Conservation of histone H2A/H2B intergene regions: a role for the

Voue1.ubr1 98NcecAisRsac

Conservation of histone H2A/HB intergene regions: a role for the H2B specific element indivergent transcription

Richard A.Sturm*, Stephen Dalton+ and Julian R.E.Wells

Department of Biochemistry, University of Adelaide, P0 Box 498, Adelaide, South Australia, 5000Australia

Received January 6, 1988; Revised and Accepted May 31, 1988 Accession nos X07756-X07761 (incl.)

ABSTRACTThe organization and function of potential regulatory elements associated with the promoters

of chicken H2A and H2B genes pairs have been examined. The intergene regions of sixdispersed and divergently-transcribed H2A/H2B gene pairs contain several extremely wellconserved and spaced blocks of sequence homology. Adjacent coding regions are on average342 base-pairs apart. Respective TATA boxes are separated by 180 base-pairs and within thisconfined region there are four CCAAT boxes and a previously identified 13 base-pair H2B-specific element (H2B-box) which has homology to the octamer motif present in a number ofgene promoter/enhancer elements. Transcription of H2A and H2B genes from wild-type andmutant constructs was measured in transient assays by transfection into HeLa cells, and inpermanently transformed clonal cell lines. In vitro separation of the two genes at a uniqueintergenic site significantly decreased transcription of each gene. This suggested that theH2A/H2B gene pairs contained overlapping promoters. Deletion or point mutagenesis of theH2B-specific element decreased the levels of H2B and the H2A transcripts indicating that thissequence is a common regulatory element of both genes in the divergent-pair configeration.

INTRODUCTION

Genomic organization studies of histone genes have revealed an apparently random gene order

for higher eukaryotes (1,2). However, upon closer examination of the histone gene families of

several species, trends do become apparent. A common theme is the close association of

H2A/H2B and H3/H4 genes. These gene pairs are often divergently transcribed (see gene

organizational Tables in reference 1).

Extensive studies of histone gene organization in the chicken genome show a general disorder,with no long range repeat being evident (3). There are, however, preferred associations, most

notably H 1 with H2A and H2B genes. The extent of the H2A/H2B association has been

examined in this report at the DNA sequence level. and conserved sequence elements 5' to

coding regions have been identified. Of particular interest was a highly conserved promoter

element (5'-CTGATTTGCATAC/G-3') originally described by Harvey and co-workers (4)

positioned six bases 5' to chicken H2B gene TATA boxes, but absent in all other histone genes.

The central core region of this motif (ATTTGCAT) was subsequently identified (in the same or

inverted orientation) in immunoglobulin heavy and light-chain promoters (5.6) and in the

immunoglobulin heavy-chain and SV40 enhancer (5,7) in U2 (8,9) and some U1 (10,1 1) small

nuclear RNA (snRNA) promoters and most recently in the herpes simplex virus thymidine kina.se

8571©) I R L Press Limited, Oxford, England.

Nucleic Acids ResearchVolume 16 Number 17 1988

Nucleic Acids Research

promoter (12). In several instances, this 'octamer' motif has been shown to be essential for

efficient (13) or cell specific promoter activity (14,15).

In conjunction with the anation of the promoter architecture of H2A/H2B gene pairs, an

expression study of one of the gene pairs was initiated. Evidence is presented which suggests

that the highly conserved intergene region is related to the co-ordinated expression of theH2A/H2B divergent gene pair. The conserved H2B-specific element apparently consistutes a

common regulatory element which is required for the efficient expression of both genes in vivo.

MATERIALS AND RETHODS:

Analysis of Divergent H2A/H2B Gene Pair Genomic Clones

The relative position of the divergent H2A/H2B gene pairs in the chicken histone gene clusters

can be found in reference 3. The name of each pair presented here derives from the name of theplasmid or lambda clone from which it had been subcloned; L and R refers to the left and rightside of the clone. Restriction fragments of each divergent gene pair were subcloned into M13

vectors for sequencing. All sequence analysis was by the M 13 dideoxy chain termination

method (16), and the sequences have been deposited with the EMBL Data Library (accessionnumbers J00864, X07756-X07766). Data analysis utilized the Staden computer programs.

M 13 Site Directed MutagenesisThe methods ofAdelman et al., (17) and, Chan and Smith (18) were utilized for deletion and

substitution mutagenesis of intergene promoter elements. Synthetic oligonucleotides were as

follows: H2B-box deletion, 5'-dTATTTATAGCCCCAAGCATTCC'lTC-3'; H2B-box base

substitutions, 5'-dGATCCTAGCCCCTCTAGGCTACTGAGAAGCAITCCTTrCG-3'; and CCAAT box

deletion 5'dTCGCACTCTTlGGAACTCGA-3'. Screening for mutant phage was performed by insitu plaque hybridization using each of the 32P-labelled mutagenesis oligonucleotides. Plaquesthat hybridized strongly relative to negative parental controls, following high temperature

washes, were picked and single-strand M13 preparations sequenced with the H2B primer

extension oligomer (26-mer, (19) see below) to confirm the mutant genotype.

