ConstitutiveCholesterol-dependentEndocytosisof ...the function of the receptor. In this respect, prolonged expo-sure to -MSH promotes its localization to lysosomes (15). Moreover,

Constitutive Cholesterol-dependent Endocytosis ofMelanocortin-4 Receptor (MC4R) Is Essential to MaintainReceptor Responsiveness to �-Melanocyte-stimulatingHormone (�-MSH)*□S

Received for publication, January 27, 2012, and in revised form, April 19, 2012 Published, JBC Papers in Press, April 27, 2012, DOI 10.1074/jbc.M112.346890

Faith K. McDaniel‡1, Brent M. Molden‡1, Sameer Mohammad‡, Giovanna Baldini§, Lakisha McPike‡, Paola Narducci§,Susana Granell‡2, and Giulia Baldini‡3

From the ‡Department of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, Arkansas72205 and the §Dipartimento Universitario Clinico di Biomedicina, Universita degli Studi di Trieste, Trieste 34100, Italy

Background:MC4R is essential for energy homeostasis and cycles continuously.Results:MC4R internalization is blocked by clathrin and cholesterol depletion, reducing receptor response to �-MSH, which ispartially recovered by mutations at Thr-312/Ser-329.Conclusion: Constitutive internalization of MC4R is cholesterol-dependent and required for receptor function.Significance: These findings provide a potentially novel mechanism by which hypothalamic cell cholesterol content can affectappetite control.

Melanocortin-4 receptor (MC4R) is a G-protein-coupledreceptor expressed in the hypothalamus where it controls feed-ing behavior. MC4R cycles constitutively and is internalized atthe same rate in the presence or absence of stimulation by theagonist, melanocyte-stimulating hormone (�-MSH). This is dif-ferent from other G-protein-coupled receptors, such as �2-ad-renergic receptor (�2AR), which internalizes more rapidly inresponse to agonist stimulation. Here, it is found that in immor-talizedneuronalNeuro2Acells expressing exogenous receptors,constitutive endocytosis ofMC4R and agonist-dependent inter-nalization of �2AR were equally sensitive to clathrin depletion.Inhibition ofMC4Rendocytosis by clathrin depletion decreasedthe number of receptors at the cell surface that were responsiveto the agonist, �-MSH, by 75%. Mild membrane cholesteroldepletion also inhibited constitutive endocytosis of MC4R by�5-fold, while not affecting recycling of MC4R or agonist-de-pendent internalization of �2AR. Reduced cholesterol did notchange the MC4R dose-response curve to �-MSH, but itdecreased the amount of cAMP generated per receptor numberindicating that a populationofMC4Rat the cell surface becomesnonfunctional. The loss of MC4R function increased over time(25–50%) and was partially reversed by mutations at putativephosphorylation sites (T312A and S329A). Thiswas reproducedin hypothalamic GT1-7 cells expressing endogenous MC4R.

The data indicate that constitutive endocytosis of MC4R isclathrin- and cholesterol-dependent. MC4R endocytosis isrequired to maintain MC4R responsiveness to �-MSH by con-stantly eliminating from the plasma membrane a pool of recep-tors modified at Thr-312 and Ser-329 that have to be cycled tothe endosomal compartment to regain function.

MC4R4 is a G-protein-coupled receptor (GPCR) expressedin the brain,which is central to the control of food intake. In thisrespect, intraventricular administration of the agonist �-MSHsuppresses feeding (1–4). Moreover, MC4R knock-out in miceleads to obesity syndrome with hyperphagia, hyperglycemia,and hyperinsulinemia (5). Although MC4R is expressed inmany areas of the brain (6), it controls feeding behavior at spe-cialized sites. Correspondingly, it has been reported thatrestored MC4R expression in the paraventricular hypothala-mus and amygdala ofMC4R-deficient mice is sufficient to con-trol food intake (7). The importance of MC4R in food intakeregulation is highlighted by the discovery that most of theknown genetic causes of obesity are due to mutations inMC4R(8–10). Following agonist stimulation, GPCRs are desensitizedby amechanism that classically includes phosphorylation of thereceptor at the C terminus, with recruitment of the clathrinadaptors �-arrestin1 and �-arrestin2. �-Arrestins bind bothdirectly to clathrin and to the clathrin adaptor AP-2, therebyclustering the receptors into clathrin-coated vesicles to beendocytosed (11–13). In hypothalamic GT1-7 and human

* This work was supported, in whole or in part, by National Institutes of HealthGrants R01-DK080424 (to G. B.) and by Grant UL1RR029884 from theNational Center for Research Resources (to the University of Arkansas forMedical Sciences Translational Research Institute).

□S This article contains supplemental Figs. S1–S3.1 Both authors contributed equally to this work.2 To whom correspondence may be addressed: Dept. of Biochemistry and

Molecular Biology, University of Arkansas for Medical Sciences, Little Rock,AR 72205. Tel.: 501-526-7793; Fax: 501-686-8169; E-mail: [email protected].

3 To whom correspondence may be addressed: Dept. of Biochemistry andMolecular Biology, University of Arkansas for Medical Sciences, Little Rock,AR 72205. Tel.: 501-526-7793; Fax: 501-686-8169; E-mail: [email protected].

4 The abbreviations used are: MC4R, melanocortin-4 receptor; �-MSH, mela-nocyte-stimulating hormone; ABTS, 2,2�-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid; CHC, sequence heavy chain; GPCR, G-protein-coupledreceptor; IBMX, 3-isobutyl-1-methylxanthine; M�CD methyl-�-cyclodex-trin; POD, peroxidase; Tf, transferrin; TfR, transferrin receptor; N2A,Neuro2A; �2AR, �2-adrenergic receptor; DAB, 3,3�-diaminobenzidine tet-rahydrochloride; MEF, mouse embryonic fibroblast; PBA, 4-phenylbutyricacid.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 287, NO. 26, pp. 21873–21890, June 22, 2012© 2012 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

JUNE 22, 2012 • VOLUME 287 • NUMBER 26 JOURNAL OF BIOLOGICAL CHEMISTRY 21873

by guest on August 24, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/cgi/content/full/M112.346890/DC1

http://www.jbc.org/

embryonic kidney (HEK) 293 cells, MC4R is desensitized fol-lowing exposure to the agonist �-MSH (14–16). Consistentwith these reports, we have found that in immortalized neuro-nal Neuro2A cells (N2A cells) and in hypothalamicGT1-7 cells,MC4R expression at the plasma membrane is decreased byexposure to the agonist (17). However, we have also found thatin these cells MC4R is internalized at the same rate in theabsence and in the presence of the agonist, indicating that theprocess is independent of receptor activity. In addition, ago-nist-dependent disappearance of MC4R from the cell surfaceappeared to occur by blocking recycling of a fraction of inter-nalized receptor back to the plasma membrane, rather than byinducing endocytosis (17). The intracellular traffic of MC4Ralong the endosomal route appears to play an important role inthe function of the receptor. In this respect, prolonged expo-sure to �-MSH promotes its localization to lysosomes (15).Moreover, trafficking of intracellular MC4R back to the cellsurface rather than to lysosomes underlies the ability of muta-tions of attractin and Mahogunin Ring Finger-1 (Mgrn1) torectify the obesity in mice overexpressing agouti-signaling pro-tein, an antagonist of MC4R (18).In addition to MC4R, other GPCRs, including the thyrotro-

pin receptor (19), M2muscarinic receptor (20), �2AR (21), andthe thrombin receptor (22, 23), are also internalized constitu-tively, albeit in most cases at a decreased rate rather than in thepresence of the agonist and by binding to other adaptors ratherthan �-arrestin. For example, �2AR, which is internalized rap-idly in response to agonist stimulation by a classical �-arrestinclathrin-dependentmechanism (11, 12, 24, 25), is also internal-ized constitutively although less rapidly by a clathrin-inde-pendent pathway (21). For some GPCRs, constitutive endocy-tosis is essential for function. In this respect, the thrombinreceptor is activated by proteolysis, and the existence of a pro-tected pool of receptors in the endosomal compartment makespossible the recovery of cell responsiveness to thrombin (26). Inthe case of the type 1 cannabinoid receptor, constitutive inter-nalization of the receptor occurring in the somatodendriticcompartment of the neuron appears to be required for axonaltargeting of the receptor (27–30). Our observation that MC4Ris constitutively internalized raises the question of whether thisprocess is relevant for MC4R function. Here, we find that con-stitutive endocytosis of MC4R is clathrin-dependent, but itoccurs by a differentmechanism than that of�2ARby being lesssensitive to depletion of �-arrestins and by being dependent onthe level of membrane cholesterol. Inhibition of MC4R consti-tutive internalization, either by reducing clathrin expression orby depletion of membrane cholesterol, decreased signaling inresponse to �-MSH in neuronal and hypothalamic cells, indi-cating that the process is essential for MC4R function.

EXPERIMENTAL PROCEDURES

Reagents and Antibodies—Lipofectamine 2000 and AmplexRed cholesterol assay kit were purchased from Invitrogen. Thefollowing antibodies were used: mouse monoclonal anti-GFPantibodies, rat monoclonal anti-HA antibody (3F10), peroxi-dase (POD)-conjugated anti-hemagglutinin (HA) antibody(3F10), fluorescein-conjugated rat monoclonal anti-HA anti-body (3F10), secondary POD-conjugated anti-mouse IgG, pro-

tease inhibitor mixture (Complete Mini), and 2,2�-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid (ABTS) tablets were fromRoche Applied Science; �-MSH, 3-isobutyl-1-methylxanthine(IBMX), mouse monoclonal anti-clathrin heavy chain clonetd.1, and methyl-�-cyclodextrin (M�CD) were from Sigma;BCA protein assay reagent, secondary POD-conjugated anti-rabbit IgG and secondary POD-conjugated anti-goat IgG werefrom Pierce; tetramethylrhodamine-Tf was from MolecularProbes (Eugene, OR); FITC-conjugated anti-mouse IgG, Cy3-and Cy5-conjugated anti-rat IgG and Cy3-conjugated anti-mouse IgG were from Jackson ImmunoResearch (West Grove,PA); enhanced chemiluminescence detection kits were fromPerkinElmer Life Sciences. Enhanced green fluorescent proteinexpression vector pEGFP-N2 was from Clontech. POD-conju-gated human transferrin (Tf) was from Rockland Immuno-chemicals, Inc. (Gilbertsville, PA); formaldehyde (16%) wasfromTed Pella Inc (Redding, CA).Mousemonoclonal antibod-ies against �-adaptin antibodies were from BD TransductionLaboratories (San Jose, CA); DAB substrate kit for peroxidasewas from Vector Laboratories (Peterborough, United King-dom); direct cAMP EIA kit was from Enzo Life Science Inc.(Farmingdale, NY); ELISA kit was from Enzo Life Science Inc.;embryonic mouse hypothalamic cell line, N-42, was purchasedfrom Cedarlane Laboratories (Burlington, Ontario, Canada).Constructs—HA-MC4R-GFP and HA-MC4R plasmids were

described earlier (17). Human �2AR cDNA in the pCMV-SPORT6 vector was obtained from Open Biosystems (Rock-ville, MD). The HA epitope (YPYDVPDYA)-tagged �2AR wasgenerated by PCR amplification using Pfx-Platinum polymer-ase (Invitrogen) using �2AR in the pCMV-SPORT6 plasmid astemplate. The forward primer, 5�-CTCAAGCTTCGACTGG-CCACCATGTATCCTTATGATGTGCCTGATTATGCCG-GGCAACCCCGAACGGC-3�, was designedwith aHindIII siteat the N terminus (underlined) and the HA epitope (in bold-face) after the starting ATG codon. The reverse primer 5�-CGGTGGATCCCGGGCTTATAGCAGTGAGTCATTTGT-ACT-3� has a BamHI restriction site. The purified PCR productwas digested with HindIII and BamHI and ligated to HindIII/BamHI-digested pEGPN2 vector.HA-MC4R-GFP mutants T312A, S329A, and S330A were

generated by PCR amplification using QuikChange site-di-rected mutagenesis kit (Stratagene). The primers used were asfollows: 5�-CGGAGTCAAGAACTGAGGAAAGCCTTCAA-AGAGATCATCTGTTGC-3� for T312A; 5�-CTGGGAGG-CCTTTGTGACTTGGCTAGCAGATATGCCCGGATC-CAC-3� for S329A; and 5�-GGAGGCCTTTGTGACTTGGC-TGCCAGATATGCCCGGATCCACCGG-3� for S330A.The single, double, and triple mutants at putative phos-

phorylation sites were generated by using HA-MC4R-GFP,HA-MC4R-GFP T312A, and HA-MC4R-GFP T312A/S329Aas templates, respectively. All mutations were confirmed bysequencing.Cell Culture andTransfection—N2A,GT1-7, N-42, andHEK

