are capable of

35 forming the primary capillary plexus, but die around day 12.5 with heart and cardiovascular

defects. - AI@" embryos have growth retarded endocardium, with some areas in which the -- - -- - - - - - - - z--- -- -

endothelial lining had collapsed fiom the myocardium. PECAM staining of the heart showed a

reduction in PECAM positive cells. Ang-1" embryos had dilated vessels with fewer branches,

and less of a difference between the diameter of large and small vessels. Micrograph analyses

show that endothelial cells have a rounded morphology and are poorly associated with the

periendothelium and the extracellular membrane. Like ~ie-2" embryos, h g - 1'" vessels have

abnormal tissue folds. As a corollary to the Tie-2 and ~ n ~ ~ 1 - I - experiments, targeted

overexpression of h g - 2 in endothelial cells had similar, or even more severe defects than the

Ang-1 knockout mouse 64. Ang-2 overexpressing embryos were smaller than wild-type siblings,

with "moth-eaten" vessels, collapse of the heart endocardium, and defects in branching. Like the

h g - 1 knockout, endothelial cells overexpressing Ang-2 had a rounded morphology, and a

tendency to detach fiom the mesenchyme. Interestingly, the converse experiment has provided a

new inroad towards the treatment of ischemia, and other problems of circulation.

Overexpression of h g - 1 in skin results in an increase in vessel density. Unlike VEGF

overexpression, which results in long, tortuous vessels prone to leakage, vessels stimulated by

h g - 1 overexpression have increased lumen diameters, and are impervious to leakage induced

by severai reagents 73.74.

Current ideas on Ang-Tie activity suggest that h g 4 mediates interactions between

endothelial cells and periendothelial support cells through the Tie-2 receptor, acting as a

permissive rather than aa instructive signal in vascular remodeling. Ang-2 is thought to act

through Tie-2 as a destabilizing signal, possibly through antagonism of h g - 1 binding. In the

absence of VEGF, and the presence of hg-2 , vessels destabilize, and endothelial cells apoptose,

resulting in vessel regression. In the presence of VEGF, endothelial cells binding Ang-2 will

undergo sprouting angiogenesis, allowing the formation of new vessels. Through in vitro and in

vivo assays, the Tie-Ang pathways have been s h o w to mediate endothelial ce11 chemotaxis, ce11

survival/apoptosis protection, endothelial-ECM interactions, and stimulation of vessel

organization and sprouting. Given this diverse assortment of effects, how are the Angiopoietins

and Tie receptors involved in vascular patteming? Two examples are presented to examine bow

Angiopoietins and the Tie receptors pattern the vasculature in interssusceptive growth and

tumow angiogenesis 75.

While - --- many labs have studied the - formation A - p of branches through sprouting, and receptor-

mediated chemotaxis, it has long been known that large vessels cm have smaller vessels split off

to form new branches 2,596. This process, tenned interssusceptive growth is often overlooked in

reviews of vascular development. Micrograph analyses pioneered by Patan and others have

demonstrated that large sinusoidal vessels, such as the dorsal aorta have folds of tissue that grow

into the lumen of the vessel, and connect with the far wall6. Normal tissue folds, comprised of

an endothelial layer bounding periendothelial cells and bundles of collagen fibers, fuse with the

vessel endothelium, resulting in the formation of a new vessel. Micrograph analysis of the Tie-2-

" vasculature shows the formation of rudimentary tissue folds, comprised of rounded endothelial

cells, and a few scattered collagen fibers. Patan hypothesizes that these folds are unable to split

the vessel properly, resulting in fewer branches. Certainly the abnormal morphology of ~ie-2"'

tissue folds, and the previously documented observations that endothelial cells fail to interact

witb the periendothelium and extracellular matrix are consistent with this model. While more

work must be done in this area, it is intnping that endothelial-mesenchymal interactions,

mediated by the Tie-hg pathway may have a role in vascular patteming.

While much has been done to study Tie-Ang activity in embryonic development, studies on

tumour vascularization have also provided important insights as to the role of the Tie-Ang

pathway in the patteming of the vasculature. One widely held model of tumour development

stated that in early stages of tumour growth cells fulfill their metabolic needs through difision,

and are unable to grow past a certain size (c 1 mm3) without a more efficient system 70976. For

a tumour to grow past this stage, it must "switch on" a vascular response, often through the

expression of VEGF and other angiogenic factors 47977. At this stage, the tumour induces the

growth of host vessels to its margin, and is able to continue its growth. This model, pioneered by

Judah FouUnan has much experimental support, and is fundamental to many of the anti-

angiogenic therapies currently undergohg clinical trials.

While the Folkman model is useful for understanding the growth of tumours initiating in

avascular tissues, Yancopoulos et al. observe that many tumours form in well-vascularized areas

78. Through studies of rat glioma, human glioblastoma, and mouse lung carcinomas,

Yancopoulos et al. have shown that tumours arising in vascularized tissues c m CO-opt host

37

vessels, resulting in a "cuff' of tumour cells surrounding the host vessel 78.79. In response to

this CO-option ( n o h g that Ymcopoulos et al. do not speculate as to how endathelid ceils detect

CO-option), CO-opted host endothelial cells up-regulate Ang-2, dissociate from their smunding

periendothelial support cells, and apoptose. This vessel regression results in extensive tumour

necrosis, followed by robust angiogenesis at the tumour periphery due to the up-regulation of

angiogenic factors 80.

The observations that h g 2 upregulation can destabilize vessels bas provided an interesting

model for vessel growth. It is known that during embryonic development, Tie-2 is expressed in

endothelial cells from day 8.5, with Ang- 1 expressed stmngly in the myocardium nom day 9- 1 1,

and is later distributed in the mesenchyme surrounding the vessels 6396? In the adult, Tie-2 is

expressed at low levels throughout the vasculature, with Ang-1 detected in most vascularized

tissues 63. Ang-2, in contrast, is expressed in the smooth muscle cells, and possibly some of the

endothelial cells of the dorsal aorta and the hepatic vessels, arnong other sites. In the adult, Ang-

2 is expressed in the tissues that undergo vascular remodeling, namely the ovary, placenta, and

uterus. Studies of Ang-1 and Ang-2 expression in the rat ovary have shown a correlation

between Ang-2 expression and follicular angiogenesis 64978979.

Although questions arise as to the relevance of tumour angiogenesis to the development of the

embryonic vasculature, it is intriguing to think that Ang-1 and Ang-2 rnight act in opposition

during embryonic vascular development, as they seem to in adult angiogenesis. Do the changes

to the vasculature seen in normal and pathologie vessel remodeling recapitulate the process of

vascular patteming in the developing embryo? Does h g - 2 mediated vessel regression occur

during the development of the embryonic vasculature? Given the model that Tie-2/Ang

interactions affect the stability of a vessel through regulating endothelial-mesenchymaVmatrix

interactions, the Tie-2/Ang pathway provides another example of an extrinsic interaction that is

important in the patterning of the mammalian vasculature.

iii. Ephrin expression and vascular patteming

While the VEGF and Angiopoietin pathways undoubteàiy have a role in vascular

development, many other genes and pathways have been shown to be required for the correct

38 formation of the vasculature. Details of the activity of such genes in the endothelium, and their

PA -A --- -- potenti@ - - interactions -- established-pathways rqnah enigmatic. Certainly the discovery that

members of the EpWephrin family are required for correct vascular patteming has provided

interesting new ideas of how a vascular network can fom arteries and veins.

The Eph receptors comprise the largest known family of receptor tyrosine kinases; split into

A and B classes based on homology and binding, both the Eph receptors and the membrane-

bound ephrin ligands become phosphorylated upon ligand stimulated clustering, resulting in

reciprocal signalhg 81,82. In 1998, it was well known that ephrin/Eph interactions were

important in axon guidance, and neural crest ce11 migration. Additionally, some evidence had

shown that ephrins were involved in vascular development 81983. Despite this background, the

publication by Wang et al. demonstrating differential expression of and roles for ephrin B2, and

Eph B4 in vascular patteming came as a surprise to both the vascular and the ephrin communities

81984. Although it was known that the primary capillary plexus was formed, and some

angiogenic remodeling occurred prior to the commencement of circulation, it was commonly

held that the differences between arteries and veins were formed during later stages of

remodeling, due to hemodynamic and physiological constraints on the vasculature. The

observation that ephrin B2 was preferentially expressed in arteries, and Eph B4 was expressed in

veins suggested that differences between arteries and veins were genetically determined, and not

solely a matter of physiology. Furthemore, the study of targeted transgenic mice mutant for

ephrin 8 2 showed that the ephrin was requùed for the remodeling (but not the differentiation) of

the yok sac vasculature and head vessels, in addition to myocardial trabeculation. In discussing

their findings, Wang et al. postulate some mechanisms for the formation of capillaries through

cis or trans ephrin-Eph interactions, and speculate on an interaction between the ephrin and

augiopoietin pathways, but little was hown as to how the ephrins might pattern the vasculature

84.

Several observations published over the next year served to confuse the understanding of

ephrin-Eph interactions in vascular patterning. While Wang et al. were unable to see expression

of any other Eph receptors or ephrin ligands in the vasculature, other groups were able to detect

such expression 83985; differences in findings were attributed to differences in sensitivity

between in situ protocols. Adams et al. reported Ephrin BI, B2, and Eph B3 expression in

39

artenes, with ephrin BI, 83, and Eph 84 were expressed in veins 83. Transgenic rnice lacking

E @ L B ~ ~ d E p h B3 were f d to have variable cudi~vascdar defects (30% penetrance).

McBride et al. extended these fiadings to show that ephrin Al was present in several developing

vessels including the dorsal aorta, allantoic vessels, and veins in the head 85. Interestingly,

studies of the Xenopus vasculature demonstrated that while Eph B4 was expressed in the veins,

and ephrin BI and B2 in the arteries, no other Eph or ephnns could be found. Such a

discrepancy might be attributed to differences in species 86. Questions of Eph redundancy were

alleviated somewhat by the publication of the Eph 84 knockout mouse 87. Like the ephnn 82

knockout, embryos lacking Eph B4 die by day 10.5 with cardiovascular defects. While neither

the Eph B2-1-, or Eph B3 -1- embryos show vascular defects separately 83, Eph B4 -1- embryos

are unable to comectly remodel the vasculahue, resulting in dilated vessels, fused branches, and

incorrect remodeling of the antenor cardinal vein 87. Like the ephrin B2 mutants, Eph B4 have

defects in remodeling both arteries and veins, which were speculated to be a result of the loss of

bidirectional signaling, rather than simply a secondary defect due to abnormal blood flow.

m i l e the results of Adams and others have shown that several ephrins/Eph may be expressed

on, or in the vicinity of the vasculature, the observation of differential ephrin B2EphB4

expression on arteries and veins has been successfÙlly reproduced. Certainly the "symmetrical"

phenotypes of the ephrin B2 knockout, and the recently published Eph B4 knockout continue to

suggest an essential role for ephrin B2 and Eph B4 signaling in the development of the

vasculature. That said, much more work needs to be done to understand 1) how the ephrins are

differentially replated between veins and arteries, 2) what interactions occur in vivo to ensure

that "like" vessels fuse only with "like" when the uasculaîure is remodele4 and 3) how

differences in ephrin expression can result in the characteristic vesse1 wall structure and elasticity

observed for arteries and veins. In this way, the ephrins provide an interesting example of a new

pathway that is required for the patterning of the mammalian vasculature.

4. The hypoxic response in mammalian vascular development

Oxygen is essential for the survival of multicellular organisms; to this end, organisms have

evolved systems to monitor and maintain O2 homeostasis h m the systemic down to the cellular

level. In mammals, detection of hypoxia by O2 senshg centers in the carotid bodies leads to the

40

stimulation of heart and respiratory rate 30, the dilation or constriction of specific subsets of

vessels, ami the stimulation of erythrocyte production. In situations of acute or regional hypoxia, A

oxygen starved tissue stimulates the ingrowth of vessels 50. Hypoxic cells also upregulate a

number of genes to allow ATP generation through anaerobic respiration; hypoxia has also been

found to stimulate apoptosis 88. Given the vast array of responses produced by low oxygea, it is

important to understand what happens in a ce11 to mediate these responses. More critical to this

work, is the question of how hypoxia might be involved in the differentiation or patteming of the

vasculature. 1s there any evidence connecting hypoxia-response and the development of blood

vessels?

The fmt of the Hypoxia Inducible Factors (HIF-I), and hypoxia responsive elements (HREs)

were âiscovered by Gregg Semenui's group, over the course of their studies of erythropoietin

(EPO) regulation in the early 1990s 89. It was known that the levels of EPO mRNA and protein

were increased in many ce11 types under hypoxic conditions; electromobility shift assays

demonstrated the formation of new complexes on EPO DNA when incubated with hypoxic

nuclear extract 89-92. Deletion analysis identified a 256 bp elernent that was sufficient to confer

hypoxia responsiveness to a heterologous transgene 89. Further work narrowed down the

minimal hypoxia responsive element (HRE) to 50, and finally 18 bp 91993-95. Interestingly,

electromobility shift assays (EMSA) performed with Hep3B ce11 extracts demonstrated the

formation of hypoxia-inducible protein complexes on radiolabeled oligonucleotides containing a

wild type, but not a mutant element; scanning mutagenesis demonstrated that an 8 bp site was

required for hypoxia inducible protein binding 91. Later analyses demonstrated that hypoxia

responsive elements containing MF-1 bmding sites were present in the promoter, first intron, or

3' untranslated regions (UTR) of several genes, including PGK, LDHA, and ENO-1 52996.

Currently, more than 28 genes have been s h o w to contain an HRE, or to be down-regulated in

cells lacking HIF-1 huiction 3O. Most relevant to this thesis are the observations that VEGF,

VEGFR-1, Ang-2, and Tie-2 mRNA are upregulated in cells exposed to hypoxic conditions

51954,97-9? Furthemore, VEGFR-2 protein, but not mRNA may be increased in hypoxic cells

543559100. The fïnding that these major vascular genes are upregulated by hypoxia is suggestive

that hypoxia has a role in the formation of tbe vasculahire.

41 Our cumnt understanding of the hypoxia response element holds that the HIF-1 complex

binds to a conserved CGTGC motif, contactingthe four &ne residues 30; this HIF binding

site is necessary, although work described in this thesis shows that it is not always sufficient to

confer hypoxia responsiveness to a promoter. Certainly several groups have demonstrated

hypoxic induction of reporter constructs containing a wild-type, but not a mutant hypoxia

response element 529549101. Other studies suggest diat additional elements, or protein-protein

interactions may be required for some elements 52,102. While many groups have s h o w HRE-

mediated reporter activation by hypoxia, work descnbed in this thesis raises some serious

questions as to the specificity and sufnciency of HRE activity derived from different genes.

The HIF family of transcription factors were first identified by Gregg Semenza's group; HIF-

1 was found to be a heterodimer comprised of an a and a B subunit, both containing a basic

helix-loop-helix domain (bHLH) and a PAS domain (named for per-amt-sim, the first three

proteias to have this sequence motif). lo3. The p-subunit of this complex was found to be

ARNT, the ubiquitously expressed p-subunit to the Aryl Hydrocarbon Receptor (AHR) 104.

HIF-la was found to be a novel gene, containing oxygen sensitive degradation and activation

domains 309 1059 106. Under n o m x i c conditions, the HIF 1 a protein is rapidly ubiquitinated and

targeted for proteosomal degradation, through a von Hippel-Lindau (VHL) dependent pathway

107,108. On detection of hypoxia, HIF-la protein is stabilized, and undergoes an oxygen-

sensitive conformational change in the transactivation domain. Active HIF- la cari then bind

ARNT, and translocate to the nucleus where it binds to the HRE, and upregulates the

transcription of target genes. Some evidence suggests that HIF-1 may upregulate its own

transcription, but it appears that much of its specificity cornes from post-translational

modifications l. It is not known how HIF senses the level of oxygen in cells, althougb

there have been some suggestions that H E - l a might sense oxygen directly, either through

interactions with reactive oxygen species, or through conformation changes induced by low

oxygen 112. Other models propose cytochromes, or even entire mitochondria to be the cellular

oxygen sensors 113. Such models are pure speculation, however, with little, or conflicting

evidence to support them. It is not known how HF- la seases bypoxic conditions 1 12.

42 Since the identification of HIF-1, homology searches and binding studies have aided in the

discovery of other hypoxia-inducible- f ~ t o r s . Where HIF- l a and ARNT are expressed at low -? --

levels throughout embryo and adult, HIF-2a is highly expressed the vasculature, with low levels

of expression in the decidua 1 1491 15. HIF-3a has also been recently identified, and is expressed

in the adult thymus, kidney, h g , brain, and heart; it is not known where HIF-3a is expressed

during embryogenesis 1 16. Recently two additional ARNT homologues have been identified.

ARNT-2 is preferentially expressed in mesectoderm denved tissues, such as the CNS, while

ARNT-1 is seen to be at higher levels in mesendodenn derived tissues such as the gut, lungs, and

heart 1 1 5 9 1 17. Finally, Northem analyses of ARNT-3 show expression in the brain and skeletal

muscle 1 18. in his 1999 review, Gregg Semenza claims that any of the three a subunits could

heterodimerize with any of the three f3-subunits to form a fuactional transcription factor. While

over expression studies have s h o w that ARNT-3 can form a functional complex with HIF-1 a or

HIF-2a in vitro, it is not known if al1 of the possible combinations will fonn fùnctional dimers

1 18. Furthemore, it has yet to be shown if this apparent redundancy is relevant in vivo.

Interestingly, hypoxia-dependent protein binding has recently been shown to be present in

Drosophilu 1 199120. Shi la r (Sima), a bHLH-PAS protein with 63% homology to human HE-1

bas been proposed to mediate this activity 121. Activity studies of hypoxia-inducible simo

fusion proteins support this claim, as fusion proteins made with sima, but not with the related

trucheuless ( t h ) , or single-minded (sim) bHLH-PAS were responsive to hypoxia 121 3 1 22. In

confiict, Bacon et al. noted that antibodies raised against sima were unable to prevent hypoxia-

dependent complex formation 122. Studies of the Trh bHLH-PAS locus have also demonstrated

some interesting results 123,124. Although the Trh protein does not appear to have hypoxia-

inducible activity, it was able to bind to and activate a reporter containing the EPO hypoxia

response element 125. Ectopic expression of Trh or human HIFla was sufficient to induce the

formation of ectopic tracheal pits in flies. Clearly, M e r studies in Drosophilu may be useful

toward understanding the role of bHLH-PAS transcription factors in regulating the hypoxia

response.