Cell Culture and HeLa Cell TransfectionHeLa cells were grown in Dulbecco modified Eagle medium supplemented with 10% fetal calf

serum. A 10 cm dish of HeLa cells seeded at 8 x 105 - 1 x 106 cells per plate was transfectedwith 5 pg of test DNA, together with 20 pg of carrier DNA, using the calcium phosphate

precipitation technique (20). The calcium precipitate was left on the cells for 18-20 hours afterwhich the medium was changed and the cells left for a further 48 hours. Cytoplasmic RNA was

extracted from the cells by lysing them in 500 p1 of 0.5% NP40, 10 mM NaCl. 10 mM Tris-HC1pH8.0, 10 mM EDTA followed by centrifugation to remove nuclei. The supernatant wascollected and subjected to phenol/chloroform extraction and ethanol precipitation. RNA was

treated with RNase-free DNase I (Promega Biotech) before primer extension analysis. Permanentclonal cell-lines were generated by methods previously described (21).

8572


Primer Extension AnalvsisSynthetic DNA primers were generously provided by Dr. D. Skingle and S. Rogers. The primers

used were as follows:

H2A primer: 5'-dAGCGACTGAACACTCAGAGAGCAAAC-3'

H2B primer. 5'-dGGCTCGGGCATAGTGGCACAACGCGC-3'

Hi primer: 5'-dGGCGGGAGCGGTCTCGGACATCGCGG-3'

Primers were 5' end-labelled with T4 polynucleotide kinase and y-32P-ATP, ing of primer mixed

with RNA, heated to 800C for 3 minutes then allowed to anneal at 420C in 200 mM NaCl, 10 mM

Tris-HC1 pH 8.3 for 1.5 hours. Following hybridization, samples were incubated with reverse

transcriptase (1 hour, 420C) in 60 mM NaCl, 10 mM Tris-HC1 pH 8.3, 10 mM dithiothreitol, 500

mM dNTPs and 8 mM MgCl2 (22). Extension products were electrophoresed on 6%

polyacrylamide sequencing gels and detected by exposure to X-ray film. Quantitation of

radioactivity displayed on autoradiograms was performed on a Zeineh Soft Laser Densitometer

(Model SL-504-XL). Densitometry was carried out in duplicate, on two exposures of the

autoradiogram.

Preparation of Chick Embryo RNA

5-day chick embyro RNA was prepared by a guanidine-HCl method (23). The RNA was size

fractionated on sucrose gradients and fractions containing histone mRNA (about 9S) collected.

Transcription in Isolated Nuclei

Nuclei were isolated from cells and pulse-labeled with a-32P-UTP as described previously (24).

Nascent 32P-labeled RNA was extracted from nuclei and used to probe filter-immobilized histone

gene inserts as described (21).

RESULTS:

DNA Sequence Organization of Six Chicken H2A/H2B Divergent Pairs

In all, thirty-six core plus six H 1 histone genes have been mapped in the chicken genome

(3,25,26,27). Amongst the general disorder of these genes in dispersed groups, six closely

associated H2A/H2B gene pairs have been found; one pair in each of the recombinants

pCH3.3E/p7AT, pCH3.5E, pCH22.OB and XCH1-10 and, two pairs in the recombinant

pCH1 1.OE (see reference 3 for details). Gross mapping indicated that these gene pairs,

although dispersed in different clusters, maintained a very similar organization. All six

intergene regions have now been sequenced and relevant details are presented in Figure 1.

Because we wish to emphasize the nature of conserved promoter elements only the sequence

between the TATA boxes is presented here. Complete sequence data are available on request(19) and have been submitted to the EMBL Data Library (accession numbers J00864 and

X07756-X07766). Proteins encoded by the H2B genes of pCH3.3E/p7AT, pCH3.5E and XCH1-10 correspond to the H2B. 1 variant described by Urban et al., (28). The H2B subtype variant

encoded in pCH22.OB has yet to be assigned. Insufficient DNA sequence data are available to

8573


AH2AH2

Distance AA CT A3 CT Al 1332 TI

Subckxw BetweenATG

pCH3.3E/p7AT 343 ... ITr.. 19 ..GATAGGC.. 25 ..CCAATG.. 21 ..CCAATG .. 43 ..CCAATG.. 22 ..CTCArTrTcATAG.. 6 TATAAATAA T

pCd22.00 346 ... TmAT. 30..GATTGGC.. 23..CC AAO .. 21 ..CCAAT .. 39..CC AATG.. 22..CTAAT7TTCATAC.. 6 ..TATAA ...

pC03.53 351 ... TTATATT0..30..GAATAG .. 26 ..CCAATG..21..ccm 4..2 ..CCAATG..22..cTGc? r.CATAA....TATpCHIl.0E L 353 ... TTATATT.. 31 ..GATAGGC.. 26 ..ccAT.. 21 ..CCAATG .. 43 CCAAT. 22 ..CTGCTcTTGCATAG. 6 ..TATAAA

poall.0 R 328 ... TTATAT.. 27 ..GATAGGc.. 25 ccAATG..21 ..ccAG.. 43 ..CCAAT .. 21 ..CTAATCTGCATAC.. 6 .TATAAAA

sao.O0 333 ...TTAT..29 ..GAr3c.. 24. ..21...CCAATG1..CCAATC3 .. 2.CcTTCATCT21T..C .TGTATAAAA

'EMSZIWS342 ... 2828GATAGGC.. 25 ..CCAATG.. 21 ..CCAATG 40..CCAATG.. 22 ..CTGATTTGCATAC.. 6..