293 cells were cultured in DMEM with 10% fetal bovine serumand penicillin/streptomycin. N2A cells were transiently trans-fected with the indicated plasmids using Lipofectamine 2000and following the manufacturer’s instructions. Experimentswere carried out 48 h after transfection. Prior to all experi-

Cholesterol and MC4R Function

21874 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 287 • NUMBER 26 • JUNE 22, 2012


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ments, cells werewashed twicewithDMEMwithout serumandincubated for 1 h in the samemedium. For the small interferingRNA (siRNA) experiments, siRNA specific to murine clathrinheavy chain (AACCGCATGGAGACATAATAT) (31), humanclathrin heavy chain (GAGCATGTGCACGCTGGCC) (31,32), and to the human AP-2 � subunit (GTGGATGC-CTTTCGGGTCA) (33, 34) were purchased fromQiagen.Non-targeting siRNApool (siControl) was purchased fromDharma-con, Inc. (Chicago, IL). Cells were transfected with 100 nMsiRNA using Lipofectamine 2000. Stably transfected N2A cellsexpressing HA-MC4R-GFP have already been described (17).Drug Treatment—Todeplete cell cholesterol, N2A cells were

washed three times with DMEM and incubated in DMEM for1 h at 37 °C. N2A cells were then treated with 3 mM M�CD forthe indicated period.Quantification of Unesterified Cell Cholesterol Content—To-

tal unesterified cell cholesterol wasmeasured using theAmplexRed cholesterol assay kit, following the manufacturer’s instruc-tions (Invitrogen).Gel Electrophoresis and Immunoblotting—Separation of pro-

teins by SDS-PAGE, immunoblotting with the indicated pri-mary antibodies and secondary POD-conjugated antibodiesusing enhanced chemiluminescence detection, and proteindetermination were performed as described previously (35).Cell lysates were prepared by scraping cells from 60-mm diam-eter plates in 0.4ml of sample buffer containing protease inhib-itors. Samples were sonicated three times for 2-s periods andloaded onto SDS-PAGE.Fluorescence Microscopy—Images were captured using

CARV spinning confocal imaging system attached to an Olym-pus X-71 fluorescence microscope. Images were collected byusing a Photometrics CoolSnapHQcamera controlled by IP labsoftware (Scanalytics, Inc., Fairfax, VA).Co-localization of Internalized �2AR and MC4R with Endo-

cytosed Tf—For these experiments, N2A cells were transientlytransfected either with HA-�2AR or HA-MC4R. Cells werewashed three times with DMEM and incubated in the samemedium at 37 °C for 1 h. Cells were incubated with 50 �g/mltetramethylrhodamine-Tf at 4 °C for 1 h to label the endoge-nous Tf receptor TfR (red fluorescence) and fixed in the pres-ence of detergent (0.2% Triton X-100) prior to staining withanti-HA fluorescein-conjugated antibodies (green fluores-cence) to label HA-�2AR or HA-MC4R.Quantification of the Effect of M�CD on HA-MC4R and

HA-�2AR Localization by Fluorescence Microscopy—N2Aand GT1-7 cells transiently transfected with HA-�2AR andHA-MC4R were washed three times with DMEM and incu-bated inDMEM for 1 h at 37 °C. Cells were then kept in DMEMfor 1 h at 37 °C with or without addition of 3 mM M�CD. Cellswere further incubated for 1 h at 4 °C in the samemedium in thepresence or absence of the agonist andwith anti-HA antibodies(25 milliunits/ml). Cells were left at 4 °C (0 min) or transferredat 37 °C for the indicated time intervals (15 and 30min and 1 h)to allow internalization of anti-HA antibodies/HA-taggedreceptor complexes. Cells were transferred on ice, washed, andfixed in nonpermeabilizing conditions by incubation in PBScontaining 4% formaldehyde at 4 °C for 20min. Fixed cells wereincubated for 1 h with FITC-conjugated anti-rat antibodies

(1:100). Cells were washed four times with PBS and incubated30 min with permeabilization solution (PBS, 0.2% Triton, 100mg/ml ovalbumin, and 0.01% azide). Permeabilized cells werefurther incubated for 1 hwithCy3-conjugated anti-rat antibod-ies (1:100). Transfected cells expressing the receptorswere cho-sen at random. Co-localization of the FITC fluorescence (HA-MC4R or HA-�2AR at the plasma membrane, greenfluorescence) with the Cy3 fluorescence (HA-MC4R orHA-�2AR at the plasma membrane and in endosomes) wasmeasured using the ImageJ software version byWayneRasband(National Institutes of Health, Bethesda) as described before(36). After segmentation of the green fluorescence and red fluo-rescence, the regions of interest were analyzed by using theintensity co-localization analysis plugin in the ImageJ software,which measures the Mander’s overlap coefficient M1 (37).GraphPad Prism version 5.0 software was used to plot and ana-lyze the data by one-way analysis of variance.Fluorescence Recovery after Photobleaching—N2A cells sta-

bly transfected with HA-MC4R-GFP or transiently transfectedwith MC4R-GFP were plated to 3.0-cm optical bottom plates.24 h after plating, the cells were treated�M�CD inDMEM for1 h at 37 °C. After 1 h, the treatment media were changed toDMEM alone, and the cells were imaged using an OlympusFluoViewTMFV1000 confocalmicroscope. In each field of view,a single cell was selected for photobleaching, and a second cellwas monitored to assess the loss in fluorescence intensity overtime due to repeated imaging. Cells were selected at random.Images were collected at 30-s intervals for 17 min; the endo-somal compartment of the selected cell was photobleachedbetween the fourth and fifth image, allowing for 2 min of fluo-rescent monitoring as a base line, and 15 min of fluorescentmonitoring to assess internalization of the receptor into endo-somal compartments. To quantify the images, a region of inter-est containing the endosomal compartment was selected fromthe photobleached cell and the nonbleached cell, and the aver-age fluorescent intensity of the region of interest at each timepointwasmeasured. The average loss of fluorescent signal fromthe nonbleached cell was measured and used to normalize thedata of the paired bleached cell. Then the data of the bleachedcells were converted to percentages, where the initial base-lineaverage is 100% and immediately after bleaching is 0%. Data areexpressed as the average percentage of fluorescent signal recov-ery, derived from five time courses per condition.Determination of HA-�2AR, HA-MC4R, or HA-MC4R-GFP

at the Cell Surface by Enzyme-linked Assay—N2A cells tran-siently transfected with HA-�2AR and HA-MC4R or stablytransfectedwithHA-MC4R-GFPwerewashed three timeswithDMEM and incubated in DMEM for 1 h at 37 °C. Cells werefurther incubated for 1 h at 4 °C in the same medium in thepresence of POD-conjugated anti-HA antibodies (25 milli-units/ml). Cells were washed two times with ice-cold DMEMand fixed with formaldehyde at 4 °C for 10 min. Cells werewashed three timeswith PBS, and PODactivitywas determinedby using theABTS substrate tomeasure the amount of receptorat the cell surface. Rate constants of receptor internalizationwere derived by fitting nonlinear regressionmodels to the data,using the GraphPad Prism (GraphPad Software, San Diego).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Internalization of HA-�2AR, HA-MC4R, and HA-MC4R-GFP by Enzyme-linked Immunoassay—N2A cells transientlytransfected with HA-�2AR and HA-MC4R or stably trans-fected with HA-MC4R-GFP were washed three times withDMEM and incubated in DMEM for 1 h at 37 °C. Cells werefurther incubated for 30 min at 4 °C in the samemedium in thepresence or absence of the agonist and for another 30 min at4 °C with the addition of POD-conjugated anti-HA antibodies(25 milliunits/ml). Cells were washed two times with ice-coldDMEM and one time with DMEM at room temperature. Cellswere transferred at 37 °C for the indicated time intervals toallow internalization of the POD-conjugated anti-HA antibod-ies/HA-tagged receptor complexes. Cells were transferred onice, washed, and fixed in nonpermeabilizing conditions by incu-bation in PBS containing 4% formaldehyde at 4 °C for 10 min.Cells were washed, and POD activity was determined asdescribed above.Recycling of HA-MC4R-GFP by Enzyme-linked Immuno-

assay—Recycling assay was carried out as described previously(17). Briefly, tomeasure recycling of wild-type HA-MC4R-GFPand mutated HA-MC4R-GFP T312A/S329A in the presenceand absence of the agonist, transiently transfected N2A cellswere pretreated with 10 �M cycloheximide for 1 h at 37 °C andincubated for 30min at 4 °Cwith orwithout�-MSH.Cells werefurther incubated in the presence of anti-HA-POD antibodies(25 milliunits/ml) and with 10 �M cycloheximide with or with-out �-MSH for 1 h at 37 °C. Cells were washed and stripped ofsurface-bound anti-HA-POD antibody by incubating withDMEM at pH 2.5 for 10 min at 4 °C. After stripping, cells werewashed three times with DMEM and transferred to 37 °C inDMEM for the indicated time points to allow internalizedreceptor to re-appear at the cell surface. Cells were transferredon ice, fixed, and washed. Total internalized POD-labeledreceptor was measured at time 0 by incubating cells permeabi-lized with 0.2% Triton X-100 with the ABTS substrate. Recep-tors bound to anti-HA-POD re-appearing at the cell surfacewere measured at the indicated time points by incubatingunpermeabilized cells withABTS.MC4R recycling is expressedas the percentage of total internalized receptor that re-appearsat the cell surface over time. To measure recycling ofHA-MC4R-GFP in stably transfected N2A cells stably express-ing HA-MC4R-GFP with and without cholesterol depletion,cells were incubated in the presence of anti-HA-POD antibod-ies and with 10 �M cycloheximide for 1 h at 37 °C. Cells werefurther incubated for 20min at 37 °C in the samemedium in thepresence or absence of 3 mM M�CD. Cells were washed andstripped of surface-bound anti-HA-POD antibody, and recy-cled receptor was measured as described above.Immunoelectron Microscopy—N2A cells stably expressing

HA-MC4R-GFP (3 � 60-mm diameter plates per condition)were washed three times withDMEMand incubated inDMEMfor 1 h at 37 °C in the absence and in the presence of 3 mM

M�CD. Cells were transferred at 4 °C, and the medium wasaspirated and replaced with DMEM containing POD-conju-gated anti-HA antibodies (25milliunits/ml) at 4 °C. After 1 h ofincubation, cells were transferred at 37 °C for 20 min. Cellsfrom were then harvested in PBS solution containing 1 mM

EDTA, centrifuged at 600 � g for 15 min at 4 °C, and fixed with

5ml of 100mM sodium phosphate, pH 7.4, containing 4% para-formaldehyde. After three washes with 100 mM sodium phos-phate, pH 7.4, cells were incubated overnight with DAB usingthe DAB substrate kit for peroxidase and following the manu-facturer’s instructions. DAB staining was then intensified bythe methenamine silver-gold reaction procedure (38).Determination of TfR at the Cell Surface by Enzyme-linked

Assay—To measure the amount of TfR at the cell surface indifferent conditions, N2A cells stably expressing HA-MC4R-GFPwere preincubated for 1 h at 37 °Cwith either no additionsor 0.45 M sucrose or M�CD. Cells were transferred at 4 °C andincubated with DMEM containing 25 mg/ml TF-POD. Cellswere washed with DMEM three times, fixed with 4% parafor-maldehyde, and incubated with POD substrate as describedabove.Assay to Determine cAMP—Cells were washed with DMEM

and incubatedwith the samemedium containing 0.5mM IBMXfor 10 min and then stimulated with 100 nM �-MSH or 1 �M

forskolin for 15 min at 37 °C. The medium was aspirated, andintracellular cAMP was measured by using the Direct cAMPEIA kit from Enzo Life Sciences following the manufacturer’sinstructions and keeping at all steps 0.5 mM IBMX. Opticaldensity data were analyzed by using GraphPad Prism version5.0 software (nonlinear regression curve) to obtain the concen-tration of cAMP in the samples. Samples from the same exper-iment were used to determine protein concentration by usingBCA protein assay reagent. For determination of EC50, datawere analyzed by using the sigmoid dose-response curve.Statistical Analysis—Data from three or more independent

experiments are expressed asmean� S.D.Datawere comparedby using the Student’s t test and one-way analysis of variance.