Several pieces of evidence suggest a connection between the HIF pathways, as mediators of

hypoxic response, and the development of the vasculature. Targeted mutations in HIF-1 resulted

43 in mid-gestational embryonic lethality (1 0.5) characterized by prominent neural defects,

myocardial - - -a hyperplasia, and defects in both the embryonic and extraernbryonic vasculature

88,126,127, Sections of HIF-1" embryos showed massively enlarged neural vessels, with

dilated and disorganized capillaries. Embryos deficient in ARNT also exhibited lethality

coupled with defects in vascular remodeling 128. Like the HE-la '" embryos, ARNT "- were

able to differentiate endothelial cells, and produce a primary plexus, but are unable to form a

proper branched network 128. hterestingly, the severe defects observed in HIF-la, and ARNT

mice show that the other HF subunits are not able to completely compensate for loss of HIF-1

activity. Whether this is due to the observed differences in expression, or to differences in

function remains to be seen. hterestingly studies of teratocarcinomas formed by HIF- 1 a '", and

ARNT 4- ES cells show that tumours impaired in hypoxia response often have decreased

vascularization. 88, 127.

An intriguing connection between HIF activity and vesse1 development cornes from the study

of HE-2a. Independently discovered by four different groups, HIF2a is specifically expnssed

in the embryonic and adult endothelium 989 1 14, 12% 130. The original knock out analysis,

performed in C57B16/129Sv mice, demonstrated that embryos died up to, or shortly afier birth of

heart failure. Detailed examination of homozygous embryos showed no obvious defects in

vascular architecture; instead, the authors described statistically significant changes in heart rate

and blood flow due to defects in the organ of Zuckerkandl, and a corresponding reduction in

catecholamine synthesis 131. Furthemore, Tian et al. claimed that the addition of a

catecholamine precursor (DOPS) to the water of pregnant females was able to increase the

number of HE-2a -1- cmbryos that surviveà to tem. An independently targeted mutation

generated by G.-H. Fong's group resulted in a very different phenotype: ICW129Sv HIF-2a-/-

mice die by day 13.5 with vascular defects and hemmorhaging 132. Specifically, some areas of

the yok sac had areas in which sheets of endothelial cells failed to f o m tubes. A shidy of 129Sv

HE-2a homozygous embryos (derived fkom tetraploid aggregations of HE-2a -/- ES cells)

showed a more severe phenotype. In this background, mutant embryos died by day 12.5 with a

severely disorganized yok sac vasculature, and abnomal remodeling of the embryonic vessels.

Since both groups demonstrated successful inactivation of the HIF-2a gene, and absence of HIF-

2a protein in homozygous, but not heterozygous, or wild-type cells, Peng et al. speculated that

44 the conflicting results could be the result of strain-specific differences in genetic background.

While the vascular anomalies reported by Peng - a - et - al. seem to correlate with the phenotype of the

HIF-la knockout, the absence of vascular abnormalities reported by Tian et al. are a surprising

finding. Clearly M e r work will have to be done to understand the potential roles of HIF-2a in

the control of heart rate and vascular development.

III. Introduction to the experimental approach

While it has long been known that a fiinctioning cardiovascular system is essential for

survival of embryo and adult alike, several exciting findings have implicated vascular

abnonnalities with disease. It is becoming increasingly evident that changes to the expression or

fûnction of a vascular gene can result in chronic defects, (e.g. venous malformations observed in

patients with a mutation in the Tie-2 receptor) or serious pathologies developing later in life (e.g.

m o u r angiogenesis). Furthemore, it is clear that the correct genetic control of vascular genes

is essential to survival: the loss of a single copy of the VEGF gene is lethal in mice. Thus,

studies to dissect the genetic control of vascular genes may be useful towards understanding, and

ultimately treating the disease state. Given the evidence that several important vascular genes

are transcriptionally upregulated under hypoxic conditions, and the observation that embryos

impaired in hypoxic response have severe vascular defects, it is reasonable to hypothesize that

hypoxia has a role in the normal development, differentiation, or patteming of the embryonic

vasculahue. If this were the case, then one would predict that areas of hypoxia would occur

naturally over the course of embryonic development, and would roughly correlate with those

areas in which VEGF and other hypoxia-responsive genes were expressed. Later experiments

could then explore a functional role for hypoxia through the production of local areas of hypoxia,

or through the examination of vascular development under increased oxygen levels. For any of

these experiments to have relevance, the first step that must be taken is to examine if areas of

hypoxia occur naturally in a developing embryo.

Several experiwnts could be perfomed to study the areas of hypoxia in a developing

embryo. From a technical standpoint, the simplest approach would be to examine the in situ

hybridization patterns of VEGF, PGK, Ang-2, and other hypoxia-regulated genes. Theoretically,

areas of expression common to many such genes, as determined by hybridiziag serial sections,

could be due to hypoxia. There are certain disadvantages to this method; firstly, many genes

45 would have to be cornpared as it is not possible to differentiate areas in which a gene was

activated - - -- -- by hypoxia h m areas in which gene A- expression was regulated by other developmental

or environmental factors. Seconàly, if conditions of hypoxia occur transiently during embryonic

development, it may be difficult to identify consistent areas between embryos. Even if

consensus regions could be identified, such areas would have to be confinned through an

independent measurement of hypoxia.

A second approach that could provide useful information as to the areas of hypoxia in an

embryo is through the use of chemical marken. As discussed in Chapter 3, the nitroimidazole

compounds EF5 and pimonidazole are fiequently used in studies of tumour development, as they

form adducts on macromolecules in hypoxic but not normoxic conditions; immunohistochemical

analysis of adduct formation shows the areas of chemical hypoxia in the tissue 127,133-135.

hterestingly, chemical marken of hypoxia have been used by pathologists to assist in patient

diagnosis; discovery of hypoxic areas in tumours is often associated with a poor prognosis

134,136. Several advantages accompany the use of nitroimidazole compounds to study

embryonic hypoxia: firstly, the formation and detection of adducts is a well-established method

to examine areas of hypoxia in tissue. Secondly, adduct formation occurs without relying on a

particular biological pathway, allowing a truly general marker of hypoxia. Perhaps the strongest

argument for the use of nitroimidazole based compounds has arisen very recently, as Chen and

others have begun to use this technique to mark areas of hypoxia in the developing rat embryo

137. Of the methods which currently c m be used to examine areas of hypoxia in the developing

embryo, the use of chemical markers appears to be one of the most promising; the use of this

method will be discussed M e r in Chapter 3. At the time that this project was undertaken,

nitroimidazole based compounds had not been used in embryos, and the antibody for their

detection was not commercially available.

A third approach that could be taken to study the areas of hypoxia in a developing embryo to

use a hypoxia-sensitive reporter construct to produce transgenic mice. If a transgene could be

constructed that gave strong induction in al1 ceIl types under hypoxia, with littfe expression

under normoxic conditions, then embryos could be dissected and stained for hypoxic areas.

Mice carrying such a marker could be bred to some of the targeted vascular mutants, or available

tumow models to examine differences in vascular growth and remodeling relative to tissue

46 oxygenation. For such an approach to be usefil, it must be possible to find a general element

that can provide a quantifiable response - specificjily and exclusively to hypoxic conditions in al1

ce11 types. Later problems would requin the generation of hypoxia-responsive ES ceIl lines and

ultimately mice that are insensitive to transgene position effects. Embryos expressing a hypoxia-

responsive marker would also have to be compared between different lines, and with chernical

markers to c o d m bypoxia-specific expression.

To identify the areas of low oxygen that occur during embryonic vascular development, a

transgene was designed juxtaposing a hypoxia responsive element, containing an intact HIF-1

binding site, with a basal promoter and reporter. A basic Hsp Lac2 transgene was readily

available, and had been used by members of out lab and others to produce enhancer-ciriven

galactosidase expression 138-140. Other arguments recommending the Hsp Lac2 transgene

included the fact that the modified Hsp68 prornoter was off in most tissues of the embryo but

could be induced to high levels of expression 138. Additionally, studies using Hsp Lac2

transgenes c o d m e d consistent, faithful replication of the endogenous expression pattern 14*.

An Hsp LacZ ûansgene was used instead of a naturally occurring hypoxia responsive promoter

to minimize expression due to the presence and activity of other, non-hypoxia dependent

regulatory elements.

The mouse VEGF HRE was chosen to drive the Lac2 transgene for several reasoas. Firstly,

while much of the early work on HRE activity bad been performed using the EPO HRE, a

minimal VEGF element had recently been shown to be sufficient to confer hypoxic induction

ont0 a transgene, by the same criteria. Since the VEGF gene had been weli snidied in our lab, it

seemed like a reasonable starting point to make a hypoxia-responsive transgene. At that time,

the assumption was made that the EPO and VEGF HRE would be fÙnctionally equivalent; work

described in this thesis demonstrates that this is not the case. Secondly, at the time that this

project was undertaken, experiments performed on the minimal human VEGF HRE

demonstrated it to be sufficient to confer hypoxic induction onto a transgene, by the criteria

established for the EPO HRE 51352. 78% homology was detected between the 47 bp human and

mouse HREs, including 100% homology at the HIF-1 binding site and conserved 3' element

34952. For comparison, the same region of the rat VEGF gene had 82% homology to the human,

and 89% homology to the mouse VEGF HRE 52,141. Furthexmore, both human and rat VEGF

-*

47 HRE had been shown to confer hypoxia responsiveness to a transgene; while the sequence of the

--- 2 - - mouse VEGF promoter was available, no experiments had been performed with the mouse

A - - -

element 349529141. At the time the fust transgene was constmcted, the assumption was made

that the mouse VEGF HRE would be sufficient to impart hypoxia responsiveness to a transgene;

work described in this thesis suggests that this assumption may have been incorrect.

To examine the areas of hypoxia present during embryonic development, a transgene was

constructed, placing an HRE from the mouse VEGF gene in the context of an Hsp Lac2

transgene. After demonstrating that this transgene was not induced in cells exposed to hypoxia,

a cornparison was made between different elements and constructs to ask several questions: 1) 1s

an HRE sufficient to mediate a hypoxic response? 2) Are there differences in the activities

conferred by different hypoxia-response elements? 3) Can a construct be created to show

reproducible, consistent induction of reporter activity in R1 ES cells exposed to hypoxia?

48

IV. References

1; Sabùi, F. K. Shidies on tEie 05iiïio~ooif-vessek andof red blwd-corpuscles as seen in

the living blastoderm of chicks during the second day of incubation. Contr. Embry., Carnegie

Iwt. W d . 9,215-258 (1920).

2. Gonzalez-Crussi, F. Vasculogenesis in the chick embryo. An ultrastructural study. Am J

Anat 130,441460 (1 97 1).

3. Le Douarin, N. A biological ceIl labeling technique and its use in expermental

embryology. Dev Bi01 30,2 17-222 (1973).

4. Pardanaud, L., Yassine, F. & Dieterlen-Lievre, F. Relationship between vasculogenesis,

angiogenesis and haemopoiesis during avian ontogeny. Development 105,473-485 (1989).

5. Hirakow, R. & Hinuna, T. TEM-studies on development and canalization of the dorsal

aorta in the chick embryo. Anat Emb*yol166,307-3 15 (1 983).

6. Patan, S. TIEl and TIE2 receptor tyrosine kinases inversely regulate embryonic

angiogenesis by the mechanism of intussusceptive rnicrovascular growth. Microvasc Res 56, 1-

21 (1998).

7. Metzger, R. J. & Krasnow, M. A. Genetic control of branching morphogenesis. Science

284, 1635-1639 (1999).

8. Krasnow, M. A. Genes that control organ form: lessons from bone and branching

morphogenesis. Cold Spring Harb Symp Quant Bi01 62,235-240 (1997).

9. Pardanaud, L., Altmann, C., Kitos, P., Dieterlen-Lievre, F. & Buck, C. A. Vasculogenesis

in the early quai1 blastodisc as studied with a monuclonal antibody recognizing endothelial cells.

Dewlopment 100,339-349 (1 987).

10. Wagner, R. C. Endothelial cells embryology and growth. Adv. Microcirc. 9, 45-75

(1 980).

1 1. Dupin, E., Ziller, C. & Le Douarin, N. M. The avian embryo as a rnodel in developmental

studies: chimeras and in vitro clona1 analysis. Curr Top Da, Biol36, 1-35 (1 998).

12. Stern, C. D., Fraser, S. E., Keynes, R. J. & Primmett, D. R. A ce11 lineage analysis of

segmentation in the chick embryo. Dewlopment lM, 23 l-24î4 (1988).

13. Foikman, J. Toward an understanding of angiogenesis: search and discovery. Perspect

Biol Med 29, 10-36 (1 985).

14. Pardanaud, L. & Dieterlen-Lievre, F. Emergence of endothelial and hemopoietic cells in

the avian embryo. Anat Embryol (Berl) 187,107-1 14 (1993).

49 15. Pardanaud, L. & Dieterlen-Lievre, F. Does the paraxial mesoderm of the avian embryo

bave hemangioblastic capacity? Ana? Embryol @erI) 192,30 1-308 (1 995).

16. Pardanaud, L. et al. Two distinct endothelial Iineages in ontogeny, one of them related to

hemopoiesis. Development 122, 1363- 137 1 (1 996).

17. Pardanaud, L. & Dieterlen-Lievre, F. Manipulation of the angiopoietic/hemangiopoietic

cornmitment in the avian embryo. Development 126,6 1 7-627 ( 1 999).

18. Risau, W. & Flamme, 1. Vasculogenesis. Annu Rev Ce11 Dev Biol 11, 73-91 (1995).

19. Shilo, B. 2. et al. Branching morphogenesis in the Drosophila tracheal system. Cold

Spring Harb Symp Quant Biol62,241-247 (1997).

20. Affolter, M. & Shilo, B. Genetic control of branching morphogenesis during drosophila

tracheal development. Curr Opin Cell Bi01 l2,73 1-735 (2000).

21. Jarecki, J., Johnson, E. & Krasnow, M. A. Oxygen regulation of airway branching in

Drosophila is mediated by branchless FGF. Cell99,2 1 1-220 (1999).

22. Wappner, P., Gabay, L. & Shilo, B. 2. Interactions between the EGF receptor and DPP

pathways establish distinct ceIl fates in the tracheal placodes. Development 124, 4707-47 16

(1 997).

23. Steneberg, P., Hemphala, J. & Samakovlis, C. Dpp and Notch specify the fusion ce11 fate

in the dorsal branches of the Drosophila trachea. Mech Dev 87, 153- 163 (1 999).

24. Sutherland, D., Samakovlis, C. & Krasnow, M. A. branchless encodes a Drosophila FGF

homolog that controls tracheal ce11 migration and the pattern of branching. Cell87, 109 1- 1 10 1

(1 996).

25. Vincent, S. et al. DPP controls tracheal ce11 migration along the dorsoventral body axis of

the Drosophila embryo. Development 124,2741-2750 (1997).

26. Glazer, L. & Shilo, B. 2. The Drosophila FGF-R homolog is expressed in the embryonic

tracheal system and appears to be required for directed tracheal ce11 extension. Genes Dev 5,

697-705. (1991).

27. Reichman-Fried, M. & Shilo, B. 2. Breathless, a Drosophila FGF receptor homolog, is

required for the onset of tracheal ce11 migration and tracheole formation. Mech Dev 52,265-273

(1 995).

28. Lee, T., Hacohen, N., Krasnow, M. & Montell, D. J. Regulated Breathless receptor

tyrosine kinase activity requued to pattern ce11 migration and branching in the Drosophila

tracheal systern. Genes Dev 10,2912-2921 (1996).

50 29. Wolf, C. & Schuh, R. Single mesodemial cells p ide outgrowth of ectodennal tubular

smctures in Drosophila. Genes Dev 14,2 140-2 145 (2000).

30. Semenza, G. L. Regulation of mammalian 0 2 homeostasis by hypoxia-inducible factor 1.

Annu Rev Cell Dev Biol15,55 1-578 (1999).

31. Petrova, T. V., Makinen, T. & Alitalo, K. Signaling via vascular endothelial growth

factor recepton. Exp Ce11 Res 253, 1 17- 130 (1 999).

32. Neufeld, G., Cohen, T., Gengrinovitch, S. & Poltorak, Z. Vascular endothelial growth

factor (VEGF) and its receptors. Faseb J 13,9-22 (1 999).

33. Meyer, M. et al. A novel vascular endothelial growth factor encoded by Orf virus,

VEGF- E, rnediates angiogenesis via signalling through VEGFR-2 (KDR) but not VEGFR-1

(Flt-1) receptor tyrosine kinases. Embo J 18,363-374 (1999).

34. Shima, D. T. et al. The mouse gene for vascular endothelial growth factor. Genomic

structure, definition of the transcriptional unit, and characterization of transcriptional and post-

transcriptional regulatory sequences. J Biol Chem 271,3877-3883 (1 996).

35. Miquerol, L., Gertsenstein, M., Harpal, K., Rossant, J. ê: Nagy, A. Multiple

developmental roles of VEGF suggested by a LacZ-tagged allele. Dev Biol212,307-322 (1999).

36. Kendall, R. L., Wang, O. & Thomas, K. A. Identification of a nahiral soluble form of the

vascular endothelial growth factor receptor, FLT-1, and its heterodimerization with KDR.

Biochem Biophys Res Commun 226,3249328. (1 996).

37. Leung, D. W., Cachianes, G., Kuang, W. J., Goeddel, D. V. & Ferrara, N. Vascular

endothelial growth factor is a secreted angiogenic mitogen. Science 246, 1306- 1309 ( 1989).

38. Keck, P. J. et al. Vascular permeability factor, an endothelial cell mitogen related to

PDGF. Science 246, 1309- 13 12 (1 989).

39. Carmeliet, P. Mechanisms of angiogencsis and artcriogenesis. Nat Med 6, 389-395

(2000).

40. Carmeliet, P. et al. Abnomal blood vesse1 development and lethality in embryos lacking

a single VEGF allele. Nature 380,435439 (1996).

41. Ferrara, N. et al. Heterozygous embryonic lethality induced by targeted inactivation of

the VEGF gene. Nature 380,439442 (1996).

42. Shalaby, F. et al. Failure of blood-island formation and vasculogenesis in Fk- 1 -deficient

mice. Nature 376,62-66 (1995).

43. Fong, G. H., Rossant, J., Gertsenstein, M. & Breitman, M. L. Role of the Flt-1 receptor

tyrosine kinase in regulating the assembly of vascular endothelium. Naîure 376,66-70 (1 995).

44. Fong, G. H., Zhang, L., Bryce, D. M. & Peng, J. Increased hemangioblast commitment,

not - vascular disorganization, is the primary defect in flt-l knock-out mice. Developnrent 126,

30 15-3025 (1 999).

45. Hiratsuka,S.,Minowa,O.,Kuno,J.,Noda,T.&Shibuya,M.Flt-l lackingthetyrosine

kinase domain is suf'fïcient for normal development and angiogenesis in mice. Proc Natl Acad

Sci U S A 95,9349-9354 (1 998).

46. Fong, O. H., Klingensmith, J., Wood, C. R., Rossant, J. 8t Breimian, M. L. Regulation of

flt-1 expression during mouse embryogenesis suggests a role in the establishment of vascular

endotheliurn. Dev Dyn 207,l- 1 0 ( 1 996).