B pCHMEGCT GGCTCCTCGCCTCTGCGCTGATAGGCTGACGTCTGGGTCCGCTCTGGGCAGC

CAATGAGAAAGCGAATCGAATTTGAACCAATGAAAAGCAGTTATAAGGGAGGAAAGG

CGTGTTCTCGAGTTCCGACCAATGAAAGAGTGCGAAAGGAATGCTTCTCATTTGCAT

AGAGGGGCTATAAATAAATGCCTA**

pCH22.OBGCCCZTTATCCCGCCTGGGGTCGTGCGGCAcTrGATTGGGGAGACGGAG

ArGCGGGGTTAACCAATGGGAACAGCCGTAGAATACCGACCAATTGAACAGCGCGA

GTGATGACGTCACGGTCGAAGATGTCCAATGGGGAGGAACGACCTCGAGTCTC

CTAATTTGCATACCGCCTCTATAAGTAC

p0E13.5ECOGCTTAT CAG1rCGGSGGCGGAGGCGCrGTCGGATAGGCCGAGCGGTC

GAGCTGCTGCGT1GCATAGXCCGCTATAAAGGcG

CGGAGCTGCTGCTTTGCATAGOGCCGCTATAAAGGCG

pQllI.OE rightCCTCTATATCCCTCACTAAAAGAGCGCGATTCGATAGGCTAAGAAAAAGCGA

TTGCAAAATCAGCCAATGGGAGCGCGGATCGTATTCTAACCAATGGCGAAGAATTAT

GGACACCTATGAGCGGAAGG3ZCCTGTATCACCCAATAGAAACAGAGCATAGAGGAAC

CTAATCTGCATACAGCGACTATAAAAGAGG

CHI-10

CCTCTTAATCTCTTCCACTAAAA1GGAGTACGCGCGGTGATTGGCTGAGAACAACA

ATTGTGAAAACAACCAATGAAAGACCGGATCTTATTTCAACCAATCAGAGACAAAGA

AACACCcTTGACGGA AGGGCCTATCACCCAAGAAACAGAGCATGATTTGC

ATAACAGCGCTATAAAAAGGGG**57

8574 ~ -1


classify the pCH 1l.OE-encoded proteins. Both of the H2A subtype variants reported in the

literature can be identified from the sequence of the divergent pair H2A genes. pCH3.3E/p7AT,

pCH22.OB, pCH3.5E and as far as the DNA sequence of pCHl 1.OE left and right H2A genes

extend, all correspond to the H2A. 1 subtype variant (28). The XCH1-1-0 H2A gene encodes a

H2A.2 protein variant.

The intergene sequence of five of the six divergently transcribed H2A/H2B gene pairs differ

considerably (Figure 1B) but several highly conserved regions are apparent when the sequences

are compared (Figure 1A). The genes are very closely linked; the coding regions are, on average,

342 base-pairs apart; the TATA boxes are separated by only 180 base-pairs and are in the same

relative position for each gene pair. A striking feature observed when the sequence of each

confined intergene region Is examined is the presence of four motifs with homology to the

CCAAT box (29). These are all regularly spaced with three of them having the consensus

"CCAATG" (CAT1, CAT2 and CAT3 of Figure 1B) positioned at approximately 40, 90 and 110

bases upstream of and directed towards the H2B TATA boxes. The fourth CCAAT box (CAT4 ofFigure 1A) with a consensus sequence "GCCTATC" is an average of 28 bases upstream from the

H2A TATA boxes.

The position of the pCH3.3E/p7AT TATA box designated in Figure 1 differs from that assigned

by D'Andrea et al. (30). The only A-rich region to be found at a position consistent with the other

divergent pairs is a run of three A residues. This is an extremnely poor match to the consensus

TATA box whereas the region suggested by D'Andrea is an extremely good match. However, the

mRNA cap site of this H2A gene has been determined (from primer extension analysis presented

below and S1 mapping (19)) and is consistent with this assignment ofAAA as the TATA box.

Two of the intergene regions have almost identical nucleotide sequences. pCH3.5E H2A/H2B

and the left H2A/H2B pair of pCH 1 .OE have only seven base differences between them. The

sequence of the pCH3.3E H2A mRNA 5' untranslated sequence is almost the same as that of thepCH3.5E/pCH1 l.OE L H2A genes. All three of these pairs are in gene clusters that are

immediately next to one another on the chicken chromosome (3). Gene conversion or gene

duplication processes may have been involved in generating these homologies.A fifth region of homology with almost exact conservation for 13 bases (5'-CTGATTTGCATAC/G-3') located 6 bases upstream of the H2B TATA box (Figure 1A, H2B box),has been described previously (4). This element is closely associated with the H2B gene

Figure 1: Architecture of chicken H2A/H2B intergene regions.(A) Six divergent H2A/H2B intergene regions are compared and a consensus of conservedregions and distances compiled. The average distance between divergent pair ATG initiationcodons are indicated in addition to the subclone from which they were derived (see reference 3).(B) The sequences of the H2A/H2B intergene regions between the TATA elements outlined in (A)are listed (accession numbers X07756-X07761). The TATA box is underlined by a continuousline, CAT 1.2,3 and 4 elements are underlined by dashed lines and the H2B-box is underscoredby asterisks.