RESULTS

Constitutive Internalization of MC4R Occurs Faster ThanConstitutive Internalization of �2AR—Attachment of hemag-glutinin (HA) and GFP tags to the N and C termini of MC4R,respectively, does not change the ability of the receptor to bindto �-MSH and signal (14, 15). By using both HA-MC4R andHA-MC4R-GFP, we have found that the receptor is internal-ized at the same rate in the absence and presence of �-MSH(17). To visualize internalization of MC4R and of anotherGPCR, �2AR, in the absence and presence of agonist, neuro-blastoma Neuro2A (N2A) cells expressing HA-MC4R orHA-�2AR were incubated with fluorescein-conjugatedanti-HA antibodies for 1 h at 4 °C and then transferred to 37 °Cfor the indicated time in the continuous presence of the anti-bodies, with and without �-MSH or isoproterenol, respectively(Fig. 1A). After 15 min of incubation at 37 °C, anti-HA�HA-MC4R complexes appeared in a perinuclear compartment (Fig.1A, left panel, arrows) at similar abundance regardless of thepresence of the agonist. In the absence of agonist, the anti-HA�HA-�2AR complexes were clearly detectable in the perinu-clear compartment at the 1-h time point, consistent with thereport that �2AR is endocytosed constitutively (21). However,in the presence of isoproterenol, the intracellular anti-HA�HA-�2AR complexes were more abundant at the 15-, 30-, and60-min time points Fig. 1A, right panel, arrows). We followedquantitatively constitutive HA-MC4R and HA-�2AR internal-




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ization by a biochemical assay, where the receptors at the sur-face of live cells are labeled at 4 °C by exposure to anti-HAantibody coupled to POD. The excess antibody was thenwashed off, and disappearance of the labeled cohort of recep-tors was followed over time at 37 °C in the absence of agonistexposure (Fig. 1B). During the 1-h incubation without agonist,�67% of HA-MC4R and 15% of HA-�2AR were endocytosed,and internalization of HA-M4CR at the 15-min time point wasfaster than that of HA-�2AR at least by �7-fold (Fig. 1B, paneli). Differences in the rate of constitutive internalization ofHA-MC4R and HA-�2AR were not due to a gross disparityof receptor abundance (Fig. 1B, panel ii, HA-MC4R� �60% ofHA-�2AR). Because constitutive internalization of MC4Roccurs faster than that of�2AR, this could lead to a different celldistribution of the two receptors in the basal condition. N2Acells kept in unstimulated conditions were fixed and stained

with the anti-HA antibody after permeabilization to monitorreceptor distribution at steady state (Fig. 1C). HA-�2AR wasprevalently localized to the cell margin (Fig. 1C, arrow) and,after exposure to the agonist, was clearly reduced at the plasmamembrane and accumulated in the perinuclear compartment(Fig. 1C, arrowhead), where it co-localized with the TfR. Differ-ently than HA-�2AR, HA-MC4R was already prevalent in theintracellular compartment together with endocytosed TfR inthe absence of �-MSH, and the disappearance of HA-M4CR atthe plasma membrane in response to agonist exposure was lessevident than that of HA-�2AR (Fig. 1C). To compare the extentof net disappearance of HA-�2AR and HA-MC4R at the cellsurface in response to agonist, N2A cells were exposed to iso-proterenol and �-MSH, respectively, for 1 h at 37 °C and thentreated with the anti-HA antibody coupled to POD to monitorthe amount of receptor at the cell surface. Exposure to the ago-

FIGURE 1. Constitutive internalization of MC4R occurs more rapidly than that of �2AR in N2A cells. A, N2A cells transiently transfected with HA-MC4R (leftpanel) or HA-�2AR (right panel) were incubated with fluorescein-conjugated anti-HA antibodies at 4 °C and then transferred at 37 °C for the indicated time inthe absence or presence of �-MSH and isoproterenol (Iso), respectively. Cells were washed, fixed with 4% formaldehyde in PBS, and images captured asdescribed, see “Fluorescence Microscopy” under “Experimental Procedures.” Bar in right panel � 10 �m. B, panel i, N2A cells were transiently transfected eitherwith HA-�2AR or with HA-MC4R and incubated with POD-conjugated anti-HA antibodies at 4 °C, washed, and transferred at 37 °C. Internalization of HA-MC4Rwas carried out as described, see Internalization of HA-�2AR, HA-MC4R, and HA-MC4R-GFP by Enzyme-linked Assay under “Experimental Procedures,” and dataare expressed as percentage of initial amount of receptor; panel ii, relative amounts of HA-MC4R and HA-�2AR at the cell surface are detected by theimmunoassay of panel i and expressed as OD/mg of protein. C, panel i, N2A cells expressing HA-MC4R (upper panel) and HA-�2AR (lower panel) were incubatedfor 1 h at 37 °C with and without the agonist in the presence of 50 �g/ml tetramethylrhodamine-Tf to label endogenous TfR. Cells were washed, fixed,permeabilized, and stained with fluorescein-conjugated anti-HA antibodies. Images were captured as in A. Arrows indicate transfected cells. Bar, 10 �m. D, N2Acells expressing HA-MC4R and HA-�2AR were incubated for 1 h at 37 °C with and without the agonist. Cells were transferred on ice and the amount of receptorat the cell surface was measured as described, see “Determination of HA-�2AR, HA-MC4R, or HA-MC4R-GFP at the Cell Surface by Enzyme-linked Assay” under“Experimental Procedures.” Statistical significance, ***, p � 0.001.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

nist induced a significantly more pronounced decrease ofHA-�2AR than of HA-MC4R (�2-fold, Fig. 1D). These exper-iments indicate that the dynamics and cell distribution of �2ARand MC4R in the absence of agonist exposure are different,with MC4R having faster constitutive internalization andincreased intracellular localization as compared with HA-�2AR. It also appears that the net loss of cell surfaceMC4R and�2AR in response to agonist stimulation is also different, withthat of MC4R being less pronounced.Constitutive Internalization ofMC4RandAgonist-dependent

Internalization of �2AR Are Equally Sensitive to ClathrinDepletion—We have found that, in unstimulated N2A cells,MC4R localizes to clathrin-coated pits, suggesting that consti-tutive internalization of the receptor occurs by this route (17).To test whether reduced clathrin expression inhibited MC4Rinternalization, murine clathrin heavy chain (CHC) expressionwas decreased in the N2A cells stably transfected withHA-MC4R-GFP (Fig. 2A, panel i) by an already validatedsiRNA (31). In these cells the rate of receptor internalizationwas reduced (by at least 3-fold) as compared with the control(Fig. 2A, panel ii), indicating that the process is indeed depend-ent on clathrin. To determinewhether constitutive clathrin-de-pendent endocytosis of MC4R occurs also in unspecializedcells, we used transiently transfected HEK 293 cells. WhenHA-MC4R was expressed in the HEK 293 cells, the receptorwas already rapidly endocytosed in the absence of �-MSH, andthe rate of receptor internalization remained unchanged in thepresence of the agonist (supplemental Fig. S1B). Conversely,when HA-�2AR was expressed in HEK 293 cells, the receptor

was internalized more rapidly in response to incubation withisoproterenol (supplemental Fig. S1B). Thus, fast constitutiveendocytosis of MC4R, independent of binding to the agonist,also occurs in nonspecialized cells. When CHC expression wasdecreased in HEK 293 by using previously validated siRNA tar-geted to the human orthologue (31, 32), the rate of HA-MC4Rinternalization was significantly reduced (by �2-fold, supple-mental Fig. S1C). These experiments indicate that constitutiveinternalization ofMC4R occurs by a clathrin-dependentmech-anismboth in neuronal andunspecialized cells. Agonist-depen-dent internalization of �2AR also occurs by a clathrin-depen-dent mechanism (12, 39, 40). We reasoned that if constitutiveinternalization of MC4R occurred by a clathrin-dependentroute as does agonist-dependent internalization of �2AR, thenreduced levels of the protein would lead to a similar degree ofinhibition of the rates at which MC4R and �2AR are internal-ized. In transiently transfected N2A cells, the extent of inhibi-tion of HA-MC4R constitutive internalization was the same asthat of agonist-induced HA-�2AR internalization (Fig. 2B),indicating that both processes are similarly dependent onclathrin.Inhibition of MC4R Endocytosis by Clathrin Depletion Leads to

Accumulation of Nonfunctional MC4R at the Cell Surface—The physiological relevance of constitutive cycling of MC4R isunknown. Because silencing of CHC inhibits endocytosis ofMC4R, we asked whether this would affect the distribution andfunction of the receptor.MC4R is aGs-coupled receptor, whichactivates adenylate cyclase, thereby increasing the intracellularconcentration of cAMP. Forskolin, which directly activates

FIGURE 2. Constitutive internalization of MC4R is clathrin-dependent. A, panel i, N2A cells stably expressing HA-MC4R-GFP were left untransfected or weretransiently transfected with either control siRNA or siRNA targeted to CHC. Cell lysates were analyzed by Western blot with antibodies against CHC and actin.Panel ii, HA-MC4R-GFP internalization in N2A cells stably expressing HA-MC4R-GFP was measured as in Fig. 1B. ***, p � 0.001. B, N2A cells were transientlyco-transfected with either HA-MC4R or HA-�2AR and with either control siRNA or siRNA targeted to CHC. Approximately 48 h after transfection, HA-MC4R andHA-�2AR internalization was measured as in Fig. 1B. The % inhibition due to CHC silencing was calculated at the 15-min time point by the following ratio:(reduction of receptor at the plasma membrane in control siRNA sample � reduction of receptor at the plasma membrane in CHC siRNA sample)/(reduction ofreceptor at the plasma membrane in control siRNA sample) � 100. ns, non-significant.