47. Plate, K. H., Breier, G., Weich, H. A. & Risau, W. Vascular endothelial growth factor is a

potential tumour angiogenesis factor in human gliomas in vivo. Nature 359,845-848 (1992).

48. Tufro, A. VEGF spatially directs angiogenesis during metanephric development in vitro.

Dev Bi01 227,558-566 (2000).

49. Cleaver, O. & Krieg, P. A. VEGF mediates angioblast migration during development of

the dorsal aorta in Xenopus. Developrnent 125,3905-39 14 ( 1998).

50. Shweiki, D., Itin, A., Soffer, D. & Keshet, E. Vascular endothelial growth factor induced

by hypoxia may mediate hypoxia-initiated angiogenesis. Nature 359,843-845 (1 992).

51. Liu, Y., Cox, S. R., Morita, T. & Kourembanas, S. Hypoxia regulates vascular

endothelial growth factor gene expression in endothelial cells. Identification of a 5' enhancer.

Circ Res 77,638643 (1995).

52. Forsythe, J. A. et al. Activation of vascular endothelial growth factor gene transcription

by hypoxia-inducible factor I . Mol Cell Bi01 16,4604-46 1 3 (1 996).

53. Levy, N. S., Chung, S., Fumeaux, H. & Levy, A. P. Hypoxic stabilization of vascular

cadotheliat growth factor d W A by the RNA-binding protein HttR. J Bi01 Chem 273,64 1 ?-6423

(1998).

54. Gerber, H. P., Condorelli, F., Park, J. & Ferrani, N. Differential transcriptional regulation

of the two vascular endothelial growth factor receptor genes. Flt- 1, but not Fk-IIKDR, is up-

regulated by hypoxia. J Biol C h 272,23659-23667 (1997).

55. Waltenberger, Jas Mayr, U., Pentz, S. & Hombach, V. Functional upregulation of the

vascular endothelial growth factor receptor KDR by hypoxia. Circulation 94, 1647-1654 (1996).

56. Dumont, D. J., Yamaguchi, T. P., Conlon, R. A., Rossant, J. & Breitman, M. L. tek, a

novel tyrosine kinase gene located on mouse chmmosome 4, is expressed in endothelial cells and

theu presumptive precursors. Oncogene 7,147 1 - 1480. (1 992).

52 57. Sato, T. Ney Qin, Y., Kozak, C. A. & Audus, K. L. Tie-1 and tie-2 define another class of

putative receptor tymsiqe kinase genes expressed in eqly embryonic vascular system [published - LA- - -- - -

erratum appears in Proc Natl Acad Sci U S A 1993 Dec l5;90(24): 120561. Proc Natl Acad Sci U

S A 90,9355-9358 (1993).

58. Dumont, D. J. et al. Dominant-negative and targeted nul1 mutations in the endothelial

receptor tyrosine kinase, tek, reveal a critical role in vasculogenesis of the embryo. Genes Dev 8,

1 897- 1909 ( 1994).

59. Partanen, J. & Dumont, D. J. Functions of Tiel and Tie2 receptor tyrosine kinases in

vascular development. Curr Top Microbiol Immun01 237, 159-172 (1999).

60. Jones, N. et al. Identification of TeWTie2 binding partners. Binding to a multifunctional

docking site mediates ce11 sumival and migration. JBiol Chem 274,30896-30905 ( 1 999).

61. Papapetropoulos, A. et al. Angiopoietin-1 inhibits endothelial ce11 apoptosis via the

Akt/survivin pathway. J Biol Chem 275,9 102-9 105 (2000).

62. Davis, S. et al. Isolation of angiopoietin-1, a ligand for the l'IE2 receptor, by secretion-

trap expression cloning. Ce11 87, 1 16 1 - 1 169 (1 996).

63. Suri, C. et al. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during

embryonic angiogenesis. Ce11 87, 1 17 1 - 1 1 80 (1 996).

64. Maisonpierre, P. C. et al. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in

vivo mgiogenesis. Science 277.55-60 (1997).

65. Valeimiela, D. M. et al. Angiopoietins 3 and 4: diverging gene counterparts in mice and

humaas. Proc Natl Acad Sci LI S A 96,1904- 1 909 (1 999).

66. Witzenbichler, B., Maisonpierre, P. C., Jones, P., Yancopoulos, O. D. & Isner, J. M.

Chemotactic properties of angiopoietin- 1 and -2, ligands for the endothelial-specific receptor

tyrosine kinase Tie2. JBfal Chem 273, I 8W- t852 1 (1998).

67. Hayes, A. i. et al. Angiopoietin-1 and its receptor Tie-2 participate in the regulation of

capillary-like tubule formation and survival of endothelial cells. Microvasc Res 58, 224-237

(1999).

68. Procopio, W. N., Pelavin, P. I., Lee, W. M. & Yeilding, N. M. Angiopoietin-1 and -2

coiled coi1 domains mediate distinct homo- oligomerization patterns, but fibrinogen-like domains

mediate ligand activity. J Biol C'hem 274.30 196-3020 1 (1 999).

69. Sato, T. N. et al. Distinct d e s of the receptor tyrosine kinases Tie-1 and Tie-2 in blood

vesse1 formation. Ndwe 376,70074 (1995).

53 70. Folkman, J. & D'Amon, P. A. Blood vessel formation: wbat is its molecular basis? Ce11

87,1153-1 155 u996).

71. Puri, M. C., Rossant, J., Alitalo, K., Bernstein, A. & Partanen, J. The receptor tyrosine

kinase TE is required for integrity and sumival of vascular endothelial cells. Embo J 14, 5884-

589 1 (1 995).

72. Partanen, J. et al. Ce11 autonomous fuactions of the receptor tyrosine kinase T E in a late

phase of angiogenic capillary growth and endothelial ce11 survival during murine development.

Development 122.30 13-302 1 (1 996).

73. Suri, C. et al. Increased vascularization in mice overexpressing angiopoietin-1. Science

282,468-47 1 (1998).

74. Thurston, G. et al. Leakage-resistant blood vessels in mice transgenically overexpressing

angiopoietin-1 . Science 286,251 1-25 14 (1999).

75. Yancopoulos, G. D. et al. Vascular-specific growth factors and blood vessel formation.

Nature 407,242-248 (2000).

76. Folkman, J. Tumor angiogenesis. A h Cancer Res 43, 175-203 (1985).

77. Fukumwa, D. et al. Tumor induction of VEGF promoter activity in stroma1 cells. Cell94,

7 15-725 (1998).

78. Holash, J., Wiegand, S. J. & Yancopoulos, G. D. New mode1 of tumor angiogenesis:

dynamic balance between vessel regression and growth mediated by angiopoietins and VEGF.

ûncogene 18,53564362 (1999).

79. Holash, J. et al. Vesse1 cooption, regression, and growth in tumors mediated by

angiopoietins and VEGF. Science 284,1994- 1998 (1999).

80. Boehm-Viswanathan, T. 1s angiogenesis inhibition the Holy Grail of cancer therapy?

Curr @in Oncol 12,89-94 (2000).

81. Yancopoulos, G. D., Klagsbrua, M. & Folkman, J. Vasculogenesis, angiogenesis, and

growth factors: ephrins enter the fray at the border. Cell93,66 1-664 (1 998).

82. Gale, N. W. & Yancopoulos, G. D. Growth factors acting via endothelial cell-specific

receptor tyrosine kinases: VEGFs, angiopoietins, and ephrins in vascular development. Genes

Dev 13, 1055-1066 (1999).

83. Adams, R H. et al. Roles of ephrlnB ligands and EphB receptors in cardiovascular

development: demarcation of arteriaVvenous domains, vascular morphogenesis, and sprouting

angiogenesis. Genes Dev 13,295-306 (1999).

54 84. Wang, H. U., Chen, 2. F. & Anderson, D. J. Molecular distinction and angiogenic

interaction between embryonic arteries a ~ d veins revealed by ephrin-B2 and its receptor Eph-B4.

Ce11 93,741-753 (1998).

85. McBnde, J. L. & Ruiz, 3. C. Ephrin-Al is expressed at sites of vascular development in

the mouse. Mech Dev 77,20 1-204 (1998).

86. Helbling, P. M., Saulnier, D. M. & Brandli, A. W. The receptor tyrosine kinase EphB4

and ephrin-B ligands restrict angiogenic growth of embryonic veins in Xenopus laevis.

Development 127,2690278 (2000).

87. Gerety, S. S., Wang, H. U., Chen, 2. F. & Anderson, D. J. Symmetrical mutant

phenotypes of the receptor EphB4 and its specific transmembrane ligand ephrin-B2 in

cardiovascular development. Mol Cell4,403-4 14 ( 1 999).

88. Canneliet, P. et al. Role of HE-lalpha in hypoxia-mediated apoptosis, ce11 proliferation

and tumour angiogenesis [published erratum appears in Nature 1998 Oct 1 ;395(67O l):52S].

Nature 394,485-490 (1998).

89. Semenza, G. L., Nejfelt, M. K., Chi, S. M. & Antonarakis, S. E. Hypoxia-inducible

nuclear factors bind to an enhancer element located 3' to the human erythropoietin gene. Proc

Nat1 Acad Sci U S A 88,5680-5684. (1 99 1).

90. Semenza, O. L., Koury, S. T., Nejfelt, M. K., Gearhart, J. D. & Antonarakis, S. E. Cell-

type-specific and hypoxia-inducible expression of the human erythropoietin gene in transgenic

mice. Proc Nat1 Acad Sci US A 88,8725-8729. (199 1).

91. Semeami, G. L. & Wang, G. L. A nuclear factor induced by hypoxia via de novo protein

synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional

activation. Mol Ce11 Bi01 12, 547-5454 (1992).

92. Wang, G. L. & Semenza, G. L. Characterization of hypoxia-inducible factor 1 and

regulation of DNA binding activity by bypoxia. J Biol Chem 268,2 15 13-2 15 18 (1 993).

93. Beck, L, Weinmann, R. & Caro, J. Characterization of hypoxia-responsive enhancer in

the human erythropoietin gene shows presence of hypoxia-inducible 120-Kd nuclear DNA-

binding protein in erythropoietin-produchg and nonproduchg cells. Blood 82,704-7 1 1 (1993).

94. Kvietikova, L, Wenger, R. H., Marti, H. H. & Gassmann, M. The transcription factors

ATF- 1 and CREB- 1 bind constitutively to the hypoxia-inducible factor- 1 (HIF- 1) DNA

recognition site. Nucleic AcidP Res 23,4542450 (1995).

95. Kvietikova, 1.. Wenger, R. H., Marti, H. H. & Gassmann, M. The hypoxia-inducible

factor4 DNA recognition site is CAMP-responsive. Kidney Inf 51,564466 (1997).

96. Semenza, G. L. et al. Hypoxia response elements in the aldolase A, enolase 1, and lactate

dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1. J - .=- -

Biol Chem 271,32529932537 (1996).

97. Yuan, H. T., Yang, S. P. & Woolf, A. S. Hypoxia up-regulates angiopoietin-2, a tie-2

ligand, in mouse mesangial cells. Kidney lnt 58, 19 12- 19 19. (2000).

98. Tian, H., McKnight, S. L. & Russell, D. W. Endothelial PAS domain protein 1 (EPASI),

a transcription factor selectively expressed in endothelid cells. Genes Dev 11, 72-82 (1 997).

99. Mandriota, S. J. & Pepper, M. S. Regdation of angiopoietin-2 mRNA levels in bovine

microvascular endothelial cells by cytokines and hypoxia. Circ Res 83,852-859 (1 998).

100. Shen, B. Q. et al. Homologous up-regulation of KDFUFlk-1 receptor expression by

vascular endothelial growth factor in vitro. J Bi01 Chem 273,29979-29985 ( 1 998).

101. Shibata, Tgy Akiyama, Ney Noda, M., Sasai, K. & Hiraoka, M. Enhancement of gene

expression under hypoxic conditions using fkagments of the human vascular endothelial growth

factor and the erythropoietin genes. Int J Radiut Oncol Biol Phys 42,9 13-5 16 (1998).

102. Kimura, H. et al. Identification of Hypoxia-Inducible Factor- 1 (HIF- 1) Ancillary

Sequence and Its Function in Vascular Endothelial Growtb Factor Gene Induction by Hypoxia

and Nitric Oxide. J Bi01 Chem 276,229292298 (2001).

103. Wang, G. L. & Semenza, G. L. Purification and characterization of hypoxia-inducible

factor 1. JBiol Chem 270, 1230-1237. (1995).

104. Wang, G. L., Jiang, B. H., Rue, E. A. & Semenza, O. L. Hypoxia-inducible factor 1 is a

basic-helix-loop-helix-PAS heterodimer regulated by cellular 0 2 tension. Proc Nat1 Acad Sci U

S A 92, 55 10-55 14. (1 995).

105. Jiang, B. H., Rue, E., Wang, O. L., Roe, R. & Semenza, G. L. Dimerization, DNA

biilding, aad tratisectivatioa properties of hypoxia- inducible fector 1. J Biol Chem 271, 1777 1 - 17778. (1996).

106. Salceda, S. & Caro, J. Hypoxia-inducible factor lalpha (HIF-lalpha) protein is rapidly

degraded by the ubiquitin-proteasome system under normoxic conditions. Its stabilization by

hypoxia depends on redox-induced changes. JBiol Chem 272,22642-22647. (1997).

107. Maxwell, P. H. et al. The tumour suppressor protein VHL targets hypoxia-inducible

factors for oxygen-dependent proteolysis. Nature 399,271-275 (1 999).

108. Cocbnan, M. E. et al. Hypoxia inducible factor-alpha binding and ubiquitylation by the

von Hippel-Lindau twnor suppressor protein. J Bi01 Chem 275,25733-2574 1. (2000).

56 109. Wenger, R. H., Kvietikova, I., Rolfs, A., Gassmann, M. & Marti, H. H. Hypoxia-

inducible factor- 1 alpha is regulated at the post-mRNA - - - level. Kidney Int 51,560-563 (1 997).

110. Iyer, N. V., Leung, S. W. & Semenza, G. L. The human hypoxia-inducible factor lalpha

gene: HIF 1 A structure and evolutionary conservation. Genomics 52, 159- 165 (1 998).

11 1. OIRourke, J. F., Tian, Y. M., Ratcliffe, P. J. & Pugh, C. W. Oxygen-regulated and

transactivating domains in endothelial PAS protein 1 : cornparison with hypoxia-inducible factor-

lalpha. J Biol Chem 274,2060-207 1 (1999).

1 12. Wenger, R. H. Mammalian oxygen sensing, signalling and gene regulatiun. J Exp Biol

203 Pt 8,1253- 1263 (2000).

113. Lando, D., Pongratz, I., Poellinger, L. & Whitelaw, M. L. A redox mechanism controls

differential DNA binding activities of hypoxia-inducible factor (HIF) lalpha and the HIF-like

factor. J Bi01 Chem 275,461 8-4627. (2000).

114. Ema, M. et al. A novel bHLH-PAS factor with close sequence similarity to hypoxia-

inducible factor lalpha replates the VEGF expression and is potentially involved in lung and

vascular development. Proc Natl Acad Sci U S A 94,427304278 (1997).

115. Jain, S., Maltepe, E., Lu, M. M., Simon, C. & Bradfield, C. A. Expression of ARNT,

ARNT2, HIFl alpha, HIF2 alpha and Ah receptor mRNAs in the developing mouse. Mech Dev

73, 1 17-123 (1998).

116. Gu, Y. Z., Moran, S. M., Hogenesch, J. B., Wartman, L. & Bradfield, C. A. Molecular

characterization and chromosomal localization of a third alpha-class hypoxia inducible factor

subunit, HIF3alpha. Gene Expr 7,205-213 (1998).

1 17. Hirose, K. et al. cDNA cloning and tissue-specific expression of a novel basic helix-loop-

belix/PAS factor (Amt2) with close sequence similarity to the aryl hydrocarbon receptor nuclear

translocator (Arnt). Mol Cell Bi01 16, t 706- t 7 13 ( 1996).

118. Takahata, S. et al. Transcriptionally active heterodimer formation of an Amt-Iike PAS

protein, Amt3, with HIF-la, HLF, and clock. Biochem Biophys Res Commun 248, 789-794

(1 998).

119. Nagao, M., Ebert, B. L., Ratcliffe, P. J. & Pugh, C. W. Drosophila melanogaster SL2

cells contain a hypoxically inducible DNA binding complex which recognises mammalian HIF-

binding sites. FEBS Lett 387, 16 1 - 166. (1 996).

120. Crews, S. T. Control of ce11 lineage-specific development and transcription by bHLH-

PAS proteins. Genes Dev 12,607-620 (1998).

57 121. Nambu, J. R., Chen, W., Hu, S. & Crews, S. T. The Drosophila melanogaster similar

bE&H-P-AS gene encodes a protejn related to buman hypoxia-inducible factor 1 alpha and - - - - - - - - -

Drosophila single- minded. Gene 172,249-254. (1 996).

122. Bacon, N. C. et al. Regulation of the Drosophila bHLH-PAS protein Sima by hypoxia:

hctional evidence for homology with mammalian HIF-1 alpha. Biochem Biophys Res Commun

249,811-816 (1998).

123. Wilk, R., Weizman, 1. & Shilo, B. 2. trachealess encodes a bHLH-PAS protein that is an

inducer of tracheal ce11 fates in Drosophila. Genes Dev 10,93- 102. (1 996).

124. Isaac, D. D. & Andrew, D. J. Tubulogenesis in Drosophila: a requirement for the

trachealess gene product. Genes Dev 10, 103- 1 17. (1 996).

125. Zelzer, E., Wappner, P. & Shilo, B. Z. The PAS domain confers target gene specificity of

Drosophila bHLH/PAS proteins. Genes Dev 11,2079-2089 (1 997).

126. Iyer, N. V. et al. Cellular and developmental control of 0 2 homeostasis by hypoxia-

inducible factor 1 alpha. Genes Dev 12, 149- 162 (1 998).

127. Ryan, H. E., Lo, J. & Johnson, R. S. HF-1 alpha is required for solid tumor formation

and embryonic vascularization. Embo J 17,3005-3015 (1998).

128. Maltepe, E., Schmidt, J. V., Baunoch, D., Bradfield, C. A. & Simon, M. C. Abnormal

angiogenesis and responses to glucose and oxygen depnvation in mice lacking the protein

ARNT. Nature 386,403407 (1997).

129. Flamme, 1. et al. HRF, a putative basic helix-loop-helix-PAS-domain transcription factor

is closely related to Liypoxia-inducible factor-1 alpha and developmentally expressed in blood

vessels. Mech Dev 63,5160. (1997).

130. Hogenesch, J. B. et al. Characterization of a subset of the basic-helix-loop-helix-PAS

supcrfkmily that interacts with cotqmnfilh of the dioxin signalhg pathway. J Biol Chem 272,

858 1-8593. (1 997).