8575


A xH2A H2B

.v... . _. 4 _......S

.- -4 . jAT,_

£3 M1~2

3 4

68- * 4-H2B H2B -+ !!

"-HI HI --4 -s

4 H2A H2A -_

MI1

68-.- H 2B

*I*- HI

*- H2A

Figure 2: Expression of H2A and H2B genes as separate entities.(A) A diagrammatic representation of the Hi, H2A and H2B genes within the 7 kb EcoRIgenomic subfragment used for expression analysis. The H2A/H2B intergene region has been

8576

C,


expanded to show the relative position and orientation of CCAAT boxes and position of theintergene XhoI site with respect to these elements. B=BamHI, E=EcoRI, S=SmaI, X=XhoI.(B) RNA was isolated from HeLa cells 72 hours after being transfected with, Lane 1, pJ7E; Lane2, pJ7E-H2A (H2A gene deleted); Lane 3, pJ7E; Lane 4, pJ7E-H2B (H2B gene deleted) andanalysed by primer extension analysis. A 68 base pair pBR322 HpaII marker is indicated (M).(C) Lane 1 represents quantitative primer extension analysis using the three 26 base chickenhistone specific primers (Materials and Methods) on size fractionated 5 day chick embryo RNA.A pBR322 HpaII marker lane is shown to indicate the different extension lengths of the threeprimers; H2A extends to a major band at 49 bases, H 1 to 58 bases and H2B to 68 bases.

promoters of most organisms (31) and contains the octamer homology (ATiTGCAT) that is afunctional element of a number of gene promoter/enhancer elements (5-12).

Expression of a Chicken H2A/H2B Gene Pair and Mapping of the Divergent Promoter Region.The gene pair chosen for study was the one for which the complete gene sequences were flrst

available (4,19,30). A 7kb genomal EcoRI fragment from ACH-05 (3) was subcloned into thevector pATl53 (32) for propagation and the clone named p7AT. The 7kb inserts from p7AT

derivatives were re-subcloned into pJIA- (an SV40 late replacement vector with the NcoI-NcoIregion excised, 33) for transient expression in HeLa cells. In addition to containing the completeH2A/H2B divergent pair an Hi gene is contained within the insert (34, see Figure 2A). Gene-

specific 26 base synthetic oligonucleotide primers were designed such that the length of in vitroprimer extension products from each gene transcript present in the same mixture could be

readily identified by size. Typically, major bands of 49, 58 and 68 bases are observed for H2A,H 1 and H2B extension products respectively. When the primers are used in excess the assaybecomes quantitative (22) and the level of transcription from each gene can be measured.The data in lanes 1 and 3 of Figure 2B show directly comparable quantitative primer extension

results on RNA derived from HeLa cells transfected with pJ7E (the p7AT insert cloned intopJL4-). The relative level of each gene's expression in HeLa cells is similar to that of endogenoustranscripts in 5-day chick embryo RNA (19, Figure 2C). Using primers of similar specific activityit can be seen that H2B and H 1 transcripts are well expressed whereas the H2A gene is poorly

expressed.

The H2A and H2B genes of p7AT are each contained entirely on separate XhoI restriction

fragments (3, Figure 2A). Moreover, the intergene region of the two genes is split by a XhoIrecognition sequence and expression of the Hi gene of p7AT is unaffected by XhoI digestion (19).By independent removal of each XhoI fragment of p7AT, it was possible to examine the

expression of each gene in the absence of the other. The two single gene deletions constructs

leave one CCAAT box present in p7AT minus H2A (containing H1 and H2B genes) and three in

p7AT minus H2B (containing H1 and H2A genes). In each case the level of H 1 gene

transcription serves as an internal control (35). The fragments containing the separated H2Aand H2B genes were transferred to the pJL4- vector and tested in the HeLa cell transient assay.Significant decreases in the levels of H2B (about 17-fold) and H2A (7-fold) transcription are seen

when these separated genes are expressed in HeLa cells (Figure 2B, lanes 2 and 4 respectIvely;

8577


TABLE 1S]UWARY OF TRANSIENT ASAY DATA

Relative Steadv-State mRNA Levels

Transfected H2B H2AConstruct

pJ7E 1.0 1.0

pJ7E-H2A 0.06 -

pJ7E-H2B - 0.15

pJ5E 1.0 1.0

pJCATf- 0.13 0.47

pJH2BSE 0.11 0.32

Table 1: Summary of data for transient expression of constructs in HeLa cells.HeLa cells in exponential growth phase were transfected with the constructs described andsteady-state RNA levels generated from the exogenous genes detected by primer extensionanalysis. Results are presented relative to the expression of wild-type genes, with the Hi geneas an internal reference control, as determiined by laser densitometry of autoradiograms. Eachexperiment was performed in duplicate on at least two separate occasions.

Table 1). These experiments demonstrate that the two genes appear to have overlapping

promoter elements. It is perhaps surprising that H2B transcription should decrease so

markedly considering that CAT1 and the H2B box sequence remain intact in the construct

tested. However, this result is not confined to the HeLa expression system, but is also seen in

Xenopus oocyte injection experliments (19).