http://ww

w.jbc.org/

Dow

nloaded from





http://www.jbc.org/

adenylate cyclase, induced the same amount of cAMPpermg ofprotein in cells with or without silencing of clathrin (data notshown), indicating that activity of the enzyme is not impaired inthe clathrin-silenced cells. We reasoned that if reduced endo-cytosis ofMC4R impaired the function of the receptor by inhib-iting its internalization, then the amount of MC4R at the cellsurfacewould increase, and the amount of cAMP generated perreceptor would decrease. To test that, we first determinedwhether in the stably transfected N2A cells expressingHA-MC4R-GFP an increase of the cell surface receptor corre-sponds to increased generation of cAMP. We have found thatincubation with 4-phenylbutyric acid (PBA), a chemical chap-erone, increases folding of wild-type and mutated HA-MC4R-GFP in transiently transfected N2A cells with consequentincrease of total and surface expression of the receptor (36).Consistent with these observations, incubation of N2A cellsstably expressing HA-MC4R-GFP with PBA led to an �80%increase of receptor at the cell surface (Fig. 3A) with a concom-itant 80% increase of cAMP production as compared with theuntreated control, so the amount of cAMPgenerated per recep-tor number remained the same (Fig. 3B). This indicates that thelevel of cAMP generated in N2A cells stably expressingHA-MC4R-GFP in response to the agonists is dependent uponthe amount of signaling receptors at the plasma membrane.Reduced levels of CHC in the N2A cell stably expressingHA-MC4R-GFP led to an�50% increase of receptors at the cellsurface (Fig. 3A), consistent with the finding that silencing of

CHC inhibits MC4R internalization. However, the amount ofcAMP generated per receptor number was reduced by �75%(Fig. 3B). These data indicate that inhibition ofMC4R internal-ization by CHC silencing leads to accumulation of nonfunc-tional MC4R at the cell surface.MC4R Constitutive Internalization Is Less Dependent on

�-Arrestins and AP-2 than Agonist-dependent Internalizationof �2AR—Following binding to the agonist and signaling, inter-nalization ofmost GPCRs, including�2AR, is initiated by phos-phorylation by G-protein-coupled receptor kinases with for-mation of high affinity binding sites to which �-arrestinproteins bind (13). The�-arrestin bound to the GPCR interactswith both AP-2 and clathrin to internalize �2AR (39, 41, 42).Similarly, it has been found that MC4R internalization in thepresence of �-MSH and AgRP is also dependent on �-arrestinin HEK 293 cells and COS-7 cells (14, 43). Here, we testedwhetherMC4R internalization, in the absence of agonist, is alsodependent on �-arrestin. To this end, we used mouse embry-onic fibroblasts (MEFs) derived from wild-type (WT) or �-ar-restin1/2 null mice, where �2AR internalization in response toagonist is profoundly impaired (44). When these cells weretransfected with HA-M4CR and HA-�2AR, the surface expres-sion levels of these receptors were comparable, with HA-�2AR�2-fold more abundant than that of HA-MC4R (data notshown). In these cells, constitutive internalization ofHA-MC4R was clearly detectable, with �50% of the receptordisappearing from the plasma membrane in 30 min in theabsence of the agonist (Fig. 4A). Thus, constitutive internaliza-tion of MC4R is reproduced in the MEF, as we observed earlierin unspecialized HEK 293 cells. In the MEF with �-arrestin1/2knock-out, constitutive internalization of HA-MC4R and ago-nist-induced endocytosis of HA-�2AR were both inhibited, butthe effect on HA-�2AR internalization was more pronouncedthan that on HA-MC4R internalization (60 and 20% inhibition,respectively, at the 30-min time point).Silencing of the � subunit of AP-2 in HEK 293 cells inhibited

efficiently clathrin-dependent endocytosis of TfR, whereasendocytosis of EGF, which is internalized by a different set ofclathrin adaptors, was impaired less efficiently (33). We there-fore used the HEK cells to determine whether this already val-idated siRNA, by reducing expression of the � subunit of AP-2,also inhibited constitutive and agonist-dependent HA-MC4Rand HA-�2AR internalization. Reduced expression of the AP-2� subunit inhibited agonist-dependent internalization ofHA-�2AR by �40% and constitutive internalization ofHA-MC4Rby 20% (Fig. 4B). Together, the experiments of Fig. 4indicate that, at least in unspecialized cells,�-arrestin andAP-2function in MC4R internalization, consistent with previousreports (14, 43). However, they do so at a reduced extent ascompared with agonist-dependent internalization of �2AR,suggesting differences in the mechanism by which two pro-cesses occur.Reduced Cell Cholesterol Inhibits Constitutive Internaliza-

tion of MC4R with Accumulation of the Receptor at the PlasmaMembrane and Depletion of the Endosomal Pool—Some formsof clathrin-dependent endocytosis such as internalization ofamyloid precursor protein appear to be very sensitive to thelevel of cholesterol (45). When used at elevated concentrations

FIGURE 3. Reduced clathrin expression induces loss of MC4R function.A, N2A cells stably expressing HA-MC4R-GFP were transfected with controlsiRNA or siRNA targeted to CHC and were preincubated for 24 h at 37 °C withor without 2 mM PBA. Approximately 48 h after transfection, the amount ofcell surface receptor was measured as described, see “Determination ofHA-�2AR, HA-MC4R, or HA-MC4R-GFP at the Cell Surface by Enzyme-linkedAssay” under “Experimental Procedures” and expressed as OD per mg of pro-tein. B, N2A cells stably expressing HA-MC4R-GFP and treated as in A werewashed and incubated in DMEM containing 0.5 mM IBMX for 10 min and thenincubated in the absence or presence of 100 nM �-MSH for 15 min. Theamount of cAMP induced by exposure to �-MSH was measured as described,see “Assay to Determine cAMP” under “Experimental Procedures,” and nor-malized to the amount of HA-MC4R-GFP at the cell surface. ns,non-significant.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

(10 mM), the cholesterol-depleting drug M�CD disrupts clath-rin-dependent endocytosis (46), although at lower concentra-tions (3 mM), M�CD appears to inhibit specifically lipid raftinternalization (47, 48). Incubation of N2A cells with 3 mM

M�CD for 1 h reduced the level of cell nonesterified cholesterolby �45% as compared with that of the untreated control (Fig.5A, panel i). In these conditions, clathrin-dependent endocyto-sis of transferrin receptor (TfR), which cycles constitutivelybetween the plasma membrane and endosomes (49), stilloccurred (supplemental Fig. S2B). Incubation of N2A cells with3mMM�CD for 1 hdid not change the amount ofTfR at the cellsurface, again indicating that clathrin-dependent endocytosiswas not inhibited by exposure to the drug (supplemental Fig.S2A). Differently, acute exposure to hypertonic media (0.45 M

sucrose), a treatment that disrupts formation of clathrin-coatedpits (50), impaired constitutive internalization of TfR and led toa 2-fold accumulation of TfR at the plasma membrane. Theseexperiments indicate that mild cholesterol depletion does notimpair clathrin-dependent endocytosis of transferrin receptor.Mild cholesterol depletion by M�CD increased significantly

the amount of HA-MC4R-GFP localized at the cell surface bythe immunoassay (Fig. 5A, panel ii), differently than what wasobserved with TfR. Direct observation of HA-MC4R-GFP, byfluorescence microscopy, showed that after incubation withM�CD and hypertonic medium, there was an increased pool of

receptors localized at the plasma membrane (Fig. 5A, panel iii,arrowheads). Additionally, depletion of the intracellular pool ofreceptors was observed (Fig. 5A, panel iii, arrows). To visualizeat the ultrastructural level whether cholesterol depletion inhib-ited MC4R traffic to endosomes, transiently transfected N2Acells expressing HA-MC4R-GFP were treated with anti-HA-POD at 37 °C to label the population of cycling receptors andprocessed for electron microscopy. In cells incubated withoutM�CD or agonist, anti-HA�HA-MC4R-GFP complexes corre-sponding to silver-gold depositions were visible as sites of elec-tron dense dots at the plasmamembrane and,most abundantly,in perinuclear vesicles (Fig. 5B, panels i–iii, arrowheads andarrows, respectively). These data are consistent with the immu-nofluorescence of Fig. 1, indicating that the receptor internal-izes rapidly to endosomes in the absence of agonist stimulation.Conversely, in the M�CD-treated cells, most of the anti-HA�HA-MC4R-GFP complexeswere at the cell surface (Fig. 5B,panels iv–vi, black arrowheads), although vesicles in the intra-cellular localization (Fig. 5B, black arrows), including thoseadjacent to the plasma membrane (panel vi, white arrowhead),had very little, if any, HA-MC4R-GFP immunoreactivity. Thus,cholesterol depletion, under conditions that do not affect TfRdistribution, induces accumulation of MC4R at the plasmamembrane anddepletion of the endosomal pool of the receptor.

FIGURE 4. MC4R constitutive internalization is less dependent on �-arrestins and AP-2 than agonist-dependent internalization of �2AR. A, panels i andii, MEFs with double knock-out of �-arrestin1 and �-arrestin2 and wild-type control were transiently transfected with HA-MC4R and HA-�2AR. HA-MC4R andHA-�2AR internalization was measured as in Fig. 1B. Statistical significance, **, p � 0.01; ***, p � 0.001. Panel iii, % inhibition by double knock-out of �-arrestin1and �-arrestin2 (DKO-Arr) was calculated at the 30-min time point by the following ratio: (reduction of receptor at the plasma membrane in control MEFsample � reduction of receptor at the plasma membrane in MEFs with double knock-out of �-arrestin1 and �-arrestin2)/(reduction of receptor at the plasmamembrane in control MEF sample) � 100. B, panel i, HEK 293 cells were transfected with either control siRNA or siRNA targeted to AP-2 � subunit. Cells wereharversted �72 h after transfection, and lysates (20 �g per lane) were analyzed by Western blot (WB) with antibodies against AP-2 � subunit and CHC; panelii, HEK 293 cells were co-transfected with either HA-MC4R or HA-�2AR with either control siRNA or siRNA targeted to AP-2 � subunit. Approximately 72 h aftertransfection, cells expressing HA-MC4R were preincubated for 1 h at 4 °C with anti-HA-POD, washed, and then transferred to 37 °C for 0 and 30 min. Cellsexpressing HA-�2AR were preincubated with and without 10 �M isoproterenol together with anti-HA-POD, washed, and then transferred to 37 °C in thecontinuous presence of isoproterenol. Receptor internalization is measured as in Fig. 1B after 30 min of incubation at 37 °C. Panel iii, % inhibition by AP-2 �subunit silencing was calculated by the following (reduction of receptor at the plasma membrane in control siRNA sample � reduction of receptor at theplasma membrane in AP-2 � siRNA sample)/(reduction of receptor at the plasma membrane in control siRNA sample) � 100. Statistical significance is as in A.DKO-Arr, double knock-out of �-arrestin1 and �-arrestin2.




http://ww

w.jbc.org/

Dow

nloaded from




http://www.jbc.org/

Reduced Cell Cholesterol Impairs MC4R Traffic Specificallyat the Internalization Step—The fraction of a receptor thatcycles between the plasma membrane and the endosomes isdetermined by the rate at which it is endocytosed and recycledback to the cell surface (49). MC4R undergoes constitutiveendocytosis and recycling from endosomes back to the plasmamembrane (17). Thus, accumulation of the receptor at theplasma membrane by cholesterol depletion may also result, inaddition from impaired endocytosis, from increased recyclingof internalized MC4R back to the plasma membrane. Choles-terol depletion inhibited internalization of POD-conjugatedanti-HA�HA-MC4R-GFP complexes by at least 5-fold (Fig. 6A),

consistently with the immuno-EM showing reduced labeling ofendocytosed vesicles (Fig. 5B). In contrast, recycling of POD-conjugated anti-HA�HA-MC4R-GFP complexes back to theplasma membrane remained unchanged after cholesteroldepletion (Fig. 6B). These data indicate that cholesterol deple-tion impairs traffic of MC4R specifically at the internalizationstep. To visualize MC4R internalization without using anti-body-feeding experiments, the perinuclear pool of MC4R-GFPwas photobleached in N2A cells incubated with and withoutM�CD and the fluorescence recovery after photobleaching wasmeasured. Fluorescence recovery after photobleaching ofMC4R-GFP was significantly increased in control cells as com-