131. Tian, H., Hammer, R. E., Matsumoto, A. M., Russell, D. W. & McKnight, S. L. The

hypoxia-responsive transcription factor EPAS 1 is essential for catecholamine homeostasis and

protection against heart failure during embryonic development. Genes Dev 12, 3320-3324

(1 998).

132. Peng, S., Zhang, L., Drysdale, L. & Fong, G. H. The transcription factor EPAS-

lhypoxia-inducible factor 2alpha plays an important role in vascular remodeling. Proc Nat1

Acad Sci US A 97,8386-8391. (2000).

58 3 3 Horsman, M. R. Measurement of -or oxygenation. Int J Rudiat Oncol Bi01 Phys 42,

701-704 (1998).

134. Raleigh, J. A., Dewhirst, M. W. & Thrall, D. E. Measuring Turnor Hypoxia. Semin

Radiat Oncol 6,3745 (1 996).

135. Marti, H. J. et al. Hypoxia-induced vascular endothelial growth factor expression

precedes neovascularization after cerebral ischemia. Ain J Pathol156,965-976 (2000).

136. Weidner, N. Angiogenesis as a predictor of clinical outcome in cancer patients. Hum

P ~ t h d 3 1,403-405 (2000).

137. Chen, E. Y., Fujinaga, M. & Giaccia, A. J. Hypoxic microenvironment within an embryo

induces apoptosis and is essential for proper morphological development. Teratology 60,2 15-

225 (1999).

138. Kothary, R., Perry, M. D., Moran, L. A. & Rossant, J. Cell-lineage-specific expression of

the mouse hsp68 gene during embryogenesis. Dev Bi01 121,342-348 (1987).

139. Kothary, R. et (il. Inducible expression of an hsp68-lac2 hybrid gene in transgenic mice.

Development 105,707-7 14 (1989).

140. Rossant, J., Zirngibl, R., Cado, D., Shago, M. & Giguere, V. Expression of a retinoic acid

response element-hsplacZ transgene defines specific domains of transcriptional activity duting

mouse embryogenesis. Genes Dev 5,1333- 1344 ( 199 1).

141. Levy, A. P., Levy, N. S., Wegner, S. & Ooldberg, M. A. Transcriptional regulation of the

rat vascular endothelial growth factor gene by hypoxia. J Bi01 Chem 270, 13333- 13340 (1 995).

142. Bellairs, R., and Osmond, M. The atlas of chick development. San Diego: Academic

Press (1998).

CHAPTER 2

THE CONSTRUCTION AND CHARACTERIZATION OF HYPOXIA RESPONSIVE

REPORTER GENES FOR USE IN TRANSGENIC MICE

1. Results % -

1. The VEGF HRE Hsp Lac2 transgene responds to heat shock but not bypoxia in R1 ES

ceüs

Annealed oligonucleotide concatarners containing three copies of the mouse VEGF hypoxia

responsive eletnent (HM) were cloned before a modified Hsp68 Lac2 tmsgene 192, (Figure 2-

1, Table 1). To detemine if the VEGF HRE Hsp Lac2 transgene could produce oxygen

concentration dependent fbgalactosidase activity, a transient expression assay was perfomed on

RI ES cells using constmcts containing the minimal Hsp Lac2 transgene, or a transgene

containing wild-type or mutated mouse VEGF HRE. Electroporated cells were divided into

three plates and exposed to 20% oxygen (room air), 1% oxygen, or a 42 O C heat shock, as

descnbed in the Materials and Methods. Plates were stained for fbgalactosidase activity, and fl-

galactosidase positive cells were counted. Figure 2-2 shows a summary of four replicate

experiments as a ratio of cells induced by hypoxia or heat shock relative to üninduced cells

cultured at 20% oxygen. In al1 experiments, higher levels of B-galactosidase activity were

detected in heat shocked cells than those kept at 37OC. No differences were observed in the

levels of B-galactosidase activity in cells grown at 20% and 1% oxygen with any HRE construct.

There was no evidence to suggest that the VEGF HRE Hsp LacZ construct could produce

oxygen-concentration dependent &galactosidase activity in Rl ES cells.

Several explmations could be made to account for this finding. As there was no construct

used in this experiment that did show oxygen dependent fbgalactosidase activity, it could be the

case that the low oxygen conditions that the cells were exposed to (1% for 40 hours) were not

sufficient to stimulate a hypoxic response in the R1 ES ce11 line. While there has been no work

published on the behavior of HRE transgenes in R1 ES cells, there is evidence to suggest that R1

ES cells are able to upregulate the transcription of HIF target genes in response to hypoxia; Ryan

et al. show that several genes including VEGF, are upregulated in R1 cells exposed to 1%

oxygen for 4-24 hours 3. Can R1 ES cells upregulate the expression of a transiently transfected

HRE transgene under these oxygen conditions? A second explanation for these hdings is that

the mouse VEGF HRE is not sufficient to confer oxygen-dependent responses to an Hsp Lac2

transgene. To examine these possibilities, and to m e r explore the use of HRE elements in

61 creating a hypoxia-responsive transgene, work was done to establish an in vitro system in which

- --.. - . oxygen-dependent changes in gene expression could be quantified.

Figure 2-1 : The VEGF HRE Hsp Lac2 transgenes

---- .-- - A.

Wild-Type VEGF HRE : agcttacacagtgcatacgtgggtttccacaggtcgtctcactccccgccaa

Mutated VEGF HRE: agcttacacagtgcataaaagggtttccacaggtcgtctcactccccgccaa

---- - - - Fig-2-1: A) Sepuence of the wild-tyge and mutated forms of the mouse VEGF hypoxia responsive element, with HIF- 1 consensus binding site in bold. B) Schematic diagram of

VEGF HRE Hsp Lac2 transgenes. Three copies of wild-type or mutated mouse VEGF

HRE were cloned into the Hind III (H) site 20 bp h m the start of the Hsp Lac2 cassette.

64 Table 1 : Oligonucleotide sequences and PCR pnmers used in the preparation of HRE containing

p & i Ï Ï a d e 1 ol'mber 1 Sequence

mVEGFWTHRE-F elements 1 1 1 ACGTTACACAGTGCATACGTGGGTTTCCACAGGTCGTCTCAC

mVEiGFWTfiRE-R

mVEGFMutHRE-F

mVEGFMutHRE-R

1

hEP0WTHR.E-F

TCCCCGCCAA AGCTITGGCGGGGAGTGAGACGACCTGTGGAAACCCACGTA

1

1

hEPOWTHRE-R

hEPOMutHRE-F

hEPOMutHRE-R

TGC ACTGTGTA ACGTTACACAGTGCATAAAAGGGTITCCACAGGTCGTCTCAC TCCCCGCCAA AGCTlTGGCGGGGAGTGAGACGACCTGTGGAAACCCTTlTA

3

mPGKWTHRE-R

TGCACTGTGTA AGCTTGATCGCCCTACGTGCTGTCTCAGATCGCCCTACGTGC

3

3

3

.. M-EPOPCR-F M-EPOPCR-R M-EPOPCR Kpiil-F M-EPOPCR EcoRV-R RV Primer 3 (pGL3) GL Primer 2 (pGL3)

TGTCTCAGATCGCCCTACGTGCTGTCTCAA AGCTITGAGACAGCACGTAGGGCGATCTGAGACAGCACGTA GGGCGATCTGAGACAGCACGTAGGGCGATCA AGCTTGATCGCCCTAAAAGCTGTCTCAGATCGCCCTAAAAGC TGTCTCAGATCGCCCTAAAAGCTGTCTCAA AGCTTTGAGACAGCTTITAGGGCGATCTGAGACAGCTfTTAG

3 GTCGTGCAGGACGTGACAA AGCTTTGTCACGTCCTGCACGACTGTCACGTCCTGCACGACT

PCR PCR PCR PCR PCR PCR

GTCACGTCCTGCACGACA AAAAAAAAAGCTTGCTAGCCCGGGCTCGA AAAAAAACTGCAGATGCAGATCGCAGATC AAAAAAGGTACCGCTAGCCCGGGCTCGA AGAAAGATATC ATGCAGATCGCAGATC CTAGCAAAATAGGCTGTCCC CTTTATGrr-1-rrGGCGTCl"TCCAT

65 Figure 2-2: The VEGF HRE Hsp Lac2 transgenes respond to heat shock but not hypoxia

-LA* A-& a- -

Relative induction of Hsp LacZ h s g e n e s in R I ES-cells exposed to reduced oxygen or heat shock conditions

Expenment

1 1 % Oxygen Hsp Lac2

2 Heat Shocked Hsp Lac2

4 Heat Shocked mVEGF WT H s p W

lConstruct ITreatment 1 Average IStd. Dev. 1 Hsp Lac2 Hsp LacZ mVEGF WT Hsp

,Lac2 mVEGF WT Hsp

1% Oxygen Heat Shock 1% Oxygen

mVEGF Mut Hsp LacZ

Heat Shock

1.66 15.70 1.52

1% Oxygen

0.62 0.53 1.43

22.72

mVEGF Mut Hsp [ ~ e a t Shock 17.15

6.26

8.27

1.35 0.97

Figure 66

2-2: Rl ES cells were transiently electroporated with Hsp LacZ transgenes containhg

wild-type, mutant, or no VEGF - -- H- trimer. Transfected cells were split between three

plates and incubated under normoxic (20% 0 2 , 5% CO2, 94% Ni, 37OC). hypoxic (1%

02, 5% COz, 94% N2,37OC), or heat shock conditions (20% 9 , 5 % C02,94% N2, 42OC)

as described in the Materials and Methods. Plates were stained for fbgalactosidase

activity, and the number of p-galactosidase positive cells determined for each condition.

Displayed are the average ratios calculated of 1%:20%, and 42OC:37OC for each

construct, fkom up to four replicate expenments. The induction of Hsp Lac2 by heat

shock is significantly different nom that by exposure to conditions of low oxygen (*

indicates ~<0.025. Stuclent's t-test).

67 2. The EPO EIRE can confer hypoxic expression to an SV40 Luciferase transgene in HeLa ceUs

A s w e y of the literature on hypoxia response shows that hypoxia responsive transgene

activity had been demonstrated in several ce11 lines, including HepG2, Hep3B, and HeLa. HeLa

cells were cbosen over R1 ES cells for the functional dissection of the HRE based transgenes for

three reasons. Firstly, transient transfection assays described in the literature showed that

hypoxic HeLa cells were able to mediate consistent, quantifiable induction of a given hypoxia-

responsive construct in transient transfection assays; no reports had been published on similar

assays perfomed in R1 ES 4-7. Secondly, HeLa cells were readily accessible and easy to work

with. Thirdly, a constmct was obtained that had been shown to mediate a hypoxic response in

transiently transfected HeLa cells 8, and could be used as a positive control (EPO n=4 SV40

Luciferase, Materials and Methods).

HeLa cells were transiently transfected with a constitutively expressed pgalactosidase

reporter (pBOS, Materials and Methods), and one of three constructs containiag CMV

Luciferase, SV40 Luciferase, or a constnict containing SV40 Luciferase preceded by four copies

of the EPO HRE (EPO (n=4)SV40 Luciferase, Figure 2-2, Materials and Methods). Transfected

cells were split to two plates and incubated under 20% or 1% oxygen. Cells were harvested, and

extracts assayed for fl-galactosidase and Luciferase activity. No differences in ce11 viability were

noted between samples incubated under 20% and 1% oxygen (data not shown); in this and al1

subsequent HRE-Luciferase experiments, CO-transfection of a constitutive $-galactosidase

expressing plasmid (pBOS) was used to normalize transfection efficiency and cell harvesting.

As shown in Figure 2-3 EPO (n=4)SV40 Luciferase consistently mediated 8-fold induction of

Luciferase activity in cells exposed to 1% oxygen relative to those exposed to 20% oxygen; this

is in agreement with previously reported findings (Figure 2-3) 9. Constnicts with either SV40 or

CMV Luciferase alone did not mediate hypoxic induction of Luciferase activity. These data

demonstrated that it is possible to observe and quantiv hypoxia-induced reporter activity in

transiently transfected HeLa cells; the oxygen conditions were sufficient to induce hypoxia-

responsive transgene ac tivity .

68 Figure 2-3: An EPO HRE SV40 Luciferase transgene can be induced by hypoxia in HeLa cells

. - ----- -- .- -

Induction of Luciferase activity in HeLa cells exposed to 1 % oxygen

1 2 3

Construct

1 SV40 Luciferase

2 EPO n=4 SV40 Luciferase

3 CMV Luciferase

Construct

SV40 Luciferase EPO n=4 SV40 Luciferase CMV Luciferase

Average Fold Induction 1.41 8.47 1 .50

Std. Dev.

0.54 3.98 0.39

n

11 19 6

- Figure - . 2-3: HeLa cells were transfected - with SV40 Luciferase, EPO n=4 SV40 Luciferase, or

CMV Luciferase and the consitutive fbgalactosidase expression vector pBOS.

Transfected cells were split between two plates, incubated under 1% or 20% oxygen,

harvested, and assayed for Luciferase/P-galactosidase activity as described in the

Materials and Methods. Luciferase and fLgalactosidase data fiom each 1%/20% pair was

used to calculate an induction ratio, by dividing the Luciferase activitylp-galactosidase

activity observed in cells grown under 1% by that of cells grown under 20%. Shown are

the average inductions over six to nineteen replicate experiments. EPO n=4 SV40

Luciferase gives significantly increased induction under conditions of reduced oxygen

compared with SV40 Luciferase and CMV Luciferase (***, p<0.0005, Student's t-test).

70 3. The EPO HRE can confer oxygeniensitive expression to an SV40 LacZ, but not an Hsp

LacZ based traasgeae - - - . -

Given the finding that the mouse VEGF HRE Hsp Lac2 tcansgene could not respond to

hypoxia in transiently transfected R1 ES cells, hvo questions were asked. Firstly, as it had been

demonstrated that three copies of the EPO HRE were sufficient to impart hypoxic inducibility to

a traasgene in HeLa cells, could the EPO HRE activate an Hsp Lac2 construct in HeLa cells

exposed to hypoxia? Secondly, could the EPO HRE mediate consistent, and measurable

activation of a LacZ based constmct?

To examine the effect of an HRE on the Hsp Lac2 reporter, a transgene was constmcted

placing four copies of the EPO HRE upstream of the Hsp promoter. (EPO (n=4) Hsp LacZ,

Materials and Methods) EPO HRE Hsp LacZ, or a constitutive &galactosidase were transiently

transfected with pSVLuc+ into HeLa cells, and incubated under 20% or 1% oxygen as described

in the Materials and Methods. As sbown in Figure 2-4, neither the constitutive Lac2 (pBOS),

nor the EPO HRE Hsp Lac2 gave significant increases in fbgalactosidase activity on exposure to

bypoxia. In al1 replicates, cells transfected in parallel with the EPO(n=4) SV40 Luciferase and

pBOS demonstrated significant induction (Figure 2-3).

To test whether lack of induction was due to the HRE or the particular promoter used, a

transgene was consûucted in which four copies of the EPO HRE and the SV40 promoter were

cloned before a Lac2 reporter. In al1 replicate experiments, cells transfected with the EPO HRE

SV40 LacZ, but not the SV40 Lac2 construct measurably induced LacZ activity under hypoxic

conditions (Figure 2-4).

71 Figure 2-4: The EPO HRE can activate the SV40 but not the Hsp promoter in hypoxic HeLa

-- - - cells

Activity of Lac2 transgenes in HeLa cells exposed to 1% or 20% oxygen

hEPO n=4 Hsp LacZ pBOS Construct

O Average 20% Average 1%

Activity of Lac2 transgenes in HeLa cells exposed to 1% or 20% oxygen

Average Average

Construct

Figure 2-4: A) A representative experiment in which EPO HRE Hsp LacZ or pBOS transgenes

were cotransfected with a constitutive Luciferase expression plasmid into HeLa cells.

Transfected cells were exposed to 1% or 20% oxygen, harvested, and assayed for p- galactosidase and Luciferase activity as described in the Materials and Methods. Bars

represent the absorbance for each construct averaged over two replicates after

standardizing for transfection and harvesting efficiency, using the Luciferase data. EPO

Hsp Lac2 activity was assayed in seven separate experiments; no evidence was found for

an oxygen-concentration dependent effect on EPO Hsp LacZ activity. Data shown are

fiom one of six replicate experiments. B) An experiment showing the activity of EPO

HRE SV40 LacZ, and SV40 LacZ transgenes in HeLa cells exposed to 1% or 20%

oxygen. As in A), p-galactosidase readings for 1% and 20% samples were standardized

for transfection and harvesting using the Luciferase data. Bars correspond to the average

absorbance of three replicates for each sample. (** indicates that activity under 1% and

20% oxygen is significantly different by Student's t-test, p<0.005.)

73 4. Minimal HREs from dlfterent KIF-1 target genes have diffennt responses in HeLa ceUs

exposed to low oxygen

Since the discovery of HIF-1, more than twenty-eight genes have been shown to be

upreguleted in hypoxic cells 10. Minimal hypoxia responsive elements have been identified in

some of these genes including the phosphoglycerate kinase (PGK-1) gene, the vascular

endothelial growth factor (VEGF), and the erythrocyte stimulating hormone erythropoietin

(EPO). As shown in Figure 2-5, many groups have demonstrated the sufficiency of these

elements to impart hypoxia inducibility on a transgene, although differences in experimental

conditions, reporter context, and ceIl lines make it impossible to compare them directly. Are

there differences between the activities of minimal HRE elements derived fiom different

sources?

To address this question constructs containing three copies of wild-type (wt) EPO, wt PGK,

wt VEGF, and mutated (mut) EPO HRE were cloned in consistent orientation and distance to an

SV40 Luciferase transgene. One of these constmcts, or a constitutively expressed SV40

Luciferase driven by the SV40 Enhancer @SVLuc+), was transiently transfected into HeLa cells

with a constitutively expressed bgalactosidase @BOS). As shown in Figure 2-6 the consûuct

containing three copies of the wild-type, but not the mutated EPO HRE was capable of mediating

4-fold induction of Luciferase activity. The construct containing three copies of the mouse

VEGF element gave variable activity, ranging fkom no induction in several cases, to 22-fold

induction on one occasion. (The average value is shown in Figure 2-6.) Neither the SV40

Luciferase, nor the CMV Luciferase demonstrated hypoxic induction. The addition of four or

three copies of EPO HRE, three copies of PGK HRE, three copies of VEGF HRE, or the SV40

enhancer produced significantly different inductions compared with that observed with SV40

Luci ferase alone @ varies from <0.0 1 (VEGF HRE), to <0.0005 (PGK HRE). The addition of

three copies of mutated EPO HRE produced no sipificant difference in induction when

compared with the SV40 Luciferase transgene. Sûikingly, the construct containing the wild-type

PGK element gave consistently higher induction than either the EPO H E or VEGF HRE

containing conshucts. (Figure 2-6: 52-fold compared with Cfold, and 9-fo ld) (p<0.0005).