Mutagenesis of the H2A/H2B Intergene Region

Separation of the H2A/H2B genes in the intergene region affects the level of both transcripts,but does not determine whether the two genes share any of the conserved DNA sequence

elements of the intergene region. A site-directed mutagenesis approach was used to

independently remove or modify conserved intergenic regions to see If the transcription of either

gene was affected. A 5 kb BamHI fragment containing all of the Hi. H2A/H2B gene system inthe 7 kb EcoRI fragment of p7AT (see Figure 2A). was excised and cloned into M13mp8.

Synthetic DNA deletion/mutagenesis priners (see Materials and Methods) were used toindependently delete or mutate the CAT1 and H2B box elements of the intergene region (see

Figures 1A and 2A). Mutagenesis of templates was confirmed by di-deoxy sequencing using the

H2B 26-base extension primer as a sequencing primer (data not shown).

Functional testing of each 5 kb BamHI mutated fragment was performed by separately

8578


1 23 M

H2B, - -68

Hl

H2A-

'CAT 1 Construct5'-TTCTCGAGTTCCGA CCAATG]AAAGAGTGCGAAAGG-3 pJ5E

5'-TTCTCGAGTTCCGA AAAAAGTGCGAAAGG-3' pJCAT1

H2B-Box5-GAATGCTT CTCATTTGCATAG AGGGGCTA-33 pJ5E

S-GAATGCTT |CTCAGTAGCCTAG|AGGGGCTA-3 pJH2B SE* * *

Filure 3: The H2B-specific element is required for efficient expression of H2A/H2B gene pairs invivo.The 5 kb BamHI fragment containing Hi, H2A and H2B genes was subcloned into M13mp8 anddeletion or substitution mutagenesis was performed before being inserted into pJL4-. HeLa cellswere transfected with, Lane 1, pJ5E (wild type fragement); Lane 2, pJCAT,- (CAT1 box deleted);or Lane 3, pJH2BSE (mutated H2B box). A pBR322 HpaII marker lane is shown (68 basemarker). Sequences resulting from site directed mutagenesis are shown and are compared tocorresponding unmutated (wild type) sequences in the native 5 kb BamHI fragment (*indicatesbase substitutions in the H2B box).

subcloning them into pJL4- and assaying following transfection into HeLa cells. RNA was

extracted three days after cells were transfected and subjected to primer extension analysis

using the three gene-specific primers (Figure 3). Expression of the exogenous H2B and H2A

genes was decreased by approxinately 9-fold and 3-fold, respectively, as a result of basesubstitutions within the H2B-box (Figure 3, lane 3; Table 1). This was the first indication that

the H2B-specific element is required for efficient expression of the divergently transcribed H2A

gene in vivo. Notably, the decrease in levels of H2AmRNA in HeLa cells was not as severe as

detected when the H2B gene was removed by gross deletion (Figure 2B). This implies that other

elements within the intergene region, besides the H2B-specific motif, are required for efficient

expression of both genes. Consistent with this is the observation that deletion of the CAT1 box

8579


TAE 2RELATIVE izVts OF STEADY-4TATE MRNA IN PERMANENT CELL LINE

H2B H2A

Transfected Pooled 1 2 3 Pooled 1 2 3Construct Colonies Colonies

pCH5B.P 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00

pCH2BE- 0.11 0.06 0.10 0.11 0.45 0.19 0.36 0.53

PCH2BsE 0.17 0.07 0.14 0.17 0.24 0.17 0.26 0.30

Table 2: Summary of data for expression of wfld type and H2B-box mutated constructs inHeLa cell lines.Hela cells in exponential growth phase were co-transfected with pCH5B.P (wild type 5 kbBamHIl faent in pAT153), pCH2BE- (H2B box deleted) of pCH2BSE (mutated H2B box).Three individual cell lines were analysed (1-3) and relative steady state levels of H2B and H2AmRNAs relattve to H 1 were determined by laser densitometry of autoradlograms followingprimer extension analysis. Alternatively, simIlar analysis was applied to a group of 6 pooledcolonies (see Figure 4). Data was obtained from 2 or 3 independent experiments andexpressed as the average value.

reduced steady state levels ofH2B and H2A mRNAs by 8-fold and 2-fold, respectively (Figure 3,

lane 2; Table 1). Transcription of the linked H1 gene, which served as an internal control, was

In each case essentially Invariant. Together, these results suggest that transcription from both

the H2A and H2B divergent genes are regulated by common highly conserved intergenic

sequences.

The H2B-box is Required for the Efficient Transcription of Both of the Divergently TranscribedH2A/H2B Genes in Stable Cell Lines.