FIGURE 5. Mild cholesterol depletion induces HA-MC4R-GFP redistribution with increased receptor at the plasma membrane and depletion of theendosomal compartment. A, panel i, N2A cells stably expressing HA-MC4R-GFP were preincubated for 1 h at 37 °C with or without 3 mM M�CD, and totalunesterified cell cholesterol content was determined as described, see “Quantification of Unesterified Cell Cholesterol Content” under “Experimental Proce-dures,” and normalized to protein content. Statistical significance, ***, p � 0.001. Panel ii, N2A cells stably expressing HA-MC4R-GFP were preincubated for 1 hat 37 °C with either no additions or 3 mM M�CD. Cells were transferred at 4 °C, incubated with POD-conjugated anti-HA antibodies to measure HA-MC4R-GFPat the cell as in Fig. 3A. The amount of receptor at the cell surface is shown as percentage of that found in cells treated with no additions. Statistical significance,***, p � 0.001. Panel iii, N2A cells stably expressing HA-MC4R-GFP were preincubated for 1 h at 37 °C with either no additions or 0.45 M sucrose or M�CD, asindicated, transferred at 4 °C, and fixed with 4% formaldehyde. HA-MC4R-GFP distribution was detected by fluorescence microscopy. Arrow, intracellularcompartment; arrowhead, cell surface. Bar, 10 �m. B, N2A cells stably expressing HA-MC4R-GFP were preincubated for 1 h at 4 °C with either no additions(panels i–iii), or with 3 mM M�CD (panels iv–vi). Cells were transferred at 4 °C, incubated with POD-conjugated anti-HA antibodies, washed, and furtherincubated at 37 °C for 20 min, fixed with 4% formaldehyde, and processed for EM as described, see “Immunoelectron Microscopy” under “ExperimentalProcedures.” HA-MC4R-GFP immunostaining appears as electron-dense grains at the plasma membrane (arrowheads) and in endocytic vesicles (arrows). Theiii and vi panels show an enlarged field in panels i and iv (indicated by # in panels i and iv, respectively). The white arrowhead in panel vi indicates an unlabeledvesicle near the plasma membrane. Nu, nucleus.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

pared with cells exposed toM�CD, consistent with the conclu-sion that cholesterol depletion inhibits internalization ofMC4R(Fig. 6C).Cell Cholesterol Depletion Affects Constitutive Internaliza-

tion of MC4R and Not Agonist-dependent Internalization of�2AR—To investigate whether the inhibition of internalizationby cholesterol depletion is specific toMC4R rather than sharedwith otherGPCRs, we compared the effect ofM�CDon plasmamembrane expression of HA-MC4R and HA-�2AR in tran-siently transfected N2A cells. When N2A cells transientlytransfectedwithHA-MC4Rwere preincubatedwithM�CD for1 h, the amount of HA-MC4R at the cell surface was increased(Fig. 7A, 0 min time point) and internalization of HA-MC4Rfrom the plasmamembranewas inhibited (Fig. 7A, 30-min timepoint), in agreement with the data of Figs. 5 and 6. Conversely,pretreatment of cells transiently expressing HA-�2AR withM�CD did not change the cell surface expression of HA-�2ARor the extent of isoproterenol-induced internalization of thereceptor (Fig. 7B).GT1-7 cells are immortalized hypothalamic neurons that

have endogenousMC4R (14, 17, 51–53). To compare the effectof cholesterol depletion on MC4R and �2AR endocytosis, wecarried out antibody feeding experiments. GT1-7 cells express-ing HA-MC4R and HA-�2AR were incubated with anti-HAantibody alone and with anti-HA antibodies in the presenceand absence of isoproterenol, respectively. Cells were thentransferred at 37 °C for 1 h to allow labeling of HA-tagged

receptors at the plasma membrane and to be internalized toendosomes. Cells were fixed in nonpermeabilizing conditionsand stained with a nonsaturating concentration of secondaryFITC-labeled secondary antibody to visualize the pool of theanti-HA�HA-tagged receptor complexes at the plasma mem-brane (Fig. 7C, green fluorescence) and then permeabilized andstained with Cy3-conjugated secondary antibody to label thepools of anti-HA�HA-tagged receptor complexes at the plasmamembranes and at the intracellular localization. In cells with-out cholesterol depletion, intracellular Cy3 staining (Fig. 7C,red fluorescence, merged image, red arrows) of HA-MC4R thatdid not co-localize with plasma membrane staining of thereceptor (green fluorescence) corresponds to the internalizedreceptor and was significantly increased already at the 15-mintime point. In cholesterol-depleted cells, HA-MC4R internal-ized less efficiently at all time points as compared with untreatedcells. Conversely, internalization of HA-�2AR was not signifi-cantly different in the absence or in the presence of cholesteroldepletion at all time points (Fig. 7D, red fluorescence, mergedimage). Similar resultswereobtained in theN2Acells (supplemen-tal Fig. S3). These experiments indicate that the effect of choles-terol onMC4R internalization is specific to this GPCR and occursin hypothalamic cells in addition to neuronal cells.Inhibition of MC4R Internalization by Depletion of Cell Cho-

lesterol Leads to Accumulation of Nonfunctional Receptors atthe Plasma Membrane—We have shown in Fig. 3 that inhibi-tion of MC4R internalization by silencing of clathrin leads to

FIGURE 6. Mild cholesterol depletion inhibits internalization of both HA-MC4R-GFP and MC4R-GFP and does not affect recycling of the receptor.A, N2A cells stably expressing HA-MC4R-GFP were preincubated with either no additions or M�CD for 1 h at 37 °C. Internalization of HA-MC4R-GFP was carriedout as described in Fig. 1B. Statistical significance, ***, p � 0.001. B, N2A cells stably expressing HA-MC4R-GFP were treated as in A and recycling of HA-MC4R-GFP was measured as described, “Recycling of HA-MC4R-GFP by Enzyme-linked Assay” under “Experimental Procedures.” C, panel i, cells stably expressingMC4R-GFP were plated and treated as described under “Experimental Procedures.” A representative image of each condition is shown pre-bleaching (t � �30s), immediately post-bleaching (t � 0 s), and after 15 min of monitoring (t � 15 min). Panel ii, data derived from five cells per condition, including the cell in paneli, were graphed as the percentage of fluorescent signal recovery after photobleaching. Each dot is the average of five cells per condition.




http://ww

w.jbc.org/

Dow

nloaded from



http://www.jbc.org/

FIGURE 7. Reduced cell cholesterol inhibits MC4R but not �2AR internalization. A, N2A cells transiently transfected with HA-MC4R were preincubated for30 min at 37 °C with either no additions or with 3 mM M�CD. Cells were transferred at 4 °C and incubated with POD-conjugated anti-HA antibody. Cells werewashed and either kept on ice (0 min) or transferred at 37 °C for additional 30 min. The amount of surface receptor was measured as in Fig. 3A and is expressedas percentage of that found at time 0 in the sample treated without M�CD. B, N2A cells transiently transfected with HA-�2AR were treated with or without 3 mM

M�CD for 30 min at 37 °C. Cells were transferred at 4 °C and incubated in DMEM with POD-conjugated anti-HA antibody and with isoproterenol. Cells werewashed and either kept on ice (0 min) or transferred at 37 °C in the continuous presence of 10 �M isoproterenol for an additional 30 min. The amount of receptorat the cell surface was measured as in A and is expressed as percentage of that found at time 0 in the sample treated without M�CD. C, GT1-7 cells transientlytransfected with HA-MC4R were preincubated for 1 h at 37 °C with DMEM with or without 3 mM M�CD. Cells were transferred at 4 °C and incubated with anti-HAantibody for 1 h. Cells were kept on ice (0 min) or transferred at 37 °C for the indicated time points (15 and 30 min and 1 h). Immunofluorescence andquantifications of MC4R localization, shown in the graphs where each dot or square corresponds to one cell, was done as described, see “Quantification of theeffect of M�CD on HA-MC4R and HA-�2AR Localization by Fluorescence Microscopy” under “Experimental Procedures.” np, nonpermeabilizing conditions; p,permeabilizing conditions. D, GT1-7 cells were transiently transfected with HA-�2AR and preincubated for 1 h min at 37 °C with DMEM or with 3 mM M�CD. Cellswere transferred at 4 °C and incubated with POD-conjugated anti-HA antibody and isoproterenol for 1 h. Cells were kept on ice (0 min) or transferred at 37 °Cfor the indicated time points (15 and 30 min and 1 h). Immunofluorescence and quantification of MC4R internalization was done as above. Statisticalsignificance, *, p � 0.05; **, p � 0.01; ***, p � 0.001. Bar, 10 �m. Red arrows in C and D indicate endocytosed HA-MC4R and HA-�2AR.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

accumulation of nonfunctional receptors at the plasma mem-brane. Because cholesterol depletion by incubationwithM�CDinduces an acute and specific inhibition of MC4R endocytosis,we used treatment with the drug to explore whether there wasalso a loss ofMC4R function at the cell surface andwhether thisincreased over time.When tested immediately after cholesteroldepletion, the dose-response curve and the production ofcAMP per mg of protein in response to �-MSH were similar tothe control (Fig. 8A). This indicates that binding of MC4R to�-MSH as well as the overall cell response to the hormone wasunchanged by depletion of cholesterol. When cells wereexposed to M�CD and the nonesterified cell cholesterol con-tent was measured immediately after the 1-h treatment andafter an additional 2 h of incubation at 37 °C, the abundance ofthe lipidwas similar (Fig. 8B, panel i). This indicates that the 2-htime interval was not sufficient to replenish cholesterol. In thesame cells, MC4R abundance at the cell surface was increasedimmediately after exposure to M�CD with an additionalincrease after the 2-h incubation at 37 °C (Fig. 8B, panel ii). This

is in agreement with data in Figs. 5 and 6 and indicates thatinhibited endocytosis leads to progressive accumulation ofMC4R at the cell surface. The amount of cAMP generated peramount of receptor expressed at the plasma membranedecreased immediately after exposure toM�CD (by�25%) andmore so in the following 2 h of incubation at 37 °C (�50%) (Fig.8B, panel iii). These experiments indicate that, when endocy-tosis is inhibited, a larger fraction ofMC4R at the plasmamem-brane loses activity over time.Depletion of Cell Cholesterol Leads to a Loss of Overall Cell

Response to �-MSH in Immortalized Hypothalamic GT1-7 andN-42 Cells—We have found that immediately after cholesteroldepletion by M�CD, the overall cell response to �-MSH(cAMP/mg of protein) was similar to the untreated control,most likely because of the contribution of MC4R reaching theplasma membrane from the endosomal pool (Fig. 8A). We rea-soned that a net decrease of the overall cell response to �-MSHmight become apparent at later time points, when the endo-somal pool of receptors constitutively cycling to the plasma