Figure 2-5: An alignment of HRE elements used in the literatwe

GATCGCCCTACGTGCTGTCTCA GCCCTACGTGCTGTCTCA GCCCTACGTGCTGCCTCG

CCACAGTGCATACGTGGGCTCCAACAGGTCCTCTT ACACAGTGCATACGTGGGTTTCCACAGGTCGTCTCACTCCCCGCCAA

GATCCACAGTGCATACGTGGGCTTCCACAGAGCTC GTCGTGCAGGACGTGACA ACGCTGAGTGCGTGCGGGACTCGGAGTACGTGACGGA TCTTGGCAGGACGTGCTATGGGGGGCACACATAGAT

Source 11 Mouse EPO 0

Transgene 4 Copies in SV40

9

~ u c i ferase 3 Copies in SV40

Human IGFBPl

2 Copies in TK GH 1 Copy in TK CGT 3 Copies in Hsp68 Lac2 1 Copy in TK Luci ferase 3 Copies in TK GH 1 Copy in SV40 Luci ferase 1 Copy of 372 bp fragment of IGFBPl intron 1 in Hsp7O Luci ferase

CeU Llne Induction Reference Hep 3B 50 Fold 8

HeLa I 8-9 Fold

R1 ES None This thesis

PC12 1 2.8 Fold 1 13 1 Hep G2 18 Fold 1 1 Hep 3B 34 Fold 14

---- - - - F i p - - 2.5: A survey of the literature showed - @at - - HF& sequences have been identified in many different target genes; nine representative elements are shown with details as to the

transgene and ce11 line in which they were tested. HIF-1 consensus binding sites are

highlighted, aad the EPO, VEGF, and PGK elements that were used in this study are

marked with an asterix.

76 Figure 2-6: HREs from different sources confer different induction on SV40 transgenes in

---,---A - - .. hypoxic HeLa cells

SV40 Luciferase activity of HeLa cells under 1% and 20% oxygen

1 2 3 4 5 6 7 8

Cons truc t

1 ~ ~ 4 0 Luciferase ~EPO n=4 SV40 Luciferase

Ipsv Luc+ ~ ~ E P O n=3 SV40 Luciferase

1 SV40 Luciferase

2 EPO n=4 SV40 Luciferase

3 CMV Luciferase

4 pSVLuc+

5 hEPû n=3 SV40 Luciferase

6 hEPO mut SV40 Luci feme

7 mWGF n=3 SV40 Luci ferase

8 mPGK n=3 SV40 Luciferase

Average Fold Std. Dev. n Induction 1.41 0.54 1 1

77 Figure 2-6: HeLa cells were transfected with the constitutive fhgalactosidase expressing plasmid

pBOS, and an SV40 Luciferase - - - transgene. - -- Transfected cells were incubated under 1% or

20% oxygen, harvested, and assayed for fl-galactosidase activity. The Fold Induction

was calculated by taking the ratio of Luciferase activity to ~galactosidase activity for the

sample grown at 1% oxygen, and dividing it by the same ratio for the sample grown at

20% oxygen. Data are presented as the average fold induction for n replicate samples;

the EPO n=4 SV40 Luciferase, pSVLuc+, EPO (n=3) SV40 Luciferase, VEGF SV40

Luciferase, and PGK SV40 Luciferase constructs give statistically significant differences

in induction when compared with the SV40 Luciferase transgene (*, pq0.025, ** p <0.01;

***, p<0.0005). Data on the SV40 Luciferase, EPO n=4 SV40 Luciferase, and CMV

Luciferase are the same experiments shown in Figure 2-3.

78 5. HREs can confer hypoxic-inducibiiity on TK Lucifense and TK Lac2 transgenes in

HeLa c@s --2 .----

Although it was clear that the EPO and later PGK HRE constmcts could mediate SV40

Luciferase induction in hypoxic HeLa cells, preiimioary evidence suggested that EPO n=4 SV40

Luciferase showed no inducion in hypoxic R1 ES cells (Figure 2-9, and data not shown). This

finding was surprising as it was known that RI ES cells were capable of mediating HIF-1

induction of several target genes (including VEGF and PGK) 3. Data in the literature shows that

the SV40 promoter does not work well to drive transgene expression in embryonic

teratocarcinorna cells, so it was decided to look at HRE activity on a different promoter 16. The

TK promoter was chosen for three reasons: firstly, it had been used as a basis for several

transgenics; secondly, the minimal TK promoter could be activated in ES cells; finally, evidence

in the literature had demonstrated that HREs could activate the TIC promoter in transiently

transfected Hep G2 cells 1 1.

To examine the activity of different HREs on the TK promoter, constmcts containing three or

four copies of wt EPO, or three copies of mutant EPO, wt PGK, or wt VEGF HRE TK

Luciferase were CO-transfected with pBOS into HeLa cells. As shown in Figure 2-7, replicate

experiments normalized for transfection showed that constructs containing three copies of wt

EPO or wt VEGF resulted in 2.5-foid induction of Luciferase activity relative to the normoxic

level. While low, this induction was statistically different than that observed with the TK

Luciferase transgene alone (p~0.01, 0.025 respectively). The construct containing four EPO

elements produced 9-fold induction, while a construct with three PGK elements consistently

produced high levels of Luciferase activity, averaging 40-fold induction in cells exposed to 1%

oxygen relative to those grown under 20% oxygen. The induction observed for EPO (n=4) TK

Luciferase, and PGK TK Luciferase was also significantly higher than that of the minimal TK

Luciferase transgene (p<0.0005 for each). Neither the basic TK Luciferase, nor a TK Luciferase

with a mutated EPO HRE induced under hypoxic conditions (Figure 2-7, ~ ~ 0 . 2 5 ) . A

cornparison of the induction of the TK Luciferase traasgenes to that of the corresponding SV40

Luciferase traosgene shows that there is no difference between the induction of the SV40 or TIC

constnicts containing the PGK HRE, the mutated EPO HRE, four copies of the wild-type EPO

HRE, or no HRE (p ranges from 0.25-0.40). The traiisgenes containing three copies of the

79 VEGF or EPO HREs were statistically different fkom the SV40 Luciferase counterparts,

(p<0.025,0.005 - respective1 y), although the si gni ficance of this finding is unclear.

To confimi and extend these findings, a series of TK LacZ transgenes containing wild-type or

mutated EPO HRE, PGK HRE, or no element were transiently transfected into HeLa cells, and

assayed as descnbed previously. A representative expriment is shown in Figure 2-8. In al1

expenments, neither TK LacZ, nor mutated EPO HRE TK Lac2 showed significant differences

in 0-galactosidase activity in HeLa cells exposed to 1% or 20% oxygen. HeLa cells transfected

with PGK HRE TIC Lac2 showed consistently higher levels of $-galactosidase activity in cells

exposed to 1 % oxygen than the cells exposed to 20% oxygen (n=6,3 are shown in Figure 2-8).

Figure 2-7: HRE TK Luciferase traasgenes cm be induced h hypoxic HeLa cells

Activity of TK Luciferase transgenes in HeLa cells exposed to 1% and 20% oxygen

1 hEPO n=4 SV40 60.00 1 +** 1 Luciferase

3 hEPO n=4 TK Luci ferase

4 hEPO n=3 TK Luci ferase

5 hEPO mut TK Luci ferase

6 mVEGF n=3 TK Luci ferase

7 mPGK n=3 TK

I~onstruct l~verage Fold IStd. Dev. In 1

hEPO n=4 SV40 Luciferase

~IIEPO n=3 TK Luciferase 12.72 10.5 1 16 1

TK Luci ferase hEPO n=4 'MC Luciferase

~ ~ E P O mut TIC Luci ferase 1 1.40 10.38 16 1

Induction 7.07

ImVEGF n=3 TIC Luciferase 12.45 10.50 16 1

1.64 9.15

I ~ P G K n=3 TK Luciferase (42.23 11 3.40 16 1

4.0 1 4 0.52 2.65

4 9

81 Figure 2-7: TK Luciferase tnuisgenes were transfected into HeLa cells with the constitutive p-

galactosidase expressing plamid-pBOS as described in the Matenals and Methods. As in -

previous figures, data is s h o w as an average fold induction of n replicate samples.

ConstNcts containing four or three copies of wild-type EPO HRE, VEGF HRE, PGK

HRE, but not the mutated EPO HRE produced significantly different induction on

exposure to low oxygen conditions than TK Luciferase. (*, p <O.OS; ** p < 0.01; ***, p

<0.0005, Student's t-test.)

82 Figure 2-8: The PGK HRE TK Lac2 transgene can produce quantifiable induction of $9

---, .. =---- - - galactosidase activity in HeLa-celis

Activity of Lac2 transgenes in HeLa cells exposed to 1% or 20%

TK LacZ hEPO WT hEPO Mut mPGK WT TK Lac2 TK Lac2 TK Lac2

O Average 20%

H Average 1%

Construct

Fig-e 2-8: A representative experiment in which TIC Lac2 transgenes were transiently - - - - -

transfected into HeLa cells with a constitutive Luciferase expressing plasmid pSVLuc+.

As in other experiments, transfected cells were split into two plates and incubated under

1% or 20% oxygen, harvested, and assayed for p-galactosidase activity. Data are shown

as a pair of bars corresponding to the absorbance (measure of the p-galactosidase

activity) of the 20% and 1% averaged from three replicate transfections after

standardizbg for transfection and harvesting eficiency. Shown are the data fiom one of

two replicate experiments. (* indicates that the activity of the transgene is significantly

difiemit in cells exposed to 1 % and 20% oxygen, Student's t test, pe0.025)

84 6. BRE 'MC Luciferase and HIRE TK LacZ transgenes have different activities in R1 ES

cells - --- A

The original goal of this work was to examine the areas of hypoxia in the developing embryo

through the production of hypoxia-responsive transgenic mice. For this appmach to be

successful, a constmct must be identified that Oves strong, reproducible induction specifically

upon low oxygen, with little expression under normal oxygen conditions. (Further discussion of

what is "normal" oxygen in vivo occurs later in this chapter.) As one of the commonly used

methods of producing transgenic mice requires the production of stable ES ce11 lines, it was

important to determine if HRE-containing constmcts could mediate induction of Luciferase or

Lac2 activity in R1 ES cells exposed to conditions of low oxygen.

In the first experiment, TIC Luciferase constnicts containing three copies of wt EPO, wt PGK,

wt VEGF, mutated EPO, or no element, were electroporated into Rl ES cells. Electroporated

cells were split into two and exposed to normoxic or hypoxic conditions. As in previous

experiments, cells were harvested, and extracts assayed for Luciferase and fl-galactosidase

activity. As shown in Figure 2-9, PGK, but no other HRE mediated an increase in Luciferase

activity in hypoxic R1 ES cells (p<0.0005). The induction observed with the PGK construct is

sipificantly higher than that of either the TK Luciferase alone, or than that produced by wild-

type EPO, mutated EPO, or VEGF concatamers (p<O.OOS).

To detexmine if an HRE could mediate the hypoxic induction of LacZ activity in RI ES cells,

the transient transfection experirnent was repeated with the TK LacZ based constructs. As

described previously, coastmcts containhg wt PGK, wt EPO, mut EPO, or no elemnit with TK

LacZ were electroporated into R1 ES cells, split, and incubated under 20% and 1% oxygen.

Figure 2-10 shows a representative experiment standardized to the Luciferase activity for

transfection and harvesting efficiency. Although some samples of cells transfected with the PGK

TK Lac2 construct appeared to show differences in activity between the 1% and 20% samples,

~galactosidase activity was low in al1 samples, and no consistent differences were seen with any

of the TK Lac2 constmcts (Figure 2-10, and data not shown).

85 Figure 2-9: PGK but not EPO HRE TIC Luciferase transgenes are induced in hypoxic R1 ES cells

Actnrity ratio of TK Luciferase transgenes in R1 ES cells exposed to 1 % and 20%

1 2 3 4 5 6 7 Construct

1 hEPO n=4 SV40 Luci ferase

2 TK Luciferase

3 hEPO n=4 TK Luciferase

4 hEPO n=3 TK Luciferase

5 hEPO mut TK Luciferase

6 mVEGF n=3 TK Luciferase

7 mPGK n=3 TK Luciferase

Construct , ,hEPO n=4 SV40 Luciferase ,TK Luci ferase $EPû n=4 TK Luciferase *!PO n=3 TIC Luciferase ,!iEPO mut TK Luciferase rnVEGF n=3 TIC Luciferase mPGK n=3 TK Luciferase

Average Fold Induction 0.76 0.87 t0,78 0.85 0.77 0.99 3.24

Std. Dev.

0.18 0.47 .0.12 0.23 0.15 0.3 1 1 .O4

F i g i e 2-9: TK Luciferase transgenes were electroporated into RI ES cells, split into two - -L - 2 - - -

populations and incubated under 1% or 20% oxygen as described in the Materials and

Methods. Induction ratios (Fold Induction) was calculated fkom taking the ratio of the

Luciferase activity/ unit absorbance of cells grown under 1% oxygen to that of the cells

p w n under 20% oxygen. Data are presented as an average of n replicate transfection

experiments. (***, p <0.0005 by Student 's t-test).

87 Figure 2-10: The HRE TK LacZ ûansgenes do not induce fl-galactosidase activity in hypoxic R1

- - . P A L - - ES cells

Activity of TK LacZ transgenes in RI ES cells exposed to 1% or 20% oxygen

D Average 20% Average 1 %

pBOS TK LacZ hEPû WT hEPO Mut mPGK TIC Lac2 TIC Lac2 WT TK

Lac2

88 Figure 2-10: TK Lac2 transgenes were electroporated into RI ES cells with the constitutive

w - Luciferase expression plasmid pSVLuc+. Transfected cells were split into two

populations and incubated under 1% or 20% oxygen as described in the Materials and

Methoûs. Data are presented as a pair of bars corresponding to the average Absorbance

for constmct, after standardizing for transfection and harvesting efficiency. Shown is

representative data fiom one of three replicate experiments. No significant differences in

TIC LacZ activity were seen in cells exposed to 1 % or 20% oxygen.

89 7. The PGK HRE SV40 Luciferase haasgene shows the gnatest change in acthity between

- 10% and 1% oxygen -- -

As discussed previously, the intention behind this work was to identiQ the areas of reduced

oxygen concentration that occur in a developing embryo through the expression of an oxygen

sensitive transgene. In the work to this point, HRE transgene expression has been investigated

by cornparhg transgene expression in cells exposed to 20% oxygen (normal incubator

conditions), to that observed in cells exposed to 1% oxygen (low oxygen conditions). In the

literature these conditions are often referred to as nomoxic and hypoxic respectively, and are the

standard conditions under which much of the work on hypoxia responsive genes has been

performed 1,13,14. Recently, it bas been hypothesized that the definition of 20% oxygen as

"normoxic" is misleading, and that the average tissue oxygen concentration is around 6%. This

estimate seems to be supported by the historical findings of clioicians 17. Given this

information, and the requirement that the transgene have low basal levels of activity under

nonnal conditions of oxygen, how suitable is an HRE-based transgene for the examination of

tissue oxygenation?

As shown in Figure 2-6, of the HRE SV40 Luciferase constnicts tested, the PGK HRE SV40

Luciferase transgene consistently gave the bighest increase in Luciferase activity in hypoxic

cells, averaging 52 f 16 fold induction (n=8). To examine the effect of oxygen concentration on

transgene activity HeLa cells were traasfected witb the PGK SV40 Luciferase, the EPO (n=3)

SV40 Luciferase, or the basic SV40 Luciferase transgene; transfected cells were split into two

plates and incubated at 20% oxygen, or under reduced levels of oxygen (l5%, IO%, 5%, or 1%)

for 40 hours. After incubation cells were harvested and assayed for Luciferase or p- galactosidase activity as described previously. Standardized induction ratios were calculated for

each sample set (see Matenals and Methods for calculations); Figure 2-1 1 shows the average

induction as a fiuiction of oxygen concentration. Neither the EPO nor the PGK transgene

showed a significant increase in activity between 20% and 10% oxygen (p < 0.10). Beween

10% and 5%, cells transfected with PGK HRE SV40 Luciferase showed a signifiant increase in

Luciferase activity ftom 2.6 to 11 times the level at 20% (p < 0.005). The EPO(n=3) SV40

Luciferase shows little change in activity between 10% and 5%. Between 5% and 1%, the PGK

SV40 Luciferase transgene shows a M e r increase in activity, fiom 1 1 fold increase at 5% to 24

-- - 90 fold increase at 1%. (Both compared with the level of Luciferase at 20%, p < 0.005.) At 1%

---A - - - - oxygen concentration the EPO construct showed - a modest increase to 6 times the Luciferase

activity at 20%, but there were not suficient data to conclude that the observed increase was

statistically signi ficant (p < 0.25).

91 Figure 2- 1 1 : The HRE SV40 Luciferase ûansgenes show dose dependent responses to changes

- ------ in oxygen levels.

Induction of SV40 Luciferase transgenes under increasing oxygen concentration

Oxygen concentration

-t- SV40 Luciferase

4 E P O (n=3) SV40 Luci ferase PGK (n=3) SV40 Luci ferase

concentration L

SV40 Luci ferase SV40 Luciferase SV40 Luci ferase SV40 Luci ferase

PGK (n=3) SV40 Luciferase 0.15 -1.86 0.59 PGK (n=3) SV40 Luciferase 0.1 2.59 1 .O7

Average Fold Induction

EPO (n=3) SV40 Luciferase EPO (n=3) SV40 Luciferase EPO (n=3) SV40 Luciferase EPO (n=3) SV40 Luciferase

PGK (n=3) SV40 Luciferase 0.01 24.22 7.4 1

Std. Dev.

0.15 O. 1 0.05 0.01 0.15 0.1 0.05 0.0 1

1.18 0.53 0.77 0.85

0.29 0.20 I

0.22 0.24

1.23 0.57 0.97 -6.35

0.042 O-O

0.488 4.98

Figure 2-1 1: For each oxygen concentration Ci%, 5%: IO%, or 15%), three replicates of SV40 -

Luciferase, two replicates of EPO n=4 SV40 Luciferase, and six replicates of PGK (n=3)

SV40 Luciferase were CO-transfected with the constitutive fbgalactosidase expressing

plasmid pBOS into HeLa cells. Transfected cells were split into two populations, and

incubated under 20% oxygen, or a reduced oxygen concentration. As in previous

experiments, cells were harvested, and assayed for Luci ferase and fbgalac tos idase

activity. lnduction ratios were calculated and averaged between the replicate

measurements of a constmct for a given oxygen concentration, to produce an estimate of

the activity of the construct at a given oxygen concentration, relative to the activity of the

same construct at 20% oxygen. The data are presented as a graph of the average

induction ratios. The induction of PGK HRE SV40 Luciferase was significantly different

nom that of SV40 Luciferase at al1 oxygen concentrations tested.