We have recently shown that HeLa cell lines contag integrated copies of the Hi, H2A/H2Bgenes (Figure 2A) exhibit S-phase regulation of transcription of the exogenous chicken histone

gene system (21). Permanent cell lines containing the chicken H2A/H2B gene system were

constructed to determine if the H2B-box influenced the expression of chromnosomally integrated

copies of the H2A and H2B genes. Specifically this was tested by measuring the steady-state

mRNA levels of the H2A and H2B transcripts, in several clonal cell lines and in pooled colonies

after transfection, and comparing them to the level of the H1 transcript. Primer extension

analysis on total RNA isolated from unsynchronized cells accurately reflects the transcription of

the histone genes as shown by exam nuclear mn-on transcription in isolated nuclei (21,

see below).For establshment of permanently transformed cell lines, the 5 kb BamHI mutagenized

fragments were recloned from the M13mp8 vector back into the pAT153 vector (32). Threeconstructs were tested by this approach - the parental 5 kb fragment containing each of the Hi,

8580


A 1 2 3 4 5 6

H2B

+-Hi

ilH2A

B

il H2A H2B

T 4 l3l2 i i> T

Figure 4: The H2B-specific element is a promoter element for both H2B and H2A genes in

permanently transfected HeLa cells.

(A) HeLa cells in exponential growth phase were cotransfected with pCH5B.P, pCH2BE (H2B-

box deleted) or PCH2BSE (base substitutions in H2B-box), and pSV2Neo (36). Following

selection with G418 (750i.g/ml, 21) three clonal cell lines for each construct transfected were

selected for analysis (see Table 2). Steady-state Hi,. H2A and H2B mRNA transcribed from the

transfected genes were detected in RNA samples by primer extension analysis. Amounts of RNA

from each cell line used for analysis were varied to normalize the signal from the internal control

(Hi1) gene. Data presented are for three pCH5B.P (Lanes 1-3) and three pCH2BE- (Lanes 4-6)

transfected cell lines. Similar results were obtained for pCH2BSE transfected cells

(autoradiogram not shown, but see Table 2).

(B) The 5 kb Barn Hi1 fragment containing Hi,. H2A and H2B chicken histone genes was

subcloned into pATi53 generating the construct, pCH5B.P. Positions of conserved elements in

the H2A/H2B intergene region are shown, including the H2B-box (on which deletion and

substitution mutagenesis was performed), Ci1, 02, 03 and C4 represent the CCAAT motifs, and

T represents the TATA elements.

H2A and H2B genes (pCH5B.P). the 5 kb fragment in which the H2B-box was deleted

(CTCATITGCATAGA removed; pCH2BE-). and the same 5 kb fragment with three base

substitutions within the H2B-box (CTCAGTAGCCTAGA.- pCH2B5E). These constructs were

linearized at the EcoRI site and co-transfected with the selectable marker plasmid. pSV2Neo (36)

8581


into HeLa cells by the calcium phosphate precipitation method (20). Following selection of

transformed, G418-resistant cell lines, levels of transcripts generated from the exogenous

chicken histone genes were determined by primer extension analysis (Figure 4) and the results

are summarized in Table 2.

Deletion of the H2B-specific motif resulted in a distinct decline in H2B steady-state mRNA

levels for the three pCH2BE- transfected cell lines tested (Figure 4, Table 2). A similar effect was

detected with pCH2BSE cell lines as a consequence of point mutations being inserted into the

H2B-box region. Therefore. a decrease in H2B mRNA levels caused by deletion of the H2l3-boxwas not a result of general promoter disruption as base substitutions within this region, which

conserved overall promoter architecture and the relative spatial arrangement of promoter

elements, had a similar effect to the gross deletion. Compared to H2B transcript levels in

'parental' cell lines (pCH5B.P-transfected), this represented a decrease ranging from 6 to 17-fold

(see Table 2) as determined by laser densitometry of autoradiograms. In addition to the analysis

of individual clonal cell-lines, groups of six colonies for each DNA transfection were pooled RNA

extracted and primer extension analysis carried out. Expression of Hi, H2A, and H2B genes

displayed a smilar pattem when compared to individual cell-lines. Transcript levels of the

divergently transcribed H2A gene were also reduced, generally by a factor of 2 to 6 fold (seeTable 2). It is, therefore, apparent that the H2B-box exerts a regulatory effect on both the H2A

and H2B genes in vivo, thus conffiming the transient assay results presented in Figure 3 and

summarised in Table 1.

The H2B-Box Modulates Transcription of H2B and H2A Genes in the Divergent Pair.

To directly show that the effect of mutating the H2B-box on decreasing H2B and H2A steady

state mRNA levels was at the transcriptional level, relative rates of gene transcription were

compared in cell lines which had been permanently transformed with pCH5B.P (wild-type H2B-box) or pCH2BSE (base substitutions in H2B box). his was done by isolating nuclei from these

cell lines and pulse labelling them with a-32P-UTP. Nascent labelled transcripts were hybridizedto filter-Immobilised complimentary histone gene inserts in order to quantitate the relative rates

ofH2A and H2B gene transcription over the pulse labelling interval using transcription of theHI gene as an internal control (21). The contribution of endogenous (human) gene transcriptionwas determined by probing the same DNA dots with 32P-RNA extracted from nuclei which had

no transfected chicken histone gene copies (untransfected HeLa cells). Under the strigenthybridisation conditions employed, the signal generated from endogenous genes was generallyless than 5% of that detected in pCH5B.P-transfected cell lines (see Figure 5). In cell lines

transfected with pCH5B.P, transcripts from exogenous Hi, H2A and H2B genes were readilydetected over background levels from human genes (Figure 5). Transcription of the chicken H2B

gene in cell lines transfected with the mutant construct pCH2BsE was decreased by a factor ofabout 5-fold relative to transcription of the unmutated gene in pCH5B.P-transfected cells.Importantly, the decrease in H2B gene transcription was accompanied by a 4-fold decrease in