FIGURE 8. MC4R accumulated at the cell surface of cholesterol-depleted cells is not functional. A, N2A cells stably expressing HA-MC4R-GFP werepreincubated for 1 h at 37 °C with or without 3 mM M�CD. Cells were washed and incubated in DMEM containing 0.5 mM IBMX for 10 min and then stimulatedwith varying concentrations of �-MSH as indicated. The amount of cAMP produced after stimulation with �-MSH was measured as in Fig. 3B. B, N2A cells stablyexpressing HA-MC4R-GFP were preincubated for 1 h at 37 °C with or without 3 mM M�CD and either transferred on ice (0 h) or further incubated for 2 h at 37 °C.The total amount of unesterified cholesterol in the cells was measured as in Fig. 5A, panel i; the amount of HA-MC4R-GFP at the cell surface was measured as inFig. 3A; the amount of cAMP produced normalized to the amount of HA-MC4R-GFP at the cell surface was measured as in Fig. 3B. Panel i, when cells wereexposed to M�CD and the nonesterified cell cholesterol content was measured immediately after the treatment and after an additional 2 h of incubation at37 °C, the abundance of the lipid was similar. This indicates that this time interval is not sufficient to replenish cholesterol. Panel ii, in the same cells, MC4Rabundance at the cell surface was increased immediately after exposure to M�CD with an additional increase after the 2-h incubation at 37 °C. Panel iii, this isin agreement with the data in Figs. 5 and 6 and indicates that inhibited endocytosis leads to progressive accumulation of MC4R at the cell surface. The amountof cAMP generated per amount of receptor expressed at the plasma membrane decreased immediately after exposure to M�CD (by �25%) and more so in thefollowing 2 h of incubation at 37 °C (�50%). *, p � 0.05; **, p � 0.01; ***, p � 0.001; ns, non-significant.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

membranewas exhausted. In this respect, whenM�CD-treatedN2A cells expressing HA-MC4R-GFP were further incubatedat 37 °C for 2 h to deplete the endosomal pool of receptors,there was a significant decrease of cAMP generated per mg ofprotein in response to�-MSH (Fig. 9). Such a decrease in cAMPproduction per mg of protein (�25%) was also observed in theuntransfected N2A cells and in immortalized hypothalamicN-42 and GT1-7 neurons, which express endogenous MC4R(54). These experiments show that reduced cell cholesterolleads over time to a net loss of response to �-MSH in cellsexpressing endogenous MC4R.Accumulation of Nonfunctional Receptors at the Plasma

Membrane by Inhibition of MC4R Endocytosis Is PartiallyReversed byMutations at Predicted Phosphorylation Sites—It ispossible that the time-dependent loss of functional MC4R atthe plasmamembrane upon inhibition of constitutive internal-ization of the receptor is due to covalent modifications of thereceptor, such as phosphorylation at the C-terminal domain.Phosphorylation of MC4R has been implicated in the mecha-nism by which cell surface expression ofMC4R decreases uponprotracted exposure to the agonist. In this respect, it has beenfound thatMC4Rmutations at predicted phosphorylation sites(Thr-312, Ser-329, and Ser-330 toAla residues) blunt the loss ofcell surface MC4R in response to protracted incubation with�-MSH in HEK 293 cells (14). Consistent with this report, wefind here that in N2A cells treated with prolonged exposure to�-MSH, there is a greater loss of MC4R surface expression inthe WT HA-MC4R-GFP (�40%) than of the single mutantsT312A and S329A (�20%) or the doublemutant T312A/S329A(�10%) (Fig. 10A). We have found that loss of MC4R uponagonist exposure is due to reduced recycling ofMC4R from theendosomal compartment back to the plasmamembrane, ratherthan to increased MC4R internalization (17). Thus, weexpected that mutations at predicted phosphorylation siteswould not change the rate ofMC4R internalization. Consistentwith this, the rate of internalization ofWTHA-MC4R-GFP and

of the single and double phosphorylation mutants ofHA-MC4R-GFP was similar regardless of cell exposure to�-MSH (Fig. 10B). Next, we determined the effect of mutationsat predicted phosphorylation sites on MC4R recycling in cellsthatwere incubatedwith andwithout�-MSH. In the absence ofthe hormone, �43% of the internalized WT HA-MC4R-GFPand mutated HA-MC4R-GFP T312A/S329A receptors recy-cled to the cell surface in 1 h. However, in the presence of thehormone, a significantly reduced fraction of the internalizedWTHA-MC4R-GFP (�30%) recycled back to the cell surface at1 h, whereas HA-MC4R-GFP T312A/S329A was essentiallyunchanged (�40%) (Fig. 10C). Thus, mutations at predictedphosphorylation sites blunt agonist-dependent retention ofMC4R in the endosomal compartment.We asked whether Thr-12 and Ser-329 were also implicated

in loss of MC4R response to �-MSH when constitutive endo-cytosis of the receptor was inhibited. When N2A cells express-ing WT HA-MC4R-GFP and HA-MC4R-GFP T312A/S329Awere cholesterol-depleted byM�CD, the rate of internalizationof the wild-type and mutated receptor was decreased to thesame extent, indicating that cholesterol depletion affects simi-larly the rate of WT and mutated HA-MC4R-GFP constitutiveendocytosis (Fig. 10D). Incubation with M�CD decreased sig-nificantly (p� 0.001) the amount of cAMP generated per num-ber of WT HA-MC4R-GFP and HA-MC4R-GFP T312A/S329A at the cell surface, indicating that bothWT andmutatedreceptors lose function upon prolonged residency at the cellsurface (Fig. 10E). However, the loss of function was signifi-cantly less pronounced for the MC4Rmutated at the predictedphosphorylation sites than for the wild-type receptor (�25 and�50%, respectively). Parallel experiments with the tripleHA-MC4R-GFP T312A/S329A/S330A mutant, to determinewhether incomplete inhibition of MC4R phosphorylationunderlined the incomplete recovery of MC4R function, gaveinstead the same result as the double mutant. These experi-ments indicate that, upon prolonged residency at the plasmamembrane in the absence of agonist, modifications at T312Aand S329A MC4R contribute to make MC4R unresponsive tothe agonist.

DISCUSSION

Internalization of MC4R Is Required to Maintain the Pool ofReceptors Residing at the Plasma Membrane in a FunctionalState—The data presented here indicate that MC4R constitu-tive endocytosis is both clathrin- and cholesterol-dependentand is essential for MC4R function. Constitutive internaliza-tion/recycling of MC4R appears to be required to eliminatereceptors that become nonfunctional by beingmodified duringprolonged residency at the plasmamembrane (Fig. 11A). In theabsence of constitutive endocytosis, nonfunctional MC4Raccumulates at the plasmamembrane, depleting the endosomalpool of receptors and eventually impairing the overall cellresponse to �-MSH (Fig. 11B). In support of these conclusions,we have presented here the following data. 1) Membrane cho-lesterol depletion inhibits constitutive internalization ofMC4R, while leaving recycling of the receptor unchanged. Thiscauses accumulation of MC4R at the plasma membrane andloss ofMC4R localized in the endosomal compartment, as visu-

FIGURE 9. Cholesterol depletion impairs �-MSH-stimulated cAMP pro-duction in untransfected hypothalamic cells. N2A cells stably expressingHA-MC4R-GFP, untransfected N2A, N-42, and GT1-7 cells were preincubatedfor 1 h at 37 °C with or without 3 mM M�CD and transferred at 37 °C foranother 2 h. Cells were washed and incubated in DMEM containing 0.5 mM

IBMX for 10 min and then incubated in presence of 100 nM �-MSH for 15 min.The amount of cAMP produced after stimulation with �-MSH was measuredas in Fig. 3B. The �-MSH-stimulated cAMP production by M�CD-treated cellsis expressed as percentage of that generated by the same cells incubated inthe absence of M�CD. *, p � 0.05; **, p � 0.01; ***, p � 0.001.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

FIGURE 10. Mutations at predicted phosphorylation sites blunt agonist-dependent MC4R sequestration and loss of MC4R function by cholesteroldepletion. A, N2A cells transiently expressing wild-type HA-MC4R-GFP, HA-MC4R-GFP T312A, HA-MC4R-GFP S329A, and HA-MC4R-GFP T312A/S329A werestimulated with �-MSH for 2 h. HA-MC4R-GFP at the cell surface was measured as in Fig. 3A, and data were expressed as the percentage of plasma membranereceptors disappeared from the plasma membrane in response to �-MSH treatment. B, N2A cells transiently transfected as in A were incubated without (paneli) or with (panel ii) �-MSH and in the presence of anti-HA-POD for 30 min at 4 °C. Cells were washed and transferred at 37 °C in the continuous absence andpresence of �-MSH. Receptor internalization was monitored as in Fig. 1B. C, N2A cells transiently expressing WT HA-MC4R-GFP and HA-MC4R-GFP T312A/S329Awere pretreated for 60 min with cycloheximide and incubated for 30 min at 4 °C with or without �-MSH. MC4R recycling is measured and expressed as in Fig.6B. However, in the presence of hormone, a significantly reduced fraction of the internalized WT HA-MC4R-GFP (�30%) recycled back to the cell surface at 1 h(panel i), whereas HA-MC4R-GFP T312A/S329A was essentially unchanged (�40%) (panel ii). D, N2A cells transiently expressing WT HA-MC4R-GFP andHA-MC4R-GFP T312A/S329A were preincubated with either no additions or M�CD for 1 h at 37 °C. Internalization of HA-MC4R-GFP was carried out as describedin Fig. 1B. N2A cells transiently expressing WT HA-MC4R-GFP, HA-MC4R-GFP T312A/S329A, and HA-MC4R-GFP T312A/S329A/S330A were preincubated for 1 hat 37 °C with or without 3 mM M�CD and transferred at 37 °C for other 2 h. The �-MSH-stimulated cAMP production is expressed as in Fig. 9. E, incubation withM�CD decreased significantly (p � 0.001) the amount of cAMP generated per number of WT HA-MC4R-GFP and HA-MC4R-GFP T312A/S329A at the cell surface,indicating that both WT and mutated receptors lose function upon prolonged residency at the cell surface. Statistical significance, ***, p � 0.001.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

alized both by fluorescence microscopy and by immunoelec-tron microscopy. 2) Inhibition of constitutive endocytosis ofMC4R by depletion of membrane cholesterol progressivelyincreases the pool of nonfunctional receptors at the plasmamembrane, and ultimately it causes a loss of the overall cellresponse to�-MSH. The loss of responsiveness to the agonist isfound both in transfected cell expressing exogenousMC4R andin hypothalamic neuronal cells expressing the endogenousreceptor. 3) Reduced clathrin expression by siRNA, with longterm inhibition of endocytosis, also induces increasedMC4R atthe cell surface and loss of receptor function.Thr-312 and Ser-329 Are Implicated in �-MSH-dependent

Inhibition of MC4R Recycling—In this paper we present dataindicating that mutations at putative phosphorylation sites ofMC4R, Thr-312 and Ser-329, do not affect the rate of internal-ization of the receptor in the absence or in the presence of�-MSH but enhance the receptor ability to recycle back to theplasmamembrane after prolonged incubation with the agonist.This finding is in agreement with our previous observation that�-MSH induces disappearance of MC4R at the cell surface,rather than by increasing the rate of MC4R internalization andby increasing retention of the receptor in the endosomal com-partment (17). The data presented in this study indicate thatmodifications at Thr-312 and Ser-329 of MC4R, most likelyphosphorylation, function to retain the receptor in the endo-somal compartment. It has been reported that exposure to�-MSH and to agouti-signaling protein directs MC4R to lyso-somes (15, 18). Moreover, mutations in two factors that rectifyobesity in a mouse overexpressing agouti-signaling protein,attractin, and MGRN1, block agouti-signaling protein-depen-dent traffic of MC4R to lysosomes (18). In the future, it will beinteresting to determine whethermodifications at Thr-312 andSer-329 function in combination with attractin andMGRN1 todirect MC4R to lysosomes.