93

II. Discussion -- 4.--Acoeaeesw BEF-1 binding site kaet aIw.yc suniCient tQ confer oxygem reopo~siveness

to a transgene

Several interesthg observations have been made through these experirnents. The fmt of

these is the surpriskg finding that a response element containing a consensus HIF-1 binding site

is not suficient to confer oxygen sensitive expression to an Hsp LacZ transgene in HeLa cells.

As show in Figure 2 3 , four copies of the minimal EPO HRE were sufficient to confer hypoxia

responsiveness to an SV40 Luciferase, and an SV40 LacZ transgene, but not to an Hsp Lac2

transgene in HeLa cells. Several possible explanations could account for these tindings. Of

these, two, the potential effects of chromatin structure, and the hypothesized role of secondary

structure on HRE activity, will be discussed in m e r detail.

One possible explanation for the observed difference in function may be attributed to the

chromatin structure of the heat shock loci. As described in a review by Wallrath et al., work

done on the Drosophika Hsp70 locus bas demonstrated that the binding of proteins to the GAGA

boxes prevents the formation of nucleosomes over the Hsp70 regulatory regions. This binding

allows the formation of transcription initiation complexes, but is not sufficient to stimulate the

subsequent movement of the polymerase for transcript elongation. 18. When cells are heat

shocked, Heat Shock Factors (HSFs) bind to heat shock response elements (HSEs) upstream of

the site of transcription initiation, interacting with the stalled polymerase complexes to permit

transcription. Alterations made to the chromatin structure prevent the formation of these

"preset" complexes, and reduce or eliminate heat shock induction 18-20, It is possible that HIF

binding to the EPO HRE is not sufficient to activate transcription at the stalled Hsp locus, or

even that local alterations in the chromatin structure prevent HIF-1 binding to the HRE. While

there is no reasoa to suspect that HE is less capable of activating stalled complexes at the Hsp

promoter than other transcription factors, it has not been determined if HIF can bind to the

stalled transcription complexes, or if that binding was sufficient for transcriptional activation. A

preliminary experirnent, such as an SI nuclease protection assay, might be useful to determine

the areas of protection and hypersensitivity on the EPO Hsp LacZ and Hsp Lac2 transgenes. 1s

the HRE accessible to proteh? Once the areas of protein binding were identified, it would be

interesthg to perform an in vitro binding assay, to M e r examine the interactions in EPO HRE

Hsp Lac2 transgenes. If the EPO Hsp Lac2 transgene is incubated with nuclear extract fkom

94 cells grown under 1% or 20% oxygen, are there differe-nces in the complexes formed? Can HIF-

1 bind to @ EPO HRE Hsp Lac2 transgene? -- - - -- - --

Interestingly, a recent paper by Tazuke et al demonstrated that two copies of a 372 bp

sequence containing the IGFBP-1 HRE could confer 30-fold induction ont0 an Hsp Luciferase

transgene in HepG2 cellsl5. M i l e the IGFBP-1 HRE used undoubtedly contains other

regulatory elements that could assist with transcription at the Hsp locus, the length of the element

results in a greater distance between the element and the Hsp promoter. Given the finding that

chromatin structure is an important mechanism of Hsp7O regulation, it is reasonable to propose

that altering the distance between a regulatory element and the "preset" chromatin domain might

affect element function. Given that the nucleosome is thought to contain 146 bp of DNA, the

addition of approximately 300 bp between the HRE and Hsp could be enough to shift the

element out of the nucleosome, and render it accessible to HIF. Along these lines, experiments

could be performed to examine the behavior of the minimal IGFBP-1 HRE in the Hsp Luciferase

transgene, or look at the behavior of the EPO or PGK elements at different positions with respect

to the Hsp Lac2 tmnsgene.

The idea that chromatin might be involved in the regulation of the Hsp promoter, and Hsp

based transgenes is not without precedent in the literature. The homeobox (Hox) genes are a

group of transcription factors that are essential for pattern formation in the developing

27,2 8 embryo. Unusually, these genes are clustered, and are expressed in a linear manner

proceeding fiom 3' to 5' over the spatial and temporal course of development. M i l e the

establishment of Hox expression is not well understood, it is thought that a cis acting repressor

element, located upstream of the complex prevents the promoters fiom premature activation.

Enhancer elements provide an additional level of control, by stimulating the expression of non-

repressed genes. Most imporîantly to this work is the hypothesis, described in a recent review by

Deschamps et al., that chromatia is important for the maintenance of Hox expression States. In

this model, the transition of expression fiom 3' to 5' Hox genes would occur in conjunction with,

or as a result of, the directional opening of the chromatin. As development progresses, the

chromatin would relax, resulting in the increasing availability of 5' genes for transcription. After

a time the chromatin was thought to "fieeze" the transcription state of the Hox cluster,

"propagating the memory" of the expression levels to fûture generations of cells. While much

95 mon work needs to be done to understand the role of chromatin in transcription regulation, the

A second explanation accounting for the insufficiency of an HRE to activate the Hsp

promoter lies within the concept of the "minimal" hypoxia response element. In the literature,

the term minimal is used to describe the smallest sequence identified by deletion or mutation,

that can confer an efiect ont0 an exogenous promoter. Of the elements used in this study, the

human EPO, and mouse PGK elements had been tested and met this cnteria. The mouse VEGF

element was not tested, but shared 83% homology with the minimal human VEGF HRE,

including 100% homology over the HIF-1 binding site and mrrounding sequence (Figure 2-5).

Despite these criteria, there are noticeable differences in the length and sequence composition of

the minimal elements (Figure 2-5). Given the finding that the EPO HRE can act on the SV40 but

not the Hsp promoter, it is possible that there are additional sequençe elements, or protein-

protein interactions in addition to the binding of HIF-1 which are required for the activity of the

element. Stated plainly, it is possible that the EPO HRE is not suffieient for transgene activity,

but has worked with a few transgenes because of the presence of other useful binding sites or

proteins that are in the vicinity of the promoter. The Hsp promoter, acting through a different set

of mechanisms does not have these interactions, and the HRE was not able to fimction. If this

idea were to be tested, a starting point would be to examine the areas in which proteins bind to

the Hsp promoter in vitro. A footprint analysis of protein binding to Hsp LacZ, EPO Hsp LacZ,

and EPO SV40 Lac2 using extracts prepared nom HeLa cells grown at 1% or 20% oxygen,

could be a useful fmt step in seeing what binding sites are occupied. It would be especially

interesthg to compare protein binding using extracts fiom cells incubated at 1% and 20%. Does

HIF bind to the EPO HRE Hsp Lac2 transgenes? What other promoters does this element work

with, (or not work with), and are there any similarities in promoter architecture or sequence?

While these experiments could provide interesting and usefbl data, it is important to note that

they use naked DNA, and would not be representative of nucleosome associated DNA in the

chromatin.

2, Hmoxia response elemem fro-rn dwerent sources have dinerent activities

A second interesting finding of this work is the observation that minimal HREs fbtn different

sources confer significantly different inductions to SV40 or TK based transgenes. Most

outstanding in these experiments is the activity of the PGK HRE. As shown in Figures 2-6 and

2-7, constructs containing the PGK HRE have significantly higher levels of induction than either

the base transgene or a transgene containing wild-type EPO or VEGF HRE elements. This

finding has no precedent in the literature; several groups have isolated minimal HREs from target

genes and shown that they can confer oxygen responsiveness to a transgene, but up to this point

no work has been done to compare HRE activity directly.

One possible explanation of these findings again returns to the definition of the "minimal"

hypoxia responsive element. As discussed above, it is certainly conceivable that hypoxia

responsive activity requires sequences outside the HRE. Given the differences in length and

sequence of the elements tested, it is also possible that the differences in HRE behavior stem

fiom the presence (or absence) of other regdatory regions within what has been defied as the

minimal element; such differences could alter the affmity of HIF-1 for the different HFtE

sequences. It is not clear at this time what would be the best experiment to test this idea.

Certainly, protein binding techniques such as footprinting analyses, or a crosslinking expenment

might give an idea of interacting proteins in extracts fiom cells grown under 20% and 1%

conditions. A comparison between matched constructs containing wild-type and mutated HRE

elements might give some interesting findings as to the protein activity on the element. This

said, it may be dificult to see differences due to the presence of "nonspecific" protein binding.

A better experiment might be to examine different elements in a functional assay, such as the

Luciferase assays descnbed here. Cornparisons between the activity of constnicts with wild-

type, mutated, or no HRE might reveal if there were an alteration in the level of transgene

activity in the absence of oxygen stimulation. A variation of this assay would be to keep an HRE

core sequence constant, and alter the 5' and 3' flanking elements. What sequences are

responsible for coderring the response differences?

A second possible explanation for the differences in HRE activity stems from the recent

suggestion that the formation of DNA secondary structures could be important to HRE function.

97 The formation of secondary structures was most recently proposed by Kimura et al. who

observed @at several hypoxia responsive elements have an auxiliary sequence 3' to the HIF - - - . --- - -

binding site 21. This sequence, a CAGGT motif had been reported previously by Semenza in

characterizhg the EPO element, and by Forsythe et al. in their work with the VEGF element

1,2122. In theu 2001 paper, Kirnuni et al. hypothesize that the (G/T) ACGTG sequence of the

HIF-1 binding site could form a hairpin secondary structure with the imperfect inverted repeat

CAGGT, provided by the hypoxia ancillary sequence (HAS). Mutation analysis of the VEGF

elements demonstrate that the alteration of either element, or the orientation/spacing of the

elements relative to one another significantly reduces the function of the entire HRE.

Furthermore, the sequence alignment reported by Kimura et al. shows that several previously

identified hypoxia responsive elements have similar auxillary sequences and spacing. As s h o w

in Figure 2-5, of the elements used here, only the VEGF element contains the auxiliary element

(CACAGGT). As in the paper by Kimura et al., this element forms a imperfect inverted repeat

with the HRE, and could conceivably assist in HRE activity. The EPO element used in these

concatamers lacked the awillary element; an examination of the EPO concatamer shows no

obvious candidates for secondary structure formation. Interestingly, while the PGK gene does

not have a consensus HAS, there are several small regions within the element that look as if they

could form secondary structures with the HIF-I binding site. Furthermore, an oligonucleotide

sequence compnsed of the PGK element, but not the EPO or VEGF elements appears to form a

stable secondas, structure when run on a denaturing polyacrylamide gel (data not shown). The

question of HRE activity will be discussed furiher in Chepter 3.

3. HRE transgene actMty is affected by the celiular context

One of the most striking findings of these experiments is the effect of the cellular

environment on the activity of an HRE based transgene. in the literatwe, the large number of

genes that have hypoxia response elements, coupled with the wide-ranging genetic and

physiologie reactions which occur when an organism is challenged with conditions of low

oxygen, suggested that hypoxia response was an organism-wide pathway that al1 cells could

undergo if necessary. While there is evidence to show that both the HeLa and the RI ES ce11

lines used in these experiments c m undergo a hypoxia response, the extent of induction of these

cells are very different. ûne example of the difference between the response of HeLa and RI ES

cells is shown with the PGK TK Luciferase transgene. While the PGK element mediated 40 fold

98 induction in HeLa cells, it only produced a 3 fold incnasc in activity in R i ES cells. This

difference canmt be accounted for solely on the basis of transfection efficiency, as both samples = - - d -

were standardized for ce11 number. Furthemore there is no evidence to suggest that background

levels of Luciferase activity are higher in either ceIl line (data not shown). The differences in

activity described in this paper could conceivably be attributed to species differences between

human (HeLa) and mouse (R1 ES) lines, but certainly the data in the literature shows that large

differences can occur even between a pair of human ce11 lines (e.g. Hep 3B and HeLa.) 9.

Why are there differences in HRE transgene activity between ce11 lines? One explanation for

this finding is based on the basal level of promoter activity within the different ceIl lines. Since

the efficiency of transfection is different between the two ce11 lines, it is possible that many

fewer cells are acquiring the HRE transgene, but those that have it are expressing it at a much

higher basal level. If the base level of traasgene expression were high, then one might expect to

see a reduced extent of hypoxic induction in cells, when compared to a population with the same

amount of hypoxic HIF activity, and a lower base level of expression. A second possible

explanation is that accessory transcription factors assist in activating hypoxia-dependent

transgene activity. If such an accessory factor were absent in hypoxic R1 ES cells, then one

might expect some level of transcriptional activation, since HIF-1 would be present in the cells,

but the level of activity would be lower than if HIF bound to the HRE in the presence of such a

factor. The converse could also have occuned: if a repressor were expressed in R1 ES but not in

HeLa cells, one might expect less induction to be seen in hypoxic ES cells than in their HeLa

counterparts. To examine these possibilities in M e r detail, it would be useful to test the

activity of the HRE constructs in other ce11 lines, especially those fkom mice, to see if there are

any other variations in expression. 1s the PGK HRE always active in producing a quantifiabte

hypoxia response? While it is impossible to test HRE transgene expression in every ce11 type, a

survey of transgene response in many different ceil types could give an estimate of the variation

that one might encounter over the different ce11 types of the embryo. An analysis of transgene

expression in stable lines of undifferentiated, and differentiated ES cells might also be usefùl to

assess the extent and consistency of HRE transgene behavior.

4. s- HRE - - transgene activity as a funcdon ofosygen - concentration

A fuial interesting result that was identified through this thesis work was the examination of

HRE transgene expression under a range of oxygen concentrations. In the literature, much of the

information on the minimal HRE sequences was obtained through pairwise cornparisons of

transgene behavior under conditions of "normoxia", defined as 20% oxygen (room air), and 1%

oxygen, or "hypoxia". While mmy of the ce11 lines used in such experiments are normally

cultured under 20% oxygen, such terms are misleading when considering the behaviour of the

hansgenes in vivo. Measurements in anesthetized mammals bave found that the average p02 in

the alveoli is 104 mmHg (1 3.6%), with an average of 95 mmHg (1 2.4%) in arterial blood, and 40

mmHg (5.2%) in venous blood. It has been reported that the normal intracellular p02 ranges

fkom 5 mmHg (0.65%) to 40 mmHg (5.2%), with a minimum of 1-3 mmHg (0.13% to 0.39%)

required for metabolism 23. Other groups report concentrations of 30-35 mmHg (4.5%) in the

hepatic veins, 20-30 mmHg (3.4%) in the renal cortex, and 18 mmHg (2.5%) in the cerebral

cortex z4. A consensus of 6% oxygen has been proposed as a reasonable working estimate of

tissue oxygenation in a healthy mamrnal 17.

Given this information, it was important to examine the behavior of the HRE based

transgenes over a range of oxygen concentrations relevant to physiologic oxygenation. To this

end it was decided to look at increments of 5% oxygen concentration to obtain an estimate of

transgene behavior between 20% and 1%. As shown in Figure 2-1 1, very little change in

Luciferase expression is observed between 20% and 10% in either the EPO or PGK based

transgenes. The majority of the change in PGK expression occurs at oxygen concentrations

between 10% and 1%, with a potentially greater increase between 5% and 1%; the change

detected in the EPO transgene occurred between 5% and 1%. Little change is observed with

either transgene between 20% and 10% oxygen. While M e r oxygen points would need to be

tested to better elucidate the HRE expression curve in HeLa, it is clear that the increase in

Luciferase activity occurs over a range that is physiologicaily relevant.

A survey of the work performed on HLF-1 expression and DNA binding activity appear to be

in at least partial agreement with the findings of this work. As reported in Jiang et al., HIF-1 is

expressed at low levels over much of the range fiom 20% to 6% oxygen, increasing

100

exponentially over the lower ranges, to a maximum at 0.5% oxygen 24. Given the limits of

oxygen concentration tesîed in-tbis-expriment,- it- is not possible b state that they correlaîe

exactly with the fmdings of Semenza's group (the increase in activity between 10% and 5% are a

point of contention), but it is not surprising that the expression of an HRE containing transgene

resembles the expression and activity of the HIF-1 transcription factor. To be able to clariQ this

point, M e r experiments would have to be performed to examine HRE activity under a finer

range of oxygen concentrations.

5. The use of HRE containing transgenes to detect amas of hypoxia response in vivo

While the original goal of this project was to identify the amas of low oxygen in a developing

embryo through the activity of a hypoxia responsive transgene, the unexpected finding that an

HRE coupled to Hsp LacZ was not sufficient to produce oxygen dependent Lac2 activity in RI

ES cells prompted the detailed examination of HRE activity in vitro. As described above,

several findings have been made that raise interesting questions as to the activity of an HRE in

hypoxic cells. First, the activity of an H M is dependent on its context, unlike the general

response element hiated at in the literature. Secondly, the minimal elements themselves have

some differences, the causes of which are as yet unknown, that result in differences in the extent

of hypoxic induction, under controlled conditions of ce11 type, culture, and hypoxic stress.

Thirdly, differences exist behkreen ce11 lines such that an element functional in one line may give

no detectable induction in another. Finally, the range of activity between HRE based transgenes

shows differences between elements, but generally occurs between 5% and 1%, a range in

agreement with the current data on tissue oxygenation and the HIF-1 activity curve.

From these data, it canwt be said that the development of hypoxia responsive transgenic mice

is impossible. Certainly, the consistently strong induction observed for the PGK TK Luciferase,

and PGK TIC Lac2 in HeLa cells shows that it is possible to obtain hypoxia driven reporter

activity in vitro using an HRE transgene. The induction curve produced for the HRE Luciferase

transgenes shows that the maximum induction of the transgene does occur over the

physiologically relevant region, suggesting that the transgene could produce the desired activity

under conditions of low oxygen, with low activity under nomoxia. These data show a

statistically significant, quantifiable difference in activity in cells exposed to 5% and 1% oxygen.

It is not known if such a difference wili be as noticeable in the qualitative anaiysis of expression

101 patterns for which the transgene was intended. Further refmement of the oxygen concentration

- c g including additional points between 10% and 1% might be useful to understanding the

activity of the transgene. Given the variation observed in vitro both within a ce11 line, and

between cell lines, it is impossible to predict how the transgene will behave in vivo until it is put

into the mouse and the expression pattern exarnined. The continued use of HRE based

transgenes in the development of oxygen responsive transgenic mice will be discussed in

Chapter 3.

m. Coaclusions

In an attempt to identiw the areas of low oxygen in a developing embryo, a transgene was

constructed that juxtaposed an HRE ont0 a basic Hsp LacZ gene. The surpishg behavior of the

VEGF Hsp LacZ constmct prompted a series of expenments to compare the behavior of HREs

from different sources on different transgenes. Although performed to examine, and identiQ a

transgene usefil for embryological studies, the work described here has provided new

observations on element-promoter interactions, useful to anyone interested in transgene design.

Equally important are the cornparisons of HRE behavior described here, which provide a new

avenue on which to study the mechanisms of hypoxia response.