8582


1.0* 1.0 10,

1.2 * 3.1 0.7

0.9* 0.8 0.2

Figure 5: The H2B-specific element is required for efficient transcription of divergent H2B andH2A genes.Nuclei from untransfected (HeLa), pCH5B.P-transfected (wild type fragment in pAT153) orpCH2BSE transfected (base substitutions in H2B-box) cells were pulse labelled with a-32P-UTPand 3x108 cpm of labelled RNA was hybridized to 2.5 pg of filter Immobilized, single strandedchicken histone gene insert (see Materials and Methods). Relative levels of hybridized 32P-RNAwere quantitated by scintillation spectrometry and each set expressed relative to levels of H 132P-transcripts (internal control; assigned value of 1.0). Each experiment was performed induplicate. The top, middle and bottom row of dots corresponds to RNA used to probe Hi, H2Band H2A DNA dots respectively.

transcription of the divergent H2A gene. This is consistent with the decrease in levels of H2B

and H2A steady state mRNAs detected by primer extension analysis (see Table 2) and indicates

that the H2B-box is a transcriptional element shared by both genes.

DISCUSSION:

The apparently random organization of histone genes in the chicken genome belies the

extraordinarily similar architecture of the six divergently transcribed H2A/H2B gene pairs which

occur in different clusters of the histone multigene family. The coupling of these H2A and H2B

genes cannot be mistaken for a remnant of evolution of the gene family in the chicken. DNA

sequence analysis of five of the six pairs shows that some 5' regions have been evolving

independently; the H2B box was first recognized in this context (4).

The selection pressure keeping the majority of these two genes together is possibly the

stoichiometric requirement of the proteins coded for by each gene. The equlmolar appearance of

H2A and H2B in the nucleosome can be achieved by assembly from appropriately sized pools or

by a regulatory control operating during nucleosome assembly. It is possible that a shared

promoter region for each gene pair enables coordinate control of H2A and H2B mRNA

production. Thus each protein might accumulate at an appropriate level for nucleosome

assembly.Several lines of evidence support the contention that the H2A/H2B intergene region

constitutes an overlapping promoter. This was first suggested by the observation that

separation of these genes at an intergenic site resulted in a marked decrease in the expression

8583


of both genes (Figure 2B). Experiments aimed at delineating sequence elements required for the

efficient transcription of both genes have identified a dual role for the H2B-box. Although

transcription of both genes was significantly decreased when the H2B box was either deleted or

contained point mutations, this effect was less than that when the two genes were separated at

the Xho I site (Table 1) These observations are consistent with there being additional intergenic

elements, besides the H2B box, required for the efficient in vivo expression of the gene pair.

While deletion of the CAAT1 box had an apparent effect on expression of H2B and H2A genes, it

is recognized that such a deletion may have interrupted overall promoter architecture and may

not accurately reflect the role of this sequence in the overlapping promoter. Whether disruption

of any other CAAT element in the intergene region has an affect on transcription similar to the

H2B-box is unknown.

A consistent relative decrease in H2B and H2A transcript levels (compared to the internal

control Hi gene) were detected in clonal cell lines transfected with H2B-box deleted or base-

substituted constructs. As the H2B-box influences transcription from H2B and H2A genes

(when in the divergent configuration) it is likely that this element functions as a transcriptional

amplifier of both genes, perhaps by temporally modulating levels of transcriptional initiation

during S-phase of the cell cycle. Indeed, this sequence has been shown to be involved in the

cell-cycle regulation of an isolated human H2B gene, where point mutations within the H2B-box

had no effect on basal transcription but prevented an increase in utilization of the promoter

during DNA synthesis (37). As yet, no subtype-specific sequence element has been implicated in

the S-phase regulation of H2A genes, but in the case of the chicken H2A/H2B genes studied

here this could be provided by coupling of the H2B-box as a promoter element of the H2A gene

as well as the H2B gene of each pair to mediate the induction of transcription during DNAreplication.

The H2B-box contains within its sequence the octamer homology located in the control regions

of several other non cell cycle regulated genes (5-12); the octamer motif has been found in

sequence elements implicated in controling basal transcription (8-12), tissue specific-promoter/enhancer function (5-7, 14, 15, 38) and DNA replication (39). It is possible that

various levels of combinatorial control, such as the sequence context in which the octamer motif

is embedded (40), operate to provide differential gene regulation in these cases. The overallconservation of intergene sequences in H2A/H2B gene pairs (Figure 1) and an apparent role ofthe H2B box element in influencing both H2A and H2B gene expression may explain the

preference for the paired arrangement of these genes which has been retained throughout

evolution (1).

ACKNOWLEDGEMENTS

We thank Richard D'Andrea and Leeanne Coles for the gifts of the chicken histone genomal

clones described in the text. R.A.S. and S.D. were supported by Australian Commonwealth

8584


Postgraduate Research Awards and this work was funded by a grant to the Department ofBiochemistry establishing a Commonwealth Special Research Centre for Gene Technology.