Thr-312 and Ser-329Are Implicated in Loss of Responsivenessto�-MSHWhenConstitutive Endocytosis Is Inhibited—Aques-tion that remains to be answered is why MC4R at the plasmamembrane is modified to a nonfunctional state in the absenceof the agonist. One possibility is that this is consequent to theconstitutive activity of MC4R, which appears to be importantfor energy homeostasis in humans (55–57). Such constitutiveactivity of MC4R, in conditions where constitutive endocytosisof the receptor is inhibited,may ultimately lead to loss of recep-tor function by a process that has steps in common with thepathway desensitization of MC4R following prolonged agonistexposure (14). Our findings that mutations at Thr-312 and Ser-329 of MC4R blunt both reduction of MC4R at the plasmamembrane in response to prolonged exposure to the agonistand the loss ofMC4R function consequent to inhibition of con-stitutive internalization of the receptor are in agreement withthis possibility. The model in Fig. 11 predicts that phosphory-lation at Thr-312 and Ser-329 (consequent either to an interac-tion ofMC4R to �-MSH or to constitutive activity of the recep-tor or to stochastic interactions) contributes to make MC4Rnonfunctional. The model further predicts that endocytosis ofMC4R occurs irrespective of the functional state of the receptor.This is suggested by our earlier finding thatMC4R internalizationoccurs by the same rate in the absence and in the presence of�-MSH (17) and by data presented here that mutations at theseputativeMC4Rphosphorylation sites, which affect function of thereceptor at the plasmamembrane, donot affect its internalization.The data suggest that once modifications at Thr-312 and Ser-329are lifted, MC4R recycles as a functional �-MSH-responsivereceptor back to the plasmamembrane.Constitutive Internalization of MC4R Occurs by a Clathrin-

dependent Mechanism and Is Sensitive to Cholesterol Deple-tion—The data presented here indicate that constitutiveinternalization ofMC4R occurs by a process that is clathrin-de-pendent but less sensitive to �-arrestin and AP-2 depletion

FIGURE 11. MC4R constitutive internalization is essential for function. A, most of MC4R at the plasma membrane is functional and responds to �-MSH bysignaling. Prolonged residency of MC4R at the plasma membrane makes a pool of receptors nonfunctional by a mechanism that includes phosphorylation ofthe receptor at its C-terminal cytosolic domain. Constitutive endocytosis of MC4R occurs by a clathrin-dependent process that requires cholesterol andinternalizes both functional and nonfunctional receptors. Recycling of MC4R from the endosomal compartment to the plasma membrane can take place whenMC4R is dephosphorylated and functional. B, inhibition of MC4R endocytosis by cholesterol depletion or reduced clathrin increases the time by which MC4Rresides at the plasma membrane increasing the fraction of total receptors that becomes nonfunctional. Inhibition of endocytosis over time depletes theintracellular pool of receptors that can be reconstituted to their fully functional dephosphorylated state and recycled back to the plasma membrane. Over time,inhibition of MC4R endocytosis eventually results in an overall loss of cell response to �-MSH.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

than agonist-dependent�2AR internalization and is specificallydependent on membrane cholesterol. Others have found thatinternalization of MC4R in the presence of agonist and antag-onist is dependent on �-arrestin (14, 43). In this respect, over-expression of dominant-negative mutants of �-arrestin1-V53D in HEK 293 cells inhibited agonist-mediateddisappearance of MC4R from the plasma membrane (14). Inaddition, silencing of �-arrestin1 and �-arrestin2 in the HEK293 cells inhibited MC4R internalization in the presence ofAgRP (43). Here, by using for the first time MEF with doubleknock-out of �-arrestin1 and �-arrestin2 to study MC4Rtraffic, we find that constitutive internalization of receptor is�-arrestin-dependent but to a lower extent (3-fold) than thatof �2AR. However, endocytosis of MC4R appears to be spe-cifically sensitive to the membrane cholesterol content. Theeffect of cholesterol depletion on MC4R internalization islikely to be due to inhibition of clathrin-dependent endocy-tosis of MC4R. In this respect, the extent of inhibitioninduced by clathrin depletion on constitutive internalizationof MC4R and on agonist-dependent internalization of �2AR,a well established form of a clathrin-dependent endocytosis,is similar, indicating that both processes are equally depend-ent on clathrin. Most pathways of endocytosis are eitherclathrin-dependent or clathrin-independent, with the latterfunctioning in internalization of lipid rafts (58, 59). Yet thereare some forms of clathrin-dependent endocytosis that arecholesterol-regulated. For example, clathrin-dependentinternalization of Niemann-Pick C1-like protein (NPC1L1)is enhanced by increased cholesterol (60, 61). In addition,clathrin-dependent endocytosis of amyloid precursor pro-tein is inhibited by a decreased level of cholesterol (45), sim-ilarly to what is observed here for MC4R. Another possibilityis that MC4R internalization also occurs by pathways otherthan clathrin-dependent endocytosis that have yet to beinvestigated.Importantly, it appears that membrane cholesterol is

reduced in the hypothalamus of insulin-deficient diabeticmice and that this leads to increased food intake and weightgain (62). Here, we have found that reduced membrane cho-lesterol inhibits specifically MC4R constitutive endocytosisand impairs responsiveness to �-MSH, thus suggesting anew possible molecular mechanism by which changes inmembrane lipid composition can affect appetite control. Itwill be important in the future to determine whetherchanges in cholesterol levels obtained by modulation ofphysiologically relevant pathways leads to changes in mem-brane traffic/signaling of MC4R.

Acknowledgments—We are grateful to Dr. Timothy E. McGraw(Weill Medical College, Cornell University) for the gift of the plasmidpCDTR with human TR; Dr. Robert J. Lefkowitz (Howard HughesMedical Institute, Duke University Medical Center) for the gift ofmurine embryonic fibroblasts from transgenic mice lacking �-arres-tin1 and �-arrestin2; Dr. Richard I. Weiner (University of CaliforniaSan Francisco) for the gift of GT1-7 cells, and to Dr. Brian Storrie(University of Arkansas for Medical Sciences) for comments on themanuscript.

REFERENCES1. Murphy, B., Nunes, C. N., Ronan, J. J., Hanaway, M., Fairhurst, A. M., and

Mellin, T. N. (2000) Centrally administered MTII affects feeding, drink-ing, temperature, and activity in the Sprague-Dawley rat. J. Appl. Physiol.89, 273–282

2. Rossi, M., Beak, S. A., Choi, S. J., Small, C. J., Morgan, D. G., Ghatei, M. A.,Smith, D.M., and Bloom, S. R. (1999) Investigation of the feeding effects ofmelanin-concentrating hormone on food intake. Action independent ofgalanin and the melanocortin receptors. Brain Res. 846, 164–170

3. Fan, W., Dinulescu, D. M., Butler, A. A., Zhou, J., Marks, D. L., and Cone,R. D. (2000) The central melanocortin system can directly regulate seruminsulin levels. Endocrinology 141, 3072–3079

4. Minokoshi, Y., Alquier, T., Furukawa, N., Kim, Y. B., Lee, A., Xue, B., Mu,J., Foufelle, F., Ferré, P., Birnbaum,M. J., Stuck, B. J., and Kahn, B. B. (2004)AMP-kinase regulates food intake by responding to hormonal and nutri-ent signals in the hypothalamus. Nature 428, 569–574

5. Huszar, D., Lynch, C. A., Fairchild-Huntress, V., Dunmore, J. H., Fang, Q.,Berkemeier, L. R., Gu, W., Kesterson, R. A., Boston, B. A., Cone, R. D.,Smith, F. J., Campfield, L. A., Burn, P., and Lee, F. (1997) Targeted disrup-tion of the melanocortin-4 receptor results in obesity in mice. Cell 88,131–141

6. Cone, R. D. (2005) Anatomy and regulation of the central melanocortinsystem. Nat. Neurosci. 8, 571–578

7. Balthasar, N., Coppari, R., McMinn, J., Liu, S. M., Lee, C. E., Tang, V.,Kenny, C. D., McGovern, R. A., Chua, S. C., Jr., Elmquist, J. K., and Lowell,B. B. (2004) Leptin receptor signaling in POMC neurons is required fornormal body weight homeostasis. Neuron 42, 983–991

8. Lubrano-Berthelier, C., Cavazos, M., Dubern, B., Shapiro, A., Stunff, C. L.,Zhang, S., Picart, F., Govaerts, C., Froguel, P., Bougneres, P., Clement, K.,and Vaisse, C. (2003) Molecular genetics of human obesity-associatedMC4R mutations. Ann. N.Y. Acad. Sci. 994, 49–57

9. Tao, Y. X., and Segaloff, D. L. (2003) Functional characterization of mela-nocortin-4 receptor mutations associated with childhood obesity. Endo-crinology 144, 4544–4551

10. Tao, Y. X. (2010) The melanocortin-4 receptor. Physiology, pharmacol-ogy, and pathophysiology. Endocr. Rev. 31, 506–543

11. Laporte, S. A., Oakley, R. H., Zhang, J., Holt, J. A., Ferguson, S. S., Caron,M.G., and Barak, L. S. (1999) The�2-adrenergic receptor/�-arrestin com-plex recruits the clathrin adaptor AP-2 during endocytosis. Proc. Natl.Acad. Sci. U.S.A. 96, 3712–3717

12. Laporte, S. A., Oakley, R. H., Holt, J. A., Barak, L. S., and Caron, M. G.(2000) The interaction of �-arrestin with the AP-2 adaptor is required forthe clustering of �2-adrenergic receptor into clathrin-coated pits. J. Biol.Chem. 275, 23120–23126

13. Drake, M. T., Shenoy, S. K., and Lefkowitz, R. J. (2006) Trafficking of Gprotein-coupled receptors. Circ. Res. 99, 570–582

14. Shinyama, H., Masuzaki, H., Fang, H., and Flier, J. S. (2003) Regulation ofmelanocortin-4 receptor signaling. Agonist-mediated desensitization andinternalization. Endocrinology 144, 1301–1314

15. Gao, Z., Lei, D., Welch, J., Le, K., Lin, J., Leng, S., and Duhl, D. (2003)Agonist-dependent internalization of the human melanocortin-4 recep-tors in human embryonic kidney 293 cells. J. Pharmacol. Exp. Ther. 307,870–877

16. Nickolls, S. A., Fleck, B., Hoare, S. R., and Maki, R. A. (2005) Functionalselectivity of melanocortin 4 receptor peptide and nonpeptide agonists.Evidence for ligand-specific conformational states. J. Pharmacol. Exp.Ther. 313, 1281–1288

17. Mohammad, S., Baldini, G., Granell, S., Narducci, P., Martelli, A. M., andBaldini, G. (2007) Constitutive traffic of melanocortin-4 receptor inNeuro2A cells and immortalized hypothalamic neurons. J. Biol. Chem.282, 4963–4974

18. Overton, J. D., and Leibel, R. L. (2011) Mahoganoid and mahogany muta-tions rectify the obesity of the yellow mouse by effects on endosomaltraffic of MC4R protein. J. Biol. Chem. 286, 18914–18929

19. Baratti-Elbaz, C., Ghinea, N., Lahuna, O., Loosfelt, H., Pichon, C., andMilgrom, E. (1999) Internalization and recycling pathways of the thyro-tropin receptor.Mol. Endocrinol. 13, 1751–1765




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

20. Roseberry, A. G., and Hosey, M. M. (1999) Trafficking of M2-muscarinicacetylcholine receptors. J. Biol. Chem. 274, 33671–33676

21. Scarselli, M., andDonaldson, J. G. (2009) Constitutive internalization of Gprotein-coupled receptors andG proteins via clathrin-independent endo-cytosis. J. Biol. Chem. 284, 3577–3585

22. Shapiro, M. J., Trejo, J., Zeng, D., and Coughlin, S. R. (1996) Role of thethrombin receptor’s cytoplasmic tail in intracellular trafficking. Distinctdeterminants for agonist-triggered versus tonic internalization and intra-cellular localization. J. Biol. Chem. 271, 32874–32880