103 IV. Materials and Methods

-

Construction of HRE transgenes

HRE concatamerization: 10pg each of an oligonucleotide pair (Table 1) was annealed in 0.5 M

Tris (pH 7.9, and 100 m M MgC12, by placing the reaction tube in boiling water and allowing it

to cool to room temperature. Annealed oligonucleotides were phosphorylated with T4

polynucleotide kinase as per the manufacturer's instructions (NEB). HREs were ligated into

pBluescnpt (Stratagene), and sequenced to determine orientation and direction. Al1 subsequent

constructs were sequenced to c o d m HRE-promoter correctness.

Wild-tye and mutant VEGF HRE Hsp LacZ: XhoI-PstI fragments containing a trimer of wild

type or mutated mouse VEGF HRE were ligated into the XhoI-Pst1 sites of Hsp LacZ 2.

Sequencing showed that HREs were in the reverse orientation relative to the Hsp promoter.

SV40 Luciferase: The SV40 Luciferase transgene (pGL3-promoter, Promega), CMV-Luciferase,

and the EPO n=4 SV40 Luciferase construct were the kind gifts of M.Ema 8 9 . EPO n=4 SV40

Luciferase contains four copies of the EPO minimum HRE 8. HRE sequence is shown in Table

1. The pSVLuc+ containing Luciferase under the control of the SV40 promoter and enhancer

(pGL3-Control, Promega) was a gifi of Jemifer Mitchell.

HRE SV40 Luciferase constructs: EPO (n=3) wt, EPO mut, and PGK wt SV40 Luciferase were

constmcted by ligating the KpnVEco RV hgment of HRE-pBluescript into Kpd-SmaI digested

SV40 Luciferase. VEGF HRE SV40 Luciferase was prepared by ligating the Xhol-Eco RV

hgment into SmaI-XhoI digested SV40 Luciferase, resulting in a construct with three copies of

the wild type mouse VEGF HRE in the forward orientation relative to the SV40 promoter.

EPO HRE HSD Lad: Tbe concatamer of fout human EPO elements was PCR amplified fiom

EPO n=4 SV40 Luciferase using the primers pl M-EPOPCR-F and p2 M-EPOPCR-R. 20 ng of

template was amplified in 1.5 m M MgCD, 10 rnM Tris, 50 mM KCl, 0.001% gelatin, 10 ng/pL

each primer, and 0.2 mM dNTPs. Template was denatured at 94°C for 5 minutes, followed by

30 seconds annealhg at 58OC, and 1 minute extension at 72OC. 24 cycles followed consisting of

30 seconds at 91°C, 30 seconds at 58T, and 1 minute at 72°C.

SV40 Lac2 and EPO HRE SV40 LacZ: The - - - >3 kb band nom NcoI-XbaI digested EPO HRE

(II=~) SV40 Luciferase or NcoI-XbaI digested SV40 Luciferase, was ligated to the 3 kb NcoI-

XbaI hgment fiom Hsp Lac2 to produce EPO HRE SV40 LacZ, and SV40 LacZ.

TK Luciferase: The completed TK Luciferase constnict was a gift of M.Ema. Briefly, the TK

Luciferase transgene contains a 213 bp TK p m o t e r inserted into the XhoI fragment of the

pGL3 vector backbone.

EPO W. EPO mut. and PGK wt HRE TIC Luciferase: KpnI-EcoRV fragments of the HRE

in pBluescript were ligated into KpnI-Smal of TK Luciferase.

EPO (n=4 wt. VEGF HRE TK Luciferase: For these constnicts the HRE containing region of

VEGF SV40 Luciferase, or EPO SV40 Luciferase was amplified using the Rvprimer 3, and M-

EPOPCR EcoRV-R primen. PCR conditions were as described above. PCR products were

digested with KpnI-EcoRV, purified through conventional gel extraction (Qiagen), and ligated

into KpnI-EcoRV digested TK Luciferase.

TK Lac2 and HRE TK Lac2 constructs: The 3 kb NcoI-XbaI band of Hsp LacZ was gel pwified

and ligated to the 2 3 kb band of TK Luciferase, and the EPO (n=3) wt HRE, EPO mut HRE,

PGK wt HRE containing constructs to produce HRE TK LacZ.

Control constmcts: A constmct expressing Lac2 under the pENL promoter @BOS) was the kind

gifl of M.Ema 899. A second constmct, containing GFP under expression of pCAGG promoter

has been described elsewhere*?

Ceii Unes, transfection methods and incubation conditions

HeLa cells were cultured on plastic in DMEM supplemented with 10% FCS (Causera),

passaging every two days as recommended by ATCC. R1 ES cells were grown on plates pre-

treated with 0.1% gelatin, in DMEM supplemented with 15% FCS (HyClone), 2mM L-

glutamine, 100 pM B-mercaptoethanol, 1 m M sodium pyruvate, 0.1 mM non-essential amino

105 acids, 50 p g / d penicillin/sûeptomycin, and 1000 U/mL LE. R1 ES cells were passaged every

HeLa cells were transfected with 10 pg of test construct and 10 pg of a constitutively

expressed control plasmid (e.g. pBOS, pSVLuc+, or GFP, as specified in the text) for each well

of a six well plate. Transfection was by the Calcium Phosphate method: 88 pL of DNA diluted

in 1110 TE was added LOOpL of 2 x HBS (5.95 g HEPES, 8.17g NaCl, 0.37g Na2HP0.4 in 500

mL W20. pH 7.05) 12 PL of ice-cold 2M CaC12 was added over a period of 30 seconds with

agitation. Transfection mix was added to fresbly changed media on 80% confluent HeLa cells,

and plates were incubated for 4 h o u at 37OC. Afier the incubation, cells were split between two

plates and incubated at 20% Oz, 5% C02, (nomxic) or 1% 0 2 , 5% CO*, 94% Nt (hypoxic) for

40 hours.

Rl ES cells were electroporated with 20 pg each of test DNA, and a constitutiveiy expressed

control26. After a 30 minute incubation on ice, cells were split into two plates and incubated for

40 hours under nomoxic (20% 02, 5% CO2) or hypoxic (1% 0 2 , 5% CO2, 94% N2) conditions.

The transient transfection experiments to test the VEGF HRE Hsp LacZ transgene were

performed prior to the construction or acquisition of the Luciferase constnicts. In this

experiment, cells were electroporated with 40 pg of Hsp LacZ, VEGF wt Hsp LacZ, or VEGF

mut Hsp LacZ. After 30 minutes on ice, cells were split to three plates. Afier one day of

incubation under nomoxic conditions, and the addition of fiesh media, cells were incubated for

2.5 hours in either nomoxic (20% 02, 5% COZ, 37OC), hypoxic (1% 02, 5% COZ, 94% N2,

37OC), or heat shock (20% 02, 5% CO2, 42OC) conditions. M e r the specified incubation period,

cells were fixed, stained for fbgalactosidase activity, and the p-galactosidase expressing cells

counted.

Luciferase and @-galactosidase assays - - - - -

Cells were hawested in 400 pL (6 well plate), or 900 pL (100mm plate) of Reporter Lysis

Buffet, and subjected to a single freeze-thaw cycle as recommended by the

mamûachuer(Promega). 1OpL of HeLa extract, or 5OpL of RI ES extract was assayed with 50

pL Luciferase Assay Reagent (Promega) for 10 seconds in a Lumat LB 9507 luminometer

(EG&G Berthold).

For the assay of p-galactosidase activity, 50pL HeLa, or 250pL of RI ce11 extract was added

to 200pL ONPG (4 pg/mL), and 950 pL X-Buffer (16.1 g NazHP04-7H20,5.5g NaH2P04-H20,

0.75g KCI, 0.25g MgS04-7H20, 2.7 mL p-Mercaptoethanol, to IL, pH 7.0). Reaction

mixes were incubated for 4 hours (HeLa), or 12 hours (R1 ES) at 37OC; samples were read on a

Beckman DU 530 spectrophotometer (Beckman Coulter), using assayed extract fiom GFP

transfected control cells as a blank,

HRE Luciferase data is presented as the induction of Luciferase activity observed in hypoxic

extract relative to that observed in an equivalent sample of cells exposed to nonnoxia.

Fold induction = (1 % Luciferasell % LacZ) / (20% Luciferasel 20% LacZ)

Statistical analyses were perfonned using Student's t test, with reference to the table of t values

located at http:l/www.statsofi.com/textbook/sttable.h~l.

HRE &galactosidase results are presented as graphs of representative experiments showing

the $-ptactosidase activity meamcl m 20% and 1% ceti extracts, standdzed far the cumber

of cells. Unlike the constitutively expressed B-galactosidase used with the HRE Luciferase

experiments, p-galactosidase activity produced by the HRE-Lac2 constructs is almost

undetectable in most 20% extracts. Conversely, some samples, such as the HeLa cells

transfected with PGK HRE Lac2 produce nearly undetectable levels of pgalactosidase activity

under 20% oxygen, and measurable activity from cells exposed to 1% oxygen. Because of the

low level of activity observed under 20%, the calculation of a ratio between 1% and 20% & galactosidase activity is meaningless, mathematically equating to -/O. It is not known if the low

level of B-galactosidase activity detected in 20% samples represents "no expression" of the

107 transgene under 20% oxygen, or if the spectrophotometric assay is simply not sufficiently

-A--- - - sensitive to detect a response.

in the experiment to look at the effect of oxygen concentration on transgene activity (Figure

2-1 l), HeLa cells were tramfected as described above with EPO (n=3) SV40 Luciferase, PGK

Luciferase, or SV40 Luciferase, and pBOS. Transfected cells were split equally to two plates,

and incubated under 20% and a reduced level of oxygen (15% Oz, 5% CO2, 80% N2), (10% 0 2 ,

5% CO2, 85% N2), (5% 02, 5% CO2, 90% N2), (1% 0 2 , 5% C02, 94% N2). Cells were

harvested, and extracts assayed for Luciferase and fbgalactosidase activity. Spectrophotometer

and Luminometer were blanked using matched samples prepared with GFP ûansfected cells. A11

samples in this experiment were assayed at the sarne time, using the same batch of Luciferase

Assay Reagent, ONFG, and p-galactosidase assay buffer. Measurements were standardized for

ceIl number, and average induction ratios calculated for each construct within an oxygen cohort.

Figure 2-1 1 shows a plot of the average induction ratio for each construct at each oxygen

concentration.

10s V. References - =

1. Forsythe, J. A. et al. Activation of vascular endothelial growth factor gene transcription

by hypoxia-inducible factor 1. Mol Ce11 Bi01 16,4604-46 13 ( 1996).

2. Kothary, R. et al. Inducible expression of an hsp68-lacZ hybrid gene in transgenic mice.

Developrnent 105,707-7 14 (1989).

3. Ryan, H. E., Lo, J. & Johnson, R. S. HIF-1 alpha is requiml for solid tumor formation

and embryonic vascularization. Embo J 17,3005-30 15 (1998).

4. Wenger, R. H., Kvietikova, L, Rolfs, A., Camenisch, G. & Gassmann, M. Oxygen-

regulated erythropoietin gene expression is dependent on a CpG methylation-fiee hypoxia-

inducible factor- 1 DNA-binding site. Eur J Biochem 253,77 1 -777 (1 998).

5. Kvietikova, I., Wenger, R. H., Marti, H. H. & Gassmann, M. The transcription factors

ATF- 1 and CREB- 1 bind constitutively to the hypoxia-inducible factor- 1 (HIF- 1) DNA

recognition site. Nucleic AcidF Res 23,4542450 (1995).

6. Kvietikova, L, Wenger, R. H., Marti, H. H. & Gassmann, M. The hypoxia-inducible

factor4 DNA recognition site is CAMP-responsive. Kidney Int 51,564466 (1997).

7. Gerber, H. P., Condorelli, F., Park, S. & Ferma, N. Differential transcriptional regulation

of the two vascular endothelial growth factor receptor genes. Flt-1, but not Flk-l/KDR, is up-

regulated by hypoxia. J Biol Chem 272,23659-23667 (1997).

8. Ema, M. et al. A novel bHLH-PAS factor with close sequence similarity to hypoxia-

inducible factor lalpha regulates the VEGF expression and is potentially involved in lung and

vascular development. P m Natl Acud Sci U S A 94,427304278 (1 997).

9. Ema, M. et al. Molecular mechanisms of transcription activation by HLF and HIFlalpha

in response tv hypoxia: their stabilizetion and redox signabindueed interaction with CBP/p300.

Embo J 18, 1905-1914. (1999).

10. Semenza, G. L. Regulation of mammalian 0 2 homeostasis by hypoxia-inducible factor 1.

Annu R a , Ce11 Dev Biol15,551-578 (1999).

11. Firth, J. D., Ebert, B. L., Pugh, C. W. & Ratcliffe, P. J. Oxygen-regulated control

elements in the phosphoglycerate kinase 1 and lactate dehydrogenase A genes: similarities with

the erythropoietin 3' enhancer. Froc Natl Acud Sci US A 91,6496-6500 (1994).

12. Liu, Y., Cox, S. Rey Monta, T. & Kourembanas, S. Hypoxia regulates vascular

endothelial growth factor gene expression in endothelial cells. Identification of a 5' enhancer.

Circ Res 77,638-643 (1 995).

109 13. Levy, A. P., Levy, N. S., Wegner, S. & Goldberg, M. A. Transcriptional regulation of the

rat vascular endothelial growth factor gene by hypoxia. JBiol Chem 270, 13333-13340 (1995). - - - -

14. Semenza, G. L. et al. Hypoxia response elements in the aldolase A, enolase 1, and lactate

dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1. J

Bi01 Chem 271,32529-32537 (1996).

15. Tanike, S. 1. et al. Hypoxia stimulates insulin-like growth factor binding protein 1

(IGFBP- i) gene expression in HepG2 cells: a possible mode1 for IGFBP-1 expression in fetai

hypoxia. Proc Nutl Acad Sci U S A 95, 10 1 88- 1 0 1 93. (1 998).

16. Nicolas, J. F. & Berg, P. in Teratocarcinornu Stem Ceils (eds. Silver, L. M., Martin, G. R.

& Stnck ld , S.) 467-497 (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1983).

17. Csete, M. in Great Lakes Mummalian Deveiopment Meeting (Toronto, 2001).

18. Wallrath, L. L., Lu, Q., Granok, H. & Elgin, S. C. Architectural variations of inducible

eukaryotic promoters: preset and remodeling chromatin structures. Bioessays 16, 1 65- 1 70.

(1 994).

19. Bevilacqua, A. & Mangia, F. Activity of a microinjected inducible murine hsp68 gene

promoter depends on plasmid configuration and the presence of heat shock elements in mouse

dictyate oocytes but not in hvo-ce11 embryos. Dev Genet 14,92402 (1993).

20. Peny, M. D., Aujame, L., Shtang, S. & Moran, L. A. Structure and expression of an

inducible HSP70sncoding gene f?om Mus musculus. Gene 146,273-278. (1994).

21. Kimura, H. et al. Identification of Hypoxia-Inducible Factor-1 (HIF-1) Ancillary

Sequence and Its Function in Vascular Endothelial Growth Factor Gene induction by Hypoxia

and Nitric Oxide. 3 Bi01 Chem 276,2292-2298 (2001).

22. Semenza, G. L. & Wang, G. L. A nuclear factor induced by hypoxia via de novo protein

syntiKsis binds to the buman erythropoietia geae enbancet at a site required fot traascriptiond

activation. Mol Cell Bi01 12,5447-5454 ( 1 992).

23. Guyton, A. C. Texbook of medical physiology (WB Saunders, Philadelphia, 1 99 1).

24. Jiang, B. Hay Semenza, G. L., Bauer, C. & Md, H. H. Hypoxia-inducible factor 1 levels

Vary exponentially over a physiologically relevant range of 0 2 tension. Am J Physiol 271,

C 1 172- 1 180. (1 996).

25. Hadjantonakis, A. K., Gertsenstein, M., Ikawa, M., Okabe, M. & Nagy, A. Generating

green fluorescent mice by gennline transmission of green fluorescent ES cells. Mech Dev 76,799

90. (1998).

110 26. Matise, M. P., Auerbach, W., and Joyner, A.L. in Gene targeting: a pructical approach

(ed. Joyner, A. L.) 10 1 - 132 (Oxford University Press, Oxford, 2000). --" - .+A-. - & -.. -

27. Deschamps, J., Van Den M e r , Esy Forlani, S., De Graaff, W., Oosterveen, T., Roelen,

B., and Roelfsema, S. Initiation, establishment, and maintenance of Hox gene expression paiterns

in the mouse. Int. J. Dm. Biol. 43,635-650. (1999).

28. Castelli-Gair, J. Implications of the spatial and temporal regulation of Hox genes on

development and evolution. h t . J. Dev. Biol. 42,43744. ( 1 998).

C W T E R 3

FUTURE DIRECTIONS

112

1. Summary -

ASpart oftoe work to Senti@ aieas ofredücedoxygen in a developing embryo, a transgene

was constnicted juxtaposing a hypoxia responsive element upstream of a minimal Hsp LacZ

transgene. Transient transfection assays of this constnict in RI ES cells showed no evidence of

&galactosidase induction, prompting a detailed examination of HRE behavior in viîro, as part of

the effort to develop a HRE based transgene suitable for the production of transgenic mice. A

survey of the literatrw showed that several minimal HRE sequences had been characterized, but

variations in transgene context and the choice of ce11 line prevented direct comparisons. To

better examine the question of HRE activity a series of matched transgenes were constnicted and

tested, allowing the examination of element behavior in a constant context. interestingly, it was

found tbat minimal elements have significantly different activities under constant conditions of

transgene context, ce11 type, and incubation conditions. Furthermore, the minimal HRE is not

always sufficient to drive promoter activity, even in cells that are capable of using the HRE in a

different transgenic context. Work presented here also shows that the choice of cell line also

affects the activity of an HRE based transgene. Finally, preliminary evidence suggests that at

least two of the HRE transgenes described here are active under the physiologically relevant

m g e of oxygen concentrations (1-10%) detennined for several tissues in vivo.

II. Future Directions

., - The work described here opens up several possible avenues of experimentation, of which

three will be discussed bere. Of these areas, two: the production of oxygen responsive transgenic

mice tbrough the optimizatioa of an HRE transgene, and the identification of areas of low

oxygen in a developing embryo, are as interesting and relevant as they were at the begiming of

this work. The third ana, the analysis of HRE structure and function, diverges fkom the rationale

underlying this investigation, but is no less relevant as an area of study arising fiom this work.

The funw directions discussed here are presented as the questions that could be addressed given

the work described in this thesis. This section is not intended to descnbe a contiguous group of

experiments that could lead to fùrther publications.