Present addresses: * Cold Spring Harbor Laboratory, P0 Box 100, Cold Spring Harbor, New York,NY 11724, USA and +Research Institute for Molecular Pathology, A-1030 Wien, Dr. Bohr-Gasse 7,Austria

REFERENCES1. Maxson, R, Cohn, R, Kedes, L. and Mohun, T. (1983). Ann Rev. Genet. 17, 239-277.2. Hentschel, C.C. and Birnstiel, M.L. (1981). Cell 25, 301-313.3. D'Andrea, RJ., Coles, L.S., Lesnlkowskl, C., Table, L. and Wells, J.RE. (1985). Mol.

Cell Biol. 5, 3108-3115.4. Harvey, RP., Robins, A.J. and Wells,J.RE. (1982). Nucl. Acids Res. 10, 7851-7863.5. Falkner, F.G., and Zachau, H.G. (1984). Nature 310, 71-74.6. Parslow, T.G., Blair, D.L., Murphy, W.J. and Granner, D.K. (1984). Proc. Natl. Acad.

Sci. USA 81, 2650-2654.7. Falkner, F.G., Macikat, R and Zachau, H.G. (1986). Nucl. Acids Res. 14, 8819-8827.8. Ares, M., Jr., Mangin. M. and Weiner, A.M. (1985). Mol. Cell. Biol. 5, 1560-1570.9. Mattaj, I.W., Lienhard, S., Jirichy, J. and DeRobertis, E.M. (1985). Nature 316, 163-

167.10. Ciliberto, G., Buckland, R, Cortese, R and Philipson, L. (1985). EMBO J. 5, 1537-

1543.11. Krol, A, Lund, E. and Dahlberg, J.E. (1985). EMBO J. 4, 1529-1535.12. Parslow, T.G., Jones, S.D., Bond, B. and Yamamoto, K.R (1987). Science 235, 1498-

1501.13. Sive, H.L., Heintz, N., and Roeder, RG. (1986). Mol. Cell. Biol. 6, 3329-3340.14. Dreyfus, M., Doyen, N. and Rougen, F. (1987). EMBO J. 6, 1685-1690.15. Wirth, T., Staudt, L. and Baltimore, D. (1987). Nature 329, 174-178.16. Sanger, F., Nicklen, S. and Coulson, A.R (1977). Proc. Natl. Acad. Sci. USA 74,

5463-5467.17. Adelman, J.P., Hayflick, J.S., Vasser, M. and Seeburg, P.H. (1983). DNA 2, 183-193.18. Chan, V-L., and Smith, M. (1984). Nucl. Acids Res. 12, 2407-2419.19. Sturm, RA. (1985). Ph.D. Thesis, University ofAdelaide, Adelaide, South Australia.20. Graham, F.L., and van der Eb, AJ. (1973). Virology 52, 456-467.21. Dalton, S. and Wells, J.RE. (1988). EMBO J. 7, 49-56.22. McKnight, S.L., Gavis, E.R, Kingsbury, R and Axel, R (1981). Cell 25, 385-398.23. Brooker, J.D., May, B.K. and Elliott, W.H. (1980). Eur. J. Biochem. 106, 17-24.24. Dalton, S., Coleman, J.R and Wells, J.R.E. (1986). Mol. Cell Biol. 6, 601-606.25. Wang, S-W., Robins, AJ., D'Andrea, R and Wells, J.RE. (1985). Nucl. Acids Res. 13,

1369-1387.26. Grandy. D.K. and Dodgson, J.B. (1987). Nucl. Acids Res. 15, 1063-1080.27. Coles, L.S., Robins, AJ., Madley, L.K. and Wells, J.RE. (1987). J. Biol. Chem. 262,

9656-9663.28. Urban, M.K., Franklin, S.G. and Zweidler, A. (1979). Biochemistry 18, 3952-3960.29. Breathnach, R and Chambon, P. (1981). Ann. Rev. Biochem. 50,349-383.30. D'Andrea, R, Harvey, R, and Wells, J.RE. (1981). Nucl. Acids Res. 9,3119-3128.31. Wells, D.E. (1986). Nucl. Acids Res. 14, rl 19-r149.32. Twlgg, AJ. and Sherratt, D. (1980). Nature 283, 216-218.33. Gough, M.N., Metcalf, D., Gough, J., Grail, D. and Dunn. ANR (1985). EMBO J. 4,

645-653.34. Coles, L.S. and Wells, J.RE. (1985). Nucl. Acids Res. 13, 585-594.35. Younghusband, H.B., Sturm, R and Wells. J.RE. (1986). Nucl. Acids Res. 14, 635-

644.36. Southern, E.M. and Berg, P. (1982). J. Mol. Appl. Genet. 1, 327-341.

8585


37. LaBella, F., Sive, H.L., Roeder, RG. and Heintz, N. (1988). Genes and Development 232-39.

38. Gerster, T., Matthias, P., Thali, M., Jiricny, J. and Schaffner, W. (1987). EMBO J. 6,1323-1330.

39. Pruijn. G.J.M., van Driel, W. and van der Vliet, P.C. (1986). Nature 322, 656-659.40. Sturm, R, Baumruker, T., Franza, B.R Jr. and Herr, W. (1987). Genes &

Development 1, 1147-1160.

8586

Documents

Conservation of histone H2A/H2B intergene regions: a role for the