23. Paing, M.M., Johnston, C. A., Siderovski, D. P., and Trejo, J. (2006) Clath-rin adaptor AP2 regulates thrombin receptor constitutive internalizationand endothelial cell resensitization.Mol. Cell. Biol. 26, 3231–3242

24. Ferguson, S. S., Downey, W. E., 3rd, Colapietro, A. M., Barak, L. S., Mé-nard, L., and Caron, M. G. (1996) Role of �-arrestin in mediating agonist-promoted G protein-coupled receptor internalization. Science 271,363–366

25. Ferguson, S. S., and Caron,M. G. (2004) Green fluorescent protein-tagged�-arrestin translocation as a measure of G protein-coupled receptor acti-vation.Methods Mol. Biol. 237, 121–126

26. Hein, L., Ishii, K., Coughlin, S. R., and Kobilka, B. K. (1994) Intracellulartargeting and trafficking of thrombin receptors. A novel mechanism forresensitization of a G protein-coupled receptor. J. Biol. Chem. 269,27719–27726

27. Leterrier, C., Bonnard, D., Carrel, D., Rossier, J., and Lenkei, Z. (2004)Constitutive endocytic cycle of the CB1 cannabinoid receptor. J. Biol.Chem. 279, 36013–36021

28. Leterrier, C., Lainé, J., Darmon, M., Boudin, H., Rossier, J., and Lenkei, Z.(2006) Constitutive activation drives compartment-selective endocytosisand axonal targeting of type 1 cannabinoid receptors. J. Neurosci. 26,3141–3153

29. McDonald, N. A., Henstridge, C. M., Connolly, C. N., and Irving, A. J.(2007) An essential role for constitutive endocytosis, but not activity, inthe axonal targeting of the CB1 cannabinoid receptor. Mol. Pharmacol.71, 976–984

30. Bohn, L. M. (2007) Constitutive trafficking. More than just running incircles?Mol. Pharmacol. 71, 957–958

31. Collin, G., Franco, M., Simon, V., Bénistant, C., and Roche, S. (2007) TheTom1L1-clathrin heavy chain complex regulates membrane partitioningof the tyrosine kinase Src required for mitogenic and transforming activ-ities.Mol. Cell. Biol. 27, 7631–7640

32. Huang, F., Khvorova, A., Marshall, W., and Sorkin, A. (2004) Analysis ofclathrin-mediated endocytosis of epidermal growth factor receptor byRNA interference. J. Biol. Chem. 279, 16657–16661

33. Motley, A., Bright, N. A., Seaman, M. N., and Robinson, M. S. (2003)Clathrin-mediated endocytosis in AP-2-depleted cells. J. Cell Biol. 162,909–918

34. Dugast,M., Toussaint, H., Dousset, C., and Benaroch, P. (2005) AP2 clath-rin adaptor complex, but not AP1, controls the access of the major histo-compatibility complex (MHC) class II to endosomes. J. Biol. Chem. 280,19656–19664

35. Wang, G., Witkin, J. W., Hao, G., Bankaitis, V. A., Scherer, P. E., andBaldini, G. (1997) Syndet is a novel SNAP-25 related protein expressed inmany tissues. J. Cell Sci. 110, 505–513

36. Granell, S., Mohammad, S., Ramanagoudr-Bhojappa, R., and Baldini, G.(2010) Obesity-linked variants of melanocortin-4 receptor are misfoldedin the endoplasmic reticulum and can be rescued to the cell surface by achemical chaperone.Mol. Endocrinol. 24, 1805–1821

37. Manders, E. M., Stap, J., Brakenhoff, G. J., van Driel, R., and Aten, J. A.(1992) Dynamics of three-dimensional replication patterns during the S-phase, analyzed by double labeling of DNA and confocal microscopy.J. Cell Sci. 103, 857–862

38. Teclemariam-Mesbah, R., Wortel, J., Romijn, H. J., and Buijs, R. M.(1997) A simple silver-gold intensification procedure for double DABlabeling studies in electron microscopy. J. Histochem. Cytochem. 45,619–621

39. Laporte, S. A., Miller, W. E., Kim, K. M., and Caron, M. G. (2002) �-Ar-restin/AP-2 interaction in G protein-coupled receptor internalization.Identification of a �-arrestin-binding site in �2-adaptin. J. Biol. Chem.

277, 9247–925440. Kim, Y. M., and Benovic, J. L. (2002) Differential roles of arrestin-2 inter-

action with clathrin and adaptor protein 2 in G protein-coupled receptortrafficking. J. Biol. Chem. 277, 30760–30768

41. Burtey, A., Schmid, E. M., Ford, M. G., Rappoport, J. Z., Scott, M. G.,Marullo, S., Simon, S. M., McMahon, H. T., and Benmerah, A. (2007) Theconserved isoleucine-valine-phenylalanine motif couples activation stateand endocytic functions of �-arrestins. Traffic 8, 914–931

42. Edeling,M. A.,Mishra, S. K., Keyel, P. A., Steinhauser, A. L., Collins, B.M.,Roth, R., Heuser, J. E., Owen, D. J., and Traub, L. M. (2006) Molecularswitches involving the AP-2�2 appendage regulate endocytic cargo selec-tion and clathrin coat assembly. Dev. Cell 10, 329–342

43. Breit, A., Wolff, K., Kalwa, H., Jarry, H., Büch, T., and Gudermann, T.(2006) The natural inverse agonist agouti-related protein induces arres-tin-mediated endocytosis of melanocortin-3 and -4 receptors. J. Biol.Chem. 281, 37447–37456

44. Kohout, T. A., Lin, F. S., Perry, S. J., Conner, D. A., and Lefkowitz, R. J.(2001) �-Arrestin 1 and -2 differentially regulate heptahelical receptorsignaling and trafficking. Proc. Natl. Acad. Sci. U.S.A. 98, 1601–1606

45. Cossec, J. C., Simon, A., Marquer, C., Moldrich, R. X., Leterrier, C.,Rossier, J., Duyckaerts, C., Lenkei, Z., and Potier, M. C. (2010) Clathrin-dependent APP endocytosis and A� secretion are highly sensitive to thelevel of plasma membrane cholesterol. Biochim. Biophys. Acta 1801,846–852

46. Subtil, A., Gaidarov, I., Kobylarz, K., Lampson, M. A., Keen, J. H., andMcGraw, T. E. (1999) Acute cholesterol depletion inhibits clathrin-coatedpit budding. Proc. Natl. Acad. Sci. U.S.A. 96, 6775–6780

47. Antonescu, C. N., Díaz, M., Femia, G., Planas, J. V., and Klip, A. (2008)Clathrin-dependent and -independent endocytosis of glucose transporter4 (GLUT4) inmyoblasts. Regulation bymitochondrial uncoupling.Traffic9, 1173–1190

48. Kanzaki, M., Furukawa, M., Raab, W., and Pessin, J. E. (2004) Phosphati-dylinositol 4,5-bisphosphate regulates adipocyte actin dynamics andGLUT4 vesicle recycling. J. Biol. Chem. 279, 30622–30633

49. Maxfield, F. R., and McGraw, T. E. (2004) Endocytic recycling. Nat. Rev.Mol. Cell Biol. 5, 121–132

50. Heuser, J. E., and Anderson, R. G. (1989) Hypertonic media inhibit recep-tor-mediated endocytosis by blocking clathrin-coated pit formation.J. Cell Biol. 108, 389–400

51. Dumont, L. M., Wu, C. S., Aschkenasi, C. J., Elmquist, J. K., Lowell, B. B.,and Mountjoy, K. G. (2001) Mouse melanocortin-4 receptor gene 5�-flanking region imparts cell-specific expression in vitro. Mol. Cell. Endo-crinol. 184, 173–185

52. Khong, K., Kurtz, S. E., Sykes, R. L., and Cone, R. D. (2001) Expression offunctional melanocortin-4 receptor in the hypothalamic GT1-1 cell line.Neuroendocrinology 74, 193–201

53. Büch, T. R., Heling, D., Damm, E., Gudermann, T., and Breit, A. (2009)Pertussis toxin-sensitive signaling of melanocortin-4 receptors in hypo-thalamic GT1-7 cells defines agouti-related protein as a biased agonist.J. Biol. Chem. 284, 26411–26420

54. Dalvi, P. S., Nazarians-Armavil, A., Tung, S., and Belsham, D. D. (2011)Immortalized neurons for the study of hypothalamic function. Am. J.Physiol. Regul. Integr. Comp. Physiol. 300, R1030–R1052

55. Nijenhuis,W. A., Oosterom, J., and Adan, R. A. (2001) AgRP(83–132) actsas an inverse agonist on the human-melanocortin-4 receptor.Mol. Endo-crinol. 15, 164–171

56. Haskell-Luevano, C., and Monck, E. K. (2001) Agouti-related proteinfunctions as an inverse agonist at a constitutively active brain melanocor-tin-4 receptor. Regul. Pept. 99, 1–7

57. Srinivasan, S., Lubrano-Berthelier, C., Govaerts, C., Picard, F., Santiago, P.,Conklin, B. R., and Vaisse, C. (2004) Constitutive activity of the melano-cortin-4 receptor is maintained by its N-terminal domain and plays a rolein energy homeostasis in humans. J. Clin. Invest. 114, 1158–1164

58. Mayor, S., and Pagano, R. E. (2007) Pathways of clathrin-independentendocytosis. Nat. Rev. Mol. Cell Biol. 8, 603–612

59. Traub, L. M. (2009) Tickets to ride. Selecting cargo for clathrin-regulated




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

internalization. Nat. Rev. Mol. Cell Biol. 10, 583–59660. Yu, L., Bharadwaj, S., Brown, J. M.,Ma, Y., Du,W., Davis, M. A., Michaely,

P., Liu, P., Willingham, M. C., and Rudel, L. L. (2006) Cholesterol-regu-lated translocation of NPC1L1 to the cell surface facilitates free choles-terol uptake. J. Biol. Chem. 281, 6616–6624

61. Ge, L., Wang, J., Qi, W., Miao, H. H., Cao, J., Qu, Y. X., Li, B. L., and

Song, B. L. (2008) The cholesterol absorption inhibitor ezetimibe actsby blocking the sterol-induced internalization of NPC1L1. Cell Metab.7, 508–519

62. Suzuki, R., Lee, K., Jing, E., Biddinger, S. B.,McDonald, J. G.,Montine, T. J.,Craft, S., and Kahn, C. R. (2010) Diabetes and insulin in regulation of braincholesterol metabolism. Cell Metab. 12, 567–579




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

McPike, Paola Narducci, Susana Granell and Giulia BaldiniFaith K. McDaniel, Brent M. Molden, Sameer Mohammad, Giovanna Baldini, Lakisha

-MSH)α-Melanocyte-stimulating Hormone (α(MC4R) Is Essential to Maintain Receptor Responsiveness to

Constitutive Cholesterol-dependent Endocytosis of Melanocortin-4 Receptor

doi: 10.1074/jbc.M112.346890 originally published online April 27, 20122012, 287:21873-21890.J. Biol. Chem.

10.1074/jbc.M112.346890Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

http://www.jbc.org/content/suppl/2012/04/27/M112.346890.DC1

http://www.jbc.org/content/287/26/21873.full.html#ref-list-1

This article cites 62 references, 32 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M112.346890

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;287/26/21873&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/287/26/21873

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=287/26/21873&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/287/26/21873

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/suppl/2012/04/27/M112.346890.DC1

http://www.jbc.org/content/287/26/21873.full.html#ref-list-1

http://www.jbc.org/

Documents

ConstitutiveCholesterol-dependentEndocytosisof ...the function of the receptor. In this respect, prolonged expo-sure to -MSH promotes its localization to lysosomes (15). Moreover,