1. An examination of HRE structure and b c t i o n

While the major focus of this project has been to identim areas of low oxygen in a developing

embryo relative to the areas of vascular development and VEGF expression, the work described

here centers around the approach chosen: the development of a hypoxia responsive transgene to

be used in making transgenic mice. Several fhdings, especially the observation that HRE

elements confer different activities in a cornmon background of ce11 line and transgene context,

have raised new questions on HRE structure and function. in the literature, a minimal HRE has

typically been defined as the smallest sequence required to confer oxygen responsiveness to an

exogenous transgene; in practice the HRE is typically cornprised of a HIF- 1 consensus binding

site, and a small amount of flanking sequence 1-3. Recent papers have described the existence of

an additional element, and hypothesized that the formation of an HRE seconday stnicture might

be necessary for oxygen dependent binding activity 3 y 4 . It is clear that there is much more work

that needs to be done to dissect the function of the HRE, and the role that it plays in the hypoxic

activation of gene expression. Such work is relevant to both the tumour pathologist, and the

developmental biologist, as a mounting body of literature demonstrates the importance of

hypoxia-stimulated gene expression in physiologie and pathologic growth 5-8.

ûne of the most interesting hdings of this work has been the observation that elements from

different transgenes $ive different activities under conditions of low oxygen. Given the different

minimal elements that have been identifie4 it could k interesting to expand the study to hclude

114 additional elements, simply by constructing new HRE SV40 or TK based transgenes. How

consistent are the differences between the elements? Are there any conelations that cm be made - - - -

between element sequence/stnicture and activity? The hypothesis made by Kimura et al., that

secondary structures fonned at the HRE are important for the mediation of hypoxic response, is a

reasonable starting point to m e r examine the function of these elements 4. Does the strength

of an element correlate with its predicted ability to fom a secondary structure? If changes are

made to an element that are predicted to enhance or interfere with the putative secondary

structure, does one observe corresponding changes in the strengtb of the element? To begin

testing this idea, a non-denaturing gel could be used to test the propensity of an element to fonn

a secondary structure in vitro. Were this hypothesis correct, one might expect to see a stronger

element, like that of the mouse PGK gene migrate abnomally compared to scrambled sequences,

a mutated element, or a weaker element of the same length. Along similar lines, one could

produce mutated HREs predicted to enhance the putative secondary structure in a weak element,

or hinder the secondary structure in a strong HRE. These elements could then be placed in the

context of an exogenous transgene to look for differences in hypoxia-responsive activity, in

assays similar to those perfonned here. While these types of experiments look at the elements

outside of their natural context, they would be useful to dissect the sources of element

differences, and may even be useful to define an "optimal" HIE.

2. The optimization and implementation of an HRE based transgene

As discussed previously, a mouse expressing a hypoxia-responsive marker could be a

valuable tool for identifjmg areas of reduced oxygen concentration during both embryonic and

pathologie devetopment. Certahly the data obtained over the course of this work have shown

that it is possible to produce a transgene that produces alterations in activity when cells are

exposed to reduced levels of oxygen. Furthemore, preliminary data on the effect of oxygen

concentration on transgene activity suggest that an HRE based transgene has activity at oxygen

concentrations that are encountered in vivo. Finally, it has been shown that it is possible to

observe oxygen-concentration dependent reporter expression in R1 ES cells. Taken together,

these &ta suggest that an HRE based construct could be used to obtain stable lines of RI ES

cells carrying an HRE-based hypoxia nsponsive transgene.

115 Of the transgenes described here, the PGK TK Luciferase would appear to be the best

candidate -- to produce stable ES ce11 h e s , as it reproducibly gives quantifiable induction under

low oxygen conditions. While the Luciferase reporter gene is not frequently used in the

production of transgenic rnice, detection systems have recently been developed to allow the

imaging of living mice, while the detection of the Luciferase mRNA or protein could

theoretically be perfomed using immunohistochemistry or in situ hybridization 9 . It is not

known how the sensitivity of the Luciferase reporter compares with that of the more commonly

used fbgalactosidase or GFP transgenes in vivo; the availability of sensitive chernical assay that

can be used in screening ce11 Iines, coupled with the fact that the transgene is already consûucted

suggest that it is worth trying. Prior to the preparation of stable PGK TK Luciferase ce11 lines, it

would be important to prepare and test a matched construct containing a fom of the PGIC HRE

mutated in the HIF-1 binding site. One would expect that constructs containing a mutated

element would not have an increase in activity in cells exposed to reduced oxygen concentration,

since the HIF-1 transcription factor should not be able to bind to the HRE. Quantifiable

induction of the mutant PGK Luciferase would require m e r study of PGK HRE transgene

activation; if the mutant PGK element gave no induction under hypoxia, stable lines of ES cells

could be created using the wild-type and mutant TK Luciferase constructs.

One concem when generating stable lines of transgenic Rl ES cells is the possibility of

transgene integration into, or near the regdatory elements of an unrelated gene. Were such lines

to be used to produce transgenic mice, one would expect ectopic expression due to the site of

integration, in addition to, or even in lieu of the hypoxia-responsive expression conferred by the

transgene. Such an occurrence is fiindamental to gene trapping, but represents a complication in

observing hypoxia-specific transgene expression. in these cases, aithough Luciferase expression

would occur in hypoxic tissues, there would be no way of differentiating areas of low oxygen

fiom normoxic tissue that had Luciferase activity due to other transcriptional regulation. To

adâress this problem, two approaches could be taken. Firstly, the HRE-Luciferase constmct

could be flanked by insulating sequemes, such as that of the chick p-globin, or mammalian Alu

sequences 10911. Such a constmct has the advantage that it could be randomly integrated into

ES cells, or injected into blastocysts, allowing expression to be analyzed without creating

targeting vectors, and targeted cell-lines. However, such a method would allow no control of

copy number, nor of mutations generated by random iiitegration of the transgene. A second

116 approach, the targeted integration of the HRE Luciferase transgene into the HPRT locus would

allow -- better control over copy number A A and integration - site, and permit comparisons between

wild-type and mutant HRE mediated expression, while controllhg position efiects.

In either case, several expenments could be performed with lines of stable HRE TIC

Luciferase expressing cells. Although the transient expression assays have demonstrated PGK

TIC Luciferase hypoxic induction in undifferentiated ES cells, they tell nothing of the induction

in differentiated tissue. To address this question, stable lines of RI ES cells containing wild-type

or mutant HRE TK Luciferase, TK Luciferase, or no traasgene could allowed to differentiate

under different oxygen conditions. These embryoid bodies could then be assayed or hybridized

for Luciferase activity, allowing the examination of HRE TK Luciferase activity in many

different ce11 types exposed to nomoxic and hypoxic conditions.

If stable lines of HRE TIC Luciferase ES cells were made, and it was possible to obtain

gemline-expressing chimeras, it would be valuable to test the response of the transgene to

difierent oxygen concentrations. Transgenic embryos could be cultured under 1 %-6%, 10% or

20% oxygen and assayed, or hybridized for Luciferase expression. If the HRE could act on TK

Luciferase in al1 tissues, one would expect a generalized increase in Luciferase expression in

explants grown under artificially controlled hypoxic conditions. Furthemore, observations made

in explants grown under intermediate levels of hypoxia could provide some useful information as

to the sensitivity of the HRE TK Luciferase transgene.

The final, and perhaps most critical experiment tbat would have to be performed with HRE

TK Luciferase mice is (i detailed examination of the Luciferase expression pattern. Here, stage-

matched embryos from multiple lines would have to be compared to determine if a general

consensus pattern could be obtained. If multiple HRE TK Luciferase transgenes containing

different eiements were available, they would also have to be compared in tbis way; certainly

lines containing wild-type and mutant PGK TK Luciferase would have to be compared to

detemine regions of PGK-specific background expression. Most importantly, if a set of mice

were obtained with a consensus expression pattern produced between different lines, this

expression pattern would have to be compared with that produced by chernical markers of

hypoxia. Only then could HRE Luciferase transgenic mice be considered to be a usefûl marker

for hypoxia.

3. Identification - - of areas of hypoxia during normal embryonic development

While the development of a hypoxia-responsive transgenic mouse was an attractive approach

to examine areas of hypoxia in the developing embryo, work described in this thesis has s h o w

that it is a challenging rnethod, which will require m e r work to detexmine its feasibility. Over

the past decade tumour biologists have developed new approaches to assess the oxygen

concentration in tumour tissue. Among the most promising of these are the chemical markers

EF5 and pimonidazole 12. Like many of the nitroirnidazole based compounds, pimonidazole cm

be injected into a host and form adducts on macromolecules in cells exposed to conditions of low

oxygen. Comparisons of pimonidazole binding to other methods of oxygen concentration

determination show that very little pimonidazole binding cm be observed from 30 mmHg (3.9%)

to 10 mmHg (1.3%), but adduct formation increases exponentially when the oxygen

concentration is lower than 10 mmHg (1.3%) 1 3 ~ 1 ~ . Recently, two groups have published data

in which nitroimidazole-based compounds have been used to detect embryonic hypoxia in

developing rat and mouse embryos 15.16. Preliminary results show that hypoxic areas exist in

the neural tube, and neuronal mesenchyme, yolk sac, allantois, EPC, and extraembryonic

endodem of day 8.5-9.0 embryos. Examination of later staged embryos (9.5- 12.5) showed that

the neural tube, and head mesenchyme continued to have areas of hypoxia, in addition to the

intersomitic mesenchyme. By late stages of vascular development, many organs showed

hypoxic immunoreactivity, including the heart, liver, kidney, and gastrointestinal tract. 16. As

might be expected, HIFla and VEGF expression CO-localized with areas of hypoxia.

Further studies of embryonic hypoxia could prove to be most interesting, particularly an

extension of the study to include earlier stages. At what time is hypoxia first seen in the

embryo? Several possible experiments could be performed using the chemical marken of

hypoxia to obtain a better understanding of the areas of low oxygen in a developing embryo, as

well as to test if there is an effect of oxygen concentration on embryonic development. It would

be interesting to repeat the experiments of Lee et al. focussing on earlier stages in embryonic

development. Lee et al. remark that the yok sac appears to be hypoxic through much of its life

16. Are hypoxic areas present at the time of blood island formation? In earlier stages of

embryonic development, especiaily those pre-implantation, the embryo is thought to obtain much

118 of its oxygen nom diffusion. Are the embryos chemically hypoxic? These questions are

-especially relevant in the light of cent -work @at suggests that stem ce11 renewal is favored in

cells grown under reduced oxygea concentration, witb a bias toward differentiation pathways in

cells grown under increased, or "standard" (20%) oxygen concentrations 17.

A second set of experiments that could be performed in parallel would be to detennine if

there is a correlation between the concentration of oxygen in a developing embryo and the

number and extent of blood vessels that are formed. At this time there is a large (and growing)

set of data to suggest that oxygen concentration could be a regulator of vascular development. A

s w e y of the literature shows that oxygen concentration affects the expression of VEGF in a

large number of different ce11 lines. Additionally, there are papers that describe vascular

anomalies in embryos camed by mothers exposed to low oxygen, and two studies in which

pieces of embryonic heart and kidney were cultured under conditions of low oxygen 18-23. To

determine if there is an effect of oxygen on vascular development it would be useful to dissect

and culture matched pairs of embryos under different oxygen cwditions, and examine the

number and extent of vessels formed. Are there any significant differences in the vasculature in

explants grown at 1%, 6%, or 20% oxygen? It might also be interesting to examine the

production of blood islands in embryo culture. 1s there an effect of oxygen concentration on the

formation of blood islands in cultured embryos? Given that evidence exists that there are areas

of reduced oxygen concentration in an embryo, and that there are a number of pieces of data to

suggest that oxygen concentration has an effect on vascular development, these experiments

would be a step towards determining if oxygen c m have a d e in vascular developrnent. Should

there be a significant effect observed, fûrther work could be performed to dissect the source of

the effect.

Instead of assessing the areas of, and postulated effects of oxygen in embryonic development,

a third experirnent that could be perfonned is to use the pimonidazole reagent to dissect some of

the phenotypes observed in embryos mutated in genes important in vascular development. In the

papers characterizhg the knockout phenotype of several genes, the authors descnbe an intact,

and "normal" primary plexus, followed by '%ascular remodeling defects", and often embryonic

lethality 24,25. While many angiogenic mutants appear to have a normal primary capillary

plexi, it is not known if the vasculature hctions nonnally. The use of pimonidazole could be

119 one method of observing if there are defects in the function of the vasculature prior to the

--A - observed defects L - in vascular architecture; - % if such defects existed, one might expect an increase in

the level of pimonidazole activity relative to that of a stage matched, wild-type embryo due to

abnormal circulation and oxygen delivery. This would be a risky course of research, as it is

entirely possible that no sucb functional abnormalities exist, or even that variations between

pimonidazole binding in different individuals would make it impossible to Say with certainty if

there were a difference, but it is one idea that could be attempted using available technology to

dissect the formation of the vasculature during development.

III. Final Comments

--, ---a---- -- A -- - -

Over the course of this work, several interesting findkgs have raised questions on the

mechanisms of hypoxic regulation. In this thesis is presented the fmt data showing tbat minimal

hypoxia response elements coder significantly different inductions under standard conditions of

transgene context, incubation time/oxygen concentration, and ce11 line. Furthemore, work

presented in this thesis have demonsûated differences in HRE activity on the SV40, TK, and

Hsp68 promoters; these data show that a minimal element, containing a HIF-1 binding site, is not

always sufficient to confer hypoxia responsiveness on an exogenous promoter. Furthemore,

significant differences were found in both the pmsence and the extent of hypoxic induction

conferred by a transgene in HeLa, and R1 ES ce11 lines. Finally, preliminary data has been

assembled to demonstrate that two HRE Luciferase transgenes have activity under

physiologically relevant oxygen concentrations. Data presented in this thesis has provided new

and interesting information on the hypoxic response, which can only help in the mderstanding of

the genetic control of vascular development and differentiation.

121 IV. References

1. Semenza, G. L. Regulation of mammalian 0 2 homeostasis by hypoxia-inducible factor 1.

Annu Rev Cell Dev Bi01 15,55 1-578 (1 999).

2. Liu, Y., Cox, S. Rey Morita, T. & Kourembanas, S. Hypoxia regulates vascular

endothelial growth factor gene expression in endothelial cells. Identification of a 5' enhancer.

Circ Res 77,638-643 (1995).

3. Forsythe, J'. A. et al. Activation of vascular endothelial growth factor gene transcription

by hypoxia-inducible factor 1. Mol Cell Biol16,4604-46 1 3 ( 1 996).

4. Kimura, H. et al. Identification of Hypoxia-Inducible Factor4 (HIF-1) Ancillary

Sequence and Its Function in Vascular Endothelial Growth Factor Gene Induction by Hypoxia

and Nitric Oxide. J Biol Chent 276,2292-2298 (200 1 ) .

5. Carmeliet, P. et al. Role of HIF-lalpha in hypoxia-mediated apoptosis, ce11 proliferation

and tumour angiogenesis [published erratum appears in Nature 1998 Oct 1;395(6701):525].

Nature 394,485490 (1998).

6. Blancher, C. & Harris, A. L. The molecular basis of the hypoxia response pathway:

tumour hypoxia as a therapy target. Cancer Metastusis R a t 17, 1 87- 194 (1 998).

7. Maxwell, P. H. et al. The tumour suppressor protein MIL targets hypoxia-inducible

factors for oxygen-dependent proteolysis. Nature 399,27 1-275 (1999).

8. Holash, J., Wiegand, S. J. & Yancopoulos, G. D. New mode1 of tumor angiogenesis:

dynamic balance between vesse1 regression and growth mediated by angiopoietins and VEGF.

Oncogene 18,5356-5362 (1999).

9. Hasan, M. T., Schonig, K., Berger, S., Graewe, W. & Bujard, H. Long-terni, noninvasive

imaging of ngulated gene expression in living mice. Genesis W. 1 16- 122. (200 1).

10. Chung, J. H a y Bell, A. C. & Felsenfeld, G. Characterization of the chicken beta-globin

insulator. Proc Nat1 Acad Sci U S A 94,5750580 (1997).

1 1. Willoughby, D. A., Vilalta, A. & Oshima, R. G. An Alu element from the KI 8 gene

confers position-independent expression in transgenic mice. J Bi01 Chem 275,759-768 (2000).

12. Raleigh, J. A., Dewhirst, M. W. & Thrall, D. E. Measuring Tumor Hypoxia. Semin

Radiai Oncol 6,374 (1 996).

13. Raleigh, J. A., Chou, S. C., Arteel, G. E. & Horsman, M. R. Comparisons among

pimonidazole binding, oxygen electrode measurements, and radiation response in C3H mouse

tumors. Radiat Res 151,580-589. (1999).

122 14. Gross, M. W., Karbach, W., Groebe, K., Franko, A. J. & Mueller-Klieser, W. Calibration

of -m~so-@&tole label& by s@-@taymus mequement of oxygea tension and labeling density in

multicelluiar spheroids. Int J Cancer 61,567-573. (1995).

1 5 Chen, E. Y., Fujinaga, M. & Giaccia, A. J. Hypoxic microenvironment within an embryo

induces apoptosis and is essential for proper morpbological development. Teratology 60, 2 15-

225 (1999).

16. Lee, Y. M. et al. Determination of hypoxic region by hypoxia marker in developing

mouse embryos in vivo: A possible signal for vesse1 development. Dev Dyn 220, 175-186.

(2001).

1 7. Csete, M. in Great Lakes M m a l i a n Development Meeting (Toronto, 200 1).

18. Tufio, A. VEGF spatially directs angiogenesis during metanephnc development in vitro.

Dev Bi01 227,5580566 (2000).

19. Grabowski, C. T. & Paar, J. A. The tenitogenic effects of graded doses of hypoxia on the

chick embryo. Arnerican Journal o/Anatomy 103,3 13-347 (1958).

20. Ingalls, T. H., Curley, F. J. & Prindle, R. A. Anoxia as a cause of fetal death and

congenital defect in the mouse. Am. J. Dis. C M 80.34-45 (1950).

21. Ingalls, T. H., Tedeschi, C. G. & Helpem, M. M. Congenital malformations of the eye

induced in mice by materna1 anoxia. Am. J. Ophth. 35, 3 1 1-329 (1952).

22. Tedeschi, C. D., Ingalls, T.H. Vascular anomalies of mouse fetuses exposed to anoxia

during pregnancy. Am. J. Obstet. Gynecof. 71,1628 (1 956).

23. Stone, J. et al. Development of retinal vasculature is mediated by hypoxia-induced

vascular endothelial growth factor (VEGF) expression by neuroglia. J Neurosci 15,4738-4747.

(1995).

24. Xue, Y. et al. Embryonic laliality and va~cular defects in mice lacking the Notch ligand

Jaggedl. Hum Mol Genet 8,723-730 (1999).

25. Adams, R. H. et al. Roles of ephrinB ligands and EphB receptors in cardiovascular

development: demarcation of arteriavvenous domains, vascular morphogenesis, and sprouting

angiogenesis. Genes Dev 13,295-306 (1 